|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 5 (September 1), 1998:
pp. 1646-1651
Molecular Mechanisms of FVII Deficiency: Expression of Mutations
Clustered in the IVS7 Donor Splice Site of Factor VII Gene
By
M. Pinotti,
R. Toso,
R. Redaelli,
M. Berrettini,
G. Marchetti, and
F. Bernardi
From the Dipartimento di Biochimica e Biologia Molecolare - CIBF,
Sezione SBPGU, Università di Ferrara, Ferrara; the Divisione di
Ematologia, Ospedale Niguarda, Milano; and the Istituto di Medicina
Interna e di Medicina Vascolare, Università di Perugia, Perugia,
Italy.
 |
ABSTRACT |
In three Italian patients, two point mutations and a short deletion
were found in the intron 7 of factor VII gene, clustered in the donor
splice site and located in the first of several repeats. The mutation
9726+5G A, the most frequent cause of symptomatic factor VII
deficiency in Italy, as well as the deletion (9729del4) gave rise in
expression studies to abnormally spliced transcripts, which were
exclusively produced from the cryptic site in the second repeat. The
insertion in the mature mRNA of the first intronic repeat caused
(9726+5GA) a reading frameshift, abolishing most of the
factor VII catalytic domain, or produced (9729del4), an altered factor
with 11 additional residues, the activity of which was not detectable
in the cell medium after mutagenesis and expression studies. Studies of
factor VII ectopic mRNA from leukocytes and expression studies
indicated that the deleted gene produced 30% of normally spliced
transcript. Differently, the 9726+5GA mutation permitted a
very low level (0.2% to 1%) of correct splicing to occur, which could
be of great importance to prevent the onset, in the homozygous
patients, of most of the life-threatening bleeding symptoms. The
9726+7AG mutation was found to be a rare and functionally silent polymorphism. These findings, which provide further evidence of
the interplay of sequence and position in the 5 splice site selection, throw light on the heterogeneous molecular bases and clinical phenotypes of FVII deficiency.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
FACTOR VII (gene symbol, F7; acronym,
FVII) is a vitamin K-dependent serine protease glycoprotein
circulating as a zymogen in plasma, with a pivotal role in the
initiation of blood coagulation.1 While increased levels of
FVII are associated with an increased risk of coronary heart
disease,2 very low levels of FVII (<2% of normal) cause
severe bleeding disorders in patients.3 FVII gene knock-out
experiments in mice showed a reduction in the live birth rate and very
frequent death in the first day after birth.4 Patterns of
mutations have been defined in FVII deficiency,3,5-7 which
offer the opportunity to investigate the mechanisms through which the
genotypes produce a low level of FVII expression.8-13
FVII gene belongs to a subgroup of coagulation serine proteases, which
also includes factor IX, factor X, and protein C, characterized by
sequence and structure homology.14,15 Different from the other members of this family, FVII gene16 contains in
introns 1A, 1B, 2, 7 and in exon 8, five minisatellites imperfect
tandem repeats with monomer element lengths ranging from 14 to 37 bp.17 The intron 7 (IVS7) is characterized by the presence
of a variable number (ranging from 5 to 8) of 37-bp
repeats,17-19 the first of which contains the IVS7 donor
splice site followed by several repeats showing cryptic sites
completely homologous in sequence to the functional site. Two
mutations, one (9726+5GA) present in several Italian patients
with symptomatic FVII deficiency and another (9726+7AG) in an
asymptomatic subject, have been found in the IVS7 donor splice
site.20 However, the functional meaning of both mutations
has not been defined.
This gene region, characterized by sequence and repeat variations and
thus potentially a "hot spot mutation site,"21 was
investigated in one patient with symptomatic FVII deficiency and in two
patients selected for reduced FVII level. Mutants were characterized
through expression studies in mammalian cells, which provided a
sensitive and specific assay for normal and altered splicing products,
as well as for mutant FVII.
| |
MATERIALS AND METHODS |
Subjects.
Patient 1 was referred at the time of menarca when she showed severe
meno-metrorrhagia and was treated with concentrated FVII (Provetin UM;
Immuno, Wien, Austria). She experienced two pregnancies without any complication. The FVII activity level was less than 1% as
compared with the pooled normal plasma. The enzyme-linked immunoadsorbent assay (ELISA) assay showed an undetectable level of
FVII antigen.
Patients 2 and 3 were asymptomatic and were referred for a mildly
prolonged prothrombin time (>2 standard deviation from
the prothrombin time of the reference plasma), detected in a presurgery screening. FVII:C and FVII:Ag levels were 61% and 58% for patient 2 and 43% and 42% for patient 3.
Genomic studies and reverse transcriptase-polymerase chain reaction
(RT-PCR).
DNA and RNA extraction, PCR amplification, restriction and direct
sequencing were as previously described.6 Amplification of
genomic fragments for cloning was obtained by using the Expand high
fidelity PCR system (Boehringer Mannheim, Mannheim,
Germany) with the oligos 2-6 (Table 1) in
30 cycles: 20 seconds denaturation at 94°C; 3 seconds annealing at
52°C; 30 seconds extension at 70°C. Total RNA from the
buffy-coat fraction of peripheral blood or from 106 baby
hamster kidney (BHK) cells was used as template for cDNA synthesis with 40 U of avian myeloblastosis virus RT with
10 nmol of oligo 4 or 5 and the RT reaction mixture (1/10) was
amplified with oligos 1-5, 3-4, or 3-5 (Table 1).
Cloning.
The genomic region spanning nucleotides 9568-10908 was amplified from
DNA of normal subjects (carrying 6 or 7 repeats) and from patients,
restricted by Sac I and inserted in the pUC18 vector. Single
clones containing the mutation were isolated and subcloned in the
eucaryotic expression vector pCDNA3 (Invitrogen Corp, Carlsbad, CA) by
using the XbaI and EcoRI restriction sites. Each
construct is designated with the name of the mutation inserted. The
complete human factor VII cDNA22 was kindly provided by Dr
John H. McVey (MRC Clinical Sciencies Centre, London, UK) and cloned in
the pCDNA3 by using the XbaI and HindIII restriction
sites.
Mutagenesis.
The additional 33-bp (GTACCACTCTCCCCTGTCCGACCGCGGTGCTGG) were inserted
at the position 9726 of the FVII-cDNA by using the QuikChange
Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to
the instruction of the manufacturer. Fifteen base pairs (nt 9727-9741)
were inserted using primers 7-8 (Table 1). The mutagenized vector was
used as template for a second mutagenesis with oligonucleotides 9-10 (Table 1). For each step, 18 cycles were run as follow: 30 seconds
denaturation at 95°C; 1 minute annealing at 45°C; 16 minutes
extension at 68°C.
Cell culture, transfection, and expression.
BHK cells were grown in Dulbecco's modified essential medium
supplemented with 10% inactivated fetal calf serum (FCS), 4 mmol/L L-glutamine, 125 U/mL of penicillin, and 125 mg/mL of streptomycin and
nonessential amino acids in the 5% CO2 atmosphere at
37°C. A total of 5 × 105 cells were transfected
into 10-mm petri-dish using lipofectin (GIBCO-BRL, Gaithersburg, MD).
Cells and medium were harvested and studied after 48 hours. Cell
lysates were obtained as previously reported.23
Measurement of FVII activity and antigen.
The FVII antigen level was measured by using an enzyme immunoassay
(Asserachrom VII:Ag, Diagnostica Stago, Asnieres, France). FVII coagulant activity was determined by a one-stage method using FVII-deficient plasma as a substrate and a commercial human
thromboplastin preparation. A standard normal pooled plasma prepared
from 50 healthy donors was defined to contain 100% FVII antigen and
100% FVII activity.
| |
RESULTS |
DNA from patients with FVII deficiency was screened by restriction for
the presence of FVII gene mutations previously described in the Italian
population.7 The suppression of an Rsa I
restriction site in the amplified IVS7 (Fig
1), which was compatible with two transitions (9726+5GA,
9726+7AG) previously reported,20 was detected in
patients 1 and 3. The Rsa I restriction produced in patient 2 a
shorter band. Sequencing showed in patients 1 and 3 the 9726+5 G to A
transition in the homozygous condition and the 9726+7A to G transition
in the heterozygous condition, respectively. Differently, a 4-bp
deletion (nt 9729-9732, Fig 1) was found in the heterozygous condition
in patient 2. The inheritance of this short deletion and of the
coagulation phenotype was demonstrated in his granddaughter,
characterized by a parallel reduction in FVII activity (47%) and in
FVII antigen (42%).
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Schematic diagram of the mutated FVII gene region and of
the vectors used for the expression of mutant mRNA (1) and protein (2).
The sequence of the Rsa I site is reported in bold; 2 and 6, primers. The open and closed triangles indicate the position of the
IVS7 mutations and of the additional residues inserted in the FVII
cDNA, respectively. P, Gla, EGF1, EGF2 and A, FVII domains.
|
|
The RsaI restriction excluded the presence of these mutations
in 100 normal controls. The consensus values (CV) of the wild-type 5IVS7 splice site, calculated according to Shapiro and
Senapathy,24 was 74.7 and a cryptic site with an identical
CV is present in each repeat. The 9726+5A and 9729del4 mutations
lowered this value to 60.9 and 58.1, respectively. Cryptic sites at
positions +4, +19, and +30 are detectable with CV of 63.3, 53.9, and
56.7, respectively. The cryptic site at position +4 was removed by the
9726+5GA transition and by the 9729del4 mutation.
Because the sequence statistics of Shapiro and Senapathy do not include
the position +7, the variation of CV for the 9726+7AG transition cannot be estimated. However, this mutation makes the regions of the functional donor splice site and of the cryptic site
located at +37 completely overlapping for 25 bases. This mutation was
found to be associated in patient 3 with the presence of Gln at
position 353, a frequent FVII gene polymorphic allele.
mRNA studies.
The availability of fresh white blood cells enabled us to study in
patient 2 the FVII gene expression at the mRNA level by RT-PCR of
illegitimate transcripts. The size of the cDNA
(Fig 2A) was compatible with splicing of
exons 7 and 8, whereas the absence of a splicing product 172 bp in size
excluded the occurrence of exon 7 skipping. Restriction by BclI showed
the expected normal bands (190 bp and 104 bp, Fig 2A) and an additional
band larger in size, compatible with the presence in the spliced mRNA
of a short intronic sequence.
View larger version (52K):
[in this window]
[in a new window]
| Fig 2.
Studies of ectopic and in vitro-expressed FVII mRNA. (A)
RT-PCR amplification of white blood cell mRNA obtained from patient 2 carrying the 9729del4 mutation. PCR products (primers 1-5) were
separated by 8% PAGE (left) or by 11% PAGE after Bcl I
restriction (right). NC, negative control. (B) RT-PCR amplification of
FVII mRNA expressed in cells transfected with constructs containing the
three mutations (9729del4, 9726+5A, 9726+7G) or the normal sequence
(N). Upper part, ethidium bromide staining of fragments amplified with
primers 3 and 4; M, size marker. Lower part, autoradiographs of the
same fragments labeled by 32P and restricted by Taq
I. Gels were overexposed. (C) Schematic diagrams of FVII cDNAs (exons
6-8) and of fragments amplified from the ectopic mRNA (primers 1-5) or
from the mRNA expressed in transfected cells (primers 3-4). The
restriction sites used in (A) (Bcl I) and (B) (Taq I)
are also indicated together with the sizes of fragments, which are
given in bp. Length of abnormally spliced transcripts and of their
restricted fragments are reported in parentheses. The 182-bp and 186-bp
fragments were obtained from the 9729del4 and 9726+5A constructs,
respectively. The 144-bp fragment was obtained by Taq I
restriction of the 186-bp amplified fragment. The gray box indicates
the repeat inserted in the abnormally spliced transcripts.
|
|
Because the study of illegitimate transcripts was not feasible in
patients 1 and 3 and in addition two mutations were present combined
with a normal allele (patients 2 and 3), the mechanisms through which
the putative gene defects exert their phenotypic effects were
investigated in expression studies. The complete IVS7, the 3
region of exon 7 and the 5 region of exon 8 were amplified from
DNA of each patient and inserted in a mammalian expression vector (Fig
1). In addition, the IVS7 from normal controls was also amplified and
cloned.
The spliced mRNA was evaluated by RT-PCR of total RNA extracted from
transfected cells (Fig 2B). The normal cDNA (149 bp, Fig 2B) was
detected in the expression of normal control and of the constructs
bearing the 9726+7G or the 9729del4 mutations. A fragment larger in
size was detected in the expression of the 9729del4 and 9726+5A
mutants. All fragments were characterized by direct sequencing
(Fig 3), which showed that both the altered splicing products included the first intronic repeat of IVS7. The
abnormal splicing caused the insertion of 37 bp in the mRNA bearing the
9726+5A mutation and of 33 bp in the mRNA transcribed from the 9729del4
mutant. The former insertion predicted a reading frameshift and
premature termination, whereas the latter predicted an in-frame
insertion of 11 codons (Fig 3).
View larger version (61K):
[in this window]
[in a new window]
| Fig 3.
Sequencing of abnormally spliced cDNA. The gray box
indicates the inserted sequences. The 11 additional residues inserted
between Leu208 and Gly209 and the frame-shifting after Gly209 are
indicated.
|
|
The relative amounts of the normal cDNA and of the cDNA with the 33-bp
insertion, evaluated by densitometric scanning of
polyacrylamide gels from ectopic mRNA, were similar. In
expression experiments the normal band was 30% (mean of three
transfections) of the altered one. 32P-labeling of PCR
products (Fig 2B) was used to investigate the apparent absence, after
ethidium bromide staining, of normally spliced products from the
9726+5A mutant. The densitometric evaluation of the autoradiographic
pattern, after three different transfection experiments and
serial dilutions (not shown) of RT-PCR products, indicated the presence
of a normal cDNA ranging from 0.2% to 1% of the altered cDNA.
Restriction with Taq I (Fig 2B and C) produced a fragment
107-bp in size, specific for the normal cDNA.
No altered cDNA including the first repeat was detectable after
labeling the RT-PCR products of the 9726+7G mutant (Fig 2B), as well as
of the two control IVS7 (6 or 7 repeats).
Protein studies.
The presence of large amounts of normal FVII in the heterozygous
patient 2 complicates the evaluation of the altered protein translated
from the mRNA with the 33-bp insertion. A vector containing the
in-frame insertion of 11 codons in the FVII cDNA was obtained by
mutagenesis and the FVII variant was investigated in transient transfection experiments (Table 2). While similar amounts
of FVII antigen were detectable in lysate of cells transfected with normal and mutated vectors, a very low level of FVII antigen with undetectable activity was measured in medium of cells transfected with
the mutant cDNA.
| |
DISCUSSION |
We report the study in the FVII gene of two transitions and a short
deletion, localized in the donor splice site of the IVS7 and clustered
in a short direct repeat (TGGGTGGGTA), a potential "hot spot" for
mutation.21 Among the members of the coagulation serine
protease family, this intron provides a peculiar model for the study of
splicing mutations because the donor splice site, located in the first
of several highly homologous 37-bp repeats, is followed by several
cryptic splice sites, some of them with identical CV. The analysis and
the estimate of the relative amounts of splicing products were favored
by the absence of exon skipping and by the expected negligible
differences in reverse transcription and PCR amplification efficiency
of fragments similar in size (Fig 2C). Although obtained by transient
transfections of BHK cells, which may not reflect relative mRNA levels
in the hepatocyte, our studies provided further evidence of the
interplay of sequence and position among the several parameters
involved in the 5 splice site selection. In normal, polymorphic,
and mutated IVS7, the cryptic sites with lower CV were ignored and only
the proximal among the several identical sites with higher score was
chosen, which underlines the importance of position of splicing signals for the spliceosome.
Because patient 3 was homozygous for the Gln353 allele of the common
polymorphism (Arg353Gln) associated with reduced FVII level,25,26 expression studies were required to define the single role of the 9726+7AG transition, a position found
mutated in other coagulation serine proteases
deficiencies.27 After expression and labeling of PCR
products, only normally spliced mRNA was detected, thus indicating that
the 9726+7AG mutation is a rare and functionally silent
polymorphism and that the reduction of FVII activity in the patient is
probably explained by the functional Arg353Gln substitution.
Two of the mutations under study (9726+5GA, 9729del4), which
cause a reduction of the CV, predict a reduction in efficiency of
normal splicing and therefore of FVII levels.
The 9726+5GA mutation is the most frequent mutation
responsible for clinically symptomatic FVII deficiency in
Italy,20 as demonstrated by the allelic frequency (3%)
that we have detected in a small village near Rome and by the seven
unrelated homozygous patients so far diagnosed by us in central Italy.
The severe impairment of normal splicing and the detection of abnormal
spliced transcript including 37 additional bp demonstrated the
causative nature of this mutation. The insertion caused a reading
frameshift and premature termination of translation at residue 231, thus abolishing most of the C-terminal catalytic domain (residues
168-406). Although the altered mRNA was highly prevalent (approximately
99%), we demonstrated that the mutation permits a minute amount of
correct splicing to occur, which predicts the encoding of very low
amounts of circulating FVII. Even the very low level of FVII activity at the beginning of blood coagulation may explain the moderate clinical
phenotype observed in patient 1. Other Italian patients homozygous for
the 9726+5GA mutation20 were characterized by moderate to severe bleeding symptoms. Differently, in patients with
mutations not compatible with residual FVII activity,10,28 a severe and life-threatening bleeding condition was observed and in
FVII gene knock-out experiments in mice,4 death was very
frequent in the first day after birth. Because very low FVII values
cannot be properly evaluated with the current assays for FVII:C and
FVII:Ag, mRNA studies are of importance to establish the relationship
between the residual FVII activity and the clinical phenotype.
Although the 9729del4 produced a donor splicing sequence with a CV
lower than that of the 9726+5GA mutation, it was compatible with the production of sensibly higher amounts of the normally spliced
transcript, which defines this short deletion as responsible for a mild
FVII deficiency. As expected from the heterozygous condition of the
deletion in patient 2, the relative amount of normal transcript was
higher in the ectopic mRNA than in the in vitro-expressed mRNA. The
deletion of 4 bp caused the in frame insertion of 33 bp, thus producing
an altered FVII molecule with 11 additional residues (Fig 3). The
inspection of the crystallographic model of FVIIa29 showed
that the residues at the site of insertion (Leu208-Gly209) are mostly
covered by a chain (residues 219-223) exposed on the surface of the
catalytic domain. The insertion of the 11 additional amino acids
predicts major rearrangements that led in a theoretical
model30 to separate Leu208 from Gly209 by 10 Å and to
expose on the surface a new chain. In medium of cells transfected with
the mutant cDNA, very low levels of the abnormal protein were
detectable by FVII-specific antibodies, and no FVII activity was
measured, which is in accordance with the reduction in FVII activity
and antigen observed in the plasma of the heterozygous patient and of
his granddaughter.
The analysis of the expression of these splicing mutations throws light
on the heterogeneous molecular bases of FVII deficiency and elucidates
the mechanisms that are able to modulate FVII levels and to produce a
spectrum of clinical phenotypes.
| |
FOOTNOTES |
Submitted February 9, 1998;
accepted April 28, 1998.
Supported by Consiglio Nazionale Delle Ricerche Target Project on
Biotechnology and by Ministero Università Ricerca Scientifica Technologica.
Address reprint requests to Francesco Bernardi, BS,
Dipartimento di Biochimica e Biologia Molecolare, Universita' di
Ferrara, Via L.Borsari 46, 44100 Ferrara, Italy; e-mail:
BER{at}DNS.UNIFE.IT.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr John H. McVey for providing the FVII-cDNA and Dr Anita
Kavlie for helpful suggestions.
| |
REFERENCES |
1.
Davie EW:
Introduction to hemostasis and the vitamin K-dependent coagulation factors
, in Scriver CR,
Beaudet AL,
Sly WS,
Valle D
(eds):
The Metabolic Basis of Inherited Disease.
New York, NY, McGraw-Hill
, 1989
, p 2107
2.
Meade TW,
Mellows S,
Brozovic M,
Miller GJ,
Chakrabarti RR,
North WRS,
Haines AP,
Stirling Y,
Imeson JD,
Thompson SG:
Haemostatic function and ischaemic heart disease: Principal results of the Northwick Park Heart Study.
Lancet
2:533,
1986[Medline]
[Order article via Infotrieve]
3.
Cooper DN,
Millar DS,
Wacey A,
Banner DW,
Tuddenham EGD:
Inherited factor VII deficiency: Molecular genetics and pathophysiology.
Thromb Haemost
78:151,
1997[Medline]
[Order article via Infotrieve]
4.
Rosen E,
Chan JC,
Idusogie E,
Clotman F,
Vlasuk G,
Luther T,
Jalbert LR,
Albrecht S,
Zhong L,
Lissens A,
Schoonjans L,
Moons L,
Collen D,
Castellino FJ,
Carmeliet P:
Mice lacking factor VII develop normally but suffer fatal perinatal bleeding.
Nature
390:290,
1997[Medline]
[Order article via Infotrieve]
5.
Bernardi F,
Liney DL,
Patracchini P,
Gemmati D,
Legnani C,
Arcieri P,
Pinotti M,
Redaelli R,
Ballerini G,
Pemberton S,
Wacey AI,
Mariani G,
Tuddenham GD,
Marchetti G:
Molecular defect in CRM+ factor VII deficiencies: Modelling of missense mutations in the catalytic domain of FVII.
Br J Haematol
86:610,
1994[Medline]
[Order article via Infotrieve]
6.
Bernardi F,
Castaman G,
Redaelli R,
Pinotti M,
Lunghi B,
Rodeghiero F,
Marchetti G:
Topologically equivalent mutations causing dysfunctional coagulation factor VII (294AlaVal) and X (334SerPro).
Hum Mol Genet
3:1175,
1994[Free Full Text]
7.
Bernardi F,
Castaman G,
Pinotti M,
Ferraesi P,
Di Iasio MG,
Lunghi B,
Rodighiero F,
Marchetti G:
Mutation pattern in clinically asymptomatic coagulation factor VII deficiency.
Hum Mutat
8:108,
1996[Medline]
[Order article via Infotrieve]
8.
Arbini AA,
Mannucci PM,
Bauer KA:
A Thr359Met mutation in factor VII of a patient with hereditary deficiency causes defective secretion of the molecule.
Blood
87:5085,
1996[Abstract/Free Full Text]
9.
Arbini AA,
Pollak ES,
Bayleran JK,
High KA,
Bauer KA:
Severe factor VII deficiency due to a mutation disrupting a hepatocyte nuclear factor 4 binding site in the factor VII promoter.
Blood
89:176,
1997[Abstract/Free Full Text]
10.
Chaing S,
Clarke B,
Sridhara S,
Chu K,
Friedman P,
VanDusen W,
Roberts HR,
Blaichman MB,
Monroe DM,
High KA:
Severe factor VII deficiency caused by mutations abolishing the cleavage site for activation and altering binding to tissue factor.
Blood
83:3524,
1994[Abstract/Free Full Text]
11.
Bharadwaj D,
Iino M,
Kontoyianni M,
Smith KJ,
Foster DC,
Kisiel W:
Factor VII Central.
J Biol Chem
271:30685,
1996[Abstract/Free Full Text]
12.
Ohiwa M,
Hayashi T,
Wada H,
Minamikawa K,
Shirakawa S,
Suzuki K:
Factor VII Mie: Homozygous asymptomatic type I deficiency caused by an amino acid substitution of His (CAC) for Arg (247)(CGC) in the catalytic domain.
Thromb Haemost
71:773,
1994[Medline]
[Order article via Infotrieve]
13.
Tamary H,
Fromovich Y,
Shalmon L,
Reich Z,
Dym O,
Lanir N,
Brenner B,
Paz M,
Luder AS,
Blau O,
Korostishevsky M,
Zaizov R,
Seligsohn U:
Ala244Val is a common, probably ancient mutation causing factor VII deficiency in Moroccan and Iranian Jews.
Thromb Haemost
76:283,
1996[Medline]
[Order article via Infotrieve]
14.
Furie B,
Furie B:
Molecular and cellular biology of blood coagulation.
N Engl J Med
326:800,
1992[Medline]
[Order article via Infotrieve]
15.
Pollak ES,
Hung HL,
Godin W,
Overton GC,
High KA:
Functional characterization of the human factor VII 5 flanking region.
J Biol Chem
271:1738,
1996[Abstract/Free Full Text]
16.
O'Hara PJ,
Grant FJ,
Haldeman BA,
Gray CL,
Insley MY,
Hagen FS,
Murray MJ:
Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation.
Proc Natl Acad Sci USA
84:5158,
1987[Abstract/Free Full Text]
17.
O'Hara PJ,
Grant FJ:
The human factor VII gene is polymorphic due to variation in repeat copy number in a minisatellite.
Gene
66:147,
1988[Medline]
[Order article via Infotrieve]
18.
Marchetti G,
Patracchini P,
Gemmati D,
DeRosa V,
Pinotti M,
Rodorigo G,
Casonato A,
Girolami A,
Bernardi F:
Detection of two missense mutations and characterization of a repeat polymorphism in the factor VII gene (F7).
Hum Genet
89:497,
1992[Medline]
[Order article via Infotrieve]
19.
Marchetti G,
Gemmati D,
Patracchini P,
Pinotti M,
Bernardi F:
PCR detection of a repeat polymorphism within the F7 gene.
Nucleic Acids Res
19:4570,
1991[Free Full Text]
20.
Bernardi F,
Patracchini P,
Gemmati D,
Ferrati M,
Arcieri P,
Papacchini M,
Redaelli R,
Baudo F,
Mariani G,
Marchetti G:
Molecular analysis of factor VII deficiency in Italy: A frequent mutation (FVII Lazio) in a repeated intronic region.
Hum Genet
92:446,
1993[Medline]
[Order article via Infotrieve]
21.
Krawczak M,
Cooper DN:
Gene deletions causing human genetic disease: Mechanisms of mutagenesis and the role of the local DNA sequence environment.
Hum Genet
86:425,
1991[Medline]
[Order article via Infotrieve]
22.
Hagen FS,
Gray CL,
O'Hara P,
Grant FJ,
Saari GC,
Woobury RG,
Hart CE,
Insley M,
Kisiel W,
Kurachi K,
Davie EW:
Characterization of a cDNA coding for human factor VII.
Proc Natl Acad Sci USA
83:2412,
1986[Abstract/Free Full Text]
23.
Katsumi A,
Senda T,
Yamashita Y,
Yamazaki T,
Hamaguchi M,
Kojima T,
Kobayashi S,
Saito H:
Protein C Nagoya, an elongated mutant of protein C, is retained within the endoplasmic reticulum and is associated with GRP78 and GRP94.
Blood
87:4164,
1996[Abstract/Free Full Text]
24.
Shapiro MB,
Senapathy P:
RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression.
Nucleic Acids Res
15:7155,
1987[Abstract/Free Full Text]
25.
Green F,
Kelleher C,
Wilkes H,
Temple A,
Meade TW,
Humphries S:
A common genetic polymorphism associated with lower coagulation factor VII levels in healthy individuals.
Arterioscler Thromb
11:540,
1991[Abstract/Free Full Text]
26.
Bernardi F,
Marchetti G,
Pinotti M,
Arcieri P,
Baroncini C,
Papacchini M,
Zepponi E,
Ursicino N,
Chiarotti F,
Mariani G:
Factor VII gene polymorphisms contribute about one third of the factor VII level variation in plasma.
Arterioscler Thromb Vasc Biol
16:72,
1996
27.
Saad S,
Rowley G,
Tagliavacca L,
Green PM,
Giannelli G,
UK Haemophilia Centres:
First report on UK database of Haemophilia B mutations and pedigrees.
Thromb Haemost
71:563,
1994[Medline]
[Order article via Infotrieve]
28.
Millar DS,
Cooper DN,
Kakkar VV,
Schwartz M,
Scheibel E:
Prenatal exclusion of severe factor VII deficiency by DNA sequencing.
Lancet
339:1359,
1992[Medline]
[Order article via Infotrieve]
29.
Banner DW,
D'Arcy A,
Chene C,
Winkler FK,
Guha A,
Konosberg WH,
Nemerson Y,
Kirchhofer D:
The crystal structure of the complex of blood coagulation factor VIIa with soluble tissue factor.
Nature
380:41,
1996[Medline]
[Order article via Infotrieve]
30.
Peitsch MC:
ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling.
Biochem Soc Trans
24:274,
1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Pinotti, L. Rizzotto, D. Balestra, M. A. Lewandowska, N. Cavallari, G. Marchetti, F. Bernardi, and F. Pagani
U1-snRNA-mediated rescue of mRNA processing in severe factor VII deficiency
Blood,
March 1, 2008;
111(5):
2681 - 2684.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Castoldi, J. W. P. Govers-Riemslag, M. Pinotti, D. Bindini, G. Tans, M. Berrettini, M. G. Mazzucconi, F. Bernardi, and J. Rosing
Coinheritance of Factor V (FV) Leiden enhances thrombin formation and is associated with a mild bleeding phenotype in patients homozygous for the FVII 9726+5G>A (FVII Lazio) mutation
Blood,
December 1, 2003;
102(12):
4014 - 4020.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Roca, R. Sachidanandam, and A. R. Krainer
Intrinsic differences between authentic and cryptic 5' splice sites
Nucleic Acids Res.,
November 1, 2003;
31(21):
6321 - 6333.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Borensztajn, M.-L. Sobrier, A.-M. Fischer, O. Chafa, S. Amselem, and J. Tapon-Bretaudiere
Factor VII gene intronic mutation in a lethal factor VII deficiency: effects on splice-site selection
Blood,
July 15, 2003;
102(2):
561 - 563.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. I. Rees, T. M. Lewis, J. B. J. Kwok, G. R. Mortier, P. Govaert, R. G. Snell, P. R. Schofield, and M. J. Owen
Hyperekplexia associated with compound heterozygote mutations in the {beta}-subunit of the human inhibitory glycine receptor (GLRB)
Hum. Mol. Genet.,
April 1, 2002;
11(7):
853 - 860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Pinotti, D. Etro, D. Bindini, M. L. Papa, G. Rodorigo, A. Rocino, G. Mariani, N. Ciavarella, and F. Bernardi
Residual factor VII activity and different hemorrhagic phenotypes in CRM+ factor VII deficiencies (Gly331Ser and Gly283Ser)
Blood,
February 15, 2002;
99(4):
1495 - 1497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Pinotti, R. Toso, D. Girelli, D. Bindini, P. Ferraresi, M. L. Papa, R. Corrocher, G. Marchetti, and F. Bernardi
Modulation of factor VII levels by intron 7 polymorphisms: population and in vitro studies
Blood,
June 1, 2000;
95(11):
3423 - 3428.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract