Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pinotti, M.
Right arrow Articles by Bernardi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pinotti, M.
Right arrow Articles by Bernardi, F.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 5 (September 1), 1998: pp. 1646-1651

Molecular Mechanisms of FVII Deficiency: Expression of Mutations Clustered in the IVS7 Donor Splice Site of Factor VII Gene

By M. Pinotti, R. Toso, R. Redaelli, M. Berrettini, G. Marchetti, and F. Bernardi

From the Dipartimento di Biochimica e Biologia Molecolare - CIBF, Sezione SBPGU, Università di Ferrara, Ferrara; the Divisione di Ematologia, Ospedale Niguarda, Milano; and the Istituto di Medicina Interna e di Medicina Vascolare, Università di Perugia, Perugia, Italy.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

In three Italian patients, two point mutations and a short deletion were found in the intron 7 of factor VII gene, clustered in the donor splice site and located in the first of several repeats. The mutation 9726+5Gright-arrowA, the most frequent cause of symptomatic factor VII deficiency in Italy, as well as the deletion (9729del4) gave rise in expression studies to abnormally spliced transcripts, which were exclusively produced from the cryptic site in the second repeat. The insertion in the mature mRNA of the first intronic repeat caused (9726+5Gright-arrowA) a reading frameshift, abolishing most of the factor VII catalytic domain, or produced (9729del4), an altered factor with 11 additional residues, the activity of which was not detectable in the cell medium after mutagenesis and expression studies. Studies of factor VII ectopic mRNA from leukocytes and expression studies indicated that the deleted gene produced 30% of normally spliced transcript. Differently, the 9726+5Gright-arrowA mutation permitted a very low level (0.2% to 1%) of correct splicing to occur, which could be of great importance to prevent the onset, in the homozygous patients, of most of the life-threatening bleeding symptoms. The 9726+7Aright-arrowG mutation was found to be a rare and functionally silent polymorphism. These findings, which provide further evidence of the interplay of sequence and position in the 5' splice site selection, throw light on the heterogeneous molecular bases and clinical phenotypes of FVII deficiency.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

FACTOR VII (gene symbol, F7; acronym, FVII) is a vitamin K-dependent serine protease glycoprotein circulating as a zymogen in plasma, with a pivotal role in the initiation of blood coagulation.1 While increased levels of FVII are associated with an increased risk of coronary heart disease,2 very low levels of FVII (<2% of normal) cause severe bleeding disorders in patients.3 FVII gene knock-out experiments in mice showed a reduction in the live birth rate and very frequent death in the first day after birth.4 Patterns of mutations have been defined in FVII deficiency,3,5-7 which offer the opportunity to investigate the mechanisms through which the genotypes produce a low level of FVII expression.8-13

FVII gene belongs to a subgroup of coagulation serine proteases, which also includes factor IX, factor X, and protein C, characterized by sequence and structure homology.14,15 Different from the other members of this family, FVII gene16 contains in introns 1A, 1B, 2, 7 and in exon 8, five minisatellites imperfect tandem repeats with monomer element lengths ranging from 14 to 37 bp.17 The intron 7 (IVS7) is characterized by the presence of a variable number (ranging from 5 to 8) of 37-bp repeats,17-19 the first of which contains the IVS7 donor splice site followed by several repeats showing cryptic sites completely homologous in sequence to the functional site. Two mutations, one (9726+5Gright-arrowA) present in several Italian patients with symptomatic FVII deficiency and another (9726+7Aright-arrowG) in an asymptomatic subject, have been found in the IVS7 donor splice site.20 However, the functional meaning of both mutations has not been defined.

This gene region, characterized by sequence and repeat variations and thus potentially a "hot spot mutation site,"21 was investigated in one patient with symptomatic FVII deficiency and in two patients selected for reduced FVII level. Mutants were characterized through expression studies in mammalian cells, which provided a sensitive and specific assay for normal and altered splicing products, as well as for mutant FVII.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Subjects.   Patient 1 was referred at the time of menarca when she showed severe meno-metrorrhagia and was treated with concentrated FVII (Provetin UM; Immuno, Wien, Austria). She experienced two pregnancies without any complication. The FVII activity level was less than 1% as compared with the pooled normal plasma. The enzyme-linked immunoadsorbent assay (ELISA) assay showed an undetectable level of FVII antigen.

Patients 2 and 3 were asymptomatic and were referred for a mildly prolonged prothrombin time (>2 standard deviation from the prothrombin time of the reference plasma), detected in a presurgery screening. FVII:C and FVII:Ag levels were 61% and 58% for patient 2 and 43% and 42% for patient 3.

Genomic studies and reverse transcriptase-polymerase chain reaction (RT-PCR).   DNA and RNA extraction, PCR amplification, restriction and direct sequencing were as previously described.6 Amplification of genomic fragments for cloning was obtained by using the Expand high fidelity PCR system (Boehringer Mannheim, Mannheim, Germany) with the oligos 2-6 (Table 1) in 30 cycles: 20 seconds denaturation at 94°C; 3 seconds annealing at 52°C; 30 seconds extension at 70°C. Total RNA from the buffy-coat fraction of peripheral blood or from 106 baby hamster kidney (BHK) cells was used as template for cDNA synthesis with 40 U of avian myeloblastosis virus RT with 10 nmol of oligo 4 or 5 and the RT reaction mixture (1/10) was amplified with oligos 1-5, 3-4, or 3-5 (Table 1).

 
View this table:
[in this window] [in a new window]
 
Table 1. Primers

 
View this table:
[in this window] [in a new window]
 
Table 2. FVII Expression Levels From Transiently Transfected BHK Cells

Cloning.   The genomic region spanning nucleotides 9568-10908 was amplified from DNA of normal subjects (carrying 6 or 7 repeats) and from patients, restricted by Sac I and inserted in the pUC18 vector. Single clones containing the mutation were isolated and subcloned in the eucaryotic expression vector pCDNA3 (Invitrogen Corp, Carlsbad, CA) by using the XbaI and EcoRI restriction sites. Each construct is designated with the name of the mutation inserted. The complete human factor VII cDNA22 was kindly provided by Dr John H. McVey (MRC Clinical Sciencies Centre, London, UK) and cloned in the pCDNA3 by using the XbaI and HindIII restriction sites.

Mutagenesis.   The additional 33-bp (GTACCACTCTCCCCTGTCCGACCGCGGTGCTGG) were inserted at the position 9726 of the FVII-cDNA by using the QuikChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the instruction of the manufacturer. Fifteen base pairs (nt 9727-9741) were inserted using primers 7-8 (Table 1). The mutagenized vector was used as template for a second mutagenesis with oligonucleotides 9-10 (Table 1). For each step, 18 cycles were run as follow: 30 seconds denaturation at 95°C; 1 minute annealing at 45°C; 16 minutes extension at 68°C.

Cell culture, transfection, and expression.   BHK cells were grown in Dulbecco's modified essential medium supplemented with 10% inactivated fetal calf serum (FCS), 4 mmol/L L-glutamine, 125 U/mL of penicillin, and 125 mg/mL of streptomycin and nonessential amino acids in the 5% CO2 atmosphere at 37°C. A total of 5 × 105 cells were transfected into 10-mm petri-dish using lipofectin (GIBCO-BRL, Gaithersburg, MD). Cells and medium were harvested and studied after 48 hours. Cell lysates were obtained as previously reported.23

Measurement of FVII activity and antigen.   The FVII antigen level was measured by using an enzyme immunoassay (Asserachrom VII:Ag, Diagnostica Stago, Asnieres, France). FVII coagulant activity was determined by a one-stage method using FVII-deficient plasma as a substrate and a commercial human thromboplastin preparation. A standard normal pooled plasma prepared from 50 healthy donors was defined to contain 100% FVII antigen and 100% FVII activity.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

DNA from patients with FVII deficiency was screened by restriction for the presence of FVII gene mutations previously described in the Italian population.7 The suppression of an Rsa I restriction site in the amplified IVS7 (Fig 1), which was compatible with two transitions (9726+5Gright-arrowA, 9726+7Aright-arrowG) previously reported,20 was detected in patients 1 and 3. The Rsa I restriction produced in patient 2 a shorter band. Sequencing showed in patients 1 and 3 the 9726+5 G to A transition in the homozygous condition and the 9726+7A to G transition in the heterozygous condition, respectively. Differently, a 4-bp deletion (nt 9729-9732, Fig 1) was found in the heterozygous condition in patient 2. The inheritance of this short deletion and of the coagulation phenotype was demonstrated in his granddaughter, characterized by a parallel reduction in FVII activity (47%) and in FVII antigen (42%).


View larger version (17K):
[in this window]
[in a new window]
 
Fig 1. Schematic diagram of the mutated FVII gene region and of the vectors used for the expression of mutant mRNA (1) and protein (2). The sequence of the Rsa I site is reported in bold; 2 and 6, primers. The open and closed triangles indicate the position of the IVS7 mutations and of the additional residues inserted in the FVII cDNA, respectively. P, Gla, EGF1, EGF2 and A, FVII domains.

The RsaI restriction excluded the presence of these mutations in 100 normal controls. The consensus values (CV) of the wild-type 5'IVS7 splice site, calculated according to Shapiro and Senapathy,24 was 74.7 and a cryptic site with an identical CV is present in each repeat. The 9726+5A and 9729del4 mutations lowered this value to 60.9 and 58.1, respectively. Cryptic sites at positions +4, +19, and +30 are detectable with CV of 63.3, 53.9, and 56.7, respectively. The cryptic site at position +4 was removed by the 9726+5Gright-arrowA transition and by the 9729del4 mutation.

Because the sequence statistics of Shapiro and Senapathy do not include the position +7, the variation of CV for the 9726+7Aright-arrowG transition cannot be estimated. However, this mutation makes the regions of the functional donor splice site and of the cryptic site located at +37 completely overlapping for 25 bases. This mutation was found to be associated in patient 3 with the presence of Gln at position 353, a frequent FVII gene polymorphic allele.

mRNA studies.   The availability of fresh white blood cells enabled us to study in patient 2 the FVII gene expression at the mRNA level by RT-PCR of illegitimate transcripts. The size of the cDNA (Fig 2A) was compatible with splicing of exons 7 and 8, whereas the absence of a splicing product 172 bp in size excluded the occurrence of exon 7 skipping. Restriction by BclI showed the expected normal bands (190 bp and 104 bp, Fig 2A) and an additional band larger in size, compatible with the presence in the spliced mRNA of a short intronic sequence.


View larger version (52K):
[in this window]
[in a new window]
 
Fig 2. Studies of ectopic and in vitro-expressed FVII mRNA. (A) RT-PCR amplification of white blood cell mRNA obtained from patient 2 carrying the 9729del4 mutation. PCR products (primers 1-5) were separated by 8% PAGE (left) or by 11% PAGE after Bcl I restriction (right). NC, negative control. (B) RT-PCR amplification of FVII mRNA expressed in cells transfected with constructs containing the three mutations (9729del4, 9726+5A, 9726+7G) or the normal sequence (N). Upper part, ethidium bromide staining of fragments amplified with primers 3 and 4; M, size marker. Lower part, autoradiographs of the same fragments labeled by 32P and restricted by Taq I. Gels were overexposed. (C) Schematic diagrams of FVII cDNAs (exons 6-8) and of fragments amplified from the ectopic mRNA (primers 1-5) or from the mRNA expressed in transfected cells (primers 3-4). The restriction sites used in (A) (Bcl I) and (B) (Taq I) are also indicated together with the sizes of fragments, which are given in bp. Length of abnormally spliced transcripts and of their restricted fragments are reported in parentheses. The 182-bp and 186-bp fragments were obtained from the 9729del4 and 9726+5A constructs, respectively. The 144-bp fragment was obtained by Taq I restriction of the 186-bp amplified fragment. The gray box indicates the repeat inserted in the abnormally spliced transcripts.

Because the study of illegitimate transcripts was not feasible in patients 1 and 3 and in addition two mutations were present combined with a normal allele (patients 2 and 3), the mechanisms through which the putative gene defects exert their phenotypic effects were investigated in expression studies. The complete IVS7, the 3' region of exon 7 and the 5' region of exon 8 were amplified from DNA of each patient and inserted in a mammalian expression vector (Fig 1). In addition, the IVS7 from normal controls was also amplified and cloned.

The spliced mRNA was evaluated by RT-PCR of total RNA extracted from transfected cells (Fig 2B). The normal cDNA (149 bp, Fig 2B) was detected in the expression of normal control and of the constructs bearing the 9726+7G or the 9729del4 mutations. A fragment larger in size was detected in the expression of the 9729del4 and 9726+5A mutants. All fragments were characterized by direct sequencing (Fig 3), which showed that both the altered splicing products included the first intronic repeat of IVS7. The abnormal splicing caused the insertion of 37 bp in the mRNA bearing the 9726+5A mutation and of 33 bp in the mRNA transcribed from the 9729del4 mutant. The former insertion predicted a reading frameshift and premature termination, whereas the latter predicted an in-frame insertion of 11 codons (Fig 3).


View larger version (61K):
[in this window]
[in a new window]
 
Fig 3. Sequencing of abnormally spliced cDNA. The gray box indicates the inserted sequences. The 11 additional residues inserted between Leu208 and Gly209 and the frame-shifting after Gly209 are indicated.

The relative amounts of the normal cDNA and of the cDNA with the 33-bp insertion, evaluated by densitometric scanning of polyacrylamide gels from ectopic mRNA, were similar. In expression experiments the normal band was 30% (mean of three transfections) of the altered one. 32P-labeling of PCR products (Fig 2B) was used to investigate the apparent absence, after ethidium bromide staining, of normally spliced products from the 9726+5A mutant. The densitometric evaluation of the autoradiographic pattern, after three different transfection experiments and serial dilutions (not shown) of RT-PCR products, indicated the presence of a normal cDNA ranging from 0.2% to 1% of the altered cDNA. Restriction with Taq I (Fig 2B and C) produced a fragment 107-bp in size, specific for the normal cDNA.

No altered cDNA including the first repeat was detectable after labeling the RT-PCR products of the 9726+7G mutant (Fig 2B), as well as of the two control IVS7 (6 or 7 repeats).

Protein studies.   The presence of large amounts of normal FVII in the heterozygous patient 2 complicates the evaluation of the altered protein translated from the mRNA with the 33-bp insertion. A vector containing the in-frame insertion of 11 codons in the FVII cDNA was obtained by mutagenesis and the FVII variant was investigated in transient transfection experiments (Table 2). While similar amounts of FVII antigen were detectable in lysate of cells transfected with normal and mutated vectors, a very low level of FVII antigen with undetectable activity was measured in medium of cells transfected with the mutant cDNA.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

We report the study in the FVII gene of two transitions and a short deletion, localized in the donor splice site of the IVS7 and clustered in a short direct repeat (TGGGTGGGTA), a potential "hot spot" for mutation.21 Among the members of the coagulation serine protease family, this intron provides a peculiar model for the study of splicing mutations because the donor splice site, located in the first of several highly homologous 37-bp repeats, is followed by several cryptic splice sites, some of them with identical CV. The analysis and the estimate of the relative amounts of splicing products were favored by the absence of exon skipping and by the expected negligible differences in reverse transcription and PCR amplification efficiency of fragments similar in size (Fig 2C). Although obtained by transient transfections of BHK cells, which may not reflect relative mRNA levels in the hepatocyte, our studies provided further evidence of the interplay of sequence and position among the several parameters involved in the 5' splice site selection. In normal, polymorphic, and mutated IVS7, the cryptic sites with lower CV were ignored and only the proximal among the several identical sites with higher score was chosen, which underlines the importance of position of splicing signals for the spliceosome.

Because patient 3 was homozygous for the Gln353 allele of the common polymorphism (Arg353Gln) associated with reduced FVII level,25,26 expression studies were required to define the single role of the 9726+7Aright-arrowG transition, a position found mutated in other coagulation serine proteases deficiencies.27 After expression and labeling of PCR products, only normally spliced mRNA was detected, thus indicating that the 9726+7Aright-arrowG mutation is a rare and functionally silent polymorphism and that the reduction of FVII activity in the patient is probably explained by the functional Arg353Gln substitution.

Two of the mutations under study (9726+5Gright-arrowA, 9729del4), which cause a reduction of the CV, predict a reduction in efficiency of normal splicing and therefore of FVII levels.

The 9726+5Gright-arrowA mutation is the most frequent mutation responsible for clinically symptomatic FVII deficiency in Italy,20 as demonstrated by the allelic frequency (3%) that we have detected in a small village near Rome and by the seven unrelated homozygous patients so far diagnosed by us in central Italy. The severe impairment of normal splicing and the detection of abnormal spliced transcript including 37 additional bp demonstrated the causative nature of this mutation. The insertion caused a reading frameshift and premature termination of translation at residue 231, thus abolishing most of the C-terminal catalytic domain (residues 168-406). Although the altered mRNA was highly prevalent (approximately 99%), we demonstrated that the mutation permits a minute amount of correct splicing to occur, which predicts the encoding of very low amounts of circulating FVII. Even the very low level of FVII activity at the beginning of blood coagulation may explain the moderate clinical phenotype observed in patient 1. Other Italian patients homozygous for the 9726+5Gright-arrowA mutation20 were characterized by moderate to severe bleeding symptoms. Differently, in patients with mutations not compatible with residual FVII activity,10,28 a severe and life-threatening bleeding condition was observed and in FVII gene knock-out experiments in mice,4 death was very frequent in the first day after birth. Because very low FVII values cannot be properly evaluated with the current assays for FVII:C and FVII:Ag, mRNA studies are of importance to establish the relationship between the residual FVII activity and the clinical phenotype.

Although the 9729del4 produced a donor splicing sequence with a CV lower than that of the 9726+5Gright-arrowA mutation, it was compatible with the production of sensibly higher amounts of the normally spliced transcript, which defines this short deletion as responsible for a mild FVII deficiency. As expected from the heterozygous condition of the deletion in patient 2, the relative amount of normal transcript was higher in the ectopic mRNA than in the in vitro-expressed mRNA. The deletion of 4 bp caused the in frame insertion of 33 bp, thus producing an altered FVII molecule with 11 additional residues (Fig 3). The inspection of the crystallographic model of FVIIa29 showed that the residues at the site of insertion (Leu208-Gly209) are mostly covered by a chain (residues 219-223) exposed on the surface of the catalytic domain. The insertion of the 11 additional amino acids predicts major rearrangements that led in a theoretical model30 to separate Leu208 from Gly209 by 10 Å and to expose on the surface a new chain. In medium of cells transfected with the mutant cDNA, very low levels of the abnormal protein were detectable by FVII-specific antibodies, and no FVII activity was measured, which is in accordance with the reduction in FVII activity and antigen observed in the plasma of the heterozygous patient and of his granddaughter.

The analysis of the expression of these splicing mutations throws light on the heterogeneous molecular bases of FVII deficiency and elucidates the mechanisms that are able to modulate FVII levels and to produce a spectrum of clinical phenotypes.

    FOOTNOTES

   Submitted February 9, 1998; accepted April 28, 1998.
   Supported by Consiglio Nazionale Delle Ricerche Target Project on Biotechnology and by Ministero Università Ricerca Scientifica Technologica.
   Address reprint requests to Francesco Bernardi, BS, Dipartimento di Biochimica e Biologia Molecolare, Universita' di Ferrara, Via L.Borsari 46, 44100 Ferrara, Italy; e-mail: BER{at}DNS.UNIFE.IT.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank Dr John H. McVey for providing the FVII-cDNA and Dr Anita Kavlie for helpful suggestions.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Davie EW: Introduction to hemostasis and the vitamin K-dependent coagulation factors , in Scriver CR, Beaudet AL, Sly WS, Valle D (eds): The Metabolic Basis of Inherited Disease. New York, NY, McGraw-Hill , 1989 , p 2107

2. Meade TW, Mellows S, Brozovic M, Miller GJ, Chakrabarti RR, North WRS, Haines AP, Stirling Y, Imeson JD, Thompson SG: Haemostatic function and ischaemic heart disease: Principal results of the Northwick Park Heart Study. Lancet 2:533, 1986[Medline] [Order article via Infotrieve]

3. Cooper DN, Millar DS, Wacey A, Banner DW, Tuddenham EGD: Inherited factor VII deficiency: Molecular genetics and pathophysiology. Thromb Haemost 78:151, 1997[Medline] [Order article via Infotrieve]

4. Rosen E, Chan JC, Idusogie E, Clotman F, Vlasuk G, Luther T, Jalbert LR, Albrecht S, Zhong L, Lissens A, Schoonjans L, Moons L, Collen D, Castellino FJ, Carmeliet P: Mice lacking factor VII develop normally but suffer fatal perinatal bleeding. Nature 390:290, 1997[Medline] [Order article via Infotrieve]

5. Bernardi F, Liney DL, Patracchini P, Gemmati D, Legnani C, Arcieri P, Pinotti M, Redaelli R, Ballerini G, Pemberton S, Wacey AI, Mariani G, Tuddenham GD, Marchetti G: Molecular defect in CRM+ factor VII deficiencies: Modelling of missense mutations in the catalytic domain of FVII. Br J Haematol 86:610, 1994[Medline] [Order article via Infotrieve]

6. Bernardi F, Castaman G, Redaelli R, Pinotti M, Lunghi B, Rodeghiero F, Marchetti G: Topologically equivalent mutations causing dysfunctional coagulation factor VII (294Alaright-arrowVal) and X (334Serright-arrowPro). Hum Mol Genet 3:1175, 1994[Free Full Text]

7. Bernardi F, Castaman G, Pinotti M, Ferraesi P, Di Iasio MG, Lunghi B, Rodighiero F, Marchetti G: Mutation pattern in clinically asymptomatic coagulation factor VII deficiency. Hum Mutat 8:108, 1996[Medline] [Order article via Infotrieve]

8. Arbini AA, Mannucci PM, Bauer KA: A Thr359Met mutation in factor VII of a patient with hereditary deficiency causes defective secretion of the molecule. Blood 87:5085, 1996[Abstract/Free Full Text]

9. Arbini AA, Pollak ES, Bayleran JK, High KA, Bauer KA: Severe factor VII deficiency due to a mutation disrupting a hepatocyte nuclear factor 4 binding site in the factor VII promoter. Blood 89:176, 1997[Abstract/Free Full Text]

10. Chaing S, Clarke B, Sridhara S, Chu K, Friedman P, VanDusen W, Roberts HR, Blaichman MB, Monroe DM, High KA: Severe factor VII deficiency caused by mutations abolishing the cleavage site for activation and altering binding to tissue factor. Blood 83:3524, 1994[Abstract/Free Full Text]

11. Bharadwaj D, Iino M, Kontoyianni M, Smith KJ, Foster DC, Kisiel W: Factor VII Central. J Biol Chem 271:30685, 1996[Abstract/Free Full Text]

12. Ohiwa M, Hayashi T, Wada H, Minamikawa K, Shirakawa S, Suzuki K: Factor VII Mie: Homozygous asymptomatic type I deficiency caused by an amino acid substitution of His (CAC) for Arg (247)(CGC) in the catalytic domain. Thromb Haemost 71:773, 1994[Medline] [Order article via Infotrieve]

13. Tamary H, Fromovich Y, Shalmon L, Reich Z, Dym O, Lanir N, Brenner B, Paz M, Luder AS, Blau O, Korostishevsky M, Zaizov R, Seligsohn U: Ala244Val is a common, probably ancient mutation causing factor VII deficiency in Moroccan and Iranian Jews. Thromb Haemost 76:283, 1996[Medline] [Order article via Infotrieve]

14. Furie B, Furie B: Molecular and cellular biology of blood coagulation. N Engl J Med 326:800, 1992[Medline] [Order article via Infotrieve]

15. Pollak ES, Hung HL, Godin W, Overton GC, High KA: Functional characterization of the human factor VII 5' flanking region. J Biol Chem 271:1738, 1996[Abstract/Free Full Text]

16. O'Hara PJ, Grant FJ, Haldeman BA, Gray CL, Insley MY, Hagen FS, Murray MJ: Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation. Proc Natl Acad Sci USA 84:5158, 1987[Abstract/Free Full Text]

17. O'Hara PJ, Grant FJ: The human factor VII gene is polymorphic due to variation in repeat copy number in a minisatellite. Gene 66:147, 1988[Medline] [Order article via Infotrieve]

18. Marchetti G, Patracchini P, Gemmati D, DeRosa V, Pinotti M, Rodorigo G, Casonato A, Girolami A, Bernardi F: Detection of two missense mutations and characterization of a repeat polymorphism in the factor VII gene (F7). Hum Genet 89:497, 1992[Medline] [Order article via Infotrieve]

19. Marchetti G, Gemmati D, Patracchini P, Pinotti M, Bernardi F: PCR detection of a repeat polymorphism within the F7 gene. Nucleic Acids Res 19:4570, 1991[Free Full Text]

20. Bernardi F, Patracchini P, Gemmati D, Ferrati M, Arcieri P, Papacchini M, Redaelli R, Baudo F, Mariani G, Marchetti G: Molecular analysis of factor VII deficiency in Italy: A frequent mutation (FVII Lazio) in a repeated intronic region. Hum Genet 92:446, 1993[Medline] [Order article via Infotrieve]

21. Krawczak M, Cooper DN: Gene deletions causing human genetic disease: Mechanisms of mutagenesis and the role of the local DNA sequence environment. Hum Genet 86:425, 1991[Medline] [Order article via Infotrieve]

22. Hagen FS, Gray CL, O'Hara P, Grant FJ, Saari GC, Woobury RG, Hart CE, Insley M, Kisiel W, Kurachi K, Davie EW: Characterization of a cDNA coding for human factor VII. Proc Natl Acad Sci USA 83:2412, 1986[Abstract/Free Full Text]

23. Katsumi A, Senda T, Yamashita Y, Yamazaki T, Hamaguchi M, Kojima T, Kobayashi S, Saito H: Protein C Nagoya, an elongated mutant of protein C, is retained within the endoplasmic reticulum and is associated with GRP78 and GRP94. Blood 87:4164, 1996[Abstract/Free Full Text]

24. Shapiro MB, Senapathy P: RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155, 1987[Abstract/Free Full Text]

25. Green F, Kelleher C, Wilkes H, Temple A, Meade TW, Humphries S: A common genetic polymorphism associated with lower coagulation factor VII levels in healthy individuals. Arterioscler Thromb 11:540, 1991[Abstract/Free Full Text]

26. Bernardi F, Marchetti G, Pinotti M, Arcieri P, Baroncini C, Papacchini M, Zepponi E, Ursicino N, Chiarotti F, Mariani G: Factor VII gene polymorphisms contribute about one third of the factor VII level variation in plasma. Arterioscler Thromb Vasc Biol 16:72, 1996

27. Saad S, Rowley G, Tagliavacca L, Green PM, Giannelli G, UK Haemophilia Centres: First report on UK database of Haemophilia B mutations and pedigrees. Thromb Haemost 71:563, 1994[Medline] [Order article via Infotrieve]

28. Millar DS, Cooper DN, Kakkar VV, Schwartz M, Scheibel E: Prenatal exclusion of severe factor VII deficiency by DNA sequencing. Lancet 339:1359, 1992[Medline] [Order article via Infotrieve]

29. Banner DW, D'Arcy A, Chene C, Winkler FK, Guha A, Konosberg WH, Nemerson Y, Kirchhofer D: The crystal structure of the complex of blood coagulation factor VIIa with soluble tissue factor. Nature 380:41, 1996[Medline] [Order article via Infotrieve]

30. Peitsch MC: ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochem Soc Trans 24:274, 1996[Medline] [Order article via Infotrieve]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0013$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
M. Pinotti, L. Rizzotto, D. Balestra, M. A. Lewandowska, N. Cavallari, G. Marchetti, F. Bernardi, and F. Pagani
U1-snRNA-mediated rescue of mRNA processing in severe factor VII deficiency
Blood, March 1, 2008; 111(5): 2681 - 2684.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Castoldi, J. W. P. Govers-Riemslag, M. Pinotti, D. Bindini, G. Tans, M. Berrettini, M. G. Mazzucconi, F. Bernardi, and J. Rosing
Coinheritance of Factor V (FV) Leiden enhances thrombin formation and is associated with a mild bleeding phenotype in patients homozygous for the FVII 9726+5G>A (FVII Lazio) mutation
Blood, December 1, 2003; 102(12): 4014 - 4020.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X. Roca, R. Sachidanandam, and A. R. Krainer
Intrinsic differences between authentic and cryptic 5' splice sites
Nucleic Acids Res., November 1, 2003; 31(21): 6321 - 6333.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Borensztajn, M.-L. Sobrier, A.-M. Fischer, O. Chafa, S. Amselem, and J. Tapon-Bretaudiere
Factor VII gene intronic mutation in a lethal factor VII deficiency: effects on splice-site selection
Blood, July 15, 2003; 102(2): 561 - 563.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. I. Rees, T. M. Lewis, J. B. J. Kwok, G. R. Mortier, P. Govaert, R. G. Snell, P. R. Schofield, and M. J. Owen
Hyperekplexia associated with compound heterozygote mutations in the {beta}-subunit of the human inhibitory glycine receptor (GLRB)
Hum. Mol. Genet., April 1, 2002; 11(7): 853 - 860.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Pinotti, D. Etro, D. Bindini, M. L. Papa, G. Rodorigo, A. Rocino, G. Mariani, N. Ciavarella, and F. Bernardi
Residual factor VII activity and different hemorrhagic phenotypes in CRM+ factor VII deficiencies (Gly331Ser and Gly283Ser)
Blood, February 15, 2002; 99(4): 1495 - 1497.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Pinotti, R. Toso, D. Girelli, D. Bindini, P. Ferraresi, M. L. Papa, R. Corrocher, G. Marchetti, and F. Bernardi
Modulation of factor VII levels by intron 7 polymorphisms: population and in vitro studies
Blood, June 1, 2000; 95(11): 3423 - 3428.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pinotti, M.
Right arrow Articles by Bernardi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pinotti, M.
Right arrow Articles by Bernardi, F.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020