|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 5 (September 1), 1998:
pp. 1713-1720
Retinoic Acid Inhibits CD40 + Interleukin-4-Mediated IgE
Production In Vitro
By
M. Worm,
J.M. Krah,
R.A. Manz, and
B.M. Henz
From the Department of Dermatology, Charité-Virchow Klinikum,
Humboldt Universität and Deutsches Rheuma-Forschungszentrum,
Berlin, Germany.
 |
ABSTRACT |
To elucidate the role of retinoic acid (RA) in anti-CD40 + interleukin-4 (IL-4)-mediated B-cell activation, the effect of 10 12 to 10 6 mol/L RA was studied in
anti-CD40 (1 µg/mL) + IL-4 (5 ng/mL)-mediated proliferation and Ig
synthesis by human peripheral blood mononuclear cells (PBMC) and B
cells in healthy donors. Anti-CD40 + IL-4-mediated proliferation of
PBMC and B cells was inhibited by RA in a dose-dependent manner, with
maximal inhibition of 62% ± 5% in PBMC and 55% ± 4.4% in B
cells by all-trans RA, and 58% ± 6.7% and 51% ± 4.7%, respectively by 13-cis RA. IgE synthesis was even more markedly inhibited by RA starting at concentrations of >10 14
mol/L for B cells and >10 10 mol/L for PBMC. Maximal
inhibition of IgE production for B cells was at 10 8
mol/L for all-trans RA (94% ± 1.8%) and 96% ± 3.2% for
13-cis RA. Low concentrations of RA inhibiting IgE synthesis
(10 10 mol/L) affected neither B-cell proliferation nor
the production of IgA, IgG, and IgM. Elucidation of the mechanism
involved in this inhibition of IgE production shows that epsilon
germline transcription is decreased by RA, whereas production of
interferon- (IFN- ) was not enhanced in the presence
of RA. To differentiate whether the RA effect was mediated by RA
receptors , , and , the expression of the retinoic acid
receptors (RAR) was examined by reverse transcriptase-polymerase chain
reaction (RT-PCR). The data show that unstimulated human peripheral B
cells express mRNA of the RA receptor , , and . Using
retinoids with different receptor binding specificity (CD336, CD437,
CD2019, CD367), dose-dependent inhibition of IgE synthesis was shown by
all four derivates, but was most marked by an RA binding the
receptor with high specificity. Taken together, this study shows that
RA inhibits IgE production of anti-CD40 + IL-4-stimulated B cells in
vitro.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
RETINOIDS ARE DERIVED from vitamin A and
are widely used in the treatment of dermatologic disorders such as acne
and psoriasis.1 Their biologic effects include the
regulation of growth and differentiation in a number of cell types
primarily of epithelial bone marrow origin. Recently, retinol and
retinoic acid (RA) have also been shown to inhibit proliferation of
isolated mature and precursor B cells from normal donors after
mitogenic stimulation.2 The role of RA on CD40 + interleukin-4 (IL-4)-mediated IgE synthesis has, however, not yet been
studied.
Stimulation of human B cells by anti-CD40 + IL-4 results in
proliferation and IgE production.3,4 Class switching
factors such as IL-4 induce expression of the germline transcript of
the C gene, which maintains an open chromatin structure in this
region. The activation of CD40 results in the induction of the class
switching machinery for S-S recombination.5 Interaction
between CD40 on B cells and CD40L on T cells is critical for
T-cell-dependent isotype switching, because it has been shown that
disruption of the CD40L gene causes X-chromosome-linked immune
deficiency, characterized by decreased serum IgA, IgG and IgE
levels.6 Anti-CD40 monoclonal antibody (MoAb) mimic the
effect of CD40L and anti-CD40 MoAb plus IL-4 induce IgE production in
vitro. CD40 + IL-4-mediated IgE production can be inhibited by various
cytokines including interferon- (IFN- ), IL-8, IL-10, and IL-12
and by various other factors such as hormones.7-9
In search of molecules that might induce a therapeutic downregulation
of IgE synthesis, which is considered to be a basic effect in atopic
diseases, we have chosen here to study the effects of RA on CD40 + IL-4-mediated B-cell activation including IgE production. The present
data show for the first time that RA induces a dose-dependent,
selective inhibition of CD40 + IL-4-mediated proliferation and even
more reduction of IgE production by human peripheral B lymphocytes,
with the latter acting at the level of epsilon germline transcription
most likely via retinoic acid receptor (RAR) .
 |
MATERIALS AND METHODS |
Cells.
Peripheral blood mononuclear cells (PBMC) were isolated from buffy
coats of nonallergic healthy donors by ficoll hypaque separation (1,400 rpm, 30 minutes, room temperature). B cells were purified using
anti-CD19-coupled magnetic beads (Dianova, Hamburg, Germany). Briefly,
cells and antibody-conjugated beads (1:5 ratio) were incubated for 1 hour on ice, then CD19-positive B cells were selected by magnetic
separation and after several washings the cells were resuspended in
medium and cultured overnight at 37°C. The next morning, cells were
separated from the beads by several washings and counted. The purified
cell population contained more than 95% B cells, as assessed by
immunofluorescence with anti-CD20 antibody. In previous studies, this
procedure has been shown not to activate B cells.10
CD19/IgM double-positive PBMC were sorted according to the instructions
of the manufacturer (Miltenyi Biotec, Bergisch-Gladbach, Germany) by
magnetic cell sorting (MACS) with the CD19 Multi Sort Kit. Briefly,
PBMC were enriched using anti-CD19 magnetic beads in combination with a
VS separation column. After release of the magnetic label,
CD19 positive cells were sorted according to the expression of IgM (VS
separation column). All reagents were obtained from Miltenyi Biotec.
For fluorescent staining 105 cells were suspended in 90 µL staining buffer (2% bovine serum albumin [BSA] in
phosphate-buffered saline [PBS], pH 7.4, 0.1% sodium azide) with 10 µL of the appropiate antibody and incubated for 30 minutes on ice.
After several washings, cells were fixed in 2% paraformaldehyde, when
the biotinylated MoAb was used, cells were incubated for another 30 minutes with streptavidin-conjugated phycoerythrin (PE) before
fixation.
Cells (105 cells/well) were cultured for 3 days for
proliferation and 10 days for IgE assays. The culture medium RPMI 1640 was supplemented with L-glutamine (2 mmol/L), penicillin (100 U/mL),
streptomycin (100 mg/mL) and 10% heat inactivated fetal calf serum
(all from Biochrom KG, Berlin, Germany). All cell cultures were
performed at 37°C in humidified air and 5% CO2
atmosphere.
Reagents.
IL-4 was purchased from Pharmingen (Hamburg, Germany), purified
anti-CD40 MoAb (clone 626.1) was a kind gift from R. Geha (Children's
Hospital, Boston, MA), and RA (all-trans and 13-cis) were from Sigma (St Louis, MO). Stock solutions (10 3
mol/L) of retinoids were prepared in dimethyl sulfoxide (DMSO). Receptor-specific retinoids were kindly provided by U. Reichert (CIRD
Galderma, France). The conjugated anti-CD19-PE, anti-IgM-fluorescein isothiocyanate (FITC), the conjugated isotype controls, and
streptavidin-PE were from Pharmingen (Hamburg, Germany).
Proliferation assay.
For proliferation assay, radioactive thymidine (0.5 µCi per well) was
added during the last 16 hours of culture. Cells were harvested on
filter paper and thymidine incorporation was measured using liquid
scintillation spectroscopy. All experiments were performed in
triplicate and data expressed as arithmetric means.
Ig production.
Cells were cultured for 10 days, and Igs were measured in the
supernatants of stimulated cells by enzyme-linked immunosorbent assay
(ELISA). The MoAb for IgE detection (clones HP 6061 and HP 6029) were
kindly provided by Bob Hamilton (Asthma and Allergy Center, Johns
Hopkins University, Baltimore, MD). The antibodies for IgA, IgG, and
IgM ELISA (anti-IgA, anti-IgG, and anti-IgM) were purchased from
Dianova (Hamburg, Germany).
Briefly, for the Ig assays, immunoplates (Nunc, Wiesbaden, Germany)
were coated overnight at 4°C with anti-human Ig-Fc
antibodies diluted in 0.1 mol/L bicarbonate buffer. The wells were then
blocked for 1 hour with 2% BSA-Tris buffer. After several washings,
supernatants and internal standards were incubated in duplicates
overnight. The next morning, after several washes, the second alkaline
phosphatase (AP)-conjugated anti-Ig (A; G; M) antibody was
added. Because the second anti-IgE MoAb was biotinylated, cells were
incubated for another hour with alkaline phosphatase-conjugated
streptavidin. After the final reaction with phosphatase substrate
(Sigma, Dreieich, Germany), plates were read in a microplate ELISA
reader at 410 nm, and the amount of Ig was calculated according to the
standard curve. The variations of readings in duplicate cultures never exceeded 15%.
Polymerase chain reaction (PCR).
Semiquantitative reverse transcriptase (RT)-PCR was used for detection
of RAR- - - ) and epsilon germline transcription. Total cellular
RNA was extracted from purified B cells with an RNA preparation kit
(Quiagen, Hilden, Germany). The mRNA was quantified and
reverse-transcribed into cDNA by RT (Boehringer, Mannheim, Germany).
PCR amplification was performed with RAR-specific11 and
epsilon germline specific primers.12 Primers used for
detection of RAR were tgg gtg gac tct ccc cgc ca for sense and ccc
acc tcc ggc gtc agc gtg for antisense resulting in a 438-bp fragment,
for RAR beta 5 cac tgg ctt gac cat cgc aga cc and 3 gag
agg tgg cat tga tcc agg resulting in an 435-bp fragment and for RAR
gamma sense ggc ctg ggc cag cct gac ctc and antisense cag ccc cag atc
cag ctg cac g resulting in a 515-bp fragment. PCR was performed using
the following program: 30 cycles (1 minute at each 94°C, 65°C,
and 74°C).
Epsilon
germline specific primers were sense (GACGGGCCACACCAT
CCACAGGCACCAAATGGACGAC) of the I epsilon exon and antisense (CAGGACGACTGTAAGATCTTCACG) of the C 2 exon resulting in a 409-bp band. As a control, a 250-bp band corresponding to
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts was
amplified using GATGACATCAAGAAGGTGGTG for sense and
GCTGTAGCCAAATTCGTTGTC for antisense. PCR was performed with a Perkin
Elmer (Branchburg, NJ) thermocycler using the following program: 35 cycles (1 minute at each 94°C, 65°C, and 74°C)
for epsilon germline transcripts and for 25 cycles (1 minute each at
94°C, 57°C, and 74°C) for the GAPDH control.
 |
RESULTS |
RA inhibits CD40 + IL-4-mediated cell proliferation.
To study the role of RA in CD40 + IL-4-mediated cell activation, we
used different concentrations of all-trans RA and its 13-cis isomer (10 12 to
10 6 mol/L) in the presence of anti-CD40 + IL-4. A
dose-dependent inhibition with both RA derivates of CD40 + IL-4-mediated PBMC proliferation was observed. For quantification of
the antiproliferative effect on CD40 + IL-4-stimulated cells, mean
values of stimulated cells were set at 100%. A 62% ± 5.2%
maximal inhibition of PBMC proliferation was observed at
10 6 mol/L by all trans retinoic acid and a 58% ± 6.3% maximal inhibition by 10-6 mol/L 13-cis
retinoic acid (Fig 1A).

View larger version (52K):
[in this window]
[in a new window]

View larger version (54K):
[in this window]
[in a new window]
| Fig 1.
Inhibition of CD40 + IL-4-mediated cell proliferation
by all-trans and 13-cis RA. Proliferation of PBMC (A)
and purified peripheral B cells (B) induced by anti-CD40 + IL-4 (1 µg/mL and 5 ng/mL) and anti-CD40 + IL-4 + all-trans RA or
13-cis RA (10 12 to 10 6 mol/L).
Cells (106/mL) were incubated for 3 days, and thymidine
(0.5 µCi) was added for the last 16 hours of culture to each well.
Each experiment was done in triplicate, the cpm values of unstimulated
cells were <500 cpm and ranged after anti-CD40 + IL-4 stimulation
from 20,000 to 30,000 cpm for PBMC and 10,000 to 20,000 for the B
cells. Anti-CD40 + IL-4 stimulation was set at 100% and mean values
of four experiments + standard error of mean (SEM) are
shown.
|
|
Because the inhibition of CD40 + IL-4-mediated cell proliferation
might be mediated either through direct effects on B cells or through
indirect effects, eg, via increased cytokine production by cells other
than B cells, we examined next the effects of all-trans and
13-cis RA on CD40 + IL-4-mediated B-cell proliferation. The pattern of inhibition with B cells was comparable to that observed with
PBMC, with a 55% ± 4.4% maximal inhibition of CD40 + IL-4-mediated B-cell proliferation for all-trans RA and 51 ± 4.7 for 13-cis RA, both at 10 6 mol/L
(Fig 1B). Incubation of the cells with RA alone caused, on the other
hand, no proliferative effects on PBMC or B cells (data not shown).
RA inhibits CD40 + IL-4-mediated IgE production.
Because stimulation of B cells with anti-CD40 + IL-4 results not only
in proliferation, but also in IgE production, we examined the effects
of RA on CD40 + IL-4-mediated IgE-synthesis.
Figure 2 shows that in the presence of
all-trans and 13-cis RA, CD40 + IL-4-mediated IgE
production was inhibited in a dose-dependent manner in both PBMC and
CD19+ B cells. In PBMC, maximal inhibition of IgE was 81% ± 8% for all-trans RA and 82% ± 11.4% for
13-cis RA, both at 10-6 mol/L (Fig 2A), and with B
cells, inhibition of IgE production even reached control levels of 94% ± 1.8% and 96% ± 3.2%, respectively, at
10 8 mol/L (Fig 2B). Interestingly, inhibition of IgE
production in the B cells was observed already at very low
concentrations of RA (10 14 mol/L), indicating a
specific effect on IgE production rather than on inhibition of cell
proliferation. To provide further evidence that RA is not just
affecting the synthesis of IgE from previously switched B cells, we
used double separated CD19-IgM+ cells
(Fig 3). The data show
(Table 1) that inhibition of IgE synthesis
after anti-CD40 + IL-4 stimulation by all-trans and 13-cis RA was also observed in double-purified
CD19-IgM+ B cells.

View larger version (41K):
[in this window]
[in a new window]

View larger version (40K):
[in this window]
[in a new window]
| Fig 2.
Retinoids inhibit the IgE-production of anti-CD40 + IL-4-stimulated human PBMC (A) and B cells (B) from normal donors.
PBMC and B cells (106/mL) were incubated for 10 days in the
presence of CD40 + IL-4 (1 µg/mL and 5 ng/mL) alone or in
combination with all-trans RA (10 10 to
10 6 mol/L for PBMC and 10 14 to
10 8 mol/L for B cells) or 13-cis RA
(10 12 to 10 6 mol/L for PBMC and
10 15 to 10 8 mol/L for B cells). IgE
(pg/mL) was detected in the supernatants by ELISA, IgE in unstimulated
PBMC and B cells was below 200 pg/mL and ranged after anti-CD40 + IL-4 stimulation from 2,204 to 12,846 pg/mL in PBMC and from 2,250 to
2,951 pg/mL in B cells. Values are expressed as percent of anti-CD40 + IL-4 stimulation and mean values of four experiments + SEM are shown.
|
|

View larger version (30K):
[in this window]
[in a new window]
| Fig 3.
Flow cytometric analysis of purified peripheral B cells
from a nonallergic donor. (A) 105 B cells stained with
anti-CD19-PE (light black line) and its isotype control-PE (bold black
line) after anti-CD19 separation. The percentage of purified
CD19+ cells was 96.5%. (B) CD19+ cells
after anti-IgM-selection staining with fluorescein conjugated anti-IgM
(light black line) and its fluorescein-conjugated isotype control (bold
black line). The percentage of purified IgM+ cells was
86%. (C) Shows staining of CD19 IgM-selected B cells with a
biotinylated anti-IgE (2 µg/mL, HP6029) and its appropiate
biotinylated isotype control in the same concentration by using
streptavidin-conjugated PE as a secondary reagent. IgE+
cells were not detectable. As a positive control, cells from an
allergic donor were stained (data not shown).
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Effects of all-trans and 13-cis Retinoic
Acid on IgA, IgG, and IgE Production in Anti-CD40 + IL-4-Stimulated
IgM+ Peripheral B Cells
|
|
RA does not affect IgA and IgG production.
To determine whether the inhibition of IgE production was accompanied
by inhibition of the production of other Igs, we measured the
production of IgA, IgG, and IgM in the supernatants of CD40 + IL-4-stimulated CD19+ cells. As shown in
Fig 4, all-trans and 13-cis
RA had hardly any effect on IgA or IgG production. RA concentrations
with greater than 50% inhibition of IgE production failed to affect
IgA or IgG production indicating a more selective effect of RA on IgE production. This finding was further confirmed by using
CD19-IgM+ B cells in which induction of IgA and IgG
production after stimulation with anti-CD40 + IL-4 was detected and,
which was not inhibitd in the presence of all-trans or
13-cis RA (Table 1). Because stimulation of B cells with
anti-CD40 + IL-4 results not only in IgE, but also IgM production, we
also examined the effects of all-trans and 13-cis RA on
anti-CD40 + IL-4-induced IgM production. All-trans RA caused a
modest inhibition of IgM production in CD40 + IL-4-stimulated B cells,
whereas 13-cis RA resulted in a more marked dose-dependent
inhibition of IgM production (Fig 4), but only at higher RA
concentrations (10 9 and 10 8).
However, the maximal inhibition of IgM production was significantly lower compared with the inhibition of IgE production.

View larger version (16K):
[in this window]
[in a new window]
| Fig 4.
Effect of all-trans and 13-cis retinoic
acid on Ig production by human B cells. Experiments were performed as
described in Fig 2. Igs (IgA, IgG, and IgM) were detected in the
supernatants by ELISA using the appropriate MoAb. Values are shown as
means percent of CD40 + IL-4 stimulation (n = 3).
|
|
RA inhibits epsilon germline transcription.
Production of epsilon germline transcription is a prerequisite for the
isotype switching to IgE.13 To examine whether RA-mediated inhibition of IgE production occurs directly at this level, we studied
the expression of germline C transcripts semiquantitatively by
RT-PCR. The specificity of the germline transcripts was confirmed by
obtaining PCR products of the expected molecular size, by its expression pattern, and by direct partial sequencing. A representative result of three experiments is shown in Fig
5. As a control, GAPDH expression was assessed for equal amounts of
cDNA. Levels of epsilon germline transcription were increased after
stimulation with anti-CD40 + IL4 for 4 days. In the presence of both RA
derivates (all-trans and 13-cis RA), a dose-dependent
inhibition of epsilon germline transcription was observed (shown for
all-trans-RA in Fig 5). In agreement with the inhibition of IgE
levels at RA concentrations tested (Fig 2), there was a marked
inhibition of epsilon germline transcription at 10 10
mol/L of all-trans RA, as assessed by semiquantitative
evaluation. This indicates that RA inhibits IgE production affecting
epsilon germline transcription in CD40 + IL-4-stimulated B cells.

View larger version (51K):
[in this window]
[in a new window]
| Fig 5.
Retinoic acid downregulates CD40 + IL-4-mediated
epsilon germline transcription. Human peripheral B cells were
stimulated for 4 days in the presence of anti-CD40 + IL-4 (1 µg/mL
and 5 ng/mL), respectively, alone or in combination with
all-trans RA (10 14, 10 12,
10 10 mol/L). Thereafter, mRNA was extracted. C
germline and GAPDH transcripts were assessed by semiquantitative
RT-PCR.
|
|
Inhibition of IgE production is IFN- independent.
To explore possible mechanisms involved in RA-induced inhibition of
epsilon germline transcription and because IFN- is known to inhibit
IgE production,14 we examined next whether the production of this cytokine is increased in the presence of RA. PBMC and B cells
from normal donors were stimulated with anti-CD40 + IL-4 alone or in
the presence of RA. As shown in Table 2,
baseline IFN- production of unstimulated cells is low and highly
variable. In the presence of both RA, the amounts of IFN- were
rather decreased in the supernatants of CD40 + IL-4-stimulated PBMC
and B cells. However, neither all-trans nor 13-cis RA
significantly enhanced the production of IFN- , indicating that
inhibition of IgE synthesis by both RA derivatives involves mechanisms
other than IFN- .
Expression of retinoic acid receptors on human B cells.
The biological effects of RA are exerted through binding the RAR ,
, and . To determine the expression of the different RAR in
unstimulated peripheral B cells, semiquantitative PCR analysis was
performed by using RAR , , and specific primers. Transcripts for the RAR , , and , were detectable in unstimulated
peripheral human B cells by RT-PCR (Fig 6).
As a positive control, primers for RAR , , and were used in a
monocytic cell line (THP-1), which has been shown to express all three
RAR (M. Babina, personal communication, November 1997).

View larger version (90K):
[in this window]
[in a new window]
| Fig 6.
Expression of RAR in peripheral human B cells. Human
peripheral B cells were isolated and mRNA was extracted. RAR-specific
( , , and ) and GADPH transcripts were assessed by
semiquantitative RT-PCR. The DNA ladder is shown in the left lane.
|
|
Effects of receptor-specific retinoids on CD40 + IL-4-mediated
IgE production.
The role of the different RAR during IgE production was determined next
by using derivates of RA with different affinity toward the RAR ,
, and . The molecular weights, their receptor specificity and
their transcriptional activation values after binding the particular
receptor indicating the intracellular activity of the four retinoids
studied are summarized in Table 3. As shown
in Table 4, all compounds were
inhibitory, but those binding RAR with high-affinity did so by
greater than 80% at concentrations of >10 11
mol/L. These findings were further confirmed by the observation that
germline transcription of CD40 + IL-4-stimulated cells was only
inhibited at concentrations above 10 12 mol/L in the
presence of CD336 and CD367, derivates of RA with high affinity toward
the RAR (data not shown). Analysis of IgA, IgG, and IgM production
in the presence of the RAR-specific compounds showed that the
production of these Igs was not altered (Table 1,
Fig 7), confirming the specificity by which
RA inhibits CD40 + IL-4-mediated IgE production.
View this table:
[in this window]
[in a new window]
|
Table 3.
Receptor Specificity, Transcriptional
Activation Activity After Binding a Particular Receptor, and Molecular
Weights of the Retinoids Used
|
|
View this table:
[in this window]
[in a new window]
|
Table 4.
Inhibition of IgE Production by RAR-Specific Retinoids
in Anti-CD40 + IL-4-Stimulated Human Peripheral B Cells
|
|

View larger version (21K):
[in this window]
[in a new window]
| Fig 7.
Effect of different RAR-specific retinoids on Ig
production by human B cells. Experiments were performed as described in
Fig 2. Igs (IgA, IgG, and IgM) were detected in the supernatants by
ELISA using the appropriate MoAb. Values are shown as means percent of
CD40 + IL-4 stimulation (n = 3).
|
|
 |
DISCUSSION |
In the present report, we demonstrate that all-trans and
13-cis RA affects CD40 + IL-4-mediated B-cell activation by
inhibition of B-cell proliferation and IgE synthesis. Using
RAR-specific RA derivates, we elucidated that these effects are
primarily mediated via the nuclear RAR . Because the physiologic
level of all-trans RA in serum is about 10 nmol/L15
and because the inhibition of DNA synthesis elicited by
all-trans-RA at this concentration was 50% in PBMC and 58% in
B cells after CD40 + IL-4 stimulation and because IgE synthesis was
even affected at a concentration of 10 14 mol/L in B
cells and 10 10 mol/L in PBMC, marked inhibition of
B-cell proliferation and of IgE production must be assumed to be
achievable during oral treatment with RA.16
Presumably due to the importance of retinoids in the treatment of
hematologic and dermatologic disorders such as leukemia, acne, or
psoriasis, the focus of past studies has been on the role of retinoids
in the growth and differentiation of myeloid cells and
keratinocytes.17,18 However, vitamin A has been shown to be
a key regulator for cell growth, cytokine production, and differentiation in normal B cells.19,20 The growth
inhibiting effects of retinoids on B lymphoid cells have been noticed
previously using cell lines at different stages of
maturation.2 Despite the dramatic effects of vitamin A
deficiency on the immune system in vivo,21 and the role of
RA on B-cell growth and differentiation in vitro,19,20 no
information about the effects of RA on CD40 + IL-4-mediated isotype
switching and Ig synthesis in human B cells is available.
The majority of in vivo experiments dealing with vitamin A and the
immune system have concluded that vitamin A has a stimulatory role on
cells of the immune system.21 This assumption is based on
deficiency studies in animal models, epidemiologic data from humans, as
well as data on supplementation of retinoids showing reduced infections
in humans. In vitro experiments using isolated lymphocytes have shown
divergent effects. Both stimulatory and inhibitory effects of retinoids
on B lymphocytes have been observed.19,22 However, more
recent studies have clearly shown that RA inhibits mitogenic activation
of human and murine B cells,2 in line with the present
results.
Induction of IgE synthesis requires two signals and has been shown to
be induced by the cytokine IL-4 and engagement of the B-cell antigen
CD40.4 No data about the role of RA in CD40 + IL-4-mediated IgE production are available to date. However, in a
previous study using an in vivo mouse model, an increased IgE response
after ovalbumin (OvA) sensitization has been demonstrated in RA-pretreated mice.23 In contrast to these findings, we
show here that CD40 + IL-4-mediated IgE production is strongly
inhibited by RA in a dose-dependent manner. Inhibition of IgE synthesis occurs at very low concentrations (down to 10 12
mol/L), which are easily achieved in the serum during retinoid treatment. The observation that while, in cultures of purified B cells,
the concentration of RA required for inhibition of IgE synthesis is
substantially lower than for proliferation is not the case in PBMC,
suggests that additional factors, eg, cytokines other than IFN- , may
prevent the RA susceptibility of IgE synthesis.
Inhibition of in vitro IgE production has also been reported with
all-trans RA by Tokuyama et al24 in the murine
system. These investigators used IL-4 + hydrocortisone-stimulated
splenic B cells from mice and detected a dose-dependent inhibition of IgE production in the presence of RA. We show here for the first time
an inhibition of CD40 + IL-4-induced IgE production in human peripheral B cells. Furthermore, we demonstrate inhibition of epsilon
germline transcription by RA suggesting thus a molecular mechanism of
RA dependent inhibition of IgE production. Epsilon germline
transcription is a prerequisite for the induction of IgE isotype
switching, because deletion of the I exon in mice results in
significant impairment of IgE production.25 Therefore, inhibition of epsilon germline transcription by RA may play an important role in the regulation of IgE production after CD40 + IL-4
stimulation in vivo.
That RA is capable of affecting Ig production in mice has been shown in
other studies. The effects of RA on B cells seems to depend on the
model or the type of stimulation used since in lipopolysaccharide
(LPS)-stimulated splenic B cells, enhancement of germline C transcripts was determined, while on the other hand, IL-4-induced I
expression was completely abolished in the presence of
RA.26 Taken together, the currently available data strongly
support the concept that RA is capable of modulating Ig production
significantly even at the level of isotype switching. However, this
does not exclude the possibility that other mechanisms are operative in
addition, possibly via the action of cytokines.
A variety of cytokines including tumor necrosis factor- (TNF- ),
IL-5, IL-6, IL-8, IL-10, IL-12, and transforming growth factor-
(TGF- ) have been shown to modulate IgE production.27 Because IFN- has been shown to inhibit IgE production,28
we studied the production of IFN- in the presence of RA. The lack of
any enhancing effects of RA on the production of IFN- suggests that
inhibition of IgE production is IFN- independent. The observation that IgE synthesis in B cells was more inhibited than in PBMC where
IFN- production is produced by monocytes or TH1 cells also speaks
against a role of IFN- in the in vitro data observed with RA.
Another cytokine that may be involved in the inhibition of IgE-production by RA is TGF- . This cytokine has been shown to be
induced by RA in keratinocytes.29 TGF- is a potent
immunosuppressive cytokine and has also been shown to inhibit IgE and
epsilon germline transcription in vitro.30 Whether TGF-
production is increased in the presence of RA in PBMC or B cells is
currently under investigation. However, a study by Tokuyama et
al31 has shown a TGF- independent modulation of germline
transcription in LPS/IL-4-stimulated mouse B cells. At the molecular
level, retinoids bind to and activate specific nuclear receptors, the
RARs and retinoic X receptors (RXRs). These recognize specific DNA
sequences as homo- or heterodimers, which in turn, bind specific DNA
sequences regulating gene expression.32 Whether RA binding
proteins can directly interact with the epsilon germline promoter
region is an interesting possibility that will have to be explored in
future studies.
 |
FOOTNOTES |
Submitted December 3, 1997;
accepted May 1, 1998.
Supported by grants from the German Research Foundation (DFG, Wo
541/2-1) and Hofmann La Roche, Basel, Switzerland.
Address reprint requests to M. Worm, MD,
Charité-Virchow Klinikum, Hautklinik, Schumannstr. 20-21, 10117 Berlin, Germany; e-mail: mworm{at}rz.charite.hu-berlin.de.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank R. Geha (Department of Immunology, Children's Hospital,
Boston, MA) for providing the purified anti-CD40 MoAb and Dr R. Hamillton (Asthma and Allergy Center, Baltimore, MD) for providing the
anti-IgE MoAb, Dr M. Babina for help with the RAR PCR, and K. Ebermayer
for technical assistance. We also thank Prof A. Radbruch (Deutsches
Rheuma-Forschungszentrum, Berlin, Germany) for cooperation and support
in IgM- B cell purification.
 |
REFERENCES |
1.
Goodman DS:
Vitamin A and retinoids in health and disease.
N Engl J Med
310:1023,
1984[Medline]
[Order article via Infotrieve]
2.
Fahlman C,
Jacobsen SE,
Smeland EB,
Lomo J,
Naess CE,
Funderud S,
Blomhoff HK:
All-trans and 9-cis- retinoic acid inhibit growth of normal human and murine B cell precursors.
J Immunol
155:58,
1995[Abstract]
3.
Armitage RJ,
Macduff BM,
Spriggs MK,
Fanslow WC:
Human B cell proliferation and Ig secretion induced by recombinant CD40 ligand are modulated by soluble cytokines.
J Immunol
150:3671,
1993[Abstract]
4.
Jabara HH,
Fu SM,
Geha RS,
Vercelli D:
CD 40 and IgE: Synergism between anti-CD40 monoclonal antibody and interleukin 4 in the induction of IgE synthesis by highly purified B-cells.
J Exp Med
172:1861,
1990[Abstract/Free Full Text]
5.
Gauchat JF,
Lebman D,
Coffman R,
Gascan H,
deVries JE:
Structure and expression of germline transcripts in human B cells induced by interleukin 4 to switch to IgE production.
J Exp Med
172:463,
1990[Abstract/Free Full Text]
6.
Ramesh N,
Morio T,
Fuleihan R,
Worm M,
Horner A,
Tsitsikov E,
Castigli E,
Geha RS:
CD40-CD40 ligand (CD40L) interactions and X-linked hyper-IgM syndrome (HIGMX-1).
Clin Immunol Immunopathol
76:S208,
1995[Medline]
[Order article via Infotrieve]
7.
Kimata H,
Yoshida A,
Ishioka C,
Lindley I,
Mikawa H:
Interleukin-8 (IL-8) selectively inhibits immunoglobulin E production induced by IL-4 in human B cells.
J Exp Med
176:1227,
1992[Abstract/Free Full Text]
8.
Kiniwa M,
Gately M,
Gubler U,
Chizzonite R,
Fargeas C,
Delespesse G:
Recombinant interleukin-12 suppresses the of immunoglobulin E by interleukin-4 stimulated human lymphocytes.
J Clin Invest
90:262,
1992
9.
Vercelli D,
Jabara H,
Arai K:
Endogenous IL-6 plays an obligatory role in IL-4 induced human IgE synthesis.
Eur J Immunol
19:1419,
1989[Medline]
[Order article via Infotrieve]
10.
Funderud S,
Erikstein B,
Asheim HC,
Nustad K,
Stokke T,
Blomhoff HK,
Holte H,
Smeland EB:
Functional properties of CD19+ B lymphocytes positively selected from buffy coats by immunomagnetic separation.
Eur J Immunol
20:201,
1990[Medline]
[Order article via Infotrieve]
11.
Rosewics S,
Stier U,
Brembek F,
Kaiser A,
Papadimitriou CA,
Berdel WE,
Wiedenmann B,
Rieken EO:
Retinoids: Effects on growth, and nuclear receptor expression in human pancreatic carcinoma cell lines.
Gastroenterology
109:1646,
1995[Medline]
[Order article via Infotrieve]
12.
Thienes CP,
De-Monte L,
Monticelli S,
Busslinger M,
Gould HJ,
Vercelli D:
The transcription factor B cell-specific activator protein (BSAP) enhances both IL-4 and CD40 mediated activation of the human epsilon germline promotor.
J Immunol
158:5874,
1997[Abstract]
13.
Vercelli D,
Geha RS:
Regulation of isotype switching.
Curr Opin Immunol
4:794,
1992[Medline]
[Order article via Infotrieve]
14.
Pene J,
Rousset F,
Briere F,
Chretien I,
Bonnefoy J-Y,
Spits H,
Yokota T,
Arai N,
Arai K-I,
Banchereau J,
deVries JE:
IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons and and prostaglandin E2.
Proc Natl Acad Sci USA
85:6880,
1988[Abstract/Free Full Text]
15.
De Ruyter M,
Lambert WE,
DeLeenheer AP:
Retinoic acid: As endogenous compound of human blood. Unequivocal demonstration of endogenous retinoic acid in normal physiological conditions.
Anal Biochem
98:402,
1979[Medline]
[Order article via Infotrieve]
16.
Maier H,
Hönigsmann H:
Concentration of etrenitate in plasma and subcutaneous fat after long term acitretin.
Lancet
348:1107,
1996[Medline]
[Order article via Infotrieve]
17.
Jacobsen SEW,
Fahlman C,
Blomhoff HK,
Okkenhaug C,
Rusten LS,
Smeland EB:
All-trans and 9-cis retinoic acid: Potent direct inhibitors of primitive murine hematopoetic progenitors in vitro.
J Exp Med
179:1665,
1994[Abstract/Free Full Text]
18.
Smeland EB,
Rusten L,
Jacobsen SEW,
Skrede B,
Blomhoff R,
Wang MY,
Funderud S,
Kvalheim G,
Blomhoff HK:
All-trans retinoic acid directly inhibits G-CSF induced proliferation of CD34+ human hematopoietic progenitor cells.
Blood
84:2490,
1994
19.
Blomhoff HK,
Smeland EB,
Erikstein B,
Rasmussen AM,
Skrede B,
Skjonsberg C,
Blomhoff R:
Vitamin A is a key regulator for cell growth, cytokine production and differentiation in normal B cells.
J Biol Chem
267:23988,
1992[Abstract/Free Full Text]
20.
Buck J,
Ritter G,
Dannecker L,
Katta V,
Cohen SL,
Chait BT,
Hämmerling U:
Retinol is essential for growth of activated human B cells.
J Exp Med
171:1613,
1990[Abstract/Free Full Text]
21. Blomhoff HK, Smeland EB: Role of retinoids in normal
hematopoiesis and the immune system. Vitamin A in health and disease
1:451, 1994
22.
Bosma M,
Sidell N:
Retinoic acid inhibits Ca2+ currents and cell proliferation in a B lymphocyte cell line.
J Cell Physiol
135:317,
1988[Medline]
[Order article via Infotrieve]
23.
Barnett JB:
Immunopotentation of the IgE antibody response by 13-cis retinoic acid.
Int Arch Allergy Immunol
67:287,
1982
24.
Tokuyama Y,
Tokuyama H:
Retinoids as Ig isotype switch modulators. The role of retinoids in directing isotype switching to IgA and IgG1 (IgE) in association with IL-4 and IL-5.
Cell Immunol
170:230,
1996[Medline]
[Order article via Infotrieve]
25.
Bottaro A,
Lansford R,
Xu L,
Zhang J,
Rothman P,
Alt FW:
S region transcription per se promotes basal IgE class switching recombination but additional factors regulate the efficiancy of the process.
EMBO J
13:665,
1994[Medline]
[Order article via Infotrieve]
26.
Tokuyama H,
Tokuyama Y,
Nakanishi K:
Retinoids inhibit IL-4-dependent IgE and IgG1 production by LPS-stimulated murine splenic B cells.
Cell Immunol
162:153,
1995[Medline]
[Order article via Infotrieve]
27.
Gauchat J-F,
Aversa G,
Gascan H,
deVries JE:
Modulation of IL-4-induced germline RNA synthesis in human B cells by tumor necrosis factor- , anti-CD40 monoclonal antibodies or transforming growth factor- correlates with levels of IgE production.
Int Immunol
4:397,
1991[Abstract/Free Full Text]
28.
Xu L,
Rothmann P:
IFN represses germline transcription and subsequently downregulates switch recombination to .
Int Immunol
6:515,
1994[Abstract/Free Full Text]
29.
Glick AB,
Flanders KC,
Danielpour D,
Yuspa SH,
Sporn MB:
Retinoic acid induces transforming growth factor 2 in cultured keratinocytes and mouse epidermis.
Cell Reg
1:87,
1989[Medline]
[Order article via Infotrieve]
30.
Wu CY,
Brinkmann V,
Cox D:
Modulation of human IgE synthesis by transforming growth factor .
Clin Immunol Immunopathol
62:277,
1992[Medline]
[Order article via Infotrieve]
31.
Tokuyama H,
Tokuyama Y:
Retinoic acid induces the expression of germ-line C alpha transcript mainly by a TGF independent mechanism.
Cell Immunol
176:14,
1997[Medline]
[Order article via Infotrieve]
32.
Kastner PM,
Mark M,
Chambon P:
Nonsteroid nuclear receptors: What are genetic studies telling us about their role in real life.
Cell
83:859,
1995[Medline]
[Order article via Infotrieve]
33.
Bernard B,
Bernadon J,
Delescluse C,
Martin B,
Lenoir M,
Maignan J,
Charpentier B,
Pilgrim W,
Reichert U,
Shroot B:
Identification of synthetic retinoids with selectivity for human 18 nuclear retinoic acid receptor gamma.
Biochem Biophys Res Commun
186:977,
1992[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Heine, A. Dahten, K. Hilt, D. Ernst, M. Milovanovic, B. Hartmann, and M. Worm
Liver X Receptors Control IgE Expression in B Cells
J. Immunol.,
May 1, 2009;
182(9):
5276 - 5282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ertesvag, H.-C. Aasheim, S. Naderi, and H. K. Blomhoff
Vitamin A potentiates CpG-mediated memory B-cell proliferation and differentiation: involvement of early activation of p38MAPK
Blood,
May 1, 2007;
109(9):
3865 - 3872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dzhagalov, P. Chambon, and Y.-W. He
Regulation of CD8+ T Lymphocyte Effector Function and Macrophage Inflammatory Cytokine Production by Retinoic Acid Receptor {gamma}
J. Immunol.,
February 15, 2007;
178(4):
2113 - 2121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. O'Nions and M. J. Allday
Proliferation and differentiation in isogenic populations of peripheral B cells activated by Epstein-Barr virus or T cell-derived mitogens
J. Gen. Virol.,
April 1, 2004;
85(4):
881 - 895.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Junttila, R. P. Bourette, L. R. Rohrschneider, and O. Silvennoinen
M-CSF induced differentiation of myeloid precursor cells involves activation of PKC-{delta} and expression of Pkare
J. Leukoc. Biol.,
February 1, 2003;
73(2):
281 - 288.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Litterst and E. Pfitzner
An LXXLL Motif in the Transactivation Domain of STAT6 Mediates Recruitment of NCoA-1/SRC-1
J. Biol. Chem.,
September 20, 2002;
277(39):
36052 - 36060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kinoshita, K. Koike, H. H. Mwamtemi, S. Ito, S. Ishida, Y. Nakazawa, Y. Kurokawa, K. Sakashita, T. Higuchi, K. Takeuchi, et al.
Retinoic acid is a negative regulator for the differentiation of cord blood-derived human mast cell progenitors
Blood,
May 1, 2000;
95(9):
2821 - 2828.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|