|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 6 (September 15), 1998:
pp. 1859-1869
RAPID COMMUNICATION
Activation of p38 MAP Kinase and JNK But Not ERK Is Required for
Erythropoietin-Induced Erythroid Differentiation
By
Yuka Nagata,
Noriko Takahashi,
Roger J. Davis, and
Kazuo Todokoro
From the Tsukuba Life Science Center, The Institute of Physical and
Chemical Research (RIKEN), Ibaraki, Japan; and the Howard Hughes
Medical Institute, Program in Molecular Medicine, Department of
Biochemistry and Molecular Biology, University of Massachusetts Medical
School, Worcester, MA.
 |
ABSTRACT |
p38 MAP kinase (p38) and JNK have been described as playing a
critical role in the response to a variety of environmental stresses
and proinflammatory cytokines. It was recently reported that
hematopoietic cytokines activate not only classical MAP kinases (ERK),
but also p38 and JNK. However, the physiological function of these
kinases in hematopoiesis remains obscure. We found that all MAP kinases
examined, ERK1, ERK2, p38, JNK1, and JNK2, were rapidly and transiently
activated by erythropoietin (Epo) stimulation in SKT6 cells, which can
be induced to differentiate into hemoglobinized cells in response to
Epo. Furthermore, p38-specific inhibitor SB203580 but not MEK-specific
inhibitor PD98059 significantly suppressed Epo-induced differentiation
and antisense oligonucleotides of p38, JNK1, and JNK2, but neither ERK1
nor ERK2 clearly inhibited Epo-induced hemoglobinization. However, in
Epo-dependent FD-EPO cells, inhibition of either ERKs, p38, or JNKs
suppressed cell growth. Furthermore, forced expression of a
gain-of-function MKK6 mutant, which specifically activated p38, induced
hemoglobinization of SKT6 cells without Epo. These results indicate
that activation of p38 and JNKs but not of ERKs is required for
Epo-induced erythroid differentiation of SKT6 cells, whereas all of
these kinases are involved in Epo-induced mitogenesis of FD-EPO cells.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
MITOGEN-ACTIVATED protein (MAP) kinases
form a large family of serine-threonine protein kinases conserved
through evolution.1,2 In mammalian cells, four distinct MAP
kinase cascades have been identified: extracellular signal-regulated
kinases (ERK),3,4 c-Jun amino-terminal kinases (JNK) or
stress-activated protein kinases (SAPK),5,6 p38 MAP kinase
(p38) or cytokine suppressive anti-inflammatory drug binding
protein,7,8 and Erk5/BMK.9,10 These cascades
have become prototypes for the study of structurally related but
functionally distinct pathways.
The classical MAP kinases (ERK1 and ERK2) are activated by a variety of
cell growth and differentiation stimuli2,11,12 and play a
central role in mitogenic signaling.13 The p38 and JNK
cascades are primarily activated by various environmental stresses
(osmotic shock, ultraviolet radiation, heat shock, x-ray radiation,
hydrogen peroxide, and protein synthesis inhibitors) and by the
proinflammatory cytokines tumor necrosis factor- and interleukin-1
(IL-1).5-8,14-21 Cellular stresses and proinflammatory cytokines induce apoptotic cell death21; thus, it has been
suggested that JNK and p38 have a role in apoptosis signals. On the
other hand, stimulation of Fas results in only a modest activation of
JNK,22 and CD40 ligand, which is known to counteract
apoptosis in B cells, activates JNK.23 Mutational analysis
of tumor necrosis factor- receptor showed that JNK activation is not
linked to apoptosis.24 JNK and p38 can also be activated by
such mitogenic factors as epidermal growth factor and phorbol
esters15 and by T-cell activation signaling.25 Thus, JNK and p38 seem to act not only in apoptotic but also in mitogenic signalings.
Hematopoietic cytokines are known to be strong activators of
ERK.26-31 Quite recently, various hematopoietic cytokines,
interleukins, and colony-stimulating factors that regulate
hematopoietic cell growth, survival, and differentiation were found to
activate JNKs and p38 as well as ERKs.32-36 However, the
roles of these distinct MAP kinases on hematopoiesis have not yet been
determined. We therefore examined the functions of the MAP kinase
family in erythropoietin (Epo)-induced erythroid differentiation of
SKT6 cells, which can respond to Epo and induce hemoglobinization, and
in Epo-dependent cell growth of FD-EPO cells, which grow dependently
with Epo. Surprisingly, we found that activation of JNKs and p38 but
not ERKs is essential for Epo-induced erythroid differentiation and that all MAP kinases are involved in Epo-dependent cell growth. We
discuss here the possible functions of ERKs, JNKs, and p38 on
hematopoietic cell growth and differentiation.
 |
MATERIALS AND METHODS |
Reagents.
Antibodies against mouse ERK1, ERK2, JNK1, JNK2, and p38 were obtained
from Santa Cruz Biotechnology (Santa Cruz, CA). MAPKAP kinase-2 assay
kit was purchased from Upstate Biotechnology (Lake Placid, NY). Human
Epo (2.6 × 105 U/mg) was a gift from Kirin Brewery
(Tokyo, Japan). SB203580 was a generous gift from Dr J. C. Lee
(Smithkline Beecham Pharmaceuticals, King of Prussia, PA). PD98059 was
from Calbiochem (La Jolla, CA). Phosphothioester oligonucleotides
(S-oligos) were prepared and purified by BEX (Tokyo, Japan).
Glutathione-S-transferase (GST)-human ATF-2 fusion protein (amino
terminal domain corresponding to amino acids 1 to 96) was obtained from
Santa Cruz Biotechnology and myelin basic protein (MBP) was from Sigma
(St Louis, MO). GST-c-Jun was prepared as reported.33
Cell culture.
Epo-responsive mouse erythroleukemia SKT6 cells have been
described37 and were cultured in Ham F-12 medium
supplemented with 10% fetal calf serum. The Epo-dependent cell line
FD-EPO was established as described previously33 and has
been maintained in RPMI-1640 medium supplemented with 10% fetal calf
serum and 1 U/mL of human Epo. SKT6 cells were induced to differentiate by the addition of 0.5 U/mL of recombinant human Epo followed by
incubation for 4.5 days, and hemoglobin-positive cells were stained by
0.05% 2,7-diaminofluorene (DAF; Sigma).38 Various concentrations of antisense, sense, or scrambled S-oligos; p38-specific inhibitor SB203580 in dimethyl sulfoxide (DMSO); or MEK-specific inhibitor PD98059 in ethanol were mixed in the culture medium before
the addition of 0.5 U/mL of Epo, and the effect on cell differentiation
and/or cell growth was examined. The S-oligos were
added again 24 hours after Epo stimulation. The effect on cell growth
was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium
bromide (MTT) assay. Antisense S-oligos used were as
follows: GGCCTCTCCTGCGACATCTT for p38; TCACGCTTGCTTCTGCTCAT for JNK1;
TCACATTTACTGTCGCTCAT for JNK2; and GCCGCCGCCGCCGCCAT for
ERKs.39 As control, the corresponding sense S-oligos and scrambled S-oligos were used. Immunoblot analysis of the kinases was
performed as described previously.33,34
In vitro protein kinase assay.
SKT6 cells were stimulated with or without 0.5 U/mL of Epo for up to
4.5 days and immediately lysed in a lysis buffer (50 mmol/L Tris, pH
7.5, 0.5% Nonidet P-40, 150 mmol/L NaCl, 100 mmol/L sodium fluoride,
10 mmol/L sodium pyrophosphate, 1 mmol/L EDTA, 2 mmol/L Pefabloc, 10 ng/mL leupeptin, and 10 ng/mL aprotinin). Insoluble material was then
removed by centrifugation, and the precleared cell lysate was incubated
with a specific antibody at 4°C for 2 hours. The immunocomplexes
were bound to protein A-Sepharose at 4°C for 1 hour. The beads were
washed five times with lysis buffer containing 0.1% Nonidet P-40.
Immunoprecipitates with anti-p38 antibody, anti-JNK1 antibody,
anti-JNK2 antibody, anti-ERK1 antibody, or anti-ERK2 antibody were
mixed with the purified substrates (1 µg of GST-ATF-2 for p38, 3 µg
of GST-c-Jun for JNKs, and 3 µg of MBP for ERKs) in 20 µmol/L ATP
and 5 µCi of [ -32P]ATP in 30 µL of kinase buffer A
(25 mmol/L HEPES, pH 7.4, 25 mmol/L -glycerophosphate, 25 mmol/L
MgCl2, 0.1 mmol/L sodium orthovanadate, 2 mmol/L
dithiothreitol [DTT]) for p38, in kinase buffer B (20 mmol/L HEPES, pH 7.6, 20 mmol/L MgCl2, 0.1 mmol/L sodium
orthovanadate, 2 mmol/L DTT) for JNKs, or in kinase buffer C (60 mmol/L
Tris, pH 8.0, and 60 mmol/L MgCl2) for ERKs. Incubation followed at 30°C for 30 minutes for p38, at 30°C for 20 minutes for JNKs, or at 25°C for 15 minutes for ERKs.
The reactions were terminated by mixing with Laemmli sample buffer and
boiling. The samples were resolved by 10% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for p38 and JNKs
or 12% SDS-PAGE for ERKs and autoradiographed. MAPKAP kinase-2 assay
was performed as described in the MAPKAP kinase-2 assay kit manual
(Upstate Biotechnology).
In-gel kinase assay.
In-gel kinase assays were performed using the modified method of Hibi
et al.40 Immunoprecipitates with anti-JNK1 or anti-JNK2 antibody were resolved on a 10% SDS-polyacrylamide gel that was polymerized in the absence or presence of 50 µg/mL GST-c-Jun. After
electrophoresis, the gel was washed twice for 30 minutes with 100 mL of
20% 2-propanol in 50 mmol/L HEPES, pH 7.6, to remove SDS. The gel was
then washed twice for 30 minutes with 100 mL of buffer A (50 mmol/L
HEPES, pH 7.6, 5 mmol/L -mercaptoethanol) and then incubated in 200 mL of 6 mol/L guanidine in buffer A at 25°C for 1 hour. After
washing several times for 1 hour each time with 100 mL of buffer A
containing 0.05% Tween 20 at 4°C, the gel was incubated in kinase
buffer containing 50 mmol/L ATP and 0.25 mCi/mL of
[ -32P]ATP at 30°C for 1 hour. Finally, the gel was
washed several times with 100 mL of 5% trichloroacetic acid and 1%
sodium pyrophosphate at 25°C, followed by drying and
autoradiography.
Cell proliferation assay.
Cell proliferation was measured by a colorimetric assay using MTT
(Sigma) originally developed by Mosmann.41 Exponentially growing cells (exactly 3 × 104) were plated on
microtiter plates in 100 µL culture medium in the presence or absence
of various concentrations of inhibitors, Epo, and antisense, sense, or
scrambled S-oligos and were cultured at 37°C for 3 days. Ten
microliters of 5 mg/mL of MTT in phosphate-buffered saline
(PBS) was then added to each well and incubated at
37°C for an additional 4 hours, and 100 µL of 0.04 mol/L HCl in
isopropanol was thoroughly mixed in. Optical densities were measured on
a microplate reader using a test wavelength of 570 nm and a reference wavelength of 630 nm.
Analysis of DNA fragmentation.
DNA fragmentation was assayed by the modified method of Sellins and
Cohen.42 SKT6 cells (1 × 106 cells)
collected by centrifugation were washed once in PBS and suspended in a
lysis buffer (10 mmol/L Tris, pH 7.5, 10 mmol/L EDTA, pH 8.0, 0.5%
Triton X-100) for 10 minutes on ice. The suspension was centrifuged at
16,000 rpm for 20 minutes and the fragmented DNA was recovered from the
supernatant, which was then subjected to digestion with ribonuclease A
(0.5 mg/mL) for 1 hour at 37°C, followed by incubation with
proteinase K (0.5 mg/mL) for 1 hour at 37°C. The sample was then
extracted with isopropanol overnight at 20°C. DNA was
precipitated and resuspended in 10 mmol/L Tris, pH 7.5, containing 1 mmol/L EDTA. Equal amounts of DNA were separated by 1.8% agarose gel
electrophoresis, and DNA was visualized by ethidium bromide staining.
 |
RESULTS |
JNKs, p38, and ERKs are rapidly and transiently activated during
Epo-induced erythroid differentiation.
It has been reported that Epo rapidly and transiently activates JNK1,
JNK2, and p38 as well as ERK1 and ERK2 in Epo-dependent FD-EPO cells or
BaF3/ER cells.30,33,34 These cells grow in response to Epo
in a dose-dependent manner. In contrast, mouse erythroleukemia SKT6
cells can be induced to differentiate into hemoglobinized cells in
response to Epo; these cells are not dependent on Epo to proliferate,
and their proliferation is neither enhanced nor impaired by the
presence of Epo. Therefore, we sought to learn whether the MAP kinase
family can also be activated during Epo-induced erythroid
differentiation of SKT6 cells.
The protein kinase activity of JNK1 and JNK2 at various time points
after Epo stimulation was measured with purified GST-c-Jun (molecular
weight, 35 kD) as a substrate (Fig 1). It
was clearly observed that Epo rapidly and transiently activated both
JNK1 (Fig 1A) and JNK2 (Fig 1B). Both activities were seen in
unstimulated cells, and a rapid and marked increase in the activities
was detected within 3 minutes of Epo treatment (Fig 1A and B, lanes 2).
These activities peaked at 5 to 60 minutes (Fig 1A and 1B, lanes 3 through 6) and returned to the basal levels by 3 hours after
stimulation (Fig 1A and B, lanes 7). Immunoblot analysis of the
immunoprecipitates showed that the amount of the immunoprecipitated
JNK1 or JNK2 in each lane was similar (Fig 1A and B, lower panels).

View larger version (25K):
[in this window]
[in a new window]

View larger version (61K):
[in this window]
[in a new window]
| Fig 1.
Epo rapidly and transiently activates JNK1 and JNK2
during Epo-induced erythroid differentiation. SKT6 cells were
stimulated with Epo for 0, 3, 5, 15, 30, 60, and 180 minutes (lanes 1 through 7) and for 1, 2, 3, and 4.5 days (lanes 8 through 11). Activity
of JNK1 (A) and JNK2 (B) was assayed in the immunoprecipitates with
anti-JNK1- or anti-JNK2-specific antibody and GST-c-Jun as a
substrate. Arrows indicate the phosphorylated GST-c-Jun (molecular
weight, 35 kD). Lower panels show the immunoblots of the
immunoprecipitated JNK1 or JNK2 in each lane. (C) In-gel kinase assay
of JNK1 and JNK2. Cell lysates before ( ) and 5 minutes after (+)
Epo stimulation were used for in-gel kinase assay. Arrows indicate the
position of JNK1 (molecular weight, 46 kD) and JNK2 (molecular weight,
55 kD).
|
|
In-gel kinase assay with GST-c-Jun as a substrate confirmed that both
JNK1 of 46 kD and JNK2 of 55 kD were indeed activated 5 minutes after
Epo stimulation (Fig 1C). Furthermore, the anti-JNK1 and anti-JNK2
antibodies used here specifically immunoprecipitated JNK1 and JNK2,
respectively, and did not cross-react with each other, as described
previously.33
Possible p38 activation was next examined by in vitro p38 kinase assay.
The purified GST-ATF-2 (molecular weight, 40 kD) was used as a
substrate (Fig 2A). The p38 activity was
seen in unstimulated cells (Fig 2A, lane 1), but it rapidly increased
and reached the maximum level within 3 minutes of Epo treatment (Fig
2A, lane 2). It remained at a high level until 30 minutes after
stimulation (Fig 2A, lanes 2 through 5) and slowly returned to the
basal level within 3 hours (Fig 2A, lane 7). Immunoblot analysis of the
immunoprecipitates showed that the amount of the immunoprecipitated p38
in each lane was similar (Fig 2A, lower panel).

View larger version (18K):
[in this window]
[in a new window]
| Fig 2.
Epo rapidly and transiently activates p38 and MAPKAP
kinase-2 during erythroid differentiation. (A) SKT6 cells were
stimulated with Epo for 0, 3, 5, 15, 30, 60, and 180 minutes (lanes 1 through 7) and for 1, 2, 3 and 4.5 days (lanes 8 through 11). The p38
activity was measured in the immunoprecipitates with anti-p38-specific
antibody and GST-ATF-2 as a substrate. Arrow indicates the
phosphorylated GST-ATF-2 (molecular weight, 40 kD). The lower panel
shows the immunoblots of the immunoprecipitated p38 in each lane. (B)
The MAPKAP kinase-2 assay was performed in the immunoprecipitates of
SKT6 cells in the presence of MAPKAP kinase-2 substrate peptide as a
substrate at various time points after Epo stimulation, as indicated.
|
|
The p38 immunoprecipitated with anti-p38-specific antibody was
immunoblotted with antiphosphotyrosine antibody 4G10, and it was found
that the level of tyrosine phosphorylation of p38 was well correlated
with its kinase activity (data not shown). Thus, it was concluded that
Epo rapidly induces tyrosine phosphorylation and activation of p38
during erythroid differentiation of SKT6 cells.
We further examined the possible activation of one of the major
substrates of p38, MAPKAP kinase-2,15,16 in Epo-stimulated SKT6 cells. As shown in Fig 2B, the kinase was rapidly and transiently activated, and this activity reached the maximal level 5 minutes after
Epo stimulation and then returned to the basal level by 3 hours after
stimulation. The activity profile of p38 is well correlated with that
of MAPKAP kinase-2 activity; furthermore, inhibition of p38 by SB203580
blocked activation of MAPKAP kinase-2 (data not shown).
Activity of ERK1 and ERK2 was measured using MBP as a substrate at
various time points after Epo stimulation
(Fig 3). Both ERK1 (Fig 3A) and ERK2 (Fig
3B) were rapidly activated within 3 minutes (Fig 3A and B, lanes 2),
and their activities reached the maximum levels at 3 to 5 minutes (Fig
3A and B, lanes 2 and 3) and then returned to the background levels by
15 to 30 minutes after stimulation (Fig 3A and B, lanes 4 and 5). The
specific activation of both ERK1 of 44 kD and of ERK2 of 42 kD was
confirmed by in-gel kinase assay (data not shown), and the immunoblot
analysis of the immunoprecipitates indicated that the amount of the
immunoprecipitated ERK1 or ERK2 in each lane was similar (Fig 3A and B,
lower panels).

View larger version (24K):
[in this window]
[in a new window]
| Fig 3.
Epo rapidly and transiently activates both ERK1 and ERK2
during erythroid differentiation. SKT6 cells were stimulated with Epo
for 0, 3, 5, 15, 30, 60, and 180 minutes (lanes 1 through 7) and for 1, 2, 3, and 4.5 days (lanes 8 through 11), and the activity of ERK1 (A)
and ERK2 (B) was measured in the immunoprecipitates with each specific
antibody and MBP as a substrate. Arrows indicate the phosphorylated MBP
(molecular weight, 18 kD). The lower panels show the immunoblots of the
immunoprecipitated ERK1 or ERK2 in each lane.
|
|
Taken together, these data clearly indicate that Epo induces rapid and
transient activation of all MAP kinases examined, ERK1, ERK2, JNK1,
JNK2, and p38, which suggests that some of these pathways may be
involved in Epo-induced erythroid differentiation signals. Furthermore,
whereas MAPKAP kinase-2 has been thought to act on apoptotic signal,
this kinase may also play a role in Epo-induced erythroid
differentiation.
Activation of p38 required for Epo-induced hemoglobinization.
We next examined the possible roles of these MAP kinase family members
on Epo-induced erythroid differentiation. First of all, the effects of
p38-specific inhibitor SB203580 (Fig 4) and MEK-specific inhibitor PD98059 (Fig 5) on
Epo-induced hemoglobinization of SKT6 cells were examined. The
percentage of hemoglobinized SKT6 cells after Epo stimulation varied
between 40% and 70% from experiment to experiment. Thus, the
percentage of hemoglobinized cells in the presence of Epo is defined as
100% as a control, and the inhibition or enhancement of SKT6 cell
differentiation in the presence of the inhibitors is shown as a
relative value against this control.

View larger version (40K):
[in this window]
[in a new window]
| Fig 4.
Activation of p38 is required for Epo-induced erythroid
differentiation. (A, B, and C) DAF-staining of the hemoglobinized SKT6
cells with (B and C) or without (A) Epo stimulation in the presence (C)
or absence (A and B) of 5 µmol/L of p38-specific inhibitor SB203580.
(D) SKT6 cells were cultured in the presence (+) or absence ( ) of
Epo (0.5 U/mL) and SB203580 (10 µmol/L) dissolved in
0.1% DMSO, and the hemoglobinized cells were stained with DAF.
The percentage of hemoglobinized cells in the presence of Epo is
defined as 100% as a control, and the inhibition or enhancement of
SKT6 cell differentiation in the presence of the inhibitor is shown as
a relative value against the control. Values shown are the means of
five experiments. (E) Dose-dependency of SB203580 in SKT6
cell differentiation in the presence ( ) or absence ( ) of Epo. (F)
Dose-dependency of SB203580 in SKT6 cell growth. The cell growth was
measured by MTT assay. (G) The p38 activity was measured in the
presence (+) or absence ( ) of SB203580 (10 µmol/L) 5 minutes
after Epo stimulation.
|
|

View larger version (26K):
[in this window]
[in a new window]
| Fig 5.
MEK-specific inhibitor PD98059 has no effect on
Epo-induced erythroid differentiation of SKT6 cells. (A) SKT6 cells
were cultured in the presence (+) or absence ( ) of Epo and
MEK-specific inhibitor PD98059 (50 µmol/L) dissolved in 0.1%
ethanol, and the hemoglobinized cells were stained with DAF. (B)
Dose-dependency of PD98059 in SKT6 cell differentiation in the presence
( ) or absence ( ) of Epo. The percentage of hemoglobinized cells
in the presence of Epo is defined as 100% as a control. Values shown
are the means of five experiments. (C) Dose-dependency of PD98059 on
SKT6 cell growth. Cell proliferation was measured by MTT assay. (D)
Activity of ERKs was blocked by PD98059. The ERK activity was assayed
in the presence (+) or absence ( ) of PD98059 (50 µmol/L) 5 minutes after Epo stimulation.
|
|
Figure 4A, B, and C shows the hemoglobinized SKT6 cells with (Fig 4B
and C) or without (Fig 4A) Epo stimulation in the presence (Fig 4C) or
absence (Fig 4A and B) of SB203580 (5 µmol/L). Surprisingly, the
addition of SB203580 to SKT6 cell culture in the presence of Epo
strongly blocked production of hemoglobinized cells (Fig 4C and D, lane
6) compared with the addition of Epo alone (Fig 4B and D, lane 2). The
solvent used to dissolve SB203580 (0.1% DMSO) slightly stimulated
Epo-induced hemoglobinization (Fig 4D, lane 4) compared with Epo alone
(Fig 4D, lane 2). Neither DMSO (Fig 4D, lane 3) nor SB203580 alone (Fig
4D, lane 5) induced erythroid differentiation. A dose-dependent
experiment clearly demonstrated that SB203580 blocked Epo-induced
differentiation in a dose-dependent manner (Fig 4E, ) and that the
inhibitor alone had no effect on it (Fig 4E, ). The MTT assay in the
presence of various concentrations of SB203580 showed that the
inhibitor has no effect on cell proliferation (Fig 4F). It was
confirmed that SB203580 actually inhibited p38 activity to the basal
level even 5 minutes after Epo stimulation, when it should be at the
maximal level (Fig 4G). These results indicate that inhibition of p38
activity clearly blocks Epo-induced erythroid differentiation; in other
words, activation of p38 induced by Epo is essential for erythroid
differentiation of SKT6 cells.
The addition of PD98059 (50 µmol/L) to SKT6 cell culture in the
presence or absence of Epo had no effect on hemoglobinization (Fig 5A,
lanes 5 and 6) compared with the controls (Fig 5A, lanes 1 through 4),
although PD98059 (50 µmol/L) completely blocked Epo-induced
activation of both ERK1 and ERK2 even 5 minutes after Epo stimulation,
at which both activities are maximum (Fig 5D). The phosphorylation of
MEKs was also inhibited by the inhibitor (data not shown). The solvent
used to dissolve PD98059 (0.1% ethanol) in the presence (Fig 5A, lane
4) or absence (Fig 5A, lane 3) of Epo had no effect on this assay. A
dose-dependent experiment confirmed that even higher concentrations of
PD98059 had no effect on erythroid differentiation in the presence (Fig
5B, ) or absence (Fig 5B, ) of Epo, whereas the dose-dependency
of PD98059 on cell growth shows that 50 µmol/L of the inhibitor had
little effect on it but over 100 µmol/L of the inhibitor exhibited
some growth inhibitory effect on SKT6 cells (Fig 5C). Thus, the effect
of PD98059 over 100 µmol/L may be nonspecific. It was therefore
concluded, although unexpectedly, that ERKs may not be involved in
Epo-induced erythroid differentiation of SKT6 cells.
The fact that inhibition of p38 activity strongly blocked Epo-induced
hemoglobinization indicates that activation of p38 is required for
Epo-induced erythroid differentiation in SKT6 cells. However, ERKs may
not be involved in Epo-induced hemoglobinization of these cells.
Because no specific inhibitor for JNK is available, the role of JNK
could not be determined in this assay.
Activation of both p38 and JNKs essential for Epo-induced
hemoglobinization.
The possible involvement of JNKs during Epo-induced SKT6 cell
differentiation was studied by applying antisense S-oligo strategy (Fig 6). In the presence of antisense
S-oligo of p38, Epo-induced hemoglobinization was significantly
inhibited in a dose-dependent manner, as expected (Fig 6B, ).
Similarly, antisense S-oligo of JNK1 or JNK2 strongly blocked
Epo-induced hemoglobinization in a dose-dependent manner (Figs 6C and
D, ), and the addition of both of these antisense S-oligos
synergistically inhibited it (Fig 6E, ). In contrast, antisense
S-oligo of ERKs (commonly effective for both ERK1 and ERK2) exhibited
only weak inhibition (Fig 6F, ), similar to that of sense S-oligos
(Fig 6F, ). The scrambled S-oligo (Fig 6A) and all sense S-oligos
(Fig 6B through 6F, ) had little effect, if any, on Epo-induced
hemoglobinization. Figure 6G shows that all of these antisense S-oligos
(30 µmol/L) specifically inhibited the expression of each
corresponding kinase. These results demonstrated that inhibition of
either JNK1, JNK2, or p38 resulted in the block of Epo-induced
hemoglobinization of SKT6 cells; in other words, JNK1 and JNK2 as well
as p38, but not ERKs, are required for Epo-induced hemoglobinization.

View larger version (18K):
[in this window]
[in a new window]

View larger version (43K):
[in this window]
[in a new window]
| Fig 6.
Activation of both p38 and JNKs is essential for
Epo-induced differentiation. Various concentrations (0 to 30 µmol/L)
of scrambled S-oligo (A), antisense S-oligo ( ), or sense S-oligo
( ) of p38 (B), JNK1 (C), JNK2 (D), a mixture of JNK1 and JNK2 (E),
or ERKs (F) were mixed with SKT6 cells in the presence of Epo, and the
hemoglobinized cells were stained with DAF after 4.5 days of culture.
The percentage of DAF-positive cells in the presence of Epo is defined
as 100%, and the inhibition of erythroid differentiation is shown as a
relative value. Each point represents the mean of five replicates. (G)
Antisense S-oligos specifically inhibit the expression of each
corresponding kinase. The lysates of the cells treated (+) or
untreated ( ) with antisense S-oligos (30 µmol/L) indicated above
were probed with specific antibody against each corresponding kinase
shown left.
|
|
Forced activation of p38 induces erythroid differentiation of SKT6
cells without Epo stimulation.
We next examined whether activation of p38 is enough to induce
erythroid differentiation of SKT6 cells without Epo stimulation. MKK6(Glu), an activated form of MKK6, which can constitutively and
specifically activate p38 as described previously,43 was expressed in SKT6 cells. Expression of MKK6(Glu) resulted in
significant activation of p38 (Fig 7B, lane
4) compared with that of Epo stimulation (Fig 7B, lane 2) and
production of hemoglobinized SKT6 cells without Epo stimulation (Fig
7A, lane 3). In the presence of Epo, the expression of MKK6(Glu)
(activation of p38) further enhanced Epo-induced differentiation (Fig
7A, lane 4) compared with Epo-stimulated mock-transfectant (Fig 7A,
lane 2). Transfection of vector alone had no effect on cell
differentiation (Fig 7A, lanes 1 and 2). It was confirmed that no DNA
fragmentation was detected in these MKK6(Glu)-expressing cells (data
not shown). Thus, the activation of p38 is sufficient to induce
erythroid differentiation to some extent without Epo stimulation. The
gain-of-function mutant of neither JNKs nor their specific upstream
kinases is yet available, so we could not examine the effect of forced
activation of JNKs.

View larger version (18K):
[in this window]
[in a new window]
| Fig 7.
Forced activation of p38 induces erythroid
differentiation without Epo stimulation. (A) SKT6 cells transfected
with a gain-of-function MKK6 mutant MKK6(Glu) (lanes 3 and 4) or the
vector (pCDNA3) alone (lanes 1 and 2) were cultured in the presence
(+) or absence ( ) of Epo, and the hemoglobinized cells were
stained with DAF. The percentage of hemoglobinized cells of the
mock-transfectants in the presence of Epo is defined as 100%. Each
value represents the mean of six experiments. (B) MKK6(Glu) activates
p38. The p38 activity in SKT6 cells (lanes 1 and 2), mock-transfected
SKT6 cells (lane 3), or MKK6(Glu)-transfected SKT6 cells (lane 4) with
(lane 2) or without (lanes 1, 3, and 4) Epo was measured in the
immunoprecipitates with anti-p38-specific antibody and GST-ATF-2 as a
substrate.
|
|
Exposure of SKT6 cells to osmotic shock induced activation of JNK1,
JNK2, and p38 after 1 hour of incubation
(Fig 8A), and DNA fragmentation was clearly
observed after 24 hours of incubation (Fig 8B), as previously seen in
various cell types.

View larger version (32K):
[in this window]
[in a new window]
| Fig 8.
Osmotic shock induces activation of JNKs and p38 and
induces apoptotic cell death in SKT6 cells. (A) Activation of JNK1,
JNK2, and p38. SKT6 cells were cultured in the presence (+) or
absence ( ) of 0.1 mol/L NaCl for 1 hour, and in vitro kinase assays
of JNK1, JNK2, and p38 were performed in the immunoprecipitates with
each specific antibody and GST-c-Jun or GST-ATF-2 as a substrate. (B)
DNA fragmentation of the cells treated (+) or untreated ( ) with
0.1 mol/L NaCl for 24 hours. M indicates the size marker (Hae
III digests of X174 DNA).
|
|
Role of MAP kinases in Epo-dependent FD-EPO cells.
We previously reported that Epo similarly activates ERKs, p38, and JNKs
in Epo-dependent cells.30,33,34 Therefore, we also examined
the effects of SB203580 and PD98059 on Epo-dependent cell growth
(Fig 9). Unexpectedly, the addition of
SB203580 to FD-EPO cells clearly blocked cell proliferation in a
dose-dependent manner, even in the presence of Epo (Fig 9A). Figure 9C
shows that SB203580 (50 µmol/L) completely blocked p38 activity. The solvent used to dissolve the inhibitor (0.1% DMSO) had no effect on it
(data not shown). Similarly, PD98059 also clearly inhibited Epo-dependent cell growth in a dose-dependent manner (Fig 9B). The
activity of both ERK1 and ERK2 was completely inhibited by PD98059 (200 µmol/L; Fig 9D). The solvent used to dissolve PD98059 (0.1% ethanol)
had no effect on this assay (data not shown).

View larger version (26K):
[in this window]
[in a new window]
| Fig 9.
Activation of p38 and ERKs is required for Epo-dependent
cell growth of FD-EPO cells. (A and B) Both SB203580 and PD98059
inhibit Epo-dependent cell growth. Various concentrations of SB203580
(A) or PD98059 (B) were mixed in FD-EPO cell culture, and the effect of
the inhibitors on Epo-dependent cell growth was measured by MTT assay.
(C) SB203580 blocked p38 activity. The p38 activity was assayed in the
presence (+) or absence ( ) of SB203580 (50 µmol/L) in
Epo-stimulated FD-EPO cells. (D) PD98059 inhibited ERKs. The activity
of ERKs was measured with (+) or without ( ) PD98059 (200 µmol/L)
in Epo-stimulated FD-EPO cells.
|
|
The effect of antisense S-oligos was examined on Epo-dependent FD-EPO
cell growth (Fig 10). In the presence of
either antisense S-oligo of p38, JNK1, JNK2, or ERKs weakly but clearly
inhibited Epo-dependent cell growth of FD-EPO cells in a dose-dependent manner (Fig 10B through E, ), whereas sense S-oligo had no effect on
cell growth (Fig 10B through E, ). The scrambled S-oligo had no
effect on it (Fig 10A). In the presence of these antisense S-oligos (30 µmol/L), little or no expression of the corresponding kinases was
detected by immunoblot analyses (Fig 10F).

View larger version (18K):
[in this window]
[in a new window]

View larger version (11K):
[in this window]
[in a new window]
| Fig 10.
The MAP kinase family is essential for Epo-dependent
cell growth. Various concentrations (0 to 30 µmol/L) of antisense
S-oligo ( ) or sense S-oligo ( ) of p38 (B), JNK1 (C), JNK2 (D), a
mixture of JNK1 and JNK2 (D), ERKs (E), or scrambled S-oligo (A) were
mixed with FD-EPO cells in the presence of Epo, and the cell growth was
measured by MTT assay. Values shown are the means of six experiments.
(F) Immunoblot analyses of FD-EPO cells treated (+) or untreated
( ) with antisense S-oligos (30 µmol/L) with specific antibody
against each corresponding kinase.
|
|
Exposure of FD-EPO cells to osmotic shock similarly induced activation
of JNK1, JNK2, and p38 and consequently induced apoptotic cell death,
as observed in SKT6 cells (Fig 8; data not shown).
Taken together, these results indicate that inhibition of p38, JNKs, or
ERK blocks Epo-dependent cell growth in FD-EPO cells.
 |
DISCUSSION |
Figure 11 shows a schematic drawing
summarizing the experimental results obtained here. In
differentiation-inducible SKT6 cells, Epo rapidly and transiently
activates all ERKs, JNKs, and p38. JNKs and p38 but not ERKs play a
critical role in Epo-induced erythroid differentiation of SKT6 cells
(Fig 11, right panel, solid lines), but JNKs and p38 play a part in
apoptosis when the cells are exposed to environmental stresses (Fig 11,
right panel, broken lines). However, in Epo-dependent FD-EPO cells, Epo
similarly induces rapid and transient activation of ERKs, JNKs, and
p38, but these kinases are all involved in cell proliferation (Fig 11,
left panel, solid lines), whereas JNKs and p38 play a role in apoptotic
signals when the cells are exposed to cellular stresses (Fig 11, left
panel, broken line). Taken together, these findings indicate that JNKs
and p38 may have a distinct function in different cell lineages and
under different intracellular conditions, ie, whether the cell is to
grow or to differentiate or whether the cell is to survive or to become
apoptotic, even after the same extracellular stimulation (Epo in this
case). Thus, the mechanism of how these kinase signaling cascades
achieve a specific response remains to be elucidated.

View larger version (23K):
[in this window]
[in a new window]
| Fig 11.
Roles of the MAP kinase family in Epo-induced erythroid
differentiation and proliferation. In differentiation-inducible SKT6
cells (right panel), JNKs and p38 function in erythroid differentiation
(solid lines), but they have a role in apoptosis when the cells are
exposed to environmental stresses (broken lines). However, in
Epo-dependent FD-EPO cells (left panel), ERKs, JNKs, and p38 are all
involved in cell proliferation (solid lines), whereas JNKs and p38
function in apoptotic signals when the cells are exposed to cellular
stresses (broken lines).
|
|
It has been thought that ERK, p38, and JNK mediate different signals
from different agonists or stimuli and are linked to different
biological functions. Activation of the ERKs has been described as
being involved in cell differentiation as well as cell
proliferation.12 Nerve growth factor (NGF) treatment of pheochromocytoma PC12 cells induces ERK activation associated with
neurite outgrowth and cessation of cell division, whereas the treatment
of PC12 cells with EGF induces ERK activation and cell
proliferation.12 In NIH3T3 cells, activation of the ERK pathway induces cell proliferation, and overexpression of the gain-of-function mutant of MEK induces morphological transformation of
the transfected cells.44,45 In contrast, it was recently reported that ERK is not necessary for, but antagonizes, 3T3-L1 adipocytic differentiation.46 However, in hematopoietic
cells, the roles of the ERKs have not been clearly defined. It was
demonstrated that the ERK pathway controls the differentiation of
immature thymocytes downstream of the pre-T-cell
receptor.47,48 Recently, it was also shown that activation
of ERK pathway is required for megakaryocytic
differentiation.49-51 We showed here that activation of
ERKs is essential for Epo-dependent cell growth but not for Epo-induced
erythroid differentiation. Therefore, it seems likely that the ERKs
play a distinct role in cell differentiation and/or proliferation, depending on the cell lineage, the extracellular stimuli, and/or the intracellular conditions. An alternative
explanation is that these transformed cell lines might not be simply
representative of the normal physiology.
It has been well documented that JNKs and p38 have an important
function in apoptotic signaling. In PC12 cells, activation of p38 and
JNK and concurrent inhibition of ERK are critical for induction of
apoptosis.52 Overexpression of MEKK1 or ASK1 in Swiss 3T3
cells, REF52 fibroblasts or, COS7 cells induces apoptotic cell
death.53,54 However, these notions are not applicable to
all cellular responses in a variety of cell types. It was recently reported that JNK and p38 are activated by the stimulation of the
hematopoietic cytokines granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-3, thrombopoietin, and Epo.32-36
Hematopoietic cytokines are known to provide not only the signals to
proliferate but also the signals to suppress apoptosis.55
In fact, JNK and p38 were recently indicated to be involved in cell
survival and/or cell growth rather than apoptosis in
hematopoietic cells. The upstream kinase of JNK and p38, SEK1,
reportedly mediates survival signals in T-cell
development.56 More recently, it was also reported that
T-cell proliferation in response to IL-2 and IL-7 requires p38
activation.57 In this study, we demonstrated that the
activation of JNKs and p38 is required for Epo-induced erythroid differentiation of SKT6 cells and for cell proliferation of FD-EPO cells. Therefore, JNKs and p38 have distinct functions (ie, induction of apoptosis, suppression of apoptosis, cell survival, cell
proliferation, and cell differentiation) depending on the cell lineage,
the extracellular stimuli, and the intracellular
conditions. It is thus critical to clarify how these
various cellular responses producing opposite effects are regulated by
the same signaling pathways.
It has been reported that JNK is essential for cell differentiation.
GTPase-deficient G proteins induce persistent activation of JNK and
PC12 cell differentiation, and overexpression of c-Jun induces neurite
outgrowth.58 In P19 carcinoma cells, ectopic expression
of c-Jun leads to differentiation of P19 cells,59 and
overexpression of the dominant negative form of JNK blocks the induction of differentiation by retinoic acid.60
Differentiation of WEHI-3B(D+) myelomonocytic leukemia
cells is reportedly also induced by ectopic expression of
c-Jun.61 Furthermore, the expression and
phosphorylation of heat shock protein hsp28, which is known as one of the target molecules of p38, are correlated with
hemin-induced K562 cell differentiation into erythroid-like
cells.62 These reports are consistent with our findings
described here, and it is obvious that JNK and p38 pathways are
involved in cell differentiation of at least some cell lineages.
JNKs and p38 are coordinately regulated, although to a different
extent, by proinflammatory cytokines, environmental stresses, and
hematopoietic cytokines.15,19,33-36 We also showed that
JNKs and p38 are coordinately activated and function in Epo-induced erythroid differentiation. We saw no clear differences between them,
although their activation profiles differ. The two of them may thus
play overlapping roles in erythroid differentiation. JNKs and p38 are
responsible for the phosphorylation and activation of transcription
factors necessary for the stress responses, including c-Jun, ATF-2,
Max, and CHOP.63-65 These substrates of the MAP kinase family are more or less specific for each MAP kinase,15
indicating that they may have particular functions in response to
various stimuli. Thus, the target molecules of JNKs and p38 and the
role of JNKs and p38 signaling pathways need to be identified in
hematopoietic cytokine-induced growth and differentiation systems.
 |
FOOTNOTES |
Submitted January 22, 1998;
accepted June 30, 1998.
Supported in part by Special Grants for Promotion of Research from The
Institute of Physical and Chemical Research (RIKEN) and by grants from
the Ministry of Education, Science and Culture of Japan.
Address reprint requests to Kazuo Todokoro, PhD, Tsukuba Life Science
Center, The Institute of Physical and Chemical Research (RIKEN), 3-1, Koyadai, Tsukuba, Ibaraki 305-0074, Japan; e-mail: todokoro{at}rtc.riken.go.jp.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Drs E. Nishida and T. Moriguchi (Kyoto University,
Kyoto, Japan), M. Hibi and R. Fukunaga (Osaka University, Osaka,
Japan), and S. Hirai (Yokohama City University, Yokohama, Japan) for
valuable discussions and thank J.S. Lee (Smithkline Beecham
Pharmaceuticals) for SB203580 and Kirin Brewery for Epo.
 |
REFERENCES |
1.
Neiman AM:
Conservation and reiteration of a kinase cascade.
Trends Genet
9:390,
1993[Medline]
[Order article via Infotrieve]
2.
Nishida E,
Gotoh Y:
The MAP kinase cascade is essential for diverse signal transduction pathway.
Trends Biochem Sci
18:128,
1993[Medline]
[Order article via Infotrieve]
3.
Boulton TG,
Nye SH,
Robbins DJ,
Ip NY,
Radziejewska E,
Morgenbesser SD,
DePinho RA,
Panayotatos N,
Cobb MH,
Yancopoulos GD:
ERKs: A family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF.
Cell
65:663,
1991[Medline]
[Order article via Infotrieve]
4.
Seger R,
Ahn NG,
Boulton TG,
Yancopoulos GD,
Panayotatos N,
Radziejewska E,
Ericsson L,
Bratlien RL,
Cobb MH,
Krebs EG:
Microtubule-associated protein 2 kinases, ERK1 and ERK2, undergo autophosphorylation on both tyrosine and threonine residues: Implications for their mechanism of activation.
Proc Natl Acad Sci USA
88:6142,
1991[Abstract/Free Full Text]
5.
Kyriakis JM,
Banerjee P,
Nikolakaki E,
Dai T,
Rubie EA,
Ahmad MF,
Avruch J,
Woodgett JR:
The stress-activated protein kinase subfamily of c-Jun kinases.
Nature
369:156,
1994[Medline]
[Order article via Infotrieve]
6.
Derijard B,
Hibi M,
Wu I-H,
Barrett T,
Su B,
Deng T,
Karin M,
Davis RJ:
JNK1: A protein kinase stimulated by UV light and H-Ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:1025,
1994[Medline]
[Order article via Infotrieve]
7.
Han J,
Lee JD,
Bibbs L,
Ulevitch RJ:
A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells.
Science
265:808,
1994[Abstract/Free Full Text]
8.
Rouse J,
Cohen P,
Trigon S,
Morange M,
Alonso-Llamazares A,
Zamanillo D,
Hunt T,
Nebreda AR:
A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins.
Cell
78:1027,
1994[Medline]
[Order article via Infotrieve]
9.
Lee JD,
Ulevitch RJ,
Han J:
Primary structure of BMK1: A new mammalian MAP kinase.
Biochem Biophys Res Commun
213:715,
1995[Medline]
[Order article via Infotrieve]
10.
Zhou G,
Bao ZQ,
Dixon JE:
Components of a new human protein kinase signal transduction pathway.
J Biol Chem
270:12665,
1995[Abstract/Free Full Text]
11.
Ray LB,
Sturgill TW:
Rapid stimulation by insulin of a serine/threonine kinase in 3T3-L1 adipocytes that phosphorylates microtubule-associated protein 2 in vitro.
Proc Natl Acad Sci USA
84:1502,
1987[Abstract/Free Full Text]
12.
Marshall CJ:
Specificity of receptor tyrosine kinase signaling: Transient versus sustained extracellular signal-regulated kinase activation.
Cell
80:179,
1995[Medline]
[Order article via Infotrieve]
13.
Pages G,
Lenormand P,
L'Allemain G,
Chambard JC,
Meloche S,
Poyssegur J:
Mitogen-activated protein kinase p42mapk and p44mapk are required for fibroblast proliferation.
Proc Natl Acad Sci USA
90:8319,
1993[Abstract/Free Full Text]
14.
Yan M,
Dai T,
Deak JC,
Kyriakis JM,
Zon LI,
Woodgett JR,
Templeton DJ:
Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activation SEK1.
Nature
372:798,
1994[Medline]
[Order article via Infotrieve]
15.
Raingeaud J,
Gupta S,
Rogers J,
Dickens M,
Han J,
Ulevitch R,
Davis RJ:
Pro-inflammatory cytokines and environmental stress cause p38 MAP kinase activation by dual phosphorylation on tyrosine and threonine.
J Biol Chem
270:7420,
1995[Abstract/Free Full Text]
16.
Freshney NW,
Rawlinson L,
Guesdon F,
Jones E,
Cowley S,
Hsuan J,
Saklatvala J:
Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27.
Cell
78:1039,
1994[Medline]
[Order article via Infotrieve]
17.
Galcheva-Gargova Z,
Derijard B,
Wu IH,
Davis RJ:
An osmosensing signal transduction pathway in mammalian cells.
Science
265:806,
1994[Abstract/Free Full Text]
18.
Lee JC,
Laydon JT,
McDonnell PC,
Gallagher TF,
Kumar S,
Green D,
McNulty D,
Blumenthal MJ,
Heys JR,
Landvatter SW,
Strickler JE,
McLaughlin MM,
Siemens IR,
Fisher SM,
Livi GP,
White JR,
Adams JL,
Young PR:
A protein kinase involved in the regulation of inflammatory cytokine biosynthesis.
Nature
372:739,
1994[Medline]
[Order article via Infotrieve]
19.
Sluss HK,
Barrett T,
Derijard B,
Davis RJ:
Signal transduction by tumor necrosis factor mediated by JNK protein kinases.
Mol Cell Biol
14:8376,
1994[Abstract/Free Full Text]
20.
Westwick JK,
Bielawska AE,
Dbaibo G,
Hannun YA,
Brenner DA:
Ceramide activates the stress-activated protein kinases.
J Biol Chem
270:22689,
1995[Abstract/Free Full Text]
21.
Verheij M,
Bose R,
Lin XH,
Yao B,
Jarvis WD,
Grant S,
Birrer MJ,
Szabo E,
Zon LI,
Kyriakis JM,
Haimovitz-Friedman A,
Fuks Z,
Kolesnick RN:
Requirement for ceramide-initiated SAPK/JNK signaling in stress-induced apoptosis.
Nature
380:75,
1996[Medline]
[Order article via Infotrieve]
22.
Lenczowski JM,
Dominguez L,
Eder AM,
King LB,
Zacharchuk CM,
Ashwell JD:
Lack of a role for Jun kinase and AP-1 in Fas-induced apoptosis.
Mol Cell Biol
17:170,
1996[Abstract]
23.
Berberich I,
Shu G,
Siebelt F,
Woodgett JR,
Kyriakis JM,
Clark EA:
Cross-linking CD40 on B cells preferentially induces stress-activated protein kinases rather than mitogen-activated protein kinases.
EMBO J
15:92,
1996[Medline]
[Order article via Infotrieve]
24.
Liu ZG,
Hsu H,
Goeddel DV,
Karin M:
Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death.
Cell
87:565,
1996[Medline]
[Order article via Infotrieve]
25.
Su B,
Jacinto E,
Hibi M,
Kallunki T,
Karin M,
Ben-Neriah Y:
JNK is involved in signal integration during costimulation of T lymphocytes.
Cell
77:727,
1994[Medline]
[Order article via Infotrieve]
26.
Satoh T,
Nakafuku M,
Miyajima A,
Kaziro Y:
Involvement of ras p21 protein in signal transduction pathways from interleukin 2, interleukin 3, and granulocyte/macrophage colony-stimulating factor, but not from interleukin 4.
Proc Natl Acad Sci USA
88:3314,
1991[Abstract/Free Full Text]
27.
Satoh T,
Nakafuku M,
Kaziro Y:
Function of Ras as a molecular switch in signal transduction.
J Biol Chem
267:24149,
1992[Free Full Text]
28.
Torti M,
Marti KB,
Altschuler D,
Yamamoto K,
Lapetina EG:
Erythropoietin induces p21 ras activation and p120GAP tyrosine phosphorylation in human erythroleukemia cells.
J Biol Chem
267:8293,
1992[Abstract/Free Full Text]
29.
Sato N,
Sakamaki K,
Terada N,
Arai K,
Miyajima A:
Signal transduction by the high-affinity GM-CSF receptor: Two distinct cytoplasmic regions of the common beta subunit responsible for different signal.
EMBO J
12:4181,
1993[Medline]
[Order article via Infotrieve]
30.
Todokoro K,
Sugiyama M,
Nishida E,
Nakaya K:
Activation of mitogen-activated protein kinase cascade through erythropoietin receptor.
Biochem Biophys Res Commun
203:1912,
1994[Medline]
[Order article via Infotrieve]
31.
Nagata Y,
Todokoro K:
Thrombopoietin induces activation of at least two distinct signaling pathways.
FEBS Lett
377:497,
1995[Medline]
[Order article via Infotrieve]
32.
Rausch O,
Marshall CJ:
Tyrosine 763 of the murine granulocyte colony-stimulating factor receptor mediates Ras-dependent activation of the JNK/SAPK mitogen-activated protein kinase pathway.
Mol Cell Biol
17:1170,
1997[Abstract]
33.
Nagata Y,
Nishida E,
Todokoro K:
Activation of JNK signaling pathway by erythropoietin, thrombopoietin, and interleukin-3.
Blood
89:2664,
1997[Abstract/Free Full Text]
34.
Nagata Y,
Moriguchi T,
Nishida E,
Todokoro K:
Activation of p38 MAP kinase pathway by erythropoietin and interleukin-3.
Blood
90:929,
1997[Abstract/Free Full Text]
35.
Foltz IN,
Schrader JW:
Activation of the stress-activated protein kinases by multiple hematopoietic growth factors with the exception of interleukin-4.
Blood
89:3092,
1997[Abstract/Free Full Text]
36.
Foltz IN,
Lee JC,
Young PR,
Schrader JW:
Hemopoietic growth factors with the exception of interleukin-4 activate the p38 mitogen-activated protein kinase pathway.
J Biol Chem
272:3296,
1997[Abstract/Free Full Text]
37.
Todokoro K,
Kanazawa S,
Amanuma H,
Ikawa Y:
Specific binding of erythropoietin to its receptor on responsive mouse erythroleukemia cells.
Proc Natl Acad Sci USA
84:4126,
1987[Abstract/Free Full Text]
38.
Worthington RE,
Bossiecodreanu J,
Vanzany G:
Quantitation in vitro using a sensitive colorimetric assay for hemoglobin.
Exp Hematol
15:85,
1987[Medline]
[Order article via Infotrieve]
39.
Sale EM,
Atkinson PG,
Sale GJ:
Requirement of MAP kinase for differentiation of fibroblasts to adipocytes, for insulin activation of p90 S6 kinase and for insulin or serum stimulation of DNA synthesis.
EMBO J
14:674,
1995[Medline]
[Order article via Infotrieve]
40.
Hibi M,
Lin A,
Smeal T,
Minden A,
Karin M:
Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain.
Genes Dev
7:2135,
1993[Abstract/Free Full Text]
41.
Mossmann T:
Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays.
J Immunol Methods
65:55,
1983[Medline]
[Order article via Infotrieve]
42.
Sellins KS,
Cohen JJ:
Gene induction by -irradiation leads to DNA fragmentation in lymphocytes.
J Immunol
139:3199,
1987[Abstract]
43.
Zechner D,
Thuerauf DJ,
Hanford DS,
McDonough PM,
Glembotski CC:
A role for the p38 mitogen-activated protein kinase pathway in myocardial cell growth, sarcomeric organization, and cardiac-specific gene expression.
J Cell Biol
139:115,
1997[Abstract/Free Full Text]
44.
Cowley S,
Paterson H,
Kemp P,
Marshall CJ:
Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells.
Cell
77:841,
1994[Medline]
[Order article via Infotrieve]
45.
Mansour SJ,
Matten WT,
Hermann AS,
Candia JM,
Rong S,
Fukasawa K,
Vande Woude GF,
Ahn NG:
Transformation of mammalian cells by constitutively active MAP kinase kinase.
Science
265:966,
1994[Abstract/Free Full Text]
46.
Font de Mora J,
Porras A,
Ahn N,
Santos E:
Mitogen-activated protein kinase activation is not necessary for, but antagonizes, 3T3-L1 adipocytic differentiation.
Mol Cell Biol
17:6068,
1997[Abstract]
47.
Alberola-Ila J,
Forbush KA,
Seger R,
Krebs EG,
Perlmutter RM:
Selective requirement for MAP kinase activation in thymocyte differentiation.
Nature
373:620,
1995[Medline]
[Order article via Infotrieve]
48.
Crompton T,
Gilmour KC,
Owen MJ:
The MAP kinase pathway controls differentiation from double-negative to double-positive thymocyte.
Cell
86:243,
1996[Medline]
[Order article via Infotrieve]
49.
Melemed AS,
Ryder JW,
Vik TA:
Activation of the mitogen-activated protein kinase pathway is involved in and sufficient for megakaryocytic differentiation of CMK cells.
Blood
90:3462,
1997[Abstract/Free Full Text]
50.
Rouyez MC,
Boucheron C,
Gisselbrecht S,
Dusanter-Fourt I,
Porteu F:
Control of thrombopoietin-induced megakaryocytic differentiation by the mitogen-activated protein kinase pathway.
Mol Cell Biol
17:4991,
1997[Abstract]
51.
Whalen AM,
Galasinski SC,
Shapiro PS,
Nahreini TS,
Ahn NG:
Megakaryocytic differentiation induced by constitutive activation of mitogen-activated protein kinase kinase.
Mol Cell Biol
17:1945,
1997
52.
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME:
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326,
1995[Abstract/Free Full Text]
53.
Ichijo H,
Nishida E,
Irie K,
Dijke P,
Saitoh M,
Moriguchi T,
Takagi M,
Matsumoto K,
Miyazono K,
Gotoh Y:
Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways.
Science
275:90,
1997[Abstract/Free Full Text]
54.
Johnson NL,
Gardner AM,
Diener KM,
Lange-Carter CA,
Gleavy J,
Jarpe MB,
Minden A,
Karin M,
Zon LI,
Johnson GL:
Signal transduction pathways regulated by mitogen-activated/extracellular response kinase kinase kinase induce cell death.
J Biol Chem
271:3229,
1996[Abstract/Free Full Text]
55.
Williams GT,
Smith CA,
Spooncer E,
Dexter TM,
Taylor DR:
Haemopoietic colony stimulating factors promote cell survival by suppressing apoptosis.
Nature
343:76,
1990[Medline]
[Order article via Infotrieve]
56.
Nishina H,
Fischer KD,
Radvanyi L,
Shahinian A,
Hakem R,
Rubie EA,
Bernstein A,
Mak TW,
Woodgett JR,
Penninger JM:
Stress-signalling kinase Sek1 protects thymocytes from apoptosis mediated by CD95 and CD3.
Nature
385:350,
1997[Medline]
[Order article via Infotrieve]
57.
Crawley JB,
Rawlinson L,
Lali FV,
Page TH,
Saklatvala J,
Foxwell BM:
T cell proliferation in response to interleukins 2 and 7 requires p38MAP kinase activation.
J Biol Chem
272:15023,
1997[Abstract/Free Full Text]
58.
Heasley LE,
Storey B,
Fanger GR,
Butterfield L,
Zamarripa J,
Blumberg D,
Maue RA:
GTPase-deficient G alpha 16 and G alpha q induce PC12 cell differentiation and persistent activation of cJun NH2-terminal kinases.
Mol Cell Biol
16:648,
1996[Abstract]
59.
de Groot RP,
Kruyt FA,
van der Saag PT,
Kruijer W:
Ectopic expression of c-jun leads to differentiation of P19 embryonal carcinoma cells.
EMBO J
9:1831,
1990[Medline]
[Order article via Infotrieve]
60.
Jho EH,
Davis RJ,
Malbon CC:
c-Jun amino-terminal kinase is regulated by Galpha12/Galpha13 and obligate for differentiation of P19 embryonal carcinoma cells by retinoic acid.
J Biol Chem
272:24468,
1997[Abstract/Free Full Text]
61.
Li J,
King I,
Satorelli AC:
Differentiation of WEHI-3B D+ myelomonocytic leukemia cells induced by ectopic expression of the protooncogene c-jun.
Cell Growth Differ
5:743,
1994[Abstract]
62.
Minowada G,
Welch W:
Variation in the expression and/or phosphorylation of the human low molecular weight stress protein during in vitro cell differentiation.
J Biol Chem
270:7047,
1995[Abstract/Free Full Text]
63.
Wang XZ,
Ron D:
Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP kinase.
Science
272:1347,
1996[Abstract]
64.
Kyriakis JM,
Avruch J:
Protein kinase cascades activated by stress and inflammatory cytokines.
Bioessays
18:567,
1996[Medline]
[Order article via Infotrieve]
65.
Kyriakis JM,
Avruch J:
Sounding the alarm: Protein kinase cascades activated by stress and inflammation.
J Biol Chem
271:24313,
1996[Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. A. Dalmas, L. A. Tierney, C. Zhang, P. K. Narayanan, R. W. Boyce, L. W. Schwartz, K. S. Frazier, and M. S. Scicchitano
Effects of p38 MAP Kinase Inhibitors on the Differentiation and Maturation of Erythroid Progenitors
Toxicol Pathol,
December 1, 2008;
36(7):
958 - 971.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bose and K. B. Udupa
Erythropoietin enhancement of rat pancreatic tumor cell proliferation requires the activation of ERK and JNK signals
Am J Physiol Cell Physiol,
August 1, 2008;
295(2):
C394 - C405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Ahuja, P. Sdek, and W. R. MacLellan
Cardiac Myocyte Cell Cycle Control in Development, Disease, and Regeneration
Physiol Rev,
April 1, 2007;
87(2):
521 - 544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Bugarski, A. Krstic, S. Mojsilovic, M. Vlaski, M. Petakov, G. Jovcic, N. Stojanovic, and P. Milenkovic
Signaling Pathways Implicated in Hematopoietic Progenitor Cell Proliferation and Differentiation
Experimental Biology and Medicine,
January 1, 2007;
232(1):
156 - 163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Sangerman, M. S. Lee, X. Yao, E. Oteng, C.-H. Hsiao, W. Li, S. Zein, S. F. Ofori-Acquah, and B. S. Pace
Mechanism for fetal hemoglobin induction by histone deacetylase inhibitors involves {gamma}-globin activation by CREB1 and ATF-2
Blood,
November 15, 2006;
108(10):
3590 - 3599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Menon, J. Fang, and D. M. Wojchowski
Core erythropoietin receptor signals for late erythroblast development
Blood,
April 1, 2006;
107(7):
2662 - 2672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Brown and S. Benchimol
The Involvement of MAPK Signaling Pathways in Determining the Cellular Response to p53 Activation: CELL CYCLE ARREST OR APOPTOSIS
J. Biol. Chem.,
February 17, 2006;
281(7):
3832 - 3840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nishigaki, C. Hanson, D. Thompson, T. Yugawa, and S. Ruscetti
Activation of the Jun N-Terminal Kinase Pathway by Friend Spleen Focus-Forming Virus and Its Role in the Growth and Survival of Friend Virus-Induced Erythroleukemia Cells
J. Virol.,
October 15, 2005;
79(20):
12752 - 12762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Renukaradhya, T. J. R. Webb, M. A. Khan, Y. L. Lin, W. Du, J. Gervay-Hague, and R. R. Brutkiewicz
Virus-Induced Inhibition of CD1d1-Mediated Antigen Presentation: Reciprocal Regulation by p38 and ERK
J. Immunol.,
October 1, 2005;
175(7):
4301 - 4308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. P. Kim, X. Wang, A. Nakao, S. I. Kim, N. Murase, M. E. Choi, S. W. Ryter, and A. M. K. Choi
Caveolin-1 expression by means of p38{beta} mitogen-activated protein kinase mediates the antiproliferative effect of carbon monoxide
PNAS,
August 9, 2005;
102(32):
11319 - 11324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Daoud, M. Amyot, E. Rassart, A. Masse, L. Simoneau, and J. Lafond
ERK1/2 and p38 regulate trophoblasts differentiation in human term placenta
J. Physiol.,
July 15, 2005;
566(2):
409 - 423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Kumar, G. Acs, D. Fang, M. Herlyn, D. E. Elder, and X. Xu
Functional Erythropoietin Autocrine Loop in Melanoma
Am. J. Pathol.,
March 1, 2005;
166(3):
823 - 830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jacobs-Helber and S. T. Sawyer
Jun N-terminal kinase promotes proliferation of immature erythroid cells and erythropoietin-dependent cell lines
Blood,
August 1, 2004;
104(3):
696 - 703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-S. Zhu, L. J. Robinson, V. Roginskaya, and S. J. Corey
G-CSF-induced tyrosine phosphorylation of Gab2 is Lyn kinase dependent and associated with enhanced Akt and differentiative, not proliferative, responses
Blood,
May 1, 2004;
103(9):
3305 - 3312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Baeza-Raja and P. Munoz-Canoves
p38 MAPK-induced Nuclear Factor-{kappa}B Activity Is Required for Skeletal Muscle Differentiation: Role of Interleukin-6
Mol. Biol. Cell,
April 1, 2004;
15(4):
2013 - 2026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Secchiero, E. Melloni, M. Heikinheimo, S. Mannisto, R. Di Pietro, A. Iacone, and G. Zauli
TRAIL regulates normal erythroid maturation through an ERK-dependent pathway
Blood,
January 15, 2004;
103(2):
517 - 522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Uddin, J. Ah-Kang, J. Ulaszek, D. Mahmud, and A. Wickrema
Differentiation stage-specific activation of p38 mitogen-activated protein kinase isoforms in primary human erythroid cells
PNAS,
January 6, 2004;
101(1):
147 - 152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Platanias
Map kinase signaling pathways and hematologic malignancies
Blood,
June 15, 2003;
101(12):
4667 - 4679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Guillard, S. Chretien, A.-S. Pelus, F. Porteu, O. Muller, P. Mayeux, and V. Duprez
Activation of the Mitogen-activated Protein Kinases Erk1/2 by Erythropoietin Receptor via a Gi Protein beta gamma -Subunit-initiated Pathway
J. Biol. Chem.,
March 21, 2003;
278(13):
11050 - 11056.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Witt, S. Monkemeyer, G. Ronndahl, B. Erdlenbruch, D. Reinhardt, K. Kanbach, and A. Pekrun
Induction of fetal hemoglobin expression by the histone deacetylase inhibitor apicidin
Blood,
March 1, 2003;
101(5):
2001 - 2007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jacobs-Helber, K.-h. Roh, D. Bailey, E. N. Dessypris, J. J. Ryan, J. Chen, A. Wickrema, D. L. Barber, P. Dent, and S. T. Sawyer
Tumor necrosis factor-alpha expressed constitutively in erythroid cells or induced by erythropoietin has negative and stimulatory roles in normal erythropoiesis and erythroleukemia
Blood,
January 15, 2003;
101(2):
524 - 531.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M.-Y. Ho, M. H.-H. Nguyen, J. K. Dierov, K. M. Badger, B. K. Beattie, P. Tartaro, R. Haq, B. W. Zanke, M. P. Carroll, and D. L. Barber
TEL-JAK2 constitutively activates the extracellular signal-regulated kinase (ERK), stress-activated protein/Jun kinase (SAPK/JNK), and p38 signaling pathways
Blood,
July 30, 2002;
100(4):
1438 - 1448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Haq, A. Halupa, B. K. Beattie, J. M. Mason, B. W. Zanke, and D. L. Barber
Regulation of Erythropoietin-induced STAT Serine Phosphorylation by Distinct Mitogen-activated Protein Kinases
J. Biol. Chem.,
May 3, 2002;
277(19):
17359 - 17366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jacobs-Helber, R. M. Abutin, C. Tian, M. Bondurant, A. Wickrema, and S. T. Sawyer
Role of JunB in Erythroid Differentiation
J. Biol. Chem.,
February 8, 2002;
277(7):
4859 - 4866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Barnache, P. Mayeux, B. Payrastre, and F. Moreau-Gachelin
Alterations of the phosphoinositide 3-kinase and mitogen-activated protein kinase signaling pathways in the erythropoietin-independent Spi-1/PU.1 transgenic proerythroblasts
Blood,
October 15, 2001;
98(8):
2372 - 2381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-I. Park, H.-S. Choi, J.-S. Jeong, J.-Y. Han, and I.-H. Kim
Involvement of p38 Kinase in Hydroxyurea-induced Differentiation of K562 Cells
Cell Growth Differ.,
September 1, 2001;
12(9):
481 - 486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rabehi, T. Irinopoulou, B. Cholley, N. Haeffner-Cavaillon, and M.-P. Carreno
Gram-Positive and Gram-Negative Bacteria Do Not Trigger Monocytic Cytokine Production through Similar Intracellular Pathways
Infect. Immun.,
July 1, 2001;
69(7):
4590 - 4599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Kadri, E. Petitfrère, C. Boudot, J.-M. Freyssinier, S. Fichelson, P. Mayeux, H. Emonard, W. Hornebeck, B. Haye, and C. Billat
Erythropoietin Induction of Tissue Inhibitors of Metalloproteinase-1 Expression and Secretion Is Mediated by Mitogen-activated Protein Kinase and Phosphatidylinositol 3-kinase Pathways
Cell Growth Differ.,
November 1, 2000;
11(11):
573 - 580.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Adachi, B. K. Choudhury, S. Stafford, S. Sur, and R. Alam
The Differential Role of Extracellular Signal-Regulated Kinases and p38 Mitogen-Activated Protein Kinase in Eosinophil Functions
J. Immunol.,
August 15, 2000;
165(4):
2198 - 2204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jacobs-Helber, J. J. Ryan, and S. T. Sawyer
JNK and p38 are activated by erythropoietin (EPO) but are not induced in apoptosis following EPO withdrawal in EPO-dependent HCD57 cells
Blood,
August 1, 2000;
96(3):
933 - 940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Witt, K. Sand, and A. Pekrun
Butyrate-induced erythroid differentiation of human K562 leukemia cells involves inhibition of ERK and activation of p38 MAP kinase pathways
Blood,
April 1, 2000;
95(7):
2391 - 2396.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. McCormack and T. J. Gonda
Novel murine myeloid cell lines that exhibit a differentiation switch in response to IL-3 or GM-CSF, or to different constitutively active mutants of the GM-CSF receptor beta subunit
Blood,
January 1, 2000;
95(1):
120 - 127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Shan, J. O. Price, W. A. Gaarde, B. P. Monia, S. B. Krantz, and Z. J. Zhao
Distinct Roles of JNKs/p38 MAP Kinase and ERKs in Apoptosis and Survival of HCD-57 Cells Induced by Withdrawal or Addition of Erythropoietin
Blood,
December 15, 1999;
94(12):
4067 - 4076.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Chen, B. H. Davis, M. Bissonnette, B. Scaglione-Sewell, and T. A. Brasitus
1,25-Dihydroxyvitamin D3 Stimulates Activator Protein-1-dependent Caco-2 Cell Differentiation
J. Biol. Chem.,
December 10, 1999;
274(50):
35505 - 35513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Engelman, A. H. Berg, R. Y. Lewis, A. Lin, M. P. Lisanti, and P. E. Scherer
Constitutively Active Mitogen-activated Protein Kinase Kinase 6 (MKK6) or Salicylate Induces Spontaneous 3T3-L1 Adipogenesis
J. Biol. Chem.,
December 10, 1999;
274(50):
35630 - 35638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Galbiati, D. Volonte, J. A. Engelman, P. E. Scherer, and M. P. Lisanti
Targeted Down-regulation of Caveolin-3 Is Sufficient to Inhibit Myotube Formation in Differentiating C2C12 Myoblasts. TRANSIENT ACTIVATION OF p38 MITOGEN-ACTIVATED PROTEIN KINASE IS REQUIRED FOR INDUCTION OF CAVEOLIN-3 EXPRESSION AND SUBSEQUENT MYOTUBE FORMATION
J. Biol. Chem.,
October 15, 1999;
274(42):
30315 - 30321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Fichelson, J.-M. Freyssinier, F. Picard, M. Fontenay-Roupie, M. Guesnu, M. Cherai, S. Gisselbrecht, and F. Porteu
Megakaryocyte Growth and Development Factor-Induced Proliferation and Differentiation Are Regulated by the Mitogen-Activated Protein Kinase Pathway in Primitive Cord Blood Hematopoietic Progenitors
Blood,
September 1, 1999;
94(5):
1601 - 1613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nagata and K. Todokoro
Requirement of Activation of JNK and p38 for Environmental Stress-Induced Erythroid Differentiation and Apoptosis and of Inhibition of ERK for Apoptosis
Blood,
August 1, 1999;
94(3):
853 - 863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Car and R. T. Robertson
Commentary: Discovery Toxicology--A Nascent Science
Toxicol Pathol,
July 1, 1999;
27(4):
481 - 483.
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nagata, F. Kiefer, T. Watanabe, and K. Todokoro
Activation of Hematopoietic Progenitor Kinase-1 by Erythropoietin
Blood,
May 15, 1999;
93(10):
3347 - 3354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Nath, H. Bian, E. F. Reed, and S. P. Chellappan
HLA Class I-Mediated Induction of Cell Proliferation Involves Cyclin E-Mediated Inactivation of Rb Function and Induction of E2F Activity
J. Immunol.,
May 1, 1999;
162(9):
5351 - 5358.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. T. Lam, C. Ronchini, J. Norton, A. J. Capobianco, and E. H. Bresnick
Suppression of Erythroid but Not Megakaryocytic Differentiation of Human K562 Erythroleukemic Cells by Notch-1
J. Biol. Chem.,
June 23, 2000;
275(26):
19676 - 19684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Alsayed, S. Uddin, N. Mahmud, F. Lekmine, D. V. Kalvakolanu, S. Minucci, G. Bokoch, and L. C. Platanias
Activation of Rac1 and the p38 Mitogen-activated Protein Kinase Pathway in Response to All-trans-retinoic Acid
J. Biol. Chem.,
February 2, 2001;
276(6):
4012 - 4019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Das, D. M. Bouchey, M. J. Moore, D. C. Hopkins, R. A. Nemenoff, and K. R. Stenmark
Hypoxia-induced Proliferative Response of Vascular Adventitial Fibroblasts Is Dependent on G Protein-mediated Activation of Mitogen-activated Protein Kinases
J. Biol. Chem.,
May 4, 2001;
276(19):
15631 - 15640.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|