|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 92 No. 6 (September 15), 1998:
pp. 1887-1897
By
From The Center for Blood Research, the Department of Genetics,
Harvard Medical School, and the Division of Clinical Genetics, The
Children's Hospital, the Combined Program in Pediatric
Gastroenterology and Nutrition, The Children's Hospital and
Massachusetts General Hospital, and the Division of Experimental
Pathology, Beth Israel Deaconess Hospital, Boston, MA; and Millennium
Pharmaceuticals, Inc, Cambridge, MA.
Eotaxin is a potent chemoattractant for eosinophils during
inflammation and allergic reactions in the adult, but its role in the
embryonic development of the hematopoietic system has not been
examined. We report here that eotaxin and its receptor, CCR-3, are
expressed by embryonic tissues responsible for blood development, such
as fetal liver (FL), yolk sac (YS), and peripheral blood. We found that
eotaxin acts synergistically with stem cell factor to accelerate the
differentiation of embryonic mast cell progenitors, and this response
can be suppressed by pertussis toxin, an inhibitor of
chemokine-induced signaling through Gi © 1998 by The American Society of Hematology.
CHEMOKINES PLAY AN important role in the
regulation of leukocyte trafficking and migration.1,2 In
most instances, the expression and function of chemokines has been
studied in adult mice during inflammatory responses. However, the
ability of chemokines to influence cell migration suggests that these
molecules may also play a role in embryonic development. For example,
hematopoietic progenitor cells must be recruited from early, transient
sites of blood development, such as the fetal liver (FL) and yolk sac (YS), to more definitive, adult sites of hematopoiesis, like the bone
marrow and spleen.3 While this developmental shift in the
site of hematopoiesis has been well documented, little is known about
the molecular signals that direct cellular trafficking in the
developing embryo.
Hematopoietic stem cells in mice were thought to originate in the YS.
However, recent evidence derived from studies in other species suggests
that the earliest precursors are located within the body of the embryo
proper.4-7 For example, chimeras constructed with chick YS
and quail bodies showed that yolk sac-derived cells populated the
organism only transiently, while long-term hematopoietic progeny were
derived from within the body of the developing embryo.6 These progeny appeared to colonize tissues over relatively short distances suggesting that secreted chemoattractants may be involved. In
mice, hematopoiesis involves the formation of "blood islands" in
the extraembryonic mesoderm of the visceral YS at 7.5 days postcoital
(dpc).8 Hematopoietic progenitors begin to fill these
islands at 7 to 8 dpc, before the circulatory systems and extraembryonic tissues of the embryo merge (at 8.5 dpc), and give rise
to primitive nucleated red blood cells (RBC). However, the greatest
number of definitive stem cells in the mouse were found in the
aorta-gonad-mesonephros (AGM) region of the embryonic
hindgut.9-11 The appearance of intraembryonic stem cell
activity in avian tissue was found to coincide with the clustering of
hematopoietic cells in the AGM region, implying that the AGM region was
the source of the stem cells.12 The factors controlling the
migration of these stem cells to extramedullary sites of hematopoiesis
are currently being investigated.
Several recent studies provide evidence that chemokines play a role in
hematopoietic development. The chemoattractant stromal-derived factor-1
(SDF-1) has been shown to induce the migration of CD34+
progenitors isolated from cord blood.13 Furthermore,
SDF-1-deficient mice exhibit defective myelopoiesis in the fetal bone
marrow and defective B-cell development in the fetal liver and bone
marrow.14 Another chemokine that influences hematopoiesis
is macrophage inflammatory protein-1 Our group and others have identified and characterized eotaxin, a
potent and specific chemoattractant for eosinophils during inflammation.17,18 Given the evidence that chemokines may
participate in hematopoietic development, we examined the expression
and function of eotaxin in progenitor cell proliferation and
differentiation. We now report that eotaxin is expressed at sites of
hematopoiesis in the embryo and that eotaxin, in combination with stem
cell factor (SCF), promotes the growth and differentiation of mast cell
progenitors.
Mice and Tissue Collection
Colony Growth and In Vitro Chemotaxis Assays
Growth of Bone Marrow Cultured Mast Cells Femoral bone marrow cells were obtained from BALB/c mice and maintained in Dulbecco's modified Eagle's medium (GIBCO) with 10% heat-inactivated fetal calf serum (Intergen, Purchase, NY), 50 mmol/L 2-mercaptoethanol, and 2 mmol/L L-glutamine at 37°C in 5% CO2 and supplemented with either concanavalin A-stimulated mouse spleen cell-conditioned medium (CM), as a source of IL-3 as previously described,20 or SCF (50 ng/mL). After 4 to 6 weeks, mast cells represented >98% of the total cells as determined by neutral red staining.Identification of Eotaxin RNA in Tissues by In Situ Hybridization Eotaxin mRNA expression in embryonic tissues was examined by in situ hybridization, as previously described.17 A 265-kb antisense RNA probe lacking the most conserved domains of the CC chemokine coding regions was prepared by T7 transcription of a Sac 1-digest of a murine eotaxin cDNA obtained by polymerase chain reaction (PCR) and subcloned into pBluescript. A sense probe was generated by SP6 transcription of an EcoRV-digest of the subclone. The probes were labeled with digoxigenin-uridine triphosphate (UTP) (Boehringer-Mannheim, Indianapolis, IN) and visualized by immunohistochemistry using antidigoxigenin antibodies coupled to alkaline phosphatase. Slides were counterstained with neutral red.Histochemical Staining Cytocentrifuge preparations were fixed in ice cold acetone for 10 minutes, then air dried. Slides were treated with the substrate for chloroacetate esterase, as described,21 1% toluidine blue in methanol for 5 minutes, or modified Giesma (1:20 dilution) for 60 minutes.Immunoperoxidase Staining Whole embryos were fixed in 10% formalin overnight, then dehydrated in serial concentrations of ethanol, embedded in paraffin, and 4-µm sections prepared. The slides were baked at 60°C for 1 hour to deparaffinize, washed in xylene, hydrated through serial concentrations of ethanol, then washed in phosphate-buffered saline (PBS). The slides were treated for 25 minutes with 0.1% trypsin in 0.1% calcium chloride, then preincubated with 10% fetal calf serum in PBS for 20 minutes. They were then incubated overnight at 4°C with a 1:10 dilution of monoclonal rat antimouse eotaxin antibodies. Endogenous peroxidase activity was quenched with 0.6% hydrogen peroxide in methanol and endogenous biotin activity blocked (Vector, Burlingame, CA) Biotinylated mouse antirat-IgG antibodies (Dako, Carpinteria, CA) were applied for 1 hour at room temperature (RT), the slides were washed, and then incubated with a complex of streptavidin-biotin for 30 minutes. Antibody deposition was visualized by incubation with diaminobenzidine and hydrogen peroxide (Vector) for 2 to 4 minutes, and the slides were subsequently washed in PBS and counterstained in hematoxylin. Immunoperoxidase staining for c-kit was performed using the anti-c-kit antibody, ACK2, at 5 mg/mL.22 Frozen sections (5 µm) were stained with anti-CD3423 (undiluted supernatant) and antiendoglin (10 µg/mL).24Immunofluorescent Analysis Cells in methylcellulose were collected in calcium/magnesium-free PBS containing 5 mmol/L EDTA, washed in PBS containing 0.1% bovine serum albumin and 0.1% sodium azide, and incubated for 15 minutes on ice with a monoclonal antibody to CD16/CD32(Fc III/II receptor;
Pharmingen, San Diego, CA). After three washes, they were incubated
with fluorescein isothiocyanate- or phycoerythrin-conjugated monoclonal
rat IgG antibodies (Pharmingen) for 30 minutes on ice, and stained
cells were analyzed on a FACSsort flow cytometer (Becton Dickinson,
Carpenteria, CA).
Reverse Transcriptase-Polymerase Chain Reaction Total RNA was prepared from fetal organs using the lithium chloride method.25 Mast cell protease mRNA expression was examined in colonies harvested on day 10 or 11 of culture. The cells were washed and suspended in 20 to 40 µL of di-ethyl pyrocarbonate (DEPC)-treated water and 40 U of RNase inhibitor was added. The pellet was boiled for 5 minutes, spun, and the supernatant was snap frozen for use in reverse transcriptase-polymerase chain reaction (RT-PCR) assays. RT-PCR was performed as previously described.17 The primer sequences for CCR-326 are GACAGCTTTGGAGAGTTTTCCTGCAGTCCTCGCTAT (5 ) and
AATATATTTTCCCAGGTAAACTGCCACATTTCT (3). To confirm the
specificity of the CCR-3 primers, PCR product from several embryonic
tissues was sequenced. As a control, RNA samples were subjected to the
same cycling conditions used to generate cDNA, except RT was absent
from the reaction. No PCR-amplified product was found, except for a
faint band that was present in yolk sac at 11 dpc, which was much
weaker than that found in YS amplified appropriately (data not shown).
Primer sequences for the serine proteases are: (1) mouse mast
cell-carboxypeptidase A (mMC-CPA): ACACAGGATCGAATGTGGAG (5) and
TAATGCAGGACTTCATGAGC (3); (2) mouse mast cell protease (mMCP)-2:
GTGATGACTGCTGCACACTG (5) and CTTGAAGAGTCTGACTCAGG (3);
(3) mMCP-4: GTAATTCCTCTGCCTCGTCCT (5) and ACCCAGGGTTATCAGAGCTC
(3).
Eotaxin mRNA is expressed in cells lining the primitive vessels of the YS. The YS is considered an important site of blood formation and/or vascularization in the embryo. We therefore examined the expression of eotaxin in the embryonic YS of mice using RNA in situ hybridization, RT-PCR, and immunoperoxidase staining. Cells lining primitive vessels within the YS at 10.5 dpc expressed eotaxin mRNA (Fig 1b and c) by in situ hybridization. These cells also expressed the endothelial markers CD34 (Fig 1f) and endoglin (data not shown), confirming that they represent endothelium.23,24 Cells within the lumen of the transected vessels also expressed eotaxin mRNA and the CD34 protein antigen (Fig 1c and f). The murine YS is composed of mesoderm and visceral endoderm cells.27 By 9.5 dpc, epithelial-like cells arise from the endoderm and primitive endothelium arises from the mesoderm. The visceral layer of the YS is thought to be crucial for the differentiation of mesodermally-derived cells into blood cells.27 We found that the visceral (epithelial) layer was negative for CD34, but positive for eotaxin by immunostaining (Fig 1e). The expression of eotaxin in the visceral layer appeared polarized with more staining seen along the edge of the cells oriented toward the lumen of the vessels.
Eotaxin and SCF synergistically induce colony formation from fetal
hematopoietic tissues.
Given the expression of eotaxin in fetal hematopoietic tissues, we next
asked whether eotaxin could induce the specific migration of
progenitors isolated from YS and FBL using a chemotaxis chamber (Fig 3).28 The migratory
(output) population was quantitated by colony-forming assays using
cytokines that support the growth of erythroid and myeloid progenitors,
but not lymphoid or megakaryocytic cells. No progenitors with
colony-forming ability migrated to eotaxin in multiple experiments
using fetal cells from gestational days 11-15 (Fig 3a). As a positive
control, we found strong chemotaxis of fetal liver progenitors to the
stromal cell supernatant, MS-5 (Fig 3a). MS-5 supernatant contains the
progenitor chemokine SDF-1
CFU-MIX are preferentially induced with SCF and eotaxin.
The type of colonies induced in our culture system was analyzed by
preparing cytospun preparations of individual colonies with varying
morphologies. We scored three types of colonies: CFU-E, CFU-MIX, and
CFU-macrophage (CFU-M). CFU-MIX contained cells of varying morphology,
including occasionally red-pigmented progeny, and the colonies were
diffusely scattered.13 Cytospun preparations confirmed that
colonies scored as CFU-MIX contained cells of varying size, nuclear
shape, and granulation (data not shown), and the majority of cells were
macrophages, mast cells, and immature, weakly-granulated cells. In Fig
4, data from pooled experiments (n = 6) are shown for FBL at day 11. Similar patterns were obtained with FL and YS. We conclude that
erythroid colonies are not induced by eotaxin alone in any tissue type.
CFU-MIX are most prevalent and additively increase in number with the
addition of eotaxin to SCF, as did CFU-M. The one exception to this
pattern was seen with YS, where the numbers of CFU-M were similar for each growth condition tested. Statistical analysis was performed using
the Friedman test for paired data. As stated above, synergistic increases in the total number of colonies and their size were seen for
FL only (Fig 3c through e), which likely reflects the rapid cell
proliferation in the liver at 11 dpc.
Phenotypic analysis of colonies grown with SCF and eotaxin.
The surface phenotype of the colony progeny produced was analyzed by
direct immunofluorescent staining with lineage-specific monoclonal
antibodies (MoAb) to myeloid cells (Mac-1; CD1132), RBC
(TER-11933), and granulocytes (Gr-134;
Table 1). In three of six experiments,
there was a synergistic increase of 1.63 times (± 0.4) in the
number of Mac-1+ cells from colonies grown in the presence
of both factors. In every case, however, synergy was only seen when the
source of progenitors for the assay was FBL. This might reflect
differences in Mac-1 expression in progenitors from different
hemaotopoietic sites, differential chemokine-induced adhesion molecule
expression (Mac-1) in organ resident (FL, YS) versus circulating
progenitors (FB), or simply limitations of the experimental system used
here. Mononuclear cells of variable size were the predominant cells induced with SCF and/or eotaxin (see Fig 3c through e). The
combined percentage of lineage-positive cells was always less than
100%, ranging from 15% to 51%. Thus, some of the lineage-negative
cells may be progenitors or stromal cells. To test this hypothesis, we
hand-pulled colonies of mixed morphology from 10-day old, YS-seeded cultures and replated these cells into methylcellulose containing IL-3,
SCF, and erythropoietin. Multiple colonies arose from these replated
cells with a plating efficiency of 19%, suggesting that undifferentiated progenitors can be maintained in our original cultures
with SCF and eotaxin (data not shown). Significant numbers of YS and
FBL-derived progeny were also positive for the SCF receptor, c-kit, a marker of progenitor cells29 and mast
cells at all stages of differentiation (Table 1).
Eotaxin influences mast cell development from embryonic progenitors.
When cytospun preparations of YS- and FBL-derived colonies induced with
SCF alone, eotaxin alone, or both factors were closely examined, we
identified a unique subpopulation of heavily granulated cells
(Fig 5C). These granulated cells were not
obtained from cultures grown in eotaxin alone or SCF alone at these
concentrations. However, cultures of progenitor cells in SCF alone at
concentrations of 50 ng/mL gave rise to cells with the same
morphological characteristics (Fig 5B). These prominent cytoplasmic
granules stained positively with toluidine blue (Fig 5D), a specific
stain for mast cells and basophils.35 The cells were also
positive for chloroacetate esterase, an enzyme found in cells of the
granulocytic lineage, including mast cells, but not eosinophils or
basophils.21 The number of granules per cell, cell size,
and nuclear profile (both mononuclear and multinucleated cells were
seen) were characteristic of mature mast cell populations derived in
vitro.36
Mast cells are more prevalent in colonies derived from FBL than from
FL.
We also examined the relative number of mast cells in FBL and FL
cultured in SCF and eotaxin. We found that the number of mature mast
cells in 10-day old methylcellulose cultures was greater in FBL (8% ± 3%) compared with fetal liver (<1%) at 11 dpc (Fig 5A). A
previous study showed that the FL contains approximately 10 times more
multipotent precursors for granulocytes, macrophages, and
megakaryocytes than FBL at 11 dpc.39 In our assay system, two to four times more total colonies were produced from FL in the
presence of SCF and eotaxin than from FBL and YS (Fig 3f), despite
using fivefold fewer FL cells to seed the cultures. The mean number of
total blood and FL cells per organism at 11 dpc was 8.5 ± 5.4 × 105 (n = 8) and 3.7 ± 2.6 × 105 (n = 5), respectively, which compares favorably with
reported estimates.39 The estimated frequency of FBL cells
at 11 dpc responsive to SCF in combination with eotaxin ranged from
0.02% (1/3,703 FBL) to 0.18% (1/555) with a mean of 0.05% (1/2,096 ± 1,312, n = 6) or Few studies have examined the role of chemoattractants in embryonic
hematopoietic development. Our study showed the chemokine eotaxin and
mRNA for its receptor, CCR-3, are expressed during embryogenesis. We
also found that eotaxin in combination with SCF synergistically induces
the differentiation from embryonic progenitors of granulated cells with
morphological features characteristic of mature mast cells, in vitro.
Mast cells were definitively identified by the expression pattern of
mast cell-specific proteases. There are several possibilities for this
observation. Eotaxin, acting through CCR-3 or another receptor, could
induce the secretion of additional SCF or other cytokines in culture
that accelerate mast cell proliferation, differentiation,
and/or survival. Alternatively, eotaxin could compensate for
low levels of c-kit occupancy by acting through a signaling
pathway that is shared by c-kit or IL-3. Ogasawara et
al,40 recently reported that mouse BM-derived mast cells initially grown in IL-3 undergo exocytosis and cytokine expression in response to G-protein-activating polybasic compounds after coculture with Swiss 3T3 fibroblasts and soluble c-kit
ligand. However, these responses were suppressed by pertussis
toxin; furthermore, they were not seen when BM-derived mast cells
were cultured with soluble SCF or 3T3 fibroblasts alone.
Phenotypically, the BM-mast cells cocultured with SCF and fibroblasts
resembled connective tissue-type mast cells, as they expressed
mMCP-4.41 This study suggested that a fibroblast-derived
mast cell maturation factor acted synergistically with SCF to mediate
the functional differentiation of BM-derived mast cells to connective
tissue-type mast cells that respond to polybasic compounds. While the
number of mature mast cells that developed in our methylcellulose
culture was insufficient to examine functional responses, our findings
suggest that eotaxin similarly aids SCF in promoting or maintaining
mast cell differentiation towards a mMCP-4-expressing mast cell.
Submitted September 22, 1997;
accepted May 19, 1998.
We wish to acknowledge Mark Ryan for his technical assistance in the
FACSsort analysis and Dr Clare Lloyd for her excellent assistance with
the immunohistochemical techniques. Dr L. Kremer (Centro Nacional de
Biotecnologia, Universidad Autonoma de Madrid) very kindly provided the
MoAb to eotaxin, and Dr Michelle Letarte (The Hospital for Sick
Children, University of Toronto) provided the antiendoglin MoAb.
Embryonic day 7.5 RNA was obtained from Dr Tak Mak at the University of
Toronto. We also wish to thank Dr Daniel Friend for his very helpful
comments and recommendations.
1.
Miller MD,
Krangel MS:
Biology and biochemistry of the chemokines: A family of chemotactic and inflammatory cytokines.
Crit Rev Immunol
12:17,
1992
2.
Bargatze RF,
Butcher EC:
Rapid G protein-regulated activation event involved in lymphocyte binding to high endothelial venules.
J Exp Med
178:367,
1993
3.
Johnson GR,
Moore MAS:
Role of stem cell migration in initiation of mouse foetal liver haemopoiesis.
Nature
258:726,
1975
4.
Kau C-L,
Turpen JB:
Dual contribution of embryonic ventral blood island and dorsal lateral plate mesoderm during ontogeny of hemopoietic cells in xenopus laevis.
J Immunol
131:2262,
1983
5.
Kelley C,
Yee K,
Harlan R,
Zon L:
Ventral expression of GATA-1 and GATA-2 in the xenopus embryo defines induction of hematopoietic mesoderm.
Dev Biol
165:193,
1994
6.
Martin C,
Beaupain D,
Dieterlen-Lievre F:
A study of the development of the hemopoietic system using quail-chick chimeras obtained by blastoderm recombination.
Dev Biol
75:303,
1980
7.
Detrich III HW,
Kieran MW,
Chan FY,
Barone LM,
Yee K,
Rundstadler JA,
Pratt S,
Ranson D,
Zon L:
Intraembryonic hematopoietic cell migration during vertebrate development.
Proc Natl Acad Sci USA
92:10713,
1995
8. Theiler K: The house mouse. An atlas of embryonic development.
New York, NY, Springer Verlag, 1989
9.
Dzierzak E,
Medvinsky A:
Mouse embryonic hematopoiesis.
Trends Genet
11:359,
1995
10.
Cumano A,
Dieterlen-Lievre F,
Godin I:
Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura.
Cell
86:907,
1996
11.
Medvinsky A,
Dzierzak E:
Definitive hematopoiesis is autonomously initiated by the AGM region.
Cell
86:897,
1996
12.
Garcia-Porrero JA,
Godin IE,
Dieterlen-Lievre F:
Potential intraembryonic hemogenic sites at pre-liver stages in the mouse.
Anat Embryol
192:425,
1995
13.
Aiuti A,
Bleul C,
Springer T,
Gutierrez-Ramos J-C:
The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood.
J Exp Med
185:111,
1997
14.
Nagasawa T,
Hirota,
S Tachibana K,
Takkura N,
Nishikawa S-I,
Kitamura Y,
Yoshida N,
Kikutani H,
Kishimoto T:
Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1.
Nature
382:635,
1996
15.
Broxmeyer HE,
Sherry B,
Lu L,
Cooper S,
Oh K-O,
Tekamp-Olson P,
Kwon BS,
Cerami A:
Enhancing and suppressing effects of recombinant murine macrophage inflammatory proteins on colony formation in vitro by bone marrow myeloid progenitor cells.
Blood
76:1110,
1990
16.
Leene W:
Origin and fate of lymphoid cells in the developing palatine tonsil of the rabbit.
Z Zellforschung
116:502,
1971
17.
Gonzalo J-A,
Jia G-Q,
Aguirre V,
Friend D,
Coyle AJ,
Jenkins NA,
Lin G-S,
Katz H,
Lichtman A,
Copeland N,
Kopf M,
Gutierrez-Ramos J-C:
Mouse eotaxin expression parallels eosinophil accumulation during lung allergic inflammation but it is not restricted to a Th2-type response.
Immunity
4:1,
1996
18.
Rothenberg ME,
Luster AD,
Leder P:
Murine eotaxin: An eosinophil chemoattractant inducible in endothelial cells and in interleukin 4-induced tumor suppression.
Proc Natl Acad Sci USA
92:8690,
1995
19.
Bleul C,
Fuhlbrigge RC,
Casanovas JM,
Aiuti A,
Springer TA:
A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1).
J Exp Med
184:1101,
1996
20.
Gordon JR,
Galli SJ:
Mast cells as a source of both pre-formed and immunologically inducible TNF-
21.
Yam LT,
Li CY,
Crosby WH:
Cytochemical identification of monocytes and granulocytes.
Am J Clin Pathol
55:283,
1971
22. (suppl)
Besmer P,
Manova K,
Duttlinger R,
Huang EJ,
Packer A,
Gyssler C,
Bachvarova RF:
The kit-ligand (steel factor) and its receptor c-kit/W: Pleiotropic roles in gametogenesis and melanogenesis.
Development
193:125,
1993
23.
Lin G,
Finger E,
Gutierrez-Ramos J-C:
Expression of CD34 in endothelial cells, hematopoietic progenitors and nervous cells in fetal and adult mouse tissues.
J Immunol
25:1508,
1995
24.
Gougos A,
Letarte M:
Biochemical characterization of the 44G4 antigen from the HOON pre-B leukemic cell line.
J Immunol
141:1925,
1988
25.
Auffray C,
Rougenon CO:
Purification of mouse immunoglobulin heavy chain messenger RNAs from total myeloma tumor RNA.
Eur J Biochem
107:303,
1979
26.
Post TW,
Bozic CR,
Rothenberg ME,
Luster AD,
Gerard N,
Gerard C:
Molecular characterization of two murine eosinophil chemokine receptors.
J Immunol
155:5299,
1995
27.
Yoder MC,
Papaioannou VE,
Breitfeld PP,
Williams DA:
Murine yolk sac endoderm- and mesoderm-derived cell lines support in vitro growth and differentiation of hematopoietic cells.
Blood
83:2436,
1994
28.
Rot A,
Krieger M,
Brunner T,
Bischoff SC,
Schall TJ,
Dalhinden CA:
RANTES and macrophage inflammatory protein 1 alpha induce the migration and activation of normal human eosinophil granulocytes.
J Exp Med
176:1489,
1992
29.
Ikuta K,
Weissman IL:
Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation.
Proc Natl Acad Sci USA
89:1502,
1992
30.
Yoder MC,
Hiatt K,
Dutt P,
Mukherjee P,
Bodine DM,
Orlic D:
Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac.
Immunity
7:335,
1997
31.
Sánchez M-J,
Holmes A,
Miles C,
Dzierzak E:
Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the embryo.
Immunity
5:513,
1996
32.
Springer TG,
Galfre G,
Secher DS,
Milstein C:
Mac-1: A macrophage differentiation antigen identified by a monclonal antibody.
Eur J Immunol
9:301,
1979
33.
Ikuta K,
Kina T,
Macneil I,
Uchida N,
Peault B,
Chien Y-H,
Weissman I:
A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic cells.
Cell
62:863,
1990
34.
Fleming TJ,
Fleming ML,
Malek TR:
Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAB to granulocyte differentiation antigen (Gr-1) detects members of the Ly-6 family.
J Immunol
151:2399,
1993
35.
Kirshenbaum AS,
Goff JP,
Kessler SW,
Mican JM,
Zsebo KM,
Metcalfe DD:
The effect of IL-3 and stem cell factor on the appearance of human basophils and mast cells from CD34+ pluripotent progenitor cells.
J Immunol
148:772,
1992
36.
Gurish MF,
Friend DS,
Webster M,
Ghildyal N,
Nicodemus CF,
Stevens RL:
Mouse mast cells that possess segmented/multi-lobular nuclei.
Blood
90:382,
1997
37.
Stevens RL,
Friend DS,
McNeil HP,
Schiller V,
Ghildyal N,
Austen F:
Strain-specific and tissue-specific expression of mouse mast cell secretory granule proteases.
Proc Natl Acad Sci USA
91:128,
1994
38.
Haig DM,
Huntley JF,
MacKellar A,
Newlands GFJ,
Inglis L,
Sangha R,
Cohen D,
Hapel A,
Galli S,
Miller RP:
Effects of stem cell factor (kit-ligand) and interleukin-3 on the growth and serine protease expression of rat bone-marrow-derived or serosal mast cells.
Blood
83:72,
1994
39.
Delassus S,
Cumano A:
Circulation of hematopoietic progenitors in the mouse embryo.
Immunity
4:97,
1996
40.
Ogasawara T,
Murakami M,
Suzuki-Nishimura T,
Uchida MK,
Kudo I:
Mouse bone marrow-derived mast cells undergo exocytosis, prostanoid generation, and cytokine expression in response to G protein-activating polybasic compounds after coculture with fibroblasts in the presence of c-kit ligand.
J Immunol
158:393,
1997
41.
Jippo T,
Tsujino K,
Kim H-M,
Kim D-K,
Lee Y-M,
Nawa Y,
Kitamura Y:
Expression of mast-cell-specific proteases in tissues of mice studied by in situ hybridization.
Am J Pathol
150:1373,
1997
42.
Rodewald H-R,
Dessing M,
Dvorak AM,
Galli SJ:
Identification of a committed precursor for the mast cell lineage.
Science
271:818,
1996
43.
Keller G,
Kennedy M,
Papayannopoulou T,
Wiles MV:
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol
13:473,
1993
44.
Guimarães MJ,
Bazan JF,
Zlotnik A,
Wiles MV,
Grimaldi JC,
Lee F,
McClanahan T:
A new approach to the study of hematopoietic development in the yolk sac and embryoid bodies.
Development
121:3335,
1995
45.
Quackenbush EJ,
Aquirre V,
Wershil BK,
Gutierrez-Ramos JC:
Eotaxin influences the development of embryonic hematopoietic progenitors in the mouse.
J Leukoc Biol
62:661,
1997
46.
Peled A,
Gonzalo JA,
Llyod C,
Gutierrez-Ramos JC:
The chemotactic cytokine, eotaxin, acts as a granulocyte and macrophage colony stimulating factor during lung inflammation.
Blood
91:1,
1998
47.
Papayannopoulou T,
Craddock C,
Nakamoto B,
Proiestley GV,
Wolf N:
The VLA4/VCAM adhesion pathway defines contrasting mechanisms of lodgement of transplanted murine hematopoietic progenitors between bone marrow and spleen.
Proc Natl Acad Sci USA
92:9647,
1995
48.
Smith JB,
Tabsh KM:
Fetal neutrophils and eosinophils express normal levels of L-selectin.
Pediatr Res
34:253,
1993
49.
Olweus J,
Terstappen LWMM,
Thompson PA,
Lund-Johansen F:
Expression and function of receptors for stem cell factor and erythropoietin during lineage commitment of human hematopoietic progenitors cells.
Blood
88:5,
1996
50.
Rothenberg ME,
MacLean JA,
Pearlman E,
Luster AD,
Leder P:
Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia.
J Exp Med
185:785,
1997
51.
Cook DN,
Beck MA,
Coffman TM,
Kirby SL,
Sheridan JF,
Pragnell IB,
Smithies O:
Requirement of MIP-1
52. Campbell JJ, Flescher EG, Butcher EC: Chemoattractant receptor
crosstalk as a potential regulatory mechanism in leukocyte adhesion and
migration. Keystone Symposium, Copper Mountain, CO, March 31-April 3, 1997 (abstr)
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 1998 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Abstract
Introduction
protein and chemotaxis. Eotaxin promotes the differentiation of fetal mast cell
progenitors into differentiated mast cells as defined by the expression
of mast cell specific proteases. Furthermore, in combination with stem
cell factor (SCF), it promotes the growth of Mac-1+
myeloid cells from embryonic progenitors. These studies suggest that
eotaxin may be involved in the growth of granulocytic progenitors and
the differentiation and/or function of mast cells during
embryogenesis and/or pathological conditions that induce high
levels of eotaxin, such as allergic responses.
Abstract
(MIP-1
1 colony/80,000 cells.
Cell migration was assessed in 24-well chemotaxis chambers (Corning
Costar, Cambridge, MA). A total of 5 × 105 cells were
placed in the upper chamber and tested for chemoattraction to media
alone (negative control), MS-5 supernatant (undiluted), or eotaxin at
100 ng/mL. The chambers were incubated for 3 hours at 37°C. Cells
migrating into the lower chamber were assessed on cytocentrifuge
preparations and in methylcellulose culture containing interleukin
(IL)-3 (10% vol), SCF (20 ng/mL), and human recombinant erythropoietin
(Epoetin Alfa Procrit, 4.3 U/mL; Amgen, Inc, Thousand Oaks, CA). In the
case of FBL cells, nucleated erythrocytes could not be excluded from
cell counts by microscopic inspection.
20°C.
-actin
(20 cycles), eotaxin (30 cycles), and CCR-3 (32 cycles) primers to
generate fragments of 348, 108, and 454 bp, respectively. Adult tissues
(A) were used as a control.
) SCF; (
) Eotaxin; (
) SCF + Eotaxin.
