|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 6 (September 15), 1998:
pp. 2032-2040
Stimulation of Mouse and Human Primitive Hematopoiesis by Murine
Embryonic Aorta-Gonad-Mesonephros-Derived Stromal Cell Lines
By
Ming-jiang Xu,
Kohichiro Tsuji,
Takahiro Ueda,
Yoh-suke Mukouyama,
Takahiko Hara,
Feng-Chun Yang,
Yasuhiro Ebihara,
Sahoko Matsuoka,
Atsushi Manabe,
Akira Kikuchi,
Mamoru Ito,
Atsushi Miyajima, and
Tatsutoshi Nakahata
From the Department of Clinical Oncology, The Institute of Medical
Science, and the Institute of Molecular and Cellular Bioscience, The
University of Tokyo, Tokyo, Japan; and the Central Institute for
Experimental Animals, Kawasaki, Japan.
 |
ABSTRACT |
We report here on a novel stromal cell line, AGM-S3, derived from
the aorta-gonad-mesonephros (AGM) region of a 10.5 days postcoitum
(dpc) mouse embryo. The AGM-S3 cells promoted production of
hematopoietic progenitors and day-12 spleen colony-forming cells from
Lin c-Kit+Sca-1+ murine
primitive hematopoietic cells. They also supported for 6 weeks
generation of human multipotential progenitors from cord blood
CD34+CD38 primitive hematopoietic cells.
Human long-term repopulating hematopoietic stem cells (LTR-HSC) with
the potential to reconstitute hematopoiesis in NOD/SCID mice were
maintained on AGM-S3 cells for at least 4 weeks. Flow cytometric
analysis showed that CD13, vascular cellular adhesion molecule-1, and
Sca-1 were expressed on AGM-S3 cells. Because stem cell factor,
interleukin-6 (IL-6), and oncostatin M, but not IL-3, IL-11, leukemia-
inhibitory factor, granulocyte colony-stimulating factor,
granulocyte-macrophage colony-stimulating factor, thrombopoietin, and
Flk2 ligand were detected in reverse transcription-polymerase chain
reaction analysis of AGM-S3 cells, the cells seem to express
species-cross reactive molecule(s) other than the cytokines examined
and which act on primitive hematopoietic progenitor/stem cells. This
cell line is expected to elucidate molecular mechanisms regulating
early hematopoiesis and pave the way for developing strategies for
expansion of human transplantable HSC.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
MUCH ATTENTION has been directed to
regulatory mechanisms governing the proliferation, self-renewal, and
differentiation of primitive hematopoietic stem and progenitor cells.
Knowledge of such mechanisms will facilitate ex vivo expansion of human
hematopoietic stem cells for transplantation and for gene therapy.
Although cytokines that act on primitive hematopoietic cells have been identified,1 attempts to expand transplantable
hematopoietic stem cells by defined cytokines have had limited
success.2-4 It is widely accepted that the microenvironment
plays an important role in hematopoiesis in vivo5 and that
stromal cells are principal components of the microenvironment. Indeed,
several cloned stromal cell lines can promote the survival,
proliferation, and differentiation of hematopoietic cells in
vitro.6-9
In the developing mouse embryo, hematopoietic cells first appear in the
yolk sac (YS) at 7.5 days postcoitum (dpc),10 but recent
studies have shown that definitive hematopoiesis might originate in an
intraembryonic site. Dissections of 8 to 9 dpc embryos have localized
multipotent progenitor activity to the para-aortic splanchnopleural
mesoderm (P-Sp).11 It has been shown that spleen
colony-forming units (CFU-S) appear simultaneously in YS and
aorta-gonad-mesonephros (AGM) region at late 9 dpc.12 The
number and frequency of CFU-S in the AGM region greatly exceed those in
the YS, increase dramatically at late 10 dpc, and then decrease at 11 dpc before a concomitant increase in the fetal liver (FL). It has been
also demonstrated that, using conditioned newborn or embryonic mice as
hematopoietic transplant recipients, long-term repopulating
hematopoietic stem cells (LTR-HSC) can be detected as early as 9 dpc in
YS and P-Sp.13 However, when conditioned adult mice are
used as the recipients, LTR-HSC are first noted in the AGM region at 10 dpc, before such activity being observed in YS and FL, and expand in 11 dpc AGM region,14,15 suggesting that the AGM region at 10 to 11 dpc provides a microenvironment suitable for the development of
LTR-HSC. These observations prompted us to establish stromal cell lines
from the AGM region at 10 to 11 dpc, which would support ex vivo
expansion of HSC.
We obtained a stromal cell line, AGM-S3, derived from the AGM region of
10.5 dpc mouse embryo. When cocultured with the stromal cells,
hematopoietic cells, especially primitive hematopoietic progenitor/stem
cells in adult mouse bone marrow and human cord blood, significantly
proliferated without additional cytokines. This cell line can now be
used to elucidate the molecular mechanisms regulating early
hematopoiesis and provide strategies for the manipulation of primitive
hematopoietic progenitor/stem cells.
| |
MATERIALS AND METHODS |
Mice and tissues.
C3H/HeN and C57BL/6 mice, 8 to 10 weeks old, were purchased from
Shizuoka Animal Farm (Shizuoka, Japan) and kept under specific pathogen-free conditions. One or two female C3H/HeN mice were caged
with a male for 2 hours late in the afternoon and then examined for
vaginal plugs. The appearance of the vaginal plug was designated as day
0 of gestation. On day 10.5 of gestation, pregnant mice were
anesthetized by ether and then killed by cervical dislocation; from the
embryos we dissected the region surrounding aorta, genital ridge, and
mesonephros using a dissecting microscope and phosphate-buffered saline
(PBS; Nissui, Tokyo, Japan). Eight-week-old male C57BL/6 mice were used
for the assay of hematopoietic progenitors and CFU-S.
Cell preparation.
Mouse bone marrow cells (BMC) were flushed from femurs and tibiae into
a-medium (Flow Laboratories, Rockville, MD). Human umbilical cord blood cells (CBC), collected according to institutional guidance, were obtained during normal full-term vaginal deliveries. Mononuclear cells (MNC) were separated by Ficoll-Hypaque density gradient centrifugation after depletion of phagocytes with Silica (IBL,
Fujioka, Japan). CD34+ cells were purified from MNC by
using Dynabeads M-450 CD34 and DETACHaBEAD CD34 (Dynal, Oslo,
Norway).16 Eighty-five percent to 95% of the cells
separated were CD34 positive by flow cytometric analysis. MS-5 cells
were kindly provided by Dr Kazuhiro J. Mori (Niigata University,
Niigata, Japan).
Cytokines.
Recombinant human (h) and mouse (m) stem cell factor (SCF) and mouse
interleukin-3 (IL-3) were kindly provided by Amgen (Thousand Oaks, CA).
Recombinant human IL-3, IL-6, granulocyte colony-stimulating factor
(G-CSF), erythropoietin (EPO), and thrombopoietin (TPO) were a generous
gift from Kirin Brewery Co Ltd (Tokyo, Japan). All the cytokines were
pure recombinant molecules and were used at concentrations that induced
optimal response in methylcellulose culture of human and mouse
hematopoietic cells.
Establishment of stromal cell lines.
AGM tissues were removed from 10.5 dpc embryos of C3H/HeN mice,
dissected to some pieces whose length was approximately 0.3 mm, and
cultured in 24-well plates (#143982; Nunc, Naperville, IL) overnight
with a drop of  -medium containing 10% fetal bovine serum (FBS;
Hyclone Laboratories, Logan, UT) at 37°C in a humidified atmosphere
flushed with 5% CO2 in air, and 1 mL of culture medium was
added to the well the next day. The adherent cells appeared around the
tissues 1 week later, and the AGM tissues were then removed. After 1 additional week of incubation, the adherent cells were harvested from
the well using 0.05% trypsin containing 0.53 mmol EDTA (GIBCO BPL,
Grand Island, NY) and were plated in 6-well plates (#152795; Nunc).
After 2 weeks of incubation, the cultured cells were irradiated with
900-rad  -ray to deplete hematopoietic cells. The medium was replaced
with fresh culture medium once weekly. Adherent cells were harvested 2 weeks later using trypsin and 50 to 100 cells were seeded into 24-well
plates. After 3 weeks of incubation, cells expanded in a well were
harvested and used for cell cloning by the limiting dilution technique
(0.3 cells/well).17 When proliferating cells were present
in each well, they were individually transferred to 25-cm2
flasks (#163371; Nunc) containing the culture medium described above.
Seventeen cloned cell lines were consequently established. Fourteen of
them showed fibroblastoid morphology and had no effect on
hematopoiesis, and the remaining 3 cell lines could support hematopoiesis, as described in Results. The three lines were used for
the following experiments.
Coculture of hematopoietic cells with stromal cells.
Stromal cells were prepared in 24- or 6-well plates. After 3 to 5 days,
mouse and human hematopoietic cells were cocultured with the stromal
cells. In stroma-noncontact cultures, human CB CD34+ cells
were incubated in the upper compartment of transwell inserts placed on
top of stromal cell layers prepared in the lower compartment of a
24-well plate (#3421; Costar, Cambridge, MA). The transwell microporous
membrane of the insert cultures was a 0.4-µm microporous filter
(Costar). Stroma-free cultures were established by seeding cells in the
upper compartment of the transwell insert placed in empty wells. The
same volume of culture medium was added to wells on day 7, and half the
amount of growth medium was exchanged every week from week 2. All the
plates were incubated at 37°C in a humidified atmosphere flushed
with 5% CO2 in air. The cells containing stromal cells and
expanded cells were harvested using 0.05% trypsin plus 0.53 mmol EDTA
after a 1 to 6 weeks of incubation.
Clonal cell culture.
Methylcellulose clonal culture was performed using a modification of
the technique described previously.18,19 Briefly, 1 mL of
culture mixture containing cells, -medium, 0.9% methylcellulose (Shinetsu Chemical Co, Tokyo, Japan), 30% FBS, 1% deionized fraction V bovine serum albumin (BSA; Sigma, St Louis, MO), 5 × 105 mol/L mercaptoethanol (Eastman Organic Chemicals,
Rochester, NY), and combinations of cytokines was plated in 35-mm
nontissue culture dishes (#1008; Falcon, Lincoln Park, NJ) and
incubated at 37°C in a humidified atmosphere flushed with 5%
CO2 in air. A combination of 100 ng/mL mSCF or hSCF, 20 ng/mL mIL-3 or hIL-3, 100 ng/mL hIL-6, 2 U/mL hEPO, 10 ng/mL hG-CSF,
and 4 ng/mL hTPO was used for the determination of the murine and the
human clonogenic progenitor cells, respectively. All cultures were
performed in triplicate and the number of colony-forming cells (CFU-C)
was scored at days 7 to 8 and days 12 to 16 of culture in mouse and human, respectively. Colony types were determined by in situ
observation using an inverted microscope and according to the criteria
described previously.19-21 The abbreviations used for the
clonogenic progenitor cells are as follows: BFU-E, erythroid
burst-forming units; CFU-GM, granulocyte-macrophage colony-forming
units; CFU- Mk, megakaryocyte colony-forming units; CFU-Mix, mixed
colony-forming units.
CFU-S assay.
Cells were injected into C57BL/6 mice exposed to 920 rads
(60Co) of total irradiation via the tail vein. Eight and 12 days after the injection, the recipients were killed and their spleens
were removed and fixed in Bouin's solution. Macroscopic colonies
(day-8- and day-12 CFU-S) were counted under a dissecting
microscope.22
Flow cytometric analysis.
Surface markers of stromal cells were analyzed by flow cytometric
analysis using the FACSCalibur (Becton Dickinson, Mountain View, CA),
as described.23 The cells were stained with fluorescein isothiocyanate (FITC)-conjugated antimouse CD34 (RAM34; Pharmingen, San
Diego, CA), phycoerythrin (PE)-conjugated antimouse Sca-1 (E13-161.7;
Pharmingen), and biotin-conjugated antimouse c-Kit (2B8), CD3 (145- 2C11), CD4 (RM4-5), CD8 (53-6.7), B220 (RA3-6B2), Mac-1 (M1/70), Gr-1
(RB6-8C5), TR119 (TER-119) vascular cellular adhesion molecule-1
(VCAM-1) (429), platelet endothelial cellular adhesion molecule-1
(PECAM-1) (MEC13.3), E-selectin (10E9.6), P-selectin (RB40.34), and
CD13 (R3-242) purchased from Pharmingen, followed by PE-conjugated
streptavidin (Becton Dickinson, San Jose, CA). Positivity or negativity
for each antibody was determined based on cells stained with
FITC-conjugated rat IgG2a (Cedarlane Laboratories, Ltd,
Horndy, Canada), PE-conjugated rat IgG2b (Cedarlane Laboratories, Ltd), or only PE-conjugated streptavidin, as negative controls.
Cell sorting.
Sorting of murine and human hematopoietic progenitors was performed
using described methods.23 Briefly, mouse BM MNC were incubated with PE-conjugated anti-Sca-1, allophycocyanin
(APC)-conjugated anti-c-Kit (ACK-2; kindly provided by Dr Shin-Ichi
Nishikawa, Kyoto University, Kyoto, Japan), and biotin-conjugated
antimouse B220, Mac-1, Gr-1, CD4, CD8, and TR119 monoclonal antibodies, followed by incubation with Texas red (TR)-conjugated streptavidin (Life Technologies, Inc, Rockville, MD). The negative controls were
cells stained with PE-conjugated rat IgG2a (Cedarlane Laboratories, Ltd), APC-conjugated rat IgG2b (Pharmingen), or only TR-conjugated streptavidin. Based on these controls,
Linc-Kit+Sca-1+/ cells were
sorted with a FACSVantage (Becton Dickinson). Human CD34+CD38+/ cells were sorted from CB MNC
stained with FITC-conjugated antihuman CD34 (My10; Becton Dickinson)
and PE-conjugated antihuman CD38 (HB-7; Becton Dickinson), based on
cells stained with FITC- and PE-conjugated mouse IgG1 (Becton
Dickinson) as the negative control.
Reverse transcription-polymerase chain reaction (RT-PCR).
Total RNA was prepared from AGM-S3 and MS-5 cells using QIAGEN RNeasy
kit (Amersham, Uppsala, Sweden), incubated with
deoxyribonuclease I, and reverse-transcribed using the first-strand
cDNA synthesis kit (Pharmacia).
Cytokine-specific cDNAs were amplified with Taq DNA polymerase, using
pairs of oligonucleotide primers as follows24-26: IL-3-5 ,
TCAGACTTTAGGTGCTCTGC-3; IL-3-3, TCGTGGAAAGCCAAGGAGAA-3; IL-6-5,
GATAGTCAATTCCAGAAACCGCTA-3; IL-6-3, TACTCCAGGTAGCTATGGTACTCC-3; oncostatin M (OSM)-5, TCCGCCTCCAAAACCTGAACAC-3; OSM-3,
TCTGTGTGGGCTCAGGTATCT-3; leukemia inhibitory factor (LIF)-5,
GGAGTCCAGCCCATAATGAAGGTC-3; LIF-3, GGCCTGGACCACCACACTTATGAC-3;
G-CSF-5, GACGGCTCGCCTTGCTCTGCACCA-3; G-CSF-3,
ACCTGGCTGCCACTGTTTCTT-TAGG-3; granulocyte-macrophage colony-stimulating factor (GM-CSF)-5, AGAAGCTAACATGTGTGCAGACCCG-3; GM-CSF-3, ATTCCAAGTTCCTGGCTCATTACGC-3; macrophage colony-stimulating factor (M-CSF)-5, GACAGGCCGTTGACAGAGGTGAACCC-3; M-CSF-3,
ATAGAATCCTTTCT-ATACTGGCAGTTC-3; SCF-5,
AAAGTAAAACTCGAGATGAAGAAGACACAAACTTGG-3; SCF-3,
TTTGACTTTTTAATTAATTAGGCTGCAACAGGGGGTAACAT-3; Flk2 ligand (FL)-5,
AAAGAAAAACTCGAGATGACAGTGCAGGCGCCAGCC-3; FL-3,
TTTGACTTTTTAATTAATTACTGCCT GGGCCGAGGCTCTGG-3; TPO-5, CAGGACCACAGCTCACAAGGAC-3; TPO-3, CCATTCACAGGTCCGTGTGTCC-3; IL-11-5,
CTCTGGCCAGATAGAGTCGTTG-3; IL-11-3, CACGGCGCAGCCATTGTACATG-3; HPRT-5, CCTGCTGGATTACATTAAAG CACTG-3; HPRT-3,
GTCAAGGGCATATCCAACAACAAAC-3. Samples were denatured at 94°C for 3 minutes, followed by amplification rounds consisting of 94°C for 1 minute (denaturing); 55°C to 65°C for 2 minutes (annealing),
and 72°C for 3 minutes (extension) for 40 cycles. Products were
separated on a 1.0% agarose gel, stained with ethidium bromide, and
photographed.
Transplantation into NOD/SCID mice.
CB MNC (1 × 106) and those cultured with stromal
cells for 4 weeks were injected into 8- to 10-week-old NOD/Shi-scid
(NOD/SCID) mice irradiated with 300 rads (60Co) of total
irradiation through the tail vein. Because natural killer cell activity
of NOD/Shi-scid mice is not so low,27 the recipient mice
were injected intraperitoneally with 300 mL of PBS containing 20 mL of
anti-asialo GM1 antibody (Wako, Osaka, Japan) immediately before the
cell transplantation and on day 11 of transplantation. Mice were killed
5 weeks after the transplantation, and BMC were collected. The presence
of human hematopoietic cells was determined by detection of cells
positively stained with FITC-conjugated antihuman CD45 in flow
cytometric analysis. Specific subsets of human hematopoietic cells were
quantified by gating on human CD45-PE-cyanine 5-succinimidylester
(PECy5)-positive cells and then assessing staining with antihuman
CD13-PE, CD33-PE, CD14-PE, CD10-FITC, CD19-PE, CD3-FITC, and CD34-FITC.
All antibodies were from Becton Dickinson except for antihuman
CD34-FITC (Immunoteck, Marseille, France). Human hematopoietic cells
were also determined by detection human ALU sequence in DNA of the BMC
by PCR analysis. For PCR analysis, DNA extracted from the BMC was
subjected to PCR amplification using as primers the following human
ALU28 and mouse  -actin29 sequences: ALU-5,
CACCTGTAATCCCAGCAGTTT-3; ALU-3, CGCGATCTCGGCTCACTGCA-3;
-actin-5, GTGGGCCGCTCTAGGCACCAA-3, -actin-3,
CTCTTTGATGTCACGCACGATTTC-3.
| |
RESULTS |
Establishment of stromal cell lines from 10.5 dpc mouse embryo AGM
region.
Three stromal cell lines, AGM-S1, 2, and 3, were obtained from the 10.5 dpc mouse embryo AGM region. They were maintained in -medium
containing 10% FBS in 25-cm2 flasks at 37°C in a
humidified atmosphere flushed with 5% CO2 in air. These
conditions led to doubling times of 5 to 7 days and 100% viability.
The photomicograph (Fig 1A) shows the
appearance of one of these, AGM-S3. AGM-S3 cells had large, flat cell
morphology with widely spread cytoplasm, and some of them converted to
fat-containing cells in confluent culture. AGM-S1 and AGM-S2 cells
manifested a similar morphology to AGM-S3 cells.
View larger version (91K):
[in this window]
[in a new window]
| Fig 1.
(A) Phase microscopy of AGM-S3 cells established. (B)
Appearance of cobblestone-like colonies generated in the coculture of
human CB CD34+ cells with AGM-S3 cells at day 14 of
culture. (C) Appearance of a part of a mixed hematopoietic colony
produced by the cells harvested from the coculture of
CD34+CD38 cells with AGM-S3 cells at week
6 of culture.
|
|
Effect of AGM-S1, 2, and 3 cells on mouse BM progenitor cells.
We first examined the effect of AGM-S1, 2, and 3 stromal cells on adult
hematopoietic cells in the coculture with BMC of C57BL/6 mice. When 1 × 105 BMC were plated on the stromal cell layers,
cobblestone-like colonies appeared under the stromal layers at day 3 of
incubation and then gradually increased. The colonies in the cocultures
with AGM-S1 and 3 cells were almostly twice the number of those with AGM-S2 cells at day 7 (Table 1). Clonal
assay of the cells in the coculture at day 7 of incubation showed that
the three cell lines supported the expansion of CFU-C. However, the
numbers of CFU-C in the cocultures with AGM-S1 and 3 cells were
approximately 5 to 7 times larger than that with AGM-S2 cells. Day-8
and day-12 CFU-S also expanded at day 7 of the coculture with AGM-S1
and 3 cells. This result indicates that AGM-S1, 2, and 3 cells are able
to promote the proliferation of hematopoietic progenitors without any
exogenous cytokines, but AGM-S2 cells seem to have less ability on
murine hematopoietic progenitors than do AGM-S1 and 3 cells.
Effect of AGM-S3 cells on
Linc-Kit+Sca-1+/
mouse BMC.
To investigate the effect of AGM-S3 cells on murine hematopoietic
progenitors in more detail, sorted
Linc-Kit+Sca-1+ and
Linc-Kit+Sca-1 cells shown to
contain murine primitive hematopoietic cells and more mature ones,
respectively,30 were cocultured with AGM-S3 cells, which
were considered to be the most potent stimulator on murine
hematopoietic progenitors among the three cell lines (Table 2). When 100 sorted
Linc-Kit+Sca-1 cells were
cocultured with AGM-S3 cells, no hematopoietic progenitors were
detected in the coculture at day 10 of culture. By contrast, in the
culture of 100 Linc-Kit+Sca-1+
cells, all types of progenitors, including CFU-GM, BFU-E, CFU-Mk, CFU-Mix, and day-8 and day-12 CFU-S, showed a remarked expansion. In
particular, CFU-Mix and day-12 CFU-S, immature hematopoietic progenitors, increased 80-fold and 10-fold, respectively, and remained
detectable after 6 weeks of coculture of AGM-S3 cells with
Linc-Kit+Sca-1+ cells (data not
shown). Thus, most of hematopoietic progenitors expanded in the
coculture with AGM-S3 cells were derived from Linc-Kit+Sca-1+ cells,
indicating that AGM-S3 cells act on primitive hematopoietic cells of
the adult mouse.
Effect of AGM-S1, 2, and 3 and MS-5 cells on human CB CD34+
cells.
Some murine stromal cell lines have been shown to support human
hematopoiesis.31 For example, MS-5 cells,17 a
stromal cell line esablished from adult mouse BMC, can stimulate
proliferation of human hematopoietic progenitors.31 We then
cocultured human CB CD34+ cells with AGM-S1, 2, and 3 and
MS-5 cells to examine the effect of these stromal cells on human
hematopoietic progenitors. Five hundred human CB CD34+
cells were cocultured with AGM-S1, 2, and 3 and MS-5 cells prepared in
24-well plates. At days 7 to 10 of incubation, cobblestone-like colonies appeared under these stromal cells (Fig 1B), and nonadherent hematopoietic cells continued to be released into the culture medium
after day 14. Clonal assay of the cells harvested from the coculture at
week 3 of incubation showed that all the cell lines stimulated the
expansion of human CB hematopoietic progenitors, but AGM-S1 and 3 cells
again showed more significant stimulatory activity than AGM-S2, and
MS-5 cells showed similar effects to AGM-S2 cells
(Table 3). The number of total progenitors
on AGM-S1, 2, and 3 and MS-5 cells increased 5.3-fold, 3-fold,
4.8-fold, and 2.3-fold, respectively, at week 3 of culture. Although
clonogenic progenitors were detectable after 6 weeks of incubation with
these stromal cells, the numbers of progenitors in coculture with
AGM-S1 and 3 cells were approximately 5 times that with AGM-S2 and MS-5 cells. Interestingly, all of the CFU-GM, BFU-E, and CFU-Mix were present in cocultures with AGM-S1 and 3 cells, whereas only CFU-GM were
detected in coculture with AGM-S2 and MS-5 cells at 6 weeks of culture.
This result indicates that AGM-S1 and 3 cells are more potent
stimulators than AGM-S2 and MS-5 cells on human CB hematopoietic cells.
Effect of AGM-S3 cells on human CB
CD34+CD38+/ cells.
To examine whether AGM-S3 cells act on human primitive hematopoietic
progenitor cells, we compared the effects of AGM-S3 cells on
CD34+CD38 and
CD34+CD38+ cells, which have been shown to
reflect human primitive hematopoietic cells and more mature
populations, respectively32
(Table 4). When both fractions sorted from
CB MNC were cocultured with AGM-S3 cells, hematopoietic progenitors
generated from CD34+CD38+ cells exceeded those
from CD34+CD38 cells at week 4 of
incubation. However, at week 6, numbers of progenitors from
CD34+CD38 cells surpassed those from
CD34+CD38+ cells, and neither BFU-E nor CFU-Mix
were detectable in the culture of CD34+CD38+
cells, whereas progenitors from CD34+CD38
cells contained 7% of BFU-E and 20% of CFU-Mix (Fig 1C). The result
indicates that AGM-S3 cells act on both
CD34+CD38+ and
CD34+CD38 cells and that the generation of
CFU-Mix, immature multipotential progenitors, from
CD34+CD38 primitive hematopoietic cells was
supported by AGM-S3 cells at least for 6 weeks.
Effect of AGM-S3 cells on human reconstituting hematopoietic stem
cells.
To investigate the effect of AGM-S3 cells on human reconstituting
hematopoietic stem cells, we performed transplantation experiments using NOD/SCID mice and examined the reconstituting abilities of CB MNC
before and after the coculture with AGM-S3 cells. When 1 × 106 CB MNC cocultured with AGM-S3 cells for 4 weeks were
transplanted into NOD/SCID mice, human CD45+ cells were
found in BMC of the recipient mice, as determined by flow cytometry
(Fig 2A) after 5 weeks of transplantation.
Chimerism percentages of human CD45+ cells in BMC were
6.2% and 5.2% in the mice transplanted with CB MNC before and after
the coculture, respectively. Human CD45+ cells in BMC of
the mouse transplanted with cocultured CB MNC were further analyzed to
determine multilineage reconstitution. In human CD45+
cells, 29% of CD13+ cells, 38% of CD33+
cells, 12% of CD14+ cells, 58% of CD19+
cells, and 8% of CD34+ cells, but no CD3+
cells, were detected (Fig 2B and data not shown). The presence of human
hematopoietic cells in the recipient BMC was also confirmed by the
detection of human ALU sequences in PCR analysis of the BMC DNA (data
not shown). Hence, AGM-S3 cells can also support survival or
self-renewal of human reconstituting stem cells at least for 4 weeks.
View larger version (26K):
[in this window]
[in a new window]
| Fig 2.
(A) Expression of human CD45 antigen on BMC collected
from NOD/SCID mice untransplanted (a) and transplanted with inoculated
1 × 106 CB MNC (b) and those cocltured with AGM-S3 for 4 weeks (c). (B) Specific subsets of human hematopoietic cells in BMC of
the NOD/SCID mouse transplanted with cocultured human CB MNC quantified
by gating on human CD45-PECy5-positive cells and then assessing
staining with antihuman CD13- PE, CD33-PE, CD14-PE, CD19-PE, and
CD34-FITC. BMC of the recipient mouse were collected 5 weeks after
transplantation.
|
|
Surface molecule expression of AGM-S3 cells.
We investigated the characteristics of AGM-S3 cells using flow
cytometric analysis. Our result (Fig 3 and
data not shown) showed that hematopoietic lineage markers such as CD3,
CD4, CD8, B220, Mac-1, Gr-1, and TR119 were undetectable on the surface of AGM-S3 cells. Adhesion molecules, VCAM-1 but no PECAM-1, E-selectin, and P-selectin were expressed on AGM-S3 cells. AGM-S3 cells also expressed CD13 and Sca-1, but not c-Kit and CD34.
View larger version (39K):
[in this window]
[in a new window]
| Fig 3.
Flow cytometric analysis of surface markers of AGM-S3
cells. AGM-S3 cells were stained with biotin-conjugated antimouse CD3,
B220, Mac-1, Gr-1, VCAM-1, PECAM-1, E-selectin, P-selectin, and CD13,
followed by PE-conjugated streptavidin (A through I), PE-conjugated
antimouse Sca-1 and c-Kit (J and K), and FITC-conjugated antimouse CD34
(L).
|
|
Cytokine expression by AGM-S3 and MS-5 cells.
We then compared cytokine expression between AGM-S3 cells and MS-5
cells by RT-PCR (Fig 4). Both AGM-S3 and
MS-5 cells showed detectable levels of SCF, IL-6, and OSM, but
undetectable levels of IL-3, LIF, G-CSF, GM-CSF, IL-11, TPO, and FL.
MS-5 cells, but not AGM-S3 cells, showed a detectable level of M-CSF.
Effect of conditioned medium of AGM-S3 cells on human CB
CD34+ cells.
To examine the effect of conditioned medium of AGM-S3 cells, human CB
CD34+ cells were plated either in stroma-contact cultures
with AGM-S3 cells or in transwell inserts placed above the stromal cell
layers (stroma-noncontact cultures; Table
5). CD34+ cells were also cultured in transwell inserts
placed in empty wells as controls (stroma-free cultures), where only
few or no clonogenic cells were detected at weeks 2 and 4 of
incubation. The number of total clonogenic progenitors decreased at
both weeks 2 and 4 in stroma-noncontact cultures, whereas it increased
4-fold and 3.2-fold in stroma-contact cultures, respectively. The
number of progenitors in stroma- contact cultures were more than 7 times than that in stroma-noncontact cultures at week 4. Moreover, all of CFU-GM, BFU-E, and CFU-Mix were present in stroma-contact cultures, whereas only CFU-GM were detected in stroma-noncontact cultures. These
results indicates that the direct interaction between AGM-S3 and human
hematopoietic cells is involved in the stimulation of human
hematopoietic cells, especially primitive hematopoietic cells.
| |
DISCUSSION |
There is abundant evidence to indicate that microenvironmental stroma
within the hematopoietic tissues play important roles in the support
and regulation of hematopoiesis.5,33 Stroma is composed of
heterogeneous cell populations and an extracellular matrix (ECM) that
constitute a suitable microenvironment for the proliferation and
differentiation of hematopoietic stem/progenotor cells.34
Not only the cytokines locally produced by stroml cells,35 but also cell-to-cell36 and cell-to-extracellular matrix
contacts37,38 are known to be involved in the maintenance
of hematopoiesis. To make the mechanisms clear, several stromal cell
lines have been established from fetal and adult mouse hematopoietic
tissues, such as MS-5 from adult BM,17 PA-6 from newborn
calvaria,6 SPY3-2 from adult spleen,7
CD34+ endothelial cells from yolk sac,8 and
AFT024 cells from fetal liver,9 some of which can support
the long-term survival of murine LTR-HSC.9
Recent evidence shows that the microenvironment of AGM region plays
important roles in the self-renewal and expansion of hematopoietic stem
cells.14 Hence, we established three stromal cell lines, AGM-S1, 2, and 3, from 10.5 dpc mouse embryo AGM region. Among these
three cell lines, which were similar in apperance, AGM-S1 and 3 cells
showed more significant stimulatory activity to proliferate murine and
human primitive hematopoietic progenitors than AGM-S2 cells. The
expression of CD13 and VCAM-1 on AGM-S3 cells may indicate the stromal
cells possess the character of endothelial cells to some extent. AGM-S3
also expressed Sca-1, which was reported to be detected in 10 dpc mouse
embryo AGM region39 and endothelial cells.40
Recently, Satoh et al41 reported that the expression level
of Sca-1 in PA-6 cells correlate with their hematopoietic supporting
activity.
The activity of the stromal cells on murine hematopoiesis was confirmed
by the expansion of CFU-C and day-8- and day-12 CFU-S in the coculture
wih murine BMC. The coculture of AGM-S3 cells with sorted hematopoietic
progenitor cells showed that these expanded progenitors were derived
from Linc-Kit+Sca-1+ cells,
indicating that AGM-S3 cells act on primitive hematopoietic progenitors.
Some evidence has accumulated showing that human hematopoiesis can
develop in a nonhuman environment.31,42,43 For example, MS-5 cells can support human hematopoiesis successfully, as shown by
the present and previous studies. Issaad et al31 reported that MS-5 cells supported the generation of various hematopoietic progenitors, including CFU-Mix from human BM
CD34+CD38 cells in long-term culture. In
contract, Nishi et al42 showed that MS-5 cells were able to
support the generation of CFU-GM, but not CFU-Mix from CB
CD34+CD38 cells, in accordance with our
studies. Our data presented here demonstrated that AGM-S3 cells also
promoted the expansion of human CB hematopoietic progenitor cells
without the addition of human growth factors. When CB
CD34+CD38 cells were cocultured with AGM-S3
and MS-5 cells, only AGM-S3 cells supported the generation of CFU-Mix,
at least for 6 weeks. Moreover, we performed experiments using NOD-SCID
mice to examine the effect of AGM-S3 cells on human hematopoietic stem
cells. The result indicated that AGM-S3 cells had the ability to
maintain the survival or self-renewal of human reconstituting
hematopoietic stem cells for more than 4 weeks. These results suggest
that AGM-S3 cells have more potent stimulatory activity in human
primitive hematopoiesis than MS-5 cells.
Little is known on how murine stromal cells stimulate human
hematopoietic cells, but the involvement of growth factor(s) with species-cross activity produced by stromal cells is most likely. In
RT-PCR analysis, AGM-S3 cells produced detectable levels of SCF, IL-6,
and OSM, but no detectable levels of M-CSF, IL-3, LIF, G-CSF, GM-CSF,
IL-11, TPO, and FL. Our data and previous reports44 showed
that the cytokine expression of AGM-S3 cells was similar to that of
MS-5 cells, except for the expression of M-CSF. It is of interest that
M-CSF is expressed on MS-5 but not on AGM-S3 cells. OP9 stromal cells
lacking M-CSF were found to support murine primitive hematopoietic
progenitors45 and embryonic stem cells.46 Because the combination of SCF and IL-6 stimulates the proliferation of
murine primitive hematopoietic progenitors47 and OSM has been shown to induce hematopoiesis in the 11.5 dpc mouse AGM
region,48 these cytokines may be involved in expansion of
the murine primitive hematopoietic progenitors observed in the present
study. However, mouse IL-6 and OSM have no apparent effects on human
cells.49 Although mouse SCF has cross-activity with human
SCF, mouse SCF alone or in combination with mouse IL-6 and OSM could
not support human clonogenic progenitors for 6 weeks (data not shown).
Therefore, AGM-S3 cells seem to express species-cross reactive
molecule(s) other than the cytokines we examined and that act on
primitive hematopoietic cells.
Because the production of clonogenic progenitors in stroma-noncontact
cultures were higher than that in stroma-free cultures, soluble form
factor(s) was produced by AGM-S3 cells. However, the direct contact
between AGM-S3 and CD34+ cells was required for the optimal
stimulation of clonogenic progenitors, and the generation of CFU- Mix
and BFU-E was detected only in stroma-contact cultures. Although the
effect seen in this experiment may have been limited by factor
concentration, stability, or dependence on ECM attachment, the result
suggests a possibility that membrane-bound molecule(s) plays some roles
in the expansion of primitive hematopoietic cells by AGM-S3 cells.
Detection and characterization of the molecule(s) from AGM-S3 cells may
contribute toward understanding of regulatory mechanisms in the
development of primitive hematopoietic stem and progenitor cells and
provide a novel strategy for ex vivo expansion of human transplantable HSC.
| |
FOOTNOTES |
Submitted December 1, 1997;
accepted May 11, 1998.
Supported by grant from the Ministry of Education, Science, Sports and
Culture, Japan.
Address reprint requests to Tatsutoshi Nakahata, MD, Department of
Clinical Oncology, The Institute of Medical Science, The University of
Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan; e-mail:
nakahata{at}ims.u-tokyo.ac.jp.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors thank M. Nishihara and A. Kaneko for technical support, Drs
K. Kobayashi and Y. Ueyama for collaboration, and M. Ohara for comments
on the manuscript.
| |
REFERENCES |
1.
Ogawa M:
Differentiation and proliferation of hematopoietic stem cells.
Blood
81:2844,
1993[Abstract/Free Full Text]
2.
Bhatia M,
Bonnet D,
Kapp U,
Wang JCY,
Murdoch B,
Dick JE:
Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture.
J Exp Med
186:619,
1997[Abstract/Free Full Text]
3.
Conneally E,
Cashman J,
Petzer A,
Eaves C:
Expansion in vitro of transplantable human cord blood stem cells demonstrated using a quantitative assay of their lympho-myeloid repopulating activity in nonobese diebetic-scid/scid mice.
Proc Natl Acad Sci USA
94:9836,
1997[Abstract/Free Full Text]
4.
Miller CL,
Eaves CJ:
Expansion in vitro of adult murine hematopoietic stem cells with transplantable lympho- myeloid recostituting ability.
Proc Natl Acad Sci USA
94:13648,
1997[Abstract/Free Full Text]
5.
Wolf NS:
The hemopoietic microenvironment.
Clin Haematol
8:469,
1979[Medline]
[Order article via Infotrieve]
6.
Kodama H,
Amagai Y,
Koyama H,
Kasai S:
A new preadipose cell line derived from newborn mouse calvaria can promote the proliferation of pluripotent hemopoietic stem cells in vitro.
J Cell Physiol
112:89,
1982[Medline]
[Order article via Infotrieve]
7.
Tsuchiyama J,
Mori M,
Okada S:
Murine spleen stromal cell line SPY3-2 maintains long-term hematopoiesis in vitro.
Blood
85:3107,
1995[Abstract/Free Full Text]
8.
Fennie C,
Cheng D,
Dowbenko P,
Young P,
Lasky LA:
CD34+ endothelial cell lines derived from murine Yolk Sac induce the proliferation and differentiation of yolk sac CD34+ hematopoietic progenitors.
Blood
86:4454,
1995[Abstract/Free Full Text]
9.
Moore KA,
Ema H,
Lemischka IR:
In vitro maintenance of highly purified, transplantable hematopoietic stem cells.
Blood
89:4337,
1997[Abstract/Free Full Text]
10.
Bernstein SE:
Blood and blood formation
, in Green EL
(ed):
Biology of the Laboratory Mouse
New York, NY, McGraw-Hill
, 1966
, p 351
11.
Godin I,
Dieterlen-Lievre F,
Cumano A:
Emergence of multipotent hematopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus.
Proc Natl Acad Sci USA
92:773,
1995[Abstract/Free Full Text]
12.
Medvinsky AL,
Samoylina NL,
Muller AM,
Dzierzak EA:
An early pre-liver intraembryonic source of CFU-S in the developing mouse.
Nature
364:64,
1993[Medline]
[Order article via Infotrieve]
13.
Yoder MC,
Hiatt K,
Dutt P,
Mukherjee P,
Bodine D,
Olic D:
Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac.
Immunity
7:335,
1997[Medline]
[Order article via Infotrieve]
14.
Medvinsky AL,
Dzierzak EA:
Definitive hematopoiesis is autonomously initiated by the AGM region.
Cell
86:897,
1996[Medline]
[Order article via Infotrieve]
15.
Muller AM,
Medvinsky AL,
Strouboulis J,
Grosveld F,
Dzierzak EA:
Development of hematopoietic stem cell activity in the mouse embryo.
Immunity
1:291,
1994[Medline]
[Order article via Infotrieve]
16.
Sui X,
Tsuji K,
Tanaka R,
Tajima S,
Muraoka K,
Ebihara Y,
Ikebuchi K,
Yasukawa K,
Taga T,
Kishimoto T,
Nakahata T:
gp130 and c-Kit signalings synergize for ex vivo expansion of human primitive hemopoietic progenitor cells.
Proc Natl Acad Sci USA
92:2859,
1995[Abstract/Free Full Text]
17.
Itoh K,
Tezuka H,
Sakoda H,
Konno M,
Nagata K,
Uchiyama T,
Uchino H,
Mori KJ:
Reproducible establishment of hemopoietic supportive stroma cell lines from murine bone marrow.
Exp Hematol
17:145,
1989[Medline]
[Order article via Infotrieve]
18.
Nakahata T,
Ogawa M:
Identification in culture of a class of hemopoietic colony-forming units with extensive capability to self-renew and generate multipotential hemopoietic colonies.
Proc Natl Acad Sci USA
79:3843,
1982[Abstract/Free Full Text]
19.
Nakahata T,
Ogawa M:
Hemopoietic colony-forming cells in umbilical cord blood with extensive capability to generate mono- and multipotential hemopoietic progenitors.
J Clin Invest
70:1324,
1982
20.
Nakahata T,
Ogawa M:
Clonal origin of murine hemopoietic colonies with apparent restriction to granulocyte- macrophage-megakaryocyte (GMM) differentiation.
J Cell Physiol
111:239,
1982[Medline]
[Order article via Infotrieve]
21.
Imai T,
Koike K,
Kubo T,
Kikuchi T,
Amano Y,
Takagi M,
Okumura N,
Nakahata T:
Interleukin-6 supports human megakaryocytic proliferation and differentiation in vitro.
Blood
78:1969,
1991[Abstract/Free Full Text]
22.
Till J,
McCulloch EA:
A direct measurement of the radiation sensitivity of normal mouse bone marrow cells.
Radiat Res
14:213,
1961[Medline]
[Order article via Infotrieve]
23.
Tajima S,
Tsuji K,
Ebihara Y,
Sui X,
Tanaka R,
Muraoka K,
Yoshida M,
Yamada K,
Yasukawa K,
Taga T,
Kishimoto T,
Nakahata T:
Analysis of interleukin 6 receptor and gp130 expressions and proliferative capability of human CD34+ cells.
J Exp Med
184:1357,
1996[Abstract/Free Full Text]
24.
Szilvassy SJ,
Weller KP,
Lin W,
Sharma AK,
Ho ASY,
Tsukamoto A,
Hoffman R,
Leiby KR,
Gearing DP:
Leukemia inhibitory factor upregulates cytokine expression by a murine stroma cell line enabling the maintenance of highly enriched competitive repopulating stem cells.
Blood
87:4618,
1996[Abstract/Free Full Text]
25.
Wineman J,
Moore K,
Lemischka I,
Muller-Sieburg C:
Functional heterogeneity of the hematopoietic microenvironment: Rare stromal elements maintain long-term repopulating stem cells.
Blood
87:4082,
1996[Abstract/Free Full Text]
26.
Keller G,
Kennedy M,
Papaynnopoulou T,
Wiles MV:
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol
13:473,
1993[Abstract/Free Full Text]
27.
Koyanagi Y,
Tanaka Y,
Kira J,
Ito M,
Hioki K,
Misawa N,
Kawano Y,
Yamasaki K,
Tanaka R,
Suzuki Y,
Ueyama Y,
Terada E,
Tanaka T,
Miyasaka M,
Kobayashi T,
Kumasawa Y,
Yamanoto N:
Primary human immunodeficiency virus type 1 viremia and cental nervous system invasion in a novel hu-PBL-immunodeficient mouse stain.
J Virol
71:2417,
1997[Abstract]
28.
Cesano A,
Hoxie JA,
Lange B,
Nowell PC,
Bishop J,
Santoli D:
The severe combined immunodeficience (SCID) mouse as a model for human myeloid leukemias.
Oncogen
7:827,
1992[Medline]
[Order article via Infotrieve]
29.
Alonso S,
Minty A,
Bourlet Y,
Buckingham M:
Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm-blooded vertebrates.
J Mol Evol
23:11,
1986[Medline]
[Order article via Infotrieve]
30.
Okada S,
Nakauchi H,
Nagayoshi K,
Nishikawa S,
Miura Y,
Suda T:
In vivo and in vitro stem cell function of c-kit and Sca-1 positive murine hematopoietic cells.
Blood
80:3044,
1992[Abstract/Free Full Text]
31.
Issaad C,
Croisille L,
Katz A,
Vainchenker W,
Coulombel L:
A murine stromal cell line allows the proliferation of very primitive human CD34++/CD38 progenitor cells in long-term cultures and semisolid assays.
Blood
81:2916,
1993[Abstract/Free Full Text]
32.
Hao QL,
Shah AJ,
Thiemann FT,
Smogorzewska EM,
Crooks GM:
A functional comparison of CD34+CD38 cells in cord blood and bone marrow.
Blood
86:3745,
1995[Abstract/Free Full Text]
33.
Trentin JJ:
Influence of hematopoietic organ stroma (hematopoietic inductive microenvironment) on stem cell differentiation
, in Gordon A
(ed):
Regulation of Hematopoiesis, vol 1.
New York, NY, Appleton-Century-Crofts
, 1970
, p 161
34.
Dexter TM,
Allen TD,
Lajtha LG:
Conditions controlling the proliferation of haemopoietic stem cells in vitro.
J Cell Physiol
91:335,
1977[Medline]
[Order article via Infotrieve]
35.
Greenberger JS:
The hematopoietic microenvironment.
Crit Rev Oncol Hematol
11:65,
1991[Medline]
[Order article via Infotrieve]
36.
Torok-Storb B:
Cellular interactions.
Blood
72:373,
1988[Free Full Text]
37.
Gordon MY,
Riley GP,
Watt SM,
Greaves MF:
Compartmentalization of a haematopoietic growth factor (GM-CSF) by glycosaminoglycans in the bone marrow microenvironment.
Nature
326:403,
1987[Medline]
[Order article via Infotrieve]
38.
Roberts RA,
Gallagher J,
Spooncer E,
Allen TD,
Bloomfield F,
Dexter TM:
Heparan sulfate bound growth factors: A mechnism for stromal cell mediated haemopoiesis.
Nature
332:376,
1988[Medline]
[Order article via Infotrieve]
39.
Dzierzak EA,
Medvinsky AL:
Mouse embryonic hematopoiesis.
Trends Genet
11:356,
1995
40.
Van de Run M,
Heimfeld S,
Spangrude GJ,
Weissman IL:
Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family.
Proc Natl Acad Sci USA
86:4634,
1989[Abstract/Free Full Text]
41.
Satoh M,
Mioh H,
Shiotsu Y,
Ogawa Y,
Tamaoki T:
Mouse bone marrow stromal cell line MC3T3-G2/PA6 with hematopoietic-supporting activity expresses high levels of stem cell antigen Sca-1.
Exp Hematol
24:1312,
1996[Medline]
[Order article via Infotrieve]
42.
Nishi N,
Ishikawa R,
Inoue H,
Nishikawa M,
Kakeda M,
Yoneya T,
Tsumura H,
Ohashi H,
Yamaguchi Y,
Motoki K,
Sudo T,
Mori KJ:
Granulocyte-colony stimulating factor and stem cell factor are the crucial factors in long-term culture of human primitive hematopoietic cells supported by a murine stromal cell line.
Exp Hematol
24:1312,
1996
43.
Lamy I,
Corlu A,
Fardel O,
Gandemer V,
Rialland M,
Leberre C,
Prise PY,
Fauchet R,
Coulombel L,
Guguen-Guillouzo C:
Rat liver biliary epithelial cells support long-term production of heamopoietic progenitors from human CD34+ cells.
Br J Haematol
98:560,
1997[Medline]
[Order article via Infotrieve]
44.
Kobari L,
Bubart A,
Pesteur FL,
Vainchenker W,
Sainteny F:
Hematopoietic-promoting activity of the murine stromal cell line MS-5 is not related to the expression of the major hematopoietic cytokines.
J Cell Physiol
163:295,
1995[Medline]
[Order article via Infotrieve]
45.
Kodama M,
Nose M,
Niida S,
Yamasaki A:
Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells.
J Exp Med
173:1291,
1991[Abstract/Free Full Text]
46.
Nakano T,
kodama H,
Honjo T:
Generation of lymphohematopoietic cells from embryonic stem cells in culture.
Science
265:1098,
1994[Abstract/Free Full Text]
47.
Tsuji K,
Zsebo KM,
Ogawa M:
Enhancement of murine blast cell colony formation in culture by recombinant rat stem cell factor, ligand for c-kit.
Blood
78:1223,
1991[Abstract/Free Full Text]
48.
Mukouyama Y,
Hara T,
Xu MJ,
Tamura K,
Donovan PJ,
Kim HJ,
Kogo H,
Tsuji K,
Nakahata T,
Miyajima A:
In vitro expansion of murine multipotential hematopoietic progenitors from the embryonic Aorta-Gonad-Mesonephros region.
Immunity
8:105,
1998[Medline]
[Order article via Infotrieve]
49.
Ichihara M,
Hara T,
Kim H,
Murate T,
Miyajima A:
Oncostatin M and Leukemia inhibitory factor do not use the same functional receptor in mice.
Blood
90:165,
1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
Y. Li, S. Chen, J. Yuan, Y. Yang, J. Li, J. Ma, X. Wu, M. Freund, K. Pollok, H. Hanenberg, et al.
Mesenchymal stem/progenitor cells promote the reconstitution of exogenous hematopoietic stem cells in Fancg-/- mice in vivo
Blood,
March 5, 2009;
113(10):
2342 - 2351.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Ma, N. Kambe, D. Wang, G. Shinoda, H. Fujino, K. Umeda, A. Fujisawa, L. Ma, H. Suemori, N. Nakatsuji, et al.
Direct Development of Functionally Mature Tryptase/Chymase Double-Positive Connective Tissue-Type Mast Cells from Primate Embryonic Stem Cells
Stem Cells,
March 1, 2008;
26(3):
706 - 714.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X.-Y. Wang, Y. Lan, W.-Y. He, L. Zhang, H.-Y. Yao, C.-M. Hou, Y. Tong, Y.-L. Liu, G. Yang, X.-D. Liu, et al.
Identification of mesenchymal stem cells in aorta-gonad-mesonephros and yolk sac of human embryos
Blood,
February 15, 2008;
111(4):
2436 - 2443.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Durand, C. Robin, K. Bollerot, M. H. Baron, K. Ottersbach, and E. Dzierzak
Embryonic stromal clones reveal developmental regulators of definitive hematopoietic stem cells
PNAS,
December 26, 2007;
104(52):
20838 - 20843.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A.J. Oostendorp, C. Robin, C. Steinhoff, S. Marz, R. Brauer, U. A. Nuber, E. A. Dzierzak, and C. Peschel
Long-Term Maintenance of Hematopoietic Stem Cells Does Not Require Contact with Embryo-Derived Stromal Cells in Cocultures
Stem Cells,
June 1, 2005;
23(6):
842 - 851.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Xu, E. Bruno, J. Chao, H. Ni, V. Lindgren, R. Nunez, N. Mahmud, G. Finazzi, S. M. Fruchtman, U. Popat, et al.
The constitutive mobilization of bone marrow-repopulating cells into the peripheral blood in idiopathic myelofibrosis
Blood,
February 15, 2005;
105(4):
1699 - 1705.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kobune, Y. Ito, Y. Kawano, K. Sasaki, H. Uchida, K. Nakamura, H. Dehari, H. Chiba, R. Takimoto, T. Matsunaga, et al.
Indian hedgehog gene transfer augments hematopoietic support of human stromal cells including NOD/SCID-{beta}2m-/- repopulating cells.
Blood,
August 15, 2004;
104(4):
1002 - 1009.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Harvey and E. Dzierzak
Cell-Cell Contact and Anatomical Compatibility in Stromal Cell-Mediated HSC Support During Development
Stem Cells,
May 1, 2004;
22(3):
253 - 258.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Mitsui, S. Watanabe, Y. Taniguchi, S. Hanada, Y. Ebihara, T. Sato, T. Heike, M. Mitsuyama, T. Nakahata, and K. Tsuji
Impaired neutrophil maturation in truncated murine G-CSF receptor-transgenic mice
Blood,
April 15, 2003;
101(8):
2990 - 2995.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kawano, M. Kobune, M. Yamaguchi, K. Nakamura, Y. Ito, K. Sasaki, S. Takahashi, T. Nakamura, H. Chiba, T. Sato, et al.
Ex vivo expansion of human umbilical cord hematopoietic progenitor cells using a coculture system with human telomerase catalytic subunit (hTERT)-transfected human stromal cells
Blood,
January 15, 2003;
101(2):
532 - 540.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. J. Oostendorp, A. J. Medvinsky, N. Kusadasi, N. Nakayama, K. Harvey, C. Orelio, K. Ottersbach, T. Covey, R. E. Ploemacher, C. Saris, et al.
Embryonal subregion-derived stromal cell lines from novel temperature-sensitive SV40 T antigen transgenic mice support hematopoiesis
J. Cell Sci.,
May 15, 2002;
115(10):
2099 - 2108.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. J. Oostendorp, K. N. Harvey, N. Kusadasi, M. F. T. R. de Bruijn, C. Saris, R. E. Ploemacher, A. L. Medvinsky, and E. A. Dzierzak
Stromal cell lines from mouse aorta-gonads-mesonephros subregions are potent supporters of hematopoietic stem cell activity
Blood,
February 15, 2002;
99(4):
1183 - 1189.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Hisakawa, D. Sugiyama, I. Nishijima, M.-j. Xu, H. Wu, K. Nakao, S. Watanabe, M. Katsuki, S. Asano, K.-i. Arai, et al.
Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) stimulates primitive and definitive erythropoiesis in mouse embryos expressing hGM-CSF receptors but not erythropoietin receptors
Blood,
December 15, 2001;
98(13):
3618 - 3625.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Yoder
Introduction: spatial origin of murine hematopoietic stem cells
Blood,
July 1, 2001;
98(1):
3 - 5.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Matsuoka, K. Tsuji, H. Hisakawa, M.-j. Xu, Y. Ebihara, T. Ishii, D. Sugiyama, A. Manabe, R. Tanaka, Y. Ikeda, et al.
Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-mesonephros region-derived stromal cells
Blood,
July 1, 2001;
98(1):
6 - 12.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Ma, M. Wada, H. Yoshino, Y. Ebihara, T. Ishii, A. Manabe, R. Tanaka, T. Maekawa, M. Ito, H. Mugishima, et al.
Development of human lymphohematopoietic stem and progenitor cells defined by expression of CD34 and CD81
Blood,
June 15, 2001;
97(12):
3755 - 3762.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-j. Xu, S. Matsuoka, F.-C. Yang, Y. Ebihara, A. Manabe, R. Tanaka, M. Eguchi, S. Asano, T. Nakahata, and K. Tsuji
Evidence for the presence of murine primitive megakarycytopoiesis in the early yolk sac
Blood,
April 1, 2001;
97(7):
2016 - 2022.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Sawano, S. Iwai, Y. Sakurai, M. Ito, K. Shitara, T. Nakahata, and M. Shibuya
Flt-1, vascular endothelial growth factor receptor 1, is a novel cell surface marker for the lineage of monocyte-macrophages in humans
Blood,
February 1, 2001;
97(3):
785 - 791.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Matsuoka, Y. Ebihara, M.-j. Xu, T. Ishii, D. Sugiyama, H. Yoshino, T. Ueda, A. Manabe, R. Tanaka, Y. Ikeda, et al.
CD34 expression on long-term repopulating hematopoietic stem cells changes during developmental stages
Blood,
January 15, 2001;
97(2):
419 - 425.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Sugiura, H. Hisha, J. Ishikawa, Y. Adachi, S. Taketani, S. Lee, T. Nagahama, and S. Ikehara
Major Histocompatibility Complex Restriction Between Hematopoietic Stem Cells and Stromal Cells In Vitro
Stem Cells,
January 1, 2001;
19(1):
46 - 58.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
T. Ueda, H. Yoshino, K. Kobayashi, M. Kawahata, Y. Ebihara, M. Ito, S. Asano, T. Nakahata, and K. Tsuji
Hematopoietic Repopulating Ability of Cord Blood CD34+ Cells in NOD/Shi-scid Mice
Stem Cells,
May 1, 2000;
18(3):
204 - 213.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Y. Nakamura, K. Ando, J. Chargui, H. Kawada, T. Sato, T. Tsuji, T. Hotta, and S. Kato
Ex Vivo Generation of CD34+ Cells From CD34- Hematopoietic Cells
Blood,
December 15, 1999;
94(12):
4053 - 4059.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract
