|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 6 (September 15), 1998:
pp. 2093-2102
The Induction of Nitric Oxide by Interleukin-12 and Tumor Necrosis
Factor- in Human Natural Killer Cells: Relationship With the
Regulation of Lytic Activity
By
Ombretta Salvucci,
Jean Pierre Kolb,
Bernard Dugas,
Nathalie Dugas, and
Salem Chouaib
From the Laboratoire Cytokines et Immunologie des Tumeurs Humaines, U
487 INSERM, Institut Gustave-Roussy, Villejuif, France; the
Interférons et cytokines, Unité 365 INSERM, Institut Curie,
Paris, France; the Laboratoire d'Immuno-Hématologie, CNRS URA
625, Hôpital la Pitié Salpétrière, Paris,
France; and the Laboratoire Virus Neurone et Immunité, IFR
Kremlin Bicètre, Kremlin Bicètre, France.
 |
ABSTRACT |
We have investigated the interleukin-12 (IL-12) and tumor necrosis
factor- (TNF)-induced regulation of human natural killer (NK)
cell function and their relationship with nitric oxide (NO) generation.
We demonstrate that both cytokines were efficient to trigger the
transcription of the inducible nitric oxide synthase (iNOS) mRNA, as
detected by reverse transcriptase-polymerase chain reaction (RT-PCR).
Western blot analysis and intracytoplasmic fluorescence showed that
iNOS protein was also induced by both cytokines. However, our data
indicate that NO does not play a significant role in the effector phase
of the cytotoxic activity mediated by NK-stimulated cells, inasmuch as
the lytic activity was not affected in the presence of specific NO
synthase inhibitors. When aminoguanidine (AMG), an inhibitor of iNOS,
was added during the afferent phase of NK stimulation with IL-12 and
TNF, a subsequent increase in the lytic potential of the effector
cells towards the NK-sensitive target cells (K562) and
lymphokine-activated killer (LAK) target cells (Daudi) was observed.
Conversely, the addition of chemical NO donors during the afferent step
resulted in a dose-dependent inhibition of the NK and LAK cytotoxicity. Our data suggest that the enhancement of NK-cell cytotoxic activity resulting from iNOS inhibition may be correlated, at least in part, to
an increase in interferon- production and granzyme B expression.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
NATURAL KILLER (NK) cells play an
important role in the early defense against viral infection and
malignant transformation.1,2 Their activity is
characterized as nonadaptive and major histocompatibility complex
(MHC) unrestricted and is thought to play an important role in immune surveillance. It is now well established that the lytic
function of these cells is regulated by a complex network of cytokines
acting either independently3-5 or
synergistically.6-8 Several mechanisms have been proposed
to account for NK cytotoxicity. Exocytosis of granules containing
perforin (cytolysin or pore-forming protein) and serine esterases (or
granzymes) is believed to be the primary mediator of the cellular
cytotoxicity exhibited by NK cells.9-11 Additional studies
demonstrated a granule-independent killing pathway involving Fas ligand
(FasL).12-14
The existence of a new pathway for induction of the lethal injury to
target cells by NK cells has been suggested. In murine model, a role of
nitric oxide (NO) in the generation of LAK cells has been
reported.15 Moreover, several lines of evidence suggested that nitric oxide synthase (NOS) pathway may mediate NK-cell
cytotoxicity in rats and mice.16,17
NO is synthesized from the oxidation of the terminal guanido nitrogen
atom of L-arginine by a family of nicotinamide adenine dinucleotide
phosphate (NADPH)-dependent enzyme, the NOS.18-21 In
addition to the existence of two constitutive isoforms (neuronal NOS
and endothelial NOS), a third isoform, the inducible NOS (iNOS), can be
elicited in different cell types by various stimuli such as bacteria,
microbial products, and/or cytokines.22,23 NO, a
short-lived molecule, has been identified as a potent biological mediator.24 It plays an active role in many physiological
processes such as vasodilatation, neural function, and inhibition of
platelet aggregation, as well as in pathological processes such as
inflammation.25,26 Evidence has been provided indicating
that activated murine mononuclear phagocytes synthesize NO, which
contributes in part to their cytotoxic activity against tumor cells and
bacteria.27 Similarly, it has been reported that, in vitro,
the tumoricidal function of interleukin-2 (IL-2)-activated rodent NK
cells depends, at least in part, on their NO- synthesizing ability.
Deprival of L-arginine in the medium or blocking of NO synthesis with
NG-methyl-L- arginine (NMMA) reduced the killer function of these
cells.16 In contrast, it is unclear whether NO plays a role
in the tumoricidal and antimicrobial activities of human NK cells.
In the present study, we have investigated the expression of NOS in
human NK cells as well as the involvement of NO in the regulation of
the cytotoxic activity of these cells by IL-12 and tumor necrosis
factor- (TNF). We demonstrate that, whereas treatment of NK cells
with IL-12 and TNF triggers the expression of the iNOS, NO does not
seem to be involved in the basal or induced cytotoxic activity of human
NK cells. Our data suggest that NO plays an inhibitory role on the
IL-12- and TNF-induced stimulation of NK cells.
| |
MATERIALS AND METHODS |
Reagents.
L-arginine and aminoguanidine (AMG) hemisulfate salt were purchased
from Sigma (St Louis, MO). AMG is a structural analogue of L-arginine
that was reported to be more active against the iNOS.28 The
14C-labeled L-arginine was purchased from Amersham (Les
Ulis, France) or from NEN (Dreieich, Germany). The strong acid cation
exchange resin, binding to L-arginine but not to L-citrulline (AG
50W-X8, 100 to 200 mesh, H form) was purchased from Biorad Laboratories (Richmond, CA). A second NOS inhibitor S,S -(1,3-Phenylenebis (1,2-ethanediyl)) bisisothiourea, or 1,3 PB-ITU, that was reported to
be highly selective for iNOS versus ecNOS29 was purchased from Alexis
Biochemicals (San Diego, CA). The chemical NO donor
3-morpholino-sydnonimine (Sin-1) and its inactive control
N-morpholino-imino-acetonitril (Sin-1C) were kind gifts from Dr J. Winicki (Laboratoires Hoechst, Paris, France); sodium nitroprusside
(SNP) was purchased from Sigma.
Cytokines and monoclonal antibodies (MoAbs).
Recombinant IL-12 (specific activity, 5 × 106 U/mg)
was kindly provided by S. Wolf (Genetic Institute, Boston, MA). Highly purified (99%) recombinant TNF (specific activity, 6.63 × 106 U/mg protein) was kindly provided by Dr I. Apfler (Bender Wien, Austria). A polyclonal rabbit antirat
iNOS that recognizes the human enzyme30 was kindly provided
by V. Riveros-Moreno and S. Moncada (The Cruciform Project, London,
UK); a preimmune rabbit antiserum was used as control. Fluorescein
isothiocyanate (FITC)-conjugated goat antirabbit IgG (H+L)
F(ab)2 fragments were purchased from Jackson
Immunoresearch (West Grove, PA). The FITC-conjugated mouse monoclonal
anti-macNOS (IgG2a) that recognizes the human iNOS was purchased from
Transduction Laboratories (Lexington, KY). The FITC-labeled isotypic
control (FITC-IgG2a) was from Becton Dickinson (Mountain View,
CA). The mouse monoclonal antihuman granzyme B and the
neutralizing antihuman interferon (IFN) polyclonal rabbit
antibody were kindly provided by M. Sasportes (Hopital Saint Louis,
Paris, France) and J. Wietzerbin (Institut Curie, Paris, France),
respectively.
Cell preparation.
Peripheral blood lymphocytes (PBL) were isolated from healthy donors
(Banque du sang, Hopital Saint-Louis, Paris, France) by Ficoll Hypaque
gradient centrifugation followed by plastic adherence. NK cells were
enriched by Percoll density gradients, as previously
described.7 Cells were then incubated for 30 minutes at
4°C with a cocktail of antibodies: OKT3, OKT4, OKT8 (Ortho
Diagnostics Systems, Inc, Westwood, MA), which recognize CD3, CD4, and
CD8 molecules, respectively; A13 (MoAb, IgG1) and TiV 2
(MoAb, IgG1), which react with V1 and V2 gene products, respectively31; and MY4 (anti-CD14) and B4 (anti-CD20)
(Coulter/Immunotech, Marseille, France). The cells were resuspended in
RPMI complete medium supplemented with 10% human serum, incubated with
magnetic beads (Dynal, Oslo, Norway) for 20 minutes, and passed over a magnet. This separation was performed twice and the resulting cell
preparation contained 99% CD3 cells. Alternatively, NK
cells were purified as positively sorted CD3CD56+ NK cells using
fluorescence-activated cell sorting after magnetic bead depletion.
Determination of L-citrulline, nitrate/nitrite concentration, and
cytokine assay.
NK cells were cultured for 3 days without or with IL-12 or/and TNF
in the absence or in the presence of AMG. L-citrulline levels were
determined in the cell-free supernatants from NK cultures by
colorimetric detection, as described previously.32 Briefly, L-citrulline was measured by the colorimetric reaction of carbamido groups with diacetyl monoxime in acid solution. A total of 30 µL of
urease (25 U/mL) was added to 300 µL of supernatants for 1 hour of
incubation at 37°C. After the addition of 37.5 µL of trichloroacetic acid (TCA) (59% vol/vol), the precipitated proteins were removed by 5 minutes of centrifugation at 11,000 rpm in an Eppendorf centrifuge. A total of 250 µL of supernatants was harvested and 300 µL of a 1:1 (vol/vol) mixture of 240 mmol/L diacetyl monoxime and a solution of phenazone (3 g in 104 mL H2O reacted with
12 mg FeSO4 and 21 mL H2SO4 36 N)
was added for 15 minutes of incubation at 90°C in the dark. A total
of 200 µL was collected and transferred to a microtitration plate for
measurement of the optical density (OD) at 492 nm using an autoreader
(Dynatech Laboratories Inc, Boulogne, Billancourt, France). A
calibration curve was performed in parallel with a standard solution of
citrulline. Supernatants were also tested for the presence of
nitrite/nitrate after reduction of nitrate into nitrite using a Nitric
Oxide Assay kit (R&D Systems Europe, Oxon, UK).
The same supernatants were also tested for IFN production by
enzyme-linked immunosorbent assay (ELISA; Genzyme, Cambridge, MA or
Immunotech/Coulter, Marseille, France).
Analysis of iNOS gene expression.
Total RNA was isolated from freshly harvested cells using RNAzol
(Bioprobe System, Montreuil-sous-bois, France) procedure based on the
method of Chomczynski and Sacchi.33 iNOS mRNA expression was investigated with reverse transcriptase-polymerase chain reaction (RT-PCR), as described.34 The low expression level of iNOS
mRNA does not allow its detection by classical Northern blot analysis and usually required a more sensitive technique, such
RT-PCR.35 The sequences of the intron-spanning
oligonucleotide primer sets in these experiments were as follows: iNOS
mRNA sense (5 TCCGAGGCAAACAGCACATTCA 3) and iNOS mRNA antisense (5
GGGTTGGGGGTGTGGTGATGT 3) and  -actin mRNA sense (5
GGGTCAGAAGGATTCCTATG 3) and mRNA antisense (5 GGGTCAGAAGGATTCCTAATG
3). The iNOS message is represented by a 371-bp band, and a 237- bp
band indicates the -actin message. The PCR conditions were the
following: 3 minutes of denaturation at 94°C, 1 minute of annealing
at 60°C, and 1 minute of elongation at 72°C for 42 cycles using
a GeneAmp 96000 PCR system (Perkin-Elmer Cetus, Norwalk,
CT). The amplified products were analyzed on 0.8% agarose
gel containing 0.5 mg/mL ethidium bromide.
Immunofluorescence analysis.
Detection of intracellular protein iNOS was performed with FIX & PERM
cell permeabilization kits (Caltag Laboratories, Burlingame, CA) for
fixing in suspension and then permealizing the cells. The cells were
incubated with appropriate dilution of the anti-iNOS antibody or
control rabbit serum for 30 minutes at 4°C. After washes in
phosphate-buffered saline supplemented with 1% bovine serum albumin
(PBS-BSA), the cells were incubated with FITC-labeled goat antirabbit
F(ab)2 fragment for an additional 30 minutes at 4°C.
Alternatively, direct fluorescence was performed using the
FITC-conjugated anti-macNOS MoAb. Cells were then extensively washed
and analyzed using an EPICS C (Coulter Counter). Fluorescence data were
collected on 5 × 103 viable cells, as determined by
forward light scatter intensity. Background fluorescence was determined
in each case by using an isotype-matched antibody.
Western blot analysis for iNOS and granzyme B.
Determination of iNOS protein in NK cells, cultured for various times
(from 4 to 24 hours) without or with IL-12 or/and TNF, was performed
by Western blotting of cytosolic protein extracts. The cells were lysed
in 10 mmol/L Tris-HCl, pH 7.4, buffer heated to 90°C. The buffer
contained 1% sodium dodecyl sulfate (SDS), 10 µg/mL leupeptin, 2 mmol/L phenylmethylsulfonyl fluoride (PMSF), 2 µg/mL aprotinin, 10 µg/mL pepstatin A, and 2 mmol/L phenanthroline. Samples of 10 or 50 µg of protein were electrophoresed under reducing conditions on 7.5%
SDS-polyacrylamide minigels. The proteins were then electroblotted to
0.2-mm vinylidene difluoride and the membrane was blocked with 10 mmol/L Tris-HCl, 100 mmol/L NaCl, pH 7.5 (TBS), containing 1% BSA and
0.1% Tween 20. Blots were then incubated with the rabbit antimouse
iNOS antibody at a final concentration of 1/500 vol/vol.36
The blots were then washed with 1% TBS containing 0.1% Tween 20 and
incubated with a goat antirabbit Ig-conjugated to horseradish
peroxidase, and bands were shown by luminol-dependent chemiluminescence
(ECL; Amersham). The maximum light emission is at a wavelength of 428 nm and was detected by short exposure to blue light-sensitive
autoradiography film (Hyperfilm ECL, Paris, France). For granzyme B
protein, NK cells were cultured for 12 hours with IL-12 and TNF, in
the presence or absence of AMG. The cells were lysed in the buffer
containing 20 mmol/L Tris/HCl, pH 8, 1 mmol/L EDTA, pH 8, 150 mmol/L
NaCl, 1% NP40, 10% glycerol, 0.2 mmol/L PMSF, 1 mmol/L dithiothreitol
(DTT), and 20 µL/mL of Protease Inhibitor Cocktail
tablets (Complete; Boehringer Mannheim, Mannheim,
Germany). Samples of 10 µg were electrophoresed on
12.5% SDS-polyacrylamide minigels and the blot was incubated with the mouse antihuman granzyme B at a final concentration of 1/600 and shown
as previously described with a peroxidase-conjugated antimouse Ig
(Santa Cruz Biotechnology, Inc, Santa Cruz, CA).
Enzymatic iNOS activity.
NK cells (2 × 106) were stimulated with IL-12 or/and
TNF in presence or absence of AMG. Cultures were performed in Iscove medium (1 mL/well) supplemented with glutamine (2 mmol/L), penicillin (100 U/mL), streptomycin (100 µg/mL), 20 mmol/L HEPES, 5% normal human serum, and L-arginine to obtain a concentration of 1 mmol/L in
the medium. Cell extracts were prepared by 4 cycles of freezing on
liquid nitrogen and thawing in a 50 mmol/L Tris, HCl buffer, pH 7.5, containing a cocktail of protease inhibitors and centrifuged at
14,000g for 15 minutes at 4°C to remove debries.
Supernatants were collected, their protein concentration was
determined, and iNOS activity was measured by quantifying the
conversion of [14C] L-arginine into
[14C] L-citrulline according to a technique described
elsewhere.34 [14C] L-citrulline in the eluate
was quantitated by scintillation counting.
Cytotoxicity assay.
NK cells were stimulated for 3 days in complete medium (CM; RPMI 1640 supplemented with 10% normal human serum, 100 UI/mL penicillin, 100 µg/mL streptomycin, and 2 mmol/L L-glutamine) in the presence of the
indicated cytokines. L-arginine and AMG were added in CM at final
concentrations of 2 and 4 mmol/L, respectively. AMG was added either
during the time of incubation with the cytokines or during the
51Cr- release assay. After the culture period, serial
dilutions of effector cells were then distributed in duplicates (0.1 mL per well) into round-bottomed microwell plates. K562 and Daudi target
cells were labeled with 200 mCi of
Na251CrO4 (5 µCi/mL; Amersham)
for 1 hour at 37°C and washed three times, and 5,000 cells per well
(in 0.1 mL volume) were distributed in round-bottom microwells with 0.1 mL of effector cells at various effector to target cell (E/T) ratios.
After 4 hours of incubation at 37°C, the plates were centrifuged at
2,000g for 2 minutes and cell-free supernatants were collected
using a cell harvester (Skatron Inc, Sterling, VA). Supernatant
radioactivity was assayed using an automated gamma counter (Packard
Instrument Co, Meriden, CT). Spontaneous release was determined by
incubating target cells in medium alone. Maximum release was determined
by adding 0.1 mL of 1 mol/L HCl to the target cell suspension. The
percentage of specific lysis was calculated as follows: 100 × (Experimental 51Cr Release  Spontaneous 51Cr
Release)/(Maximum 51Cr Release Spontaneous
51Cr Release).
Statistical analysis.
Significant differences between cytokine-induced NK-cell activation
with or without the inhibitor of iNOS were determined by the Student's
t-test adapted for a small number of samples. The data were
analyzed with use of the InStat 1.4 software (StatSoft Inc, Tulsa, OK).
Comparisons were considered significant for a corresponding P  .05.
| |
RESULTS |
Effect of IL-12 and TNF on citrulline and nitrate/nitrite release by
human NK cells.
The effect of IL-12 and TNF on NOS-derived arginine metabolite
generation in highly purified human NK cells was investigated. Because
NO by itself is a very labile molecule, it is difficult to perform
direct determination of its concentration. The amount of the other
product of the NOS enzymatic reaction, namely the citrulline released
in the supernatants, was quantitated by a colorimetric technique. As
seen in Fig 1A, a slight increase in L-citrulline production was observed in the presence of IL-12 or
TNF. However, in the presence of both cytokines, a marked accumulation of citrulline was detected that was greatly reduced in the
presence of AMG (4 mmol/L), a specific inhibitor of the iNOS. The
amount of nitrite/nitrate released by cultured cells was also measured
by NO assay. IL-12 or IL-12 and TNF induced an increase in
NO2/NO3 that was
significantly abrogated by the addition of AMG (4 mmol/L; Fig 1B). The
levels of citrulline and nitrite/nitrate released were roughly of the
same order of magnitude, taking into account the individual variations
between different blood donors.
View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
Production of citrulline and nitrate/nitrite in cultures
of NK cells. Purified NK cells (106 cells/mL) were
incubated in Dulbecco's modified Eagle's medium (DMEM;
arginine content, 0.4 mmol/L) with IL-12 (5 U/mL) or/and TNF (20 ng/mL) without or with AMG (4 mmol/L) for 3 days. Supernatants were
then collected and production of citrulline (A) and nitrate/nitrite (B)
levels was determined as described in Materials and Methods. The
results are expressed as the mean ± SE of three different
experiments. The asterisks denote a statistically significant
difference (P < .01) between IL-12 + AMG and IL-2 or/and
IL-12 + TNF + AMG and IL-12 + TNF, as determined by the
Student's t-test.
|
|
iNOS gene expression in human NK cells.
Expression of iNOS mRNA was analyzed in human NK cells upon the
addition of human recombinant IL-12 or/and TNF by reverse transcription of RNA followed by DNA polymerase chain reaction (RT-PCR)
using specific human iNOS primers. -Actin primers were used as a
control of amplification. PCR products were analyzed on
ethidium-stained agarose gel. As shown in
Fig 2, unstimulated NK cells do not express
any iNOS mRNA, although a faint band could be observed for some donors.
After stimulation with TNF, IL-12, or their combination, an
amplification fragment corresponding to the expected size of 371 bp was
visualized. These results demonstrate that iNOS expression is mostly
not constitutive in purified NK cells but can be induced after the
addition of human recombinant IL-12 or/and TNF.
View larger version (29K):
[in this window]
[in a new window]
| Fig 2.
iNOS gene expression in unstimulated and IL-12- or/and
TNF-treated NK cells. NK cells were stimulated for 7 hours in the
absence (lane 1) or presence of IL-12 (5 U/mL) (lane 2), IL-12 and
TNF (lane 3), or TNF (20 ng/mL) (lane 4), and then mRNA was
extracted. The presence of iNOS mRNA was analyzed by RT-PCR, as
described in Materials and Methods. Data are from one representative
experiment of seven that gave comparable results.
|
|
IL-12 and TNF synergize in inducing iNOS protein and activity by
human NK cells.
The expression of iNOS was investigated at the protein level by
immunofluorescence on permeabilized cells and fluorescence-activated cell sorting (FACS) analysis using a specific polyclonal
anti-iNOS antiserum. As shown in Fig 3,
cells stimulated with the combination of IL-12 and TNF displayed
higher iNOS immune reactivity in their cytoplasm than cells stimulated
with IL-12 or TNF alone. Unstimulated NK cells failed to express the
iNOS protein, and the staining was determined at the same level as the
control antibody. These experiments were confirmed on positively
selected FACS-sorted CD56+ NK cells using the commercial
FITC-conjugated anti-macNOS MoAb (not shown). The presence of iNOS
protein in stimulated NK cells was also analyzed by specific Western
blotting. Whereas the expression of iNOS was undetectable or weakly
detectable in unstimulated NK cells, depending on the donors, a major
band of 135 kD was detected after incubation of these cells for 24 hours with either IL-12 or TNF alone. This band was clearly more
intense after cell treatment by the combination of IL-12 and TNF
(Fig 4). This observation was confirmed by
immunocytochemistry and similar data were also obtained using a mouse
MoAb against human iNOS.
View larger version (19K):
[in this window]
[in a new window]
| Fig 3.
iNOS protein expression in stimulated NK cells. NK cells
were stimulated for 24 hours in the presence or absence of IL-12 (5 U/mL) or/and TNF (20 ng/mL) and then harvested. The cells were
washed, permeabilized, and stained with a polyclonal rabbit anti-iNOS
and then with a (FITC)-conjugated F(ab')2 fragment goat
antirabbit IgG, as described in Materials and Methods. Fluorescence
data were collected on 5,000 viable cells. (Open area) untreated NK
cells (profile identical to that obtained with the preimmune serum,
indicative that these cells were negative for the expression of this
marker). (Shaded area) NK cells stimulated with TNF (upper panel),
IL-12 (middle panel), or both cytokines (lower panel). The percentage
represents the change in the mean log fluorescence for this experiment.
Student's t-test after comparison of the values obtained with
IL-12 + TNF with the corresponding values obtained with medium,
IL-12, or TNF results in P < .05. Similar results were
obtained in three other experiments.
|
|
View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
Western blot analysis of iNOS expression in NK cells. NK
cells were treated with the indicated cytokines for 24 hours, lysed,
and analyzed by Western blot with a polyclonal rabbit antirat iNOS that
cross-reacts with human iNOS, as described in Materials and Methods.
The fold induction over the basal activity was quantitated with video
densitometry.
|
|
After the demonstration of iNOS mRNA and protein induction in NK cells,
we next asked whether the detected iNOS was functional. For this
purpose, the ability of cellular extracts to convert L-[14C]arginine to L-[14C]citrulline was
measured. Results in Fig 5 show that no
catalytic NOS activity was detected in extracts from unstimulated NK
cells. However, 48 hours of incubation with IL-12 was efficient to
induce iNOS activity that was potentiated through simultaneous addition of TNF. The enzymatic activity was markedly suppressed (60% to 75%) in the presence of AMG during the assay.
View larger version (16K):
[in this window]
[in a new window]
| Fig 5.
iNOS activity in human NK cells. NOS activity was
determined by monitoring of [14C] L-citrulline produced
per milligram of cellular protein per minute. NK cells were stimulated
with IL-12 (5 U/mL) or/and TNF (20 ng/mL) for 48 hours, and then
cell lysates were prepared and tested for their NOS catalytic activity
by measuring their capacity to convert radiolabeled arginine into
citrulline, as described in Materials and Methods. Results are
expressed as the mean ± SD of three representative experiments.
Significance of inhibition was assessed by the Student's
t-test after comparison of the values obtained with IL-12
or/and TNF + AMG, with the corresponding values obtained in each
experiment with IL-12 or/and TNF (**P < .01; *P < .05).
|
|
Differential effect of NO on LAK generation and LAK lytic function.
Inasmuch as NK cells stimulated with IL-12 or with IL-12 and TNF
display an increased cytotoxic activity towards NK-sensitive and
-resistant targets, the role of NO in the differentiation of LAK cells
as well as its involvement in the lytic function of both NK and LAK
cells was examined. For this purpose, the iNOS inhibitor AMG was added
to purified human NK cell cultures, either during the incubation with
or without IL-12 and/or TNF, or during the 51Cr
release assay against the classical NK target (K562) or against the LAK
target (Daudi).
The NK cells were stimulated with IL-12 or/and TNF, without or with
4 mmol/L AMG. Experiments were performed either in regular medium
RPMI-1640 (L-arginine concentration, 0.94 mmol/L) supplemented with
10% human AB serum or in the same medium adjusted to a L-arginine concentration of 2 mmol/L to alleviate a possible depletion of the
substrate during the incubation time and/or to favor the
catalytic activity of the iNOS. After 3 days of culture, the recovered
cells were tested for NK and LAK activities. As seen in
Fig 6A, the adjustment at 2 mmol/L of the
L-arginine concentration during the time of incubation with the
cytokines led to a faint inhibition of the lytic activity as compared
with the nonsupplemented cultures. The augmented activity of IL-12- and
TNF-incubated NK cells was not altered by the presence of the NOS
inhibitor AMG during the 51Cr- release assay. Strikingly,
this cytotoxicity was markedly augmented when AMG was present during
the 3 days of culture.
View larger version (29K):
[in this window]
[in a new window]
| Fig 6.
Effects of AMG on the NK cells cytotoxic activity. NK
cells were purified by negative selection as described in Materials and
Methods and stimulated for 3 days with 5 U/mL IL-12 or/and 20 ng/mL
TNF in the regular medium RPMI 1640 or in the same medium adjusted
to a L-arginine concentration of 2 mmol/L. AMG (4 mmol/L) was added
during the afferent step of sensitization (a.s.) or during the effector
step (e.s). Cytotoxicity against K562 target cells (A) and Daudi target
cells (B) was tested in a standard 4-hour 51Cr- release
assay at an E:T ratio of 12.5:1 for K562 cells and 25:1 for Daudi
cells. Bars represent the means ± SD for three independent
experiments. *P < .05, **P < .01 by the Student's
t-test comparing IL-12/IL-12 + TNF in the presence or
absence of AMG (a.s.)
|
|
Data depicted in Fig 6B demonstrate that AMG was devoid of effect when
added during LAK cytotoxicity assay, yet its presence during the
sensitization phase resulted in a marked increase of the subsequent LAK
activity. The observed increase in cytotoxicity after incubation of NK
cells with AMG could not be attributed to a direct lytic effect of AMG
on the target cells, inasmuch as the effector cells were washed before
the chromium release assay and AMG was devoid of any toxic effect when
added directly to the target cells. Similar conclusions were obtained
using another specific iNOS inhibitor of a different class, 1,3 PB-ITU,
which, when added together with IL-12 and TNF during the
sensitization phase, was also found to induce an augmentation of NK and
LAK activity.
Effect of NO donors on NK and LAK cytotoxicity.
Conversely, chemical NO donors were tested for their potential effect
on NK cytotoxicity and LAK generation. When added at the onset of the
3-day sensitization phase of incubation of NK cells with the cytokines,
SNP was found to elicit a dose-dependent inhibition of the resulting
cytotoxicity, as measured by a classical 4-hour chromium release assay
(Table 1). The SNP at the concentrations used was not toxic for the effector or target cells, with some toxicity
being observed only for concentrations of SNP greater than 100 µg/mL.
Similar results were obtained with another NO donor of a different
structure, Sin-1, as shown in Table 1, whereas control Sin 1C was
inactive (not shown).
AMG potentiates the IFN production by NK cells stimulated with
IL-12 and TNF.
The regulation of NK activity has been reported to be often associated
with IFN production.37,38 We asked whether the regulation of NK cells by AMG involves IFN production by these cells. As shown in Fig 7, stimulation of
purified NK cells with IL-12 resulted in a marked induction of IFN.
The latter was significantly increased (~50%) in the presence of the
iNOS inhibitor AMG. Moreover, in the presence of TNF, which by
itself does not stimulate IFN release nor potentiate that elicited
by IL-12, AMG was found to yield a higher amount of IFN. Therefore,
it would appear that NO generated during the sensitization of NK cells
with IL-12 and/or TNF inhibits, in part, the secretion of
IFN by these cells. The addition of anti-IFN during the
sensitization phase with IL-12 and TNF resulted in a partial
inhibition of NK and LAK function. The increased cytotoxicity observed
when AMG is present during the afferent phase was also suppressed to a
comparable level by the neutralizing anti-IFN antibody, suggesting
that the augmentation of lytic activity elicited by inhibition of NOS activity was effectively due, at least in part, to the elevated production of IFN (data not shown).
View larger version (27K):
[in this window]
[in a new window]
| Fig 7.
Effect of AMG on IFN production by NK cells. Purified
NK cells (106 cells/mL) were incubated with the indicated
cytokines in presence or absence the AMG for 3 days. Supernatants were
collected and IFN production was measured by ELISA. Results are
expressed as the mean ± SD of three different donors. Asterisks
denote statistically significant differences between IL-12 + TNF + AMG and IL-12 + TNF (*P < .05), as determined by the
Student's t-test.
|
|
AMG stimulates the expression of granzyme B in cytokine-stimulated NK
cells.
The cytotoxic granule component, granzyme B, is associated with
NK-mediated cytolytic activity.39,40 We therefore analyzed the effect of AMG on the expression of this cytotoxic molecule upon
stimulation with IL-12 and TNF. Extracts from stimulated NK cells
were probed by Western blot with mouse antihuman granzyme B. As shown
in Fig 8, granzyme B protein was
constitutively expressed by unstimulated NK cells. After incubation
with AMG, a slight increase of the basal level of granzyme B was
observed. The data in Fig 8 also demonstrate that, after stimulation of
NK cells with the combination of IL-12 and TNF, a significant
increase in granzyme B expression was observed. The addition of AMG
resulted in a potentiation of IL-12/TNF-induced granzyme B. This
suggests that NO production may inhibit the cytokines-driven increase
in cytolytic activity through downregulation of granzyme B, which can
be overcome in the presence of an iNOS inhibitor.
View larger version (18K):
[in this window]
[in a new window]
| Fig 8.
Effect of AMG on granzyme B protein in NK cells. NK cells
were cultured in RPMI complete medium during 12 hours in the absence
(lane 1) or presence of AMG (lane 2) or with IL-12 + TNF (lane 3)
and IL-12 + TNF + AMG (lane 4); the cells were then lysed. The
cell lysate was analyzed by Western blot with an anti-granzyme B
antibody, as described in Materials and Methods. Blot was quantitated
by video densitometry and fold induction over the basal activity was
indicated. Similar results were obtained in two other experiments.
|
|
| |
DISCUSSION |
The killing mediated by NK cells represents an important mechanism in
the immune defense against tumors, virus, infected cells, and
parasites.1,2 These cells have the ability to mediate cytotoxicity and also to produce cytokines.4 Recently,
evidence has been provided supporting a role for NO in murine
NK-cell-mediated lysis.15- 17 The present studies indicate
that, in most instances, iNOS is not expressed in unstimulated purified
human NK cells, either at the mRNA or protein level. However, upon
incubation of these cells with IL-12, which is known to stimulate NK
cytotoxicity and generate LAK cells,41 iNOS expression
could be detected, both at the mRNA and protein level. This effect was
potentiated in the presence of TNF. The iNOS protein was
catalytically active, as evidenced by the accumulation of citrulline
and nitrite/nitrate in the supernatants and the direct measurement of
NOS enzymatic activity in cell extracts. The iNOS induction is unlikely
to be due to the small percentage of contaminating monocytes remaining in our preparations of NK cells, because NK sorted cell culture gave
similar results (data not shown). Indeed, even if activated NK cells
release IFN, the latter cytokine, at variance with rodents monocytes, does not induce NO production by human
monocytes/macrophages, even though the presence of iNOS mRNA and
eventually protein may be detected in some instances.42-44
The combination of IL-12 and TNF appears to be more potent for
inducing iNOS protein, as measured by flow cytometry and Western
blotting, than either cytokine alone, despite the fact that IL-12
appears to be much more potent than TNF in eliciting iNOS
mRNA. The induction of iNOS by IL-12 and TNF in NK
cells is consistent with earlier findings of Hibbs et al45
and Ochoa et al46 indicating that IL-2 was also a potent
inducer of high-output NO synthase in human patients treated for
advanced malignancy. However, the cellular origin and contribution of
NO to IL-2-mediated tumor regression remains to be established.
Huang et al47 have reported that a high seric concentration
of NO in MRL/lpr mice was correlated with a high level of IL-12, as
compared with MRL/+ mice. Upon stimulation of splenic or peritoneal cells from MRL/lpr mice with IFN and lipopolysaccharide
(LPS), an increase of NO was observed, subsequent to an
upregulation of IL-12 production. The effect of IL-12 on NO production
was found to be mostly dependent on the presence of NK cells. Yet, the
putative contribution of NK-associated NO production in vivo against
tumor cells remains controversial. Recently, in a model of gene therapy
with granulocyte-macrophage colony-stimulating factor (GM-CSF) in a
mouse injected with B16 melanoma cells, the protective effect of this
cytokine appeared mainly to be mediated by activated macrophages
actively synthesizing NO, whereas the effect of NK, LAK, and CTL was
little.48 In a model of intestinal graft-versus-host reaction in mouse, NG-mono-methyl-L-arginine (L-
NMMA), an inhibitor of the iNOS pathway, was found to reduce the
enhanced activity of NK cells that occurs in this graft
complication.49 Cifone et al16 have also
observed that stimulation of rat NK cells with IL-2 and/or
through NKR-P1 triggering resulted in LAK activity that was sensitive
to NOS inhibitors and to depletion of L- arginine in the assay buffer.
Our data indicate that the IL-12/TNF combination was efficient to
trigger the induction of iNOS in NK cells. Despite the time-correlated
effects, the release of NO does not seem to be involved in the enhanced
lytic potential of NK cells. Indeed, as stated above, the presence of a
specific iNOS inhibitor, such as AMG, during the efferent stage of
51Cr-release did not significantly affect the cytotoxic
potential of the effector cells. Interestingly, we found that the
presence of AMG and of 1,3 PB-ITU, two specific iNOS inhibitors, during the sensitization phase of NK cells with IL-12 or IL-12 and TNF markedly increased the cytotoxic ability of these cells. Conversely, the addition of chemical NO donors resulted in an impairment of the
subsequent lytic activity mediated by NK and LAK cells. Taken together,
these data suggest that NO endogenously produced by the iNOS elicited
in NK cells after stimulation by IL-12 and TNF may contribute to
downregulate stimulation of lytic potential.
Our observations are somewhat different from those of studies that were
performed using mouse NK cells, in which the depletion of arginine in
the lytic assay medium resulted in an abrogation of NK
cytotoxicity.17 This discrepancy may be due
to differences in the experimental conditions related to NK
purification, stimulation, and/or to species differences. In
this regard, it should be noted that human and murine NK cells are
differentially regulated. For instance, whereas IL-4 activates NK cells
into LAK effectors in a murine model,50 we have previously
reported that this cytokine was efficient in inhibiting IL-2-induced
human LAK generation.51
Our data delineate an important role of endogenously produced NO in the
regulation of NK and LAK activity. Indeed, after the induction of iNOS
in NK cells upon stimulation with IL-12, alone or in combination with
TNF, the presence of iNOS inhibitors yields effector cells with
increased cytotoxic potential towards both NK and LAK targets. This
indicates that the NO generated inhibits, to some extent, the
cytokine-driven increase of the lytic potential of NK cells and their
differentiation into LAK effectors. A possible mechanism for the
increased NK lytic activity detected after cytokine stimulation in the
presence of an iNOS inhibitor may be due to the observed enhancement of
the secretion of IFN. It is well established that one of the most
potent functions of IL-12 is its ability to induce NK cells to produce
lymphokines, particularly IFN, which is known to upregulate the NK
lytic activity.37,38 Indeed, as expected, the addition of a
neutralizing anti-IFN antibody was found to reduce the increase in
cytotoxic activity elicited by the treatment with IL-12 and TNF,
inasmuch as this combination of cytokines is known to induce IFN
production by NK cells, which contributes to the enhanced lytic
activity. Moreover, the anti-IFN was found to reduce to a similar
level the increase in cytotoxicity evoked in the presence of iNOS
inhibitor, indicating an involvement of IFN in this process.
The addition of an iNOS inhibitor during the phase of stimulation with
cytokines also resulted in an enhanced expression of granzyme B
protein, which plays a relevant role in cell-mediated cytotoxicity.
Granzyme B is constitutively expressed in NK cells and its level of
expression in cytotoxic lymphocytes is regulated by several cytokines.
Whether NO could affect some transcription factors involved in the
expression of the IFN and granzyme B genes by IL-12 and TNF is
currently under investigation. In this regard, it has been reported
that the promoter of IFN gene contains an NF- B-related site that
binds NF-B protein family members.52 Because NO has been
shown to inhibit NF-B through stabilization of IB53, this
could contribute to the observed increased production of IFN by NK
cells stimulated by IL-12 and TNF in the presence of AMG.
Overall, these findings suggest that the NO generated in human NK cell
in response to cytokine stimulation inhibits the lytic potential of
these cells. Therefore, the development of NO inhibitors to circumvent
its production and action could potentially contribute to the design of
appropriate strategies for cytokine-based immune-intervention.
| |
FOOTNOTES |
Submitted November 3, 1997;
accepted May 11, 1998.
Supported by grant from INSERM, IGR, ARC (6227), ARC (6957), la Ligue
Nationale Française de Recherche contre le Cancer. O.S. is
supported by la Société de Secours des Amis des Sciences.
Address reprint requests to Salem Chouaib, PhD, Laboratoire Cytokines
et Immunologie des Tumeurs Humaines, U 487 INSERM, Institut Gustave-Roussy, 39 rue Camille Desmoulins, 94805 Villejuif Cedex, France; e-mail: chouaib{at}igr.fr.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors are indebted to Dr M. Sasportes and Dr Y. Zhang for kindly
providing granzyme B antibody, to Dr J. Wietzerbin for anti-IFN
antibody, and to Dr R. Webber (R&D) for iNOS antibody. We acknowledge
Dr A. Caignard, Dr F.M. Chouaib, and Dr V. Shatrov for critical reading
of the manuscript and F. Gay for excellent technical assistance.
| |
REFERENCES |
1.
Trinchieri G:
Biology of natural killer.
Adv Immunol
47:187,
1989[Medline]
[Order article via Infotrieve]
2.
Robertson MJ,
Ritz J:
Biology and clinical relevance of human natural killer cells.
Blood
76:2421,
1990[Free Full Text]
3.
Henney CS,
Kuribayashi K,
Kern DE,
Gillis S:
Interleukin 2 augments natural killer cell activity.
Nature
291:335,
1981[Medline]
[Order article via Infotrieve]
4.
Trinchieri G,
Matsumoto-Kobayashi M,
Clark SC,
Sheehra J,
London L,
Perussia B:
Response of resting human peripheral blood natural killer cells to interleukin-2.
J Exp Med
160:1147,
1984[Abstract/Free Full Text]
5.
Ellis TM,
McKenzie RS,
Simms PE,
Helfrich BA,
Fisher RI:
Induction of human lymphokine-activated killer cells by IFN-alpha and IFN-gamma.
J Immunol
143:4282,
1989[Abstract]
6.
Robinet E,
Kamoun M,
Farace F,
Chouaib S:
Interleukin-4 differentially regulates interleukin-2-mediated and CD2-mediated induction of human lymphokine-activated killer effectors.
Eur J Immunol
22:2861,
1992[Medline]
[Order article via Infotrieve]
7.
Chouaib S,
Bertoglio J,
Blay JY,
Marchiol-Fournigault C,
Fradelizi D:
Lymphokine activated killers generation pathways: Synergism between tumor necrosis factor and interleukin-2.
Proc Natl Acad Sci USA
85:6875,
1988[Abstract/Free Full Text]
8.
Salvucci O,
Mami-Chouaib F,
Moreau JL,
Thèze J,
Chehimi J,
Chouaib S:
Differential regulation of interleukin-12 and interleukin-15-induced natural killer cell activation by interleukin-4.
Eur J Immunol
26:2736,
1996[Medline]
[Order article via Infotrieve]
9.
Young JDE,
Hengartener H,
Podack ER,
Cohn ZA:
Purification and characterization of a cytolytic pore-forming protein from granules of cloned lymphocytes with natural killer activity.
Cell
44:849,
1986[Medline]
[Order article via Infotrieve]
10.
Clark WR:
Perforin-a primary or auxiliary lytic mechanism?
Immunol Today
9:101,
1988[Medline]
[Order article via Infotrieve]
11.
Clement MV,
Haddad P,
Soulie A,
Legros-Maida S,
Guillet J,
Cesar E,
Sasportes M:
Involvement of granzyme B and perforin gene expression in the lytic potential of human natural killer cells.
Res Immunol
141:477,
1990[Medline]
[Order article via Infotrieve]
12.
Henkart PA:
Lymphocyte-mediated cytotoxicity: Two pathways and multiple effector molecules.
Immunity
1:343,
1994[Medline]
[Order article via Infotrieve]
13.
Berke G:
The CTL's kiss of death.
Cell
81:9,
1995[Medline]
[Order article via Infotrieve]
14.
Arase H,
Arase N,
Saito T:
Fas-mediated cytotoxicity by freshly isolated natural killer cells.
J Exp Med
181:1235,
1995[Abstract/Free Full Text]
15.
Juretic A,
Spagnoli GC,
Von Bremen K,
Hörig H,
Filgueira L,
Lüscher U,
Babst R,
Harder F,
Heberer M:
Generation of lymphokine-activated killer activity in rodents but not in humans is nitric oxide dependent.
Cell Immunol
157:462,
1994[Medline]
[Order article via Infotrieve]
16.
Cifone MG,
Festuccia C,
Cironi L,
Cavallo G,
Chessa MA,
Pensa V,
Tubaro E,
Santoni A:
Induction of the nitric oxide-synthesizing pathway in fresh and Interleukin 2-cultured rat natural killer cells.
Cell Immunol
157:181,
1994[Medline]
[Order article via Infotrieve]
17.
Filep JG,
Baron C,
Lachance S,
Perreault C,
Chan JS:
Involvement of nitric oxide in target-cell lysis and DNA induced by murine natural killer cells.
Blood
87:5136,
1996[Abstract/Free Full Text]
18.
Nathan C:
Nitric oxide as secretory product of mammalian cells.
FASEB J
6:3051,
1992[Abstract]
19.
Moncada S,
Palmer RMJ,
Higgs EA:
Nitric oxide: Physiology, pathophysiology and pharmacology.
Pharmacol Rev
43:109,
1991[Medline]
[Order article via Infotrieve]
20.
Dugas B,
Debré P,
Moncada S:
Nitric oxide a vital poison inside the immune and inflammatory network.
Res Immunol
146:664,
1996
21.
Moncada S,
Higgs EA:
Molecular mechanisms and therapeutic strategies related to nitric oxide.
FASEB J
9:1319,
1995[Abstract]
22.
Nathan CF,
Hibbs JB:
Role of nitric oxide synthesis in macrophage antimicrobial activity.
Curr Opin Immunol
3:65,
1991[Medline]
[Order article via Infotrieve]
23.
Nussler AK,
Billiar TR:
Inflammation, immunoregulation and inducible nitric oxid synthase.
J Leukoc Biol
54:171,
1993[Abstract]
24.
Palmer RMJ,
Ferrige AS,
Moncada S:
Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor.
Nature
327:524,
1987[Medline]
[Order article via Infotrieve]
25.
Knowles RG,
Moncada S:
Nitric oxide synthases in mammals.
Biochem J
298:249,
1994
26.
Nathan C,
Xie QW:
Nitric oxide synthases: Roles, tolls, and controls.
Cell
78:915,
1994[Medline]
[Order article via Infotrieve]
27.
Sotomayor EM,
DiNapoli MR,
Calderon C,
Colsky A,
Fu Y-X,
Lopez DM:
Decreased macrophage-mediated cytotoxicity in mammary-tumor-bearing mice is related to an alteration of nitric oxide production and/or release.
Int J Cancer
60:660,
1995[Medline]
[Order article via Infotrieve]
28.
Misko TP,
Moore WM,
Kasten TP,
Nickols GA,
Corbett JA,
Tilton RG,
McDaniel ML,
Williamson JR,
Currie MG:
Selective inhibition of the inducible nitric oxide synthase by aminoguanidine.
Eur J Pharmacol
233:119,
1993[Medline]
[Order article via Infotrieve]
29.
Garvey EP,
Oplinger JA,
Tanoury GJ,
Sherman PA,
Fowler M,
Marshall S,
Harmon MF,
Paith JE,
Furfine ES:
Potent and selective inhibition of human nitric oxide synthases. Inhibition by non-amino acid isothioureas.
J Biol Chem
269:26669,
1994[Abstract/Free Full Text]
30.
Hamid Q,
Springall DR,
Riveros-Moreno V,
Chanez P,
Howarth P,
Redington A,
Bousquet J,
Godard P,
Holgate S,
Polak JM:
Induction of nitric oxide synthase in asthma.
Lancet
342:1510,
1993[Medline]
[Order article via Infotrieve]
31.
Miossec C,
Faure F,
Ferradini L,
Roman-Roman S,
Jitsukawa S,
Ferrini S,
Moretta A,
Triebel F,
Hercend T:
Further analysis of the T cell receptor gamma/delta+ peripheral lymphocyte subset: The Vdelta1 gene segment is expressed with either Calpha or Cdelta.
J Exp Med
171:1171,
1990[Abstract/Free Full Text]
32.
Paul-Eugène N,
Mossalayi MD,
Sarfati M,
Yamaoka K,
Aubry JP,
Bonnefoy JY,
Dugas B,
Kolb JP:
Evidence for a role of Fc RII/CD23 in the IL-4-induced nitric oxide production by normal human mononuclear phagocytes.
Cell Immunol
163:314,
1995[Medline]
[Order article via Infotrieve]
33.
Chomczynsky P,
Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
34.
Vouldoukis I,
Riveros-Moreno V,
Dugas B,
Ouaaz F,
Bécherel P,
Debré P,
Moncada S,
Mossalayi MD:
The killing of Leishmania major by human macrophages is mediated by nitric oxide induced after ligation of the FcRII/CD23 surface antigen.
Proc Natl Acad Sci USA
92:7804,
1995[Abstract/Free Full Text]
35.
Reiling N,
Ulmer AJ,
Duchrow M,
Ernst M,
Flad HD,
Hauschildt S:
Nitric oxide synthase: mRNA expression of different isoforms in human monocytes/macrophages.
Eur J Immunol
24:1941,
1994[Medline]
[Order article via Infotrieve]
36.
Riveros-Moreno V,
Beddell C,
Moncada S:
Nitric oxide synthase. Structural studies using anti-peptides antibodies.
Eur J Biochem
215:801,
1993[Medline]
[Order article via Infotrieve]
37.
Naume B,
Johnsen A-C,
Espevik T,
Sundan A:
Gene expression and secretion of cytokines and cytokine receptors from highly purified CD56+ natural killer cells stimulated with interleukin-2, interleukin-7 and interleukin-12.
Eur J Immunol
23:1831,
1993[Medline]
[Order article via Infotrieve]
38.
Chan SH,
Perussia B,
Gupta JW,
Kobayashi M,
Pospísil M,
Young HA,
Wolf SF,
Young D,
Clark SC,
Trinchieri G:
Induction of interferon production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers.
J Exp Med
173:869,
1991[Abstract/Free Full Text]
39.
Krähenbühl O,
Rey C,
Jenne D,
Lanzavecchia A,
Grossurth P,
Carrel S,
Tschopp J:
Characterization of granzymes A and B isolated from granules of cloned human cytotoxic T lymphocytes.
J Immunol
141:3471,
1988[Abstract]
40.
Clement MV,
Haddad P,
Soulie A,
Legros-Maida S,
Guillet J,
Cesar E,
Sasportes M:
Involvement of granzyme B and perforin gene expression in the lytic potential of human natural killer cells.
Res Immunol
141:477,
1990
41.
Robertson MJ,
Soiffer RJ,
Wolf SF,
Manley TJ,
Donahue C,
Young D,
Herrmann SH,
Ritz J:
Response of human natural killer (NK) cells to NK cell stimulatory factor (NKSF): Cytolitic activity and proliferation of NK cells are differentially regulated by NKSF.
J Exp Med
175:779,
1992[Abstract/Free Full Text]
42.
Denis M:
Human monocytes/macrophages: NO or NO?
J Leukoc Biol
55:682,
1994[Abstract]
43.
Albina JE:
On the expression of nitric oxide synthase hy human macrophages. Why no NO?
J Leukoc Biol
58:643,
1995[Abstract]
44.
Dugas B,
Mossalayi MD,
Damais S,
Kolb JP:
Nitric oxide production by human monocytes: Evidence for a role of CD23.
Immunol Today
16:574,
1995[Medline]
[Order article via Infotrieve]
45.
Hibbs JB,
Westenfelder C,
Taintor R,
Vavrin Z,
Kablitz C,
Baranowski RL,
Ward JH,
Menlove RL,
McMurry MP,
Kushner JP,
Samlowski WE:
Evidence for cytokine-inducible nitric oxide from L-arginine in patients receiving interleukin-2 therapy.
J Clin Invest
89:867,
1992
46.
Ochoa JB,
Curti B,
Peitzman AB,
Simmons RL,
Billiar TR,
Hoffman R,
Rault R,
Longo DL,
Urba WJ,
Ochoa AC:
Increased circulating nitrogen oxides after human tumor immunotherapy: Correlation with toxic hemodynamic changes.
J Natl Cancer Inst
84:864,
1992[Abstract/Free Full Text]
47.
Huang FP,
Feng GJ,
Lindop G,
DI,
Liew FY:
The role of interleukin 12 and nitric oxide in the development of spontaneous autoimmune disease in MRL/MP-lpr/lpr mice.
J Exp Med
183:1447,
1996[Abstract/Free Full Text]
48.
Ju DW,
Cao X,
Acres B:
Intratumoral injection of GM-CSF gene encoded recombinant vaccinia virus elicits potent antitumor response in a mixture melanoma model.
Cancer Gene Ther
4:139,
1997[Medline]
[Order article via Infotrieve]
49.
Garside P,
Hutton AK,
Severn A,
Liew FY,
Mowat AM:
Nitric oxide mediates intestinal pathology in graft-vs.- host disease.
Eur J Immunol
22:2141,
1992[Medline]
[Order article via Infotrieve]
50.
Mulé JJ,
Krosnick JA,
Rosenberg SA:
rIL-4 regulation of murine lymphokine-activated killer activity in vitro. Effects on the rIL-2-induced expansion, cytotoxicity, and phenotype of lymphokine-activated killer effectors.
J Immunol
142:726,
1989[Abstract]
51.
Blay JY,
Branellec D,
Robinet E,
Dugas B,
Gay F,
Chouaib S:
Involvement of cyclic adenosine monophosphate in the interleukin 4 inhibitory effect on interleukin-2 induced lymphokine-activated killer generation.
J Clin Invest
85:1909,
1990
52.
Young HA:
Regulation of IFN- gene transcription.
Semin Virol
6:175,
1995
53.
Peng HB,
Libby P,
Liao JK:
Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B.
J Biol Chem
270:14214,
1995[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. Nicolas, D. Cathelin, N. Larmonier, J. Fraszczak, P.-E. Puig, A. Bouchot, A. Bateman, E. Solary, and B. Bonnotte
Dendritic Cells Trigger Tumor Cell Death by a Nitric Oxide-Dependent Mechanism
J. Immunol.,
July 15, 2007;
179(2):
812 - 818.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Ferlito, K. Irani, N. Faraday, and C. J. Lowenstein
Nitric oxide inhibits exocytosis of cytolytic granules from lymphokine-activated killer cells
PNAS,
August 1, 2006;
103(31):
11689 - 11694.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Bielawska-Pohl, C. Crola, A. Caignard, C. Gaudin, D. Dus, C. Kieda, and S. Chouaib
Human NK Cells Lyse Organ-Specific Endothelial Cells: Analysis of Adhesion and Cytotoxic Mechanisms
J. Immunol.,
May 1, 2005;
174(9):
5573 - 5582.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. S.M. Ramsaransing, A. Teelken, A. V. Arutjunyan, and J. De Keyser
Peripheral blood leukocyte NO production in MS patients with a benign vs progressive course
Neurology,
January 27, 2004;
62(2):
239 - 242.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. W. Kang, S. Y. Choi, M. K. Cho, C. H. Lee, and S. G. Kim
Thrombin Induces Nitric-oxide Synthase via Galpha 12/13-coupled Protein Kinase C-dependent I-kappa Balpha Phosphorylation and JNK-mediated I-kappa Balpha Degradation
J. Biol. Chem.,
May 2, 2003;
278(19):
17368 - 17378.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Blesson, J. Thiery, C. Gaudin, R. Stancou, J.-P. Kolb, J.-L. Moreau, J. Theze, F. Mami-Chouaib, and S. Chouaib
Analysis of the mechanisms of human cytotoxic T lymphocyte response inhibition by NO
Int. Immunol.,
October 1, 2002;
14(10):
1169 - 1178.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. D. Joshi, D. V. Kalvakolanu, J. D. Hasday, R. J. Hebel, and A. S. Cross
IL-18 Levels and the Outcome of Innate Immune Response to Lipopolysaccharide: Importance of a Positive Feedback Loop with Caspase-1 in IL-18 Expression
J. Immunol.,
September 1, 2002;
169(5):
2536 - 2544.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Hosohara, H. Ueda, S.-I. Kashiwamura, T. Yano, T. Ogura, S. Marukawa, and H. Okamura
Interleukin-18 Induces Acute Biphasic Reduction in the Levels of Circulating Leukocytes in Mice
Clin. Vaccine Immunol.,
July 1, 2002;
9(4):
777 - 783.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. S. Falk, E. Noessner, E. H. Weiss, and D. J. Schendel
Retaliation against Tumor Cells Showing Aberrant HLA Expression Using Lymphokine Activated Killer-derived T Cells
Cancer Res.,
January 1, 2002;
62(2):
480 - 487.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Furuke, P. R. Burd, J. A. Horvath-Arcidiacono, K. Hori, H. Mostowski, and E. T. Bloom
Human NK Cells Express Endothelial Nitric Oxide Synthase, and Nitric Oxide Protects Them from Activation-Induced Cell Death by Regulating Expression of TNF-{alpha}
J. Immunol.,
August 1, 1999;
163(3):
1473 - 1480.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. G. Cifone, S. D'Alo, R. Parroni, D. Millimaggi, L. Biordi, S. Martinotti, and A. Santoni
Interleukin-2-Activated Rat Natural Killer Cells Express Inducible Nitric Oxide Synthase That Contributes to Cytotoxic Function and Interferon-gamma Production
Blood,
June 1, 1999;
93(11):
3876 - 3884.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract