Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salvucci, O.
Right arrow Articles by Chouaib, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salvucci, O.
Right arrow Articles by Chouaib, S.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 6 (September 15), 1998: pp. 2093-2102

The Induction of Nitric Oxide by Interleukin-12 and Tumor Necrosis Factor-alpha in Human Natural Killer Cells: Relationship With the Regulation of Lytic Activity

By Ombretta Salvucci, Jean Pierre Kolb, Bernard Dugas, Nathalie Dugas, and Salem Chouaib

From the Laboratoire Cytokines et Immunologie des Tumeurs Humaines, U 487 INSERM, Institut Gustave-Roussy, Villejuif, France; the Interférons et cytokines, Unité 365 INSERM, Institut Curie, Paris, France; the Laboratoire d'Immuno-Hématologie, CNRS URA 625, Hôpital la Pitié Salpétrière, Paris, France; and the Laboratoire Virus Neurone et Immunité, IFR Kremlin Bicètre, Kremlin Bicètre, France.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We have investigated the interleukin-12 (IL-12) and tumor necrosis factor-alpha (TNFalpha )-induced regulation of human natural killer (NK) cell function and their relationship with nitric oxide (NO) generation. We demonstrate that both cytokines were efficient to trigger the transcription of the inducible nitric oxide synthase (iNOS) mRNA, as detected by reverse transcriptase-polymerase chain reaction (RT-PCR). Western blot analysis and intracytoplasmic fluorescence showed that iNOS protein was also induced by both cytokines. However, our data indicate that NO does not play a significant role in the effector phase of the cytotoxic activity mediated by NK-stimulated cells, inasmuch as the lytic activity was not affected in the presence of specific NO synthase inhibitors. When aminoguanidine (AMG), an inhibitor of iNOS, was added during the afferent phase of NK stimulation with IL-12 and TNFalpha , a subsequent increase in the lytic potential of the effector cells towards the NK-sensitive target cells (K562) and lymphokine-activated killer (LAK) target cells (Daudi) was observed. Conversely, the addition of chemical NO donors during the afferent step resulted in a dose-dependent inhibition of the NK and LAK cytotoxicity. Our data suggest that the enhancement of NK-cell cytotoxic activity resulting from iNOS inhibition may be correlated, at least in part, to an increase in interferon-gamma production and granzyme B expression.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

NATURAL KILLER (NK) cells play an important role in the early defense against viral infection and malignant transformation.1,2 Their activity is characterized as nonadaptive and major histocompatibility complex (MHC) unrestricted and is thought to play an important role in immune surveillance. It is now well established that the lytic function of these cells is regulated by a complex network of cytokines acting either independently3-5 or synergistically.6-8 Several mechanisms have been proposed to account for NK cytotoxicity. Exocytosis of granules containing perforin (cytolysin or pore-forming protein) and serine esterases (or granzymes) is believed to be the primary mediator of the cellular cytotoxicity exhibited by NK cells.9-11 Additional studies demonstrated a granule-independent killing pathway involving Fas ligand (FasL).12-14

The existence of a new pathway for induction of the lethal injury to target cells by NK cells has been suggested. In murine model, a role of nitric oxide (NO) in the generation of LAK cells has been reported.15 Moreover, several lines of evidence suggested that nitric oxide synthase (NOS) pathway may mediate NK-cell cytotoxicity in rats and mice.16,17

NO is synthesized from the oxidation of the terminal guanido nitrogen atom of L-arginine by a family of nicotinamide adenine dinucleotide phosphate (NADPH)-dependent enzyme, the NOS.18-21 In addition to the existence of two constitutive isoforms (neuronal NOS and endothelial NOS), a third isoform, the inducible NOS (iNOS), can be elicited in different cell types by various stimuli such as bacteria, microbial products, and/or cytokines.22,23 NO, a short-lived molecule, has been identified as a potent biological mediator.24 It plays an active role in many physiological processes such as vasodilatation, neural function, and inhibition of platelet aggregation, as well as in pathological processes such as inflammation.25,26 Evidence has been provided indicating that activated murine mononuclear phagocytes synthesize NO, which contributes in part to their cytotoxic activity against tumor cells and bacteria.27 Similarly, it has been reported that, in vitro, the tumoricidal function of interleukin-2 (IL-2)-activated rodent NK cells depends, at least in part, on their NO- synthesizing ability. Deprival of L-arginine in the medium or blocking of NO synthesis with NG-methyl-L- arginine (NMMA) reduced the killer function of these cells.16 In contrast, it is unclear whether NO plays a role in the tumoricidal and antimicrobial activities of human NK cells.

In the present study, we have investigated the expression of NOS in human NK cells as well as the involvement of NO in the regulation of the cytotoxic activity of these cells by IL-12 and tumor necrosis factor-alpha (TNFalpha ). We demonstrate that, whereas treatment of NK cells with IL-12 and TNFalpha triggers the expression of the iNOS, NO does not seem to be involved in the basal or induced cytotoxic activity of human NK cells. Our data suggest that NO plays an inhibitory role on the IL-12- and TNFalpha -induced stimulation of NK cells.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Reagents.   L-arginine and aminoguanidine (AMG) hemisulfate salt were purchased from Sigma (St Louis, MO). AMG is a structural analogue of L-arginine that was reported to be more active against the iNOS.28 The 14C-labeled L-arginine was purchased from Amersham (Les Ulis, France) or from NEN (Dreieich, Germany). The strong acid cation exchange resin, binding to L-arginine but not to L-citrulline (AG 50W-X8, 100 to 200 mesh, H form) was purchased from Biorad Laboratories (Richmond, CA). A second NOS inhibitor S,S'-(1,3-Phenylenebis (1,2-ethanediyl)) bisisothiourea, or 1,3 PB-ITU, that was reported to be highly selective for iNOS versus ecNOS29 was purchased from Alexis Biochemicals (San Diego, CA). The chemical NO donor 3-morpholino-sydnonimine (Sin-1) and its inactive control N-morpholino-imino-acetonitril (Sin-1C) were kind gifts from Dr J. Winicki (Laboratoires Hoechst, Paris, France); sodium nitroprusside (SNP) was purchased from Sigma.

Cytokines and monoclonal antibodies (MoAbs).   Recombinant IL-12 (specific activity, 5 × 106 U/mg) was kindly provided by S. Wolf (Genetic Institute, Boston, MA). Highly purified (99%) recombinant TNFalpha (specific activity, 6.63 × 106 U/mg protein) was kindly provided by Dr I. Apfler (Bender Wien, Austria). A polyclonal rabbit antirat iNOS that recognizes the human enzyme30 was kindly provided by V. Riveros-Moreno and S. Moncada (The Cruciform Project, London, UK); a preimmune rabbit antiserum was used as control. Fluorescein isothiocyanate (FITC)-conjugated goat antirabbit IgG (H+L) F(ab')2 fragments were purchased from Jackson Immunoresearch (West Grove, PA). The FITC-conjugated mouse monoclonal anti-macNOS (IgG2a) that recognizes the human iNOS was purchased from Transduction Laboratories (Lexington, KY). The FITC-labeled isotypic control (FITC-IgG2a) was from Becton Dickinson (Mountain View, CA). The mouse monoclonal antihuman granzyme B and the neutralizing antihuman interferon gamma  (IFNgamma ) polyclonal rabbit antibody were kindly provided by M. Sasportes (Hopital Saint Louis, Paris, France) and J. Wietzerbin (Institut Curie, Paris, France), respectively.

Cell preparation.   Peripheral blood lymphocytes (PBL) were isolated from healthy donors (Banque du sang, Hopital Saint-Louis, Paris, France) by Ficoll Hypaque gradient centrifugation followed by plastic adherence. NK cells were enriched by Percoll density gradients, as previously described.7 Cells were then incubated for 30 minutes at 4°C with a cocktail of antibodies: OKT3, OKT4, OKT8 (Ortho Diagnostics Systems, Inc, Westwood, MA), which recognize CD3, CD4, and CD8 molecules, respectively; A13 (MoAb, IgG1) and TiVdelta 2 (MoAb, IgG1), which react with Vdelta 1 and Vdelta 2 gene products, respectively31; and MY4 (anti-CD14) and B4 (anti-CD20) (Coulter/Immunotech, Marseille, France). The cells were resuspended in RPMI complete medium supplemented with 10% human serum, incubated with magnetic beads (Dynal, Oslo, Norway) for 20 minutes, and passed over a magnet. This separation was performed twice and the resulting cell preparation contained 99% CD3- cells. Alternatively, NK cells were purified as positively sorted CD3-CD56+ NK cells using fluorescence-activated cell sorting after magnetic bead depletion.

Determination of L-citrulline, nitrate/nitrite concentration, and cytokine assay.   NK cells were cultured for 3 days without or with IL-12 or/and TNFalpha in the absence or in the presence of AMG. L-citrulline levels were determined in the cell-free supernatants from NK cultures by colorimetric detection, as described previously.32 Briefly, L-citrulline was measured by the colorimetric reaction of carbamido groups with diacetyl monoxime in acid solution. A total of 30 µL of urease (25 U/mL) was added to 300 µL of supernatants for 1 hour of incubation at 37°C. After the addition of 37.5 µL of trichloroacetic acid (TCA) (59% vol/vol), the precipitated proteins were removed by 5 minutes of centrifugation at 11,000 rpm in an Eppendorf centrifuge. A total of 250 µL of supernatants was harvested and 300 µL of a 1:1 (vol/vol) mixture of 240 mmol/L diacetyl monoxime and a solution of phenazone (3 g in 104 mL H2O reacted with 12 mg FeSO4 and 21 mL H2SO4 36 N) was added for 15 minutes of incubation at 90°C in the dark. A total of 200 µL was collected and transferred to a microtitration plate for measurement of the optical density (OD) at 492 nm using an autoreader (Dynatech Laboratories Inc, Boulogne, Billancourt, France). A calibration curve was performed in parallel with a standard solution of citrulline. Supernatants were also tested for the presence of nitrite/nitrate after reduction of nitrate into nitrite using a Nitric Oxide Assay kit (R&D Systems Europe, Oxon, UK).

The same supernatants were also tested for IFNgamma production by enzyme-linked immunosorbent assay (ELISA; Genzyme, Cambridge, MA or Immunotech/Coulter, Marseille, France).

Analysis of iNOS gene expression.   Total RNA was isolated from freshly harvested cells using RNAzol (Bioprobe System, Montreuil-sous-bois, France) procedure based on the method of Chomczynski and Sacchi.33 iNOS mRNA expression was investigated with reverse transcriptase-polymerase chain reaction (RT-PCR), as described.34 The low expression level of iNOS mRNA does not allow its detection by classical Northern blot analysis and usually required a more sensitive technique, such RT-PCR.35 The sequences of the intron-spanning oligonucleotide primer sets in these experiments were as follows: iNOS mRNA sense (5' TCCGAGGCAAACAGCACATTCA 3') and iNOS mRNA antisense (5' GGGTTGGGGGTGTGGTGATGT 3') and beta -actin mRNA sense (5' GGGTCAGAAGGATTCCTATG 3') and mRNA antisense (5' GGGTCAGAAGGATTCCTAATG 3'). The iNOS message is represented by a 371-bp band, and a 237- bp band indicates the beta -actin message. The PCR conditions were the following: 3 minutes of denaturation at 94°C, 1 minute of annealing at 60°C, and 1 minute of elongation at 72°C for 42 cycles using a GeneAmp 96000 PCR system (Perkin-Elmer Cetus, Norwalk, CT). The amplified products were analyzed on 0.8% agarose gel containing 0.5 mg/mL ethidium bromide.

Immunofluorescence analysis.   Detection of intracellular protein iNOS was performed with FIX & PERM cell permeabilization kits (Caltag Laboratories, Burlingame, CA) for fixing in suspension and then permealizing the cells. The cells were incubated with appropriate dilution of the anti-iNOS antibody or control rabbit serum for 30 minutes at 4°C. After washes in phosphate-buffered saline supplemented with 1% bovine serum albumin (PBS-BSA), the cells were incubated with FITC-labeled goat antirabbit F(ab')2 fragment for an additional 30 minutes at 4°C. Alternatively, direct fluorescence was performed using the FITC-conjugated anti-macNOS MoAb. Cells were then extensively washed and analyzed using an EPICS C (Coulter Counter). Fluorescence data were collected on 5 × 103 viable cells, as determined by forward light scatter intensity. Background fluorescence was determined in each case by using an isotype-matched antibody.

Western blot analysis for iNOS and granzyme B.   Determination of iNOS protein in NK cells, cultured for various times (from 4 to 24 hours) without or with IL-12 or/and TNFalpha , was performed by Western blotting of cytosolic protein extracts. The cells were lysed in 10 mmol/L Tris-HCl, pH 7.4, buffer heated to 90°C. The buffer contained 1% sodium dodecyl sulfate (SDS), 10 µg/mL leupeptin, 2 mmol/L phenylmethylsulfonyl fluoride (PMSF), 2 µg/mL aprotinin, 10 µg/mL pepstatin A, and 2 mmol/L phenanthroline. Samples of 10 or 50 µg of protein were electrophoresed under reducing conditions on 7.5% SDS-polyacrylamide minigels. The proteins were then electroblotted to 0.2-mm vinylidene difluoride and the membrane was blocked with 10 mmol/L Tris-HCl, 100 mmol/L NaCl, pH 7.5 (TBS), containing 1% BSA and 0.1% Tween 20. Blots were then incubated with the rabbit antimouse iNOS antibody at a final concentration of 1/500 vol/vol.36 The blots were then washed with 1% TBS containing 0.1% Tween 20 and incubated with a goat antirabbit Ig-conjugated to horseradish peroxidase, and bands were shown by luminol-dependent chemiluminescence (ECL; Amersham). The maximum light emission is at a wavelength of 428 nm and was detected by short exposure to blue light-sensitive autoradiography film (Hyperfilm ECL, Paris, France). For granzyme B protein, NK cells were cultured for 12 hours with IL-12 and TNFalpha , in the presence or absence of AMG. The cells were lysed in the buffer containing 20 mmol/L Tris/HCl, pH 8, 1 mmol/L EDTA, pH 8, 150 mmol/L NaCl, 1% NP40, 10% glycerol, 0.2 mmol/L PMSF, 1 mmol/L dithiothreitol (DTT), and 20 µL/mL of Protease Inhibitor Cocktail tablets (Complete; Boehringer Mannheim, Mannheim, Germany). Samples of 10 µg were electrophoresed on 12.5% SDS-polyacrylamide minigels and the blot was incubated with the mouse antihuman granzyme B at a final concentration of 1/600 and shown as previously described with a peroxidase-conjugated antimouse Ig (Santa Cruz Biotechnology, Inc, Santa Cruz, CA).

Enzymatic iNOS activity.   NK cells (2 × 106) were stimulated with IL-12 or/and TNFalpha in presence or absence of AMG. Cultures were performed in Iscove medium (1 mL/well) supplemented with glutamine (2 mmol/L), penicillin (100 U/mL), streptomycin (100 µg/mL), 20 mmol/L HEPES, 5% normal human serum, and L-arginine to obtain a concentration of 1 mmol/L in the medium. Cell extracts were prepared by 4 cycles of freezing on liquid nitrogen and thawing in a 50 mmol/L Tris, HCl buffer, pH 7.5, containing a cocktail of protease inhibitors and centrifuged at 14,000g for 15 minutes at 4°C to remove debries. Supernatants were collected, their protein concentration was determined, and iNOS activity was measured by quantifying the conversion of [14C] L-arginine into [14C] L-citrulline according to a technique described elsewhere.34 [14C] L-citrulline in the eluate was quantitated by scintillation counting.

Cytotoxicity assay.   NK cells were stimulated for 3 days in complete medium (CM; RPMI 1640 supplemented with 10% normal human serum, 100 UI/mL penicillin, 100 µg/mL streptomycin, and 2 mmol/L L-glutamine) in the presence of the indicated cytokines. L-arginine and AMG were added in CM at final concentrations of 2 and 4 mmol/L, respectively. AMG was added either during the time of incubation with the cytokines or during the 51Cr- release assay. After the culture period, serial dilutions of effector cells were then distributed in duplicates (0.1 mL per well) into round-bottomed microwell plates. K562 and Daudi target cells were labeled with 200 mCi of Na251CrO4 (5 µCi/mL; Amersham) for 1 hour at 37°C and washed three times, and 5,000 cells per well (in 0.1 mL volume) were distributed in round-bottom microwells with 0.1 mL of effector cells at various effector to target cell (E/T) ratios. After 4 hours of incubation at 37°C, the plates were centrifuged at 2,000g for 2 minutes and cell-free supernatants were collected using a cell harvester (Skatron Inc, Sterling, VA). Supernatant radioactivity was assayed using an automated gamma counter (Packard Instrument Co, Meriden, CT). Spontaneous release was determined by incubating target cells in medium alone. Maximum release was determined by adding 0.1 mL of 1 mol/L HCl to the target cell suspension. The percentage of specific lysis was calculated as follows: 100 × (Experimental 51Cr Release - Spontaneous 51Cr Release)/(Maximum 51Cr Release - Spontaneous 51Cr Release).

Statistical analysis.   Significant differences between cytokine-induced NK-cell activation with or without the inhibitor of iNOS were determined by the Student's t-test adapted for a small number of samples. The data were analyzed with use of the InStat 1.4 software (StatSoft Inc, Tulsa, OK). Comparisons were considered significant for a corresponding P <=  .05.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Effect of IL-12 and TNFalpha on citrulline and nitrate/nitrite release by human NK cells.   The effect of IL-12 and TNFalpha on NOS-derived arginine metabolite generation in highly purified human NK cells was investigated. Because NO by itself is a very labile molecule, it is difficult to perform direct determination of its concentration. The amount of the other product of the NOS enzymatic reaction, namely the citrulline released in the supernatants, was quantitated by a colorimetric technique. As seen in Fig 1A, a slight increase in L-citrulline production was observed in the presence of IL-12 or TNFalpha . However, in the presence of both cytokines, a marked accumulation of citrulline was detected that was greatly reduced in the presence of AMG (4 mmol/L), a specific inhibitor of the iNOS. The amount of nitrite/nitrate released by cultured cells was also measured by NO assay. IL-12 or IL-12 and TNFalpha induced an increase in NO2-/NO3- that was significantly abrogated by the addition of AMG (4 mmol/L; Fig 1B). The levels of citrulline and nitrite/nitrate released were roughly of the same order of magnitude, taking into account the individual variations between different blood donors.


View larger version (20K):
[in this window]
[in a new window]
 
Fig 1. Production of citrulline and nitrate/nitrite in cultures of NK cells. Purified NK cells (106 cells/mL) were incubated in Dulbecco's modified Eagle's medium (DMEM; arginine content, 0.4 mmol/L) with IL-12 (5 U/mL) or/and TNFalpha (20 ng/mL) without or with AMG (4 mmol/L) for 3 days. Supernatants were then collected and production of citrulline (A) and nitrate/nitrite (B) levels was determined as described in Materials and Methods. The results are expressed as the mean ± SE of three different experiments. The asterisks denote a statistically significant difference (P < .01) between IL-12 + AMG and IL-2 or/and IL-12 + TNFalpha  + AMG and IL-12 + TNFalpha , as determined by the Student's t-test.

iNOS gene expression in human NK cells.   Expression of iNOS mRNA was analyzed in human NK cells upon the addition of human recombinant IL-12 or/and TNFalpha by reverse transcription of RNA followed by DNA polymerase chain reaction (RT-PCR) using specific human iNOS primers. beta -Actin primers were used as a control of amplification. PCR products were analyzed on ethidium-stained agarose gel. As shown in Fig 2, unstimulated NK cells do not express any iNOS mRNA, although a faint band could be observed for some donors. After stimulation with TNFalpha , IL-12, or their combination, an amplification fragment corresponding to the expected size of 371 bp was visualized. These results demonstrate that iNOS expression is mostly not constitutive in purified NK cells but can be induced after the addition of human recombinant IL-12 or/and TNFalpha .


View larger version (29K):
[in this window]
[in a new window]
 
Fig 2. iNOS gene expression in unstimulated and IL-12- or/and TNFalpha -treated NK cells. NK cells were stimulated for 7 hours in the absence (lane 1) or presence of IL-12 (5 U/mL) (lane 2), IL-12 and TNFalpha (lane 3), or TNFalpha (20 ng/mL) (lane 4), and then mRNA was extracted. The presence of iNOS mRNA was analyzed by RT-PCR, as described in Materials and Methods. Data are from one representative experiment of seven that gave comparable results.

IL-12 and TNFalpha synergize in inducing iNOS protein and activity by human NK cells.   The expression of iNOS was investigated at the protein level by immunofluorescence on permeabilized cells and fluorescence-activated cell sorting (FACS) analysis using a specific polyclonal anti-iNOS antiserum. As shown in Fig 3, cells stimulated with the combination of IL-12 and TNFalpha displayed higher iNOS immune reactivity in their cytoplasm than cells stimulated with IL-12 or TNFalpha alone. Unstimulated NK cells failed to express the iNOS protein, and the staining was determined at the same level as the control antibody. These experiments were confirmed on positively selected FACS-sorted CD56+ NK cells using the commercial FITC-conjugated anti-macNOS MoAb (not shown). The presence of iNOS protein in stimulated NK cells was also analyzed by specific Western blotting. Whereas the expression of iNOS was undetectable or weakly detectable in unstimulated NK cells, depending on the donors, a major band of 135 kD was detected after incubation of these cells for 24 hours with either IL-12 or TNFalpha alone. This band was clearly more intense after cell treatment by the combination of IL-12 and TNFalpha (Fig 4). This observation was confirmed by immunocytochemistry and similar data were also obtained using a mouse MoAb against human iNOS.


View larger version (19K):
[in this window]
[in a new window]
 
Fig 3. iNOS protein expression in stimulated NK cells. NK cells were stimulated for 24 hours in the presence or absence of IL-12 (5 U/mL) or/and TNFalpha (20 ng/mL) and then harvested. The cells were washed, permeabilized, and stained with a polyclonal rabbit anti-iNOS and then with a (FITC)-conjugated F(ab')2 fragment goat antirabbit IgG, as described in Materials and Methods. Fluorescence data were collected on 5,000 viable cells. (Open area) untreated NK cells (profile identical to that obtained with the preimmune serum, indicative that these cells were negative for the expression of this marker). (Shaded area) NK cells stimulated with TNFalpha (upper panel), IL-12 (middle panel), or both cytokines (lower panel). The percentage represents the change in the mean log fluorescence for this experiment. Student's t-test after comparison of the values obtained with IL-12 + TNFalpha with the corresponding values obtained with medium, IL-12, or TNFalpha results in P < .05. Similar results were obtained in three other experiments.


View larger version (22K):
[in this window]
[in a new window]
 
Fig 4. Western blot analysis of iNOS expression in NK cells. NK cells were treated with the indicated cytokines for 24 hours, lysed, and analyzed by Western blot with a polyclonal rabbit antirat iNOS that cross-reacts with human iNOS, as described in Materials and Methods. The fold induction over the basal activity was quantitated with video densitometry.

After the demonstration of iNOS mRNA and protein induction in NK cells, we next asked whether the detected iNOS was functional. For this purpose, the ability of cellular extracts to convert L-[14C]arginine to L-[14C]citrulline was measured. Results in Fig 5 show that no catalytic NOS activity was detected in extracts from unstimulated NK cells. However, 48 hours of incubation with IL-12 was efficient to induce iNOS activity that was potentiated through simultaneous addition of TNFalpha . The enzymatic activity was markedly suppressed (60% to 75%) in the presence of AMG during the assay.


View larger version (16K):
[in this window]
[in a new window]
 
Fig 5. iNOS activity in human NK cells. NOS activity was determined by monitoring of [14C] L-citrulline produced per milligram of cellular protein per minute. NK cells were stimulated with IL-12 (5 U/mL) or/and TNFalpha (20 ng/mL) for 48 hours, and then cell lysates were prepared and tested for their NOS catalytic activity by measuring their capacity to convert radiolabeled arginine into citrulline, as described in Materials and Methods. Results are expressed as the mean ± SD of three representative experiments. Significance of inhibition was assessed by the Student's t-test after comparison of the values obtained with IL-12 or/and TNFalpha  + AMG, with the corresponding values obtained in each experiment with IL-12 or/and TNFalpha (**P < .01; *P < .05).

Differential effect of NO on LAK generation and LAK lytic function.   Inasmuch as NK cells stimulated with IL-12 or with IL-12 and TNFalpha display an increased cytotoxic activity towards NK-sensitive and -resistant targets, the role of NO in the differentiation of LAK cells as well as its involvement in the lytic function of both NK and LAK cells was examined. For this purpose, the iNOS inhibitor AMG was added to purified human NK cell cultures, either during the incubation with or without IL-12 and/or TNFalpha , or during the 51Cr release assay against the classical NK target (K562) or against the LAK target (Daudi).

The NK cells were stimulated with IL-12 or/and TNFalpha , without or with 4 mmol/L AMG. Experiments were performed either in regular medium RPMI-1640 (L-arginine concentration, 0.94 mmol/L) supplemented with 10% human AB serum or in the same medium adjusted to a L-arginine concentration of 2 mmol/L to alleviate a possible depletion of the substrate during the incubation time and/or to favor the catalytic activity of the iNOS. After 3 days of culture, the recovered cells were tested for NK and LAK activities. As seen in Fig 6A, the adjustment at 2 mmol/L of the L-arginine concentration during the time of incubation with the cytokines led to a faint inhibition of the lytic activity as compared with the nonsupplemented cultures. The augmented activity of IL-12- and TNFalpha -incubated NK cells was not altered by the presence of the NOS inhibitor AMG during the 51Cr- release assay. Strikingly, this cytotoxicity was markedly augmented when AMG was present during the 3 days of culture.


View larger version (29K):
[in this window]
[in a new window]
 
Fig 6. Effects of AMG on the NK cells cytotoxic activity. NK cells were purified by negative selection as described in Materials and Methods and stimulated for 3 days with 5 U/mL IL-12 or/and 20 ng/mL TNFalpha in the regular medium RPMI 1640 or in the same medium adjusted to a L-arginine concentration of 2 mmol/L. AMG (4 mmol/L) was added during the afferent step of sensitization (a.s.) or during the effector step (e.s). Cytotoxicity against K562 target cells (A) and Daudi target cells (B) was tested in a standard 4-hour 51Cr- release assay at an E:T ratio of 12.5:1 for K562 cells and 25:1 for Daudi cells. Bars represent the means ± SD for three independent experiments. *P < .05, **P < .01 by the Student's t-test comparing IL-12/IL-12 + TNFalpha in the presence or absence of AMG (a.s.)

Data depicted in Fig 6B demonstrate that AMG was devoid of effect when added during LAK cytotoxicity assay, yet its presence during the sensitization phase resulted in a marked increase of the subsequent LAK activity. The observed increase in cytotoxicity after incubation of NK cells with AMG could not be attributed to a direct lytic effect of AMG on the target cells, inasmuch as the effector cells were washed before the chromium release assay and AMG was devoid of any toxic effect when added directly to the target cells. Similar conclusions were obtained using another specific iNOS inhibitor of a different class, 1,3 PB-ITU, which, when added together with IL-12 and TNFalpha during the sensitization phase, was also found to induce an augmentation of NK and LAK activity.

Effect of NO donors on NK and LAK cytotoxicity.   Conversely, chemical NO donors were tested for their potential effect on NK cytotoxicity and LAK generation. When added at the onset of the 3-day sensitization phase of incubation of NK cells with the cytokines, SNP was found to elicit a dose-dependent inhibition of the resulting cytotoxicity, as measured by a classical 4-hour chromium release assay (Table 1). The SNP at the concentrations used was not toxic for the effector or target cells, with some toxicity being observed only for concentrations of SNP greater than 100 µg/mL. Similar results were obtained with another NO donor of a different structure, Sin-1, as shown in Table 1, whereas control Sin 1C was inactive (not shown).

 
View this table:
[in this window] [in a new window]
 
Table 1. Effect of NO Donors on the Stimulation of NK and LAK Activity by IL-12 and TNFalpha

AMG potentiates the IFNgamma production by NK cells stimulated with IL-12 and TNFalpha .   The regulation of NK activity has been reported to be often associated with IFNgamma production.37,38 We asked whether the regulation of NK cells by AMG involves IFNgamma production by these cells. As shown in Fig 7, stimulation of purified NK cells with IL-12 resulted in a marked induction of IFNgamma . The latter was significantly increased (~50%) in the presence of the iNOS inhibitor AMG. Moreover, in the presence of TNFalpha , which by itself does not stimulate IFNgamma release nor potentiate that elicited by IL-12, AMG was found to yield a higher amount of IFNgamma . Therefore, it would appear that NO generated during the sensitization of NK cells with IL-12 and/or TNFalpha inhibits, in part, the secretion of IFNgamma by these cells. The addition of anti-IFNgamma during the sensitization phase with IL-12 and TNFalpha resulted in a partial inhibition of NK and LAK function. The increased cytotoxicity observed when AMG is present during the afferent phase was also suppressed to a comparable level by the neutralizing anti-IFNgamma antibody, suggesting that the augmentation of lytic activity elicited by inhibition of NOS activity was effectively due, at least in part, to the elevated production of IFNgamma (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
Fig 7. Effect of AMG on IFNgamma production by NK cells. Purified NK cells (106 cells/mL) were incubated with the indicated cytokines in presence or absence the AMG for 3 days. Supernatants were collected and IFNgamma production was measured by ELISA. Results are expressed as the mean ± SD of three different donors. Asterisks denote statistically significant differences between IL-12 + TNFalpha  + AMG and IL-12 + TNFalpha (*P < .05), as determined by the Student's t-test.

AMG stimulates the expression of granzyme B in cytokine-stimulated NK cells.   The cytotoxic granule component, granzyme B, is associated with NK-mediated cytolytic activity.39,40 We therefore analyzed the effect of AMG on the expression of this cytotoxic molecule upon stimulation with IL-12 and TNFalpha . Extracts from stimulated NK cells were probed by Western blot with mouse antihuman granzyme B. As shown in Fig 8, granzyme B protein was constitutively expressed by unstimulated NK cells. After incubation with AMG, a slight increase of the basal level of granzyme B was observed. The data in Fig 8 also demonstrate that, after stimulation of NK cells with the combination of IL-12 and TNFalpha , a significant increase in granzyme B expression was observed. The addition of AMG resulted in a potentiation of IL-12/TNFalpha -induced granzyme B. This suggests that NO production may inhibit the cytokines-driven increase in cytolytic activity through downregulation of granzyme B, which can be overcome in the presence of an iNOS inhibitor.


View larger version (18K):
[in this window]
[in a new window]
 
Fig 8. Effect of AMG on granzyme B protein in NK cells. NK cells were cultured in RPMI complete medium during 12 hours in the absence (lane 1) or presence of AMG (lane 2) or with IL-12 + TNFalpha (lane 3) and IL-12 + TNFalpha  + AMG (lane 4); the cells were then lysed. The cell lysate was analyzed by Western blot with an anti-granzyme B antibody, as described in Materials and Methods. Blot was quantitated by video densitometry and fold induction over the basal activity was indicated. Similar results were obtained in two other experiments.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

The killing mediated by NK cells represents an important mechanism in the immune defense against tumors, virus, infected cells, and parasites.1,2 These cells have the ability to mediate cytotoxicity and also to produce cytokines.4 Recently, evidence has been provided supporting a role for NO in murine NK-cell-mediated lysis.15- 17 The present studies indicate that, in most instances, iNOS is not expressed in unstimulated purified human NK cells, either at the mRNA or protein level. However, upon incubation of these cells with IL-12, which is known to stimulate NK cytotoxicity and generate LAK cells,41 iNOS expression could be detected, both at the mRNA and protein level. This effect was potentiated in the presence of TNFalpha . The iNOS protein was catalytically active, as evidenced by the accumulation of citrulline and nitrite/nitrate in the supernatants and the direct measurement of NOS enzymatic activity in cell extracts. The iNOS induction is unlikely to be due to the small percentage of contaminating monocytes remaining in our preparations of NK cells, because NK sorted cell culture gave similar results (data not shown). Indeed, even if activated NK cells release IFNgamma , the latter cytokine, at variance with rodents monocytes, does not induce NO production by human monocytes/macrophages, even though the presence of iNOS mRNA and eventually protein may be detected in some instances.42-44 The combination of IL-12 and TNFalpha appears to be more potent for inducing iNOS protein, as measured by flow cytometry and Western blotting, than either cytokine alone, despite the fact that IL-12 appears to be much more potent than TNFalpha in eliciting iNOS mRNA. The induction of iNOS by IL-12 and TNFalpha in NK cells is consistent with earlier findings of Hibbs et al45 and Ochoa et al46 indicating that IL-2 was also a potent inducer of high-output NO synthase in human patients treated for advanced malignancy. However, the cellular origin and contribution of NO to IL-2-mediated tumor regression remains to be established.

Huang et al47 have reported that a high seric concentration of NO in MRL/lpr mice was correlated with a high level of IL-12, as compared with MRL/+ mice. Upon stimulation of splenic or peritoneal cells from MRL/lpr mice with IFNgamma and lipopolysaccharide (LPS), an increase of NO was observed, subsequent to an upregulation of IL-12 production. The effect of IL-12 on NO production was found to be mostly dependent on the presence of NK cells. Yet, the putative contribution of NK-associated NO production in vivo against tumor cells remains controversial. Recently, in a model of gene therapy with granulocyte-macrophage colony-stimulating factor (GM-CSF) in a mouse injected with B16 melanoma cells, the protective effect of this cytokine appeared mainly to be mediated by activated macrophages actively synthesizing NO, whereas the effect of NK, LAK, and CTL was little.48 In a model of intestinal graft-versus-host reaction in mouse, NG-mono-methyl-L-arginine (L- NMMA), an inhibitor of the iNOS pathway, was found to reduce the enhanced activity of NK cells that occurs in this graft complication.49 Cifone et al16 have also observed that stimulation of rat NK cells with IL-2 and/or through NKR-P1 triggering resulted in LAK activity that was sensitive to NOS inhibitors and to depletion of L- arginine in the assay buffer.

Our data indicate that the IL-12/TNFalpha combination was efficient to trigger the induction of iNOS in NK cells. Despite the time-correlated effects, the release of NO does not seem to be involved in the enhanced lytic potential of NK cells. Indeed, as stated above, the presence of a specific iNOS inhibitor, such as AMG, during the efferent stage of 51Cr-release did not significantly affect the cytotoxic potential of the effector cells. Interestingly, we found that the presence of AMG and of 1,3 PB-ITU, two specific iNOS inhibitors, during the sensitization phase of NK cells with IL-12 or IL-12 and TNFalpha markedly increased the cytotoxic ability of these cells. Conversely, the addition of chemical NO donors resulted in an impairment of the subsequent lytic activity mediated by NK and LAK cells. Taken together, these data suggest that NO endogenously produced by the iNOS elicited in NK cells after stimulation by IL-12 and TNFalpha may contribute to downregulate stimulation of lytic potential.

Our observations are somewhat different from those of studies that were performed using mouse NK cells, in which the depletion of arginine in the lytic assay medium resulted in an abrogation of NK cytotoxicity.17 This discrepancy may be due to differences in the experimental conditions related to NK purification, stimulation, and/or to species differences. In this regard, it should be noted that human and murine NK cells are differentially regulated. For instance, whereas IL-4 activates NK cells into LAK effectors in a murine model,50 we have previously reported that this cytokine was efficient in inhibiting IL-2-induced human LAK generation.51

Our data delineate an important role of endogenously produced NO in the regulation of NK and LAK activity. Indeed, after the induction of iNOS in NK cells upon stimulation with IL-12, alone or in combination with TNFalpha , the presence of iNOS inhibitors yields effector cells with increased cytotoxic potential towards both NK and LAK targets. This indicates that the NO generated inhibits, to some extent, the cytokine-driven increase of the lytic potential of NK cells and their differentiation into LAK effectors. A possible mechanism for the increased NK lytic activity detected after cytokine stimulation in the presence of an iNOS inhibitor may be due to the observed enhancement of the secretion of IFNgamma . It is well established that one of the most potent functions of IL-12 is its ability to induce NK cells to produce lymphokines, particularly IFNgamma , which is known to upregulate the NK lytic activity.37,38 Indeed, as expected, the addition of a neutralizing anti-IFNgamma antibody was found to reduce the increase in cytotoxic activity elicited by the treatment with IL-12 and TNFalpha , inasmuch as this combination of cytokines is known to induce IFNgamma production by NK cells, which contributes to the enhanced lytic activity. Moreover, the anti-IFNgamma was found to reduce to a similar level the increase in cytotoxicity evoked in the presence of iNOS inhibitor, indicating an involvement of IFNgamma in this process.

The addition of an iNOS inhibitor during the phase of stimulation with cytokines also resulted in an enhanced expression of granzyme B protein, which plays a relevant role in cell-mediated cytotoxicity. Granzyme B is constitutively expressed in NK cells and its level of expression in cytotoxic lymphocytes is regulated by several cytokines. Whether NO could affect some transcription factors involved in the expression of the IFNgamma and granzyme B genes by IL-12 and TNFalpha is currently under investigation. In this regard, it has been reported that the promoter of IFNgamma gene contains an NF-kappa B-related site that binds NF-kappa B protein family members.52 Because NO has been shown to inhibit NF-kappa B through stabilization of Ikappa Balpha 53, this could contribute to the observed increased production of IFNgamma by NK cells stimulated by IL-12 and TNFalpha in the presence of AMG.

Overall, these findings suggest that the NO generated in human NK cell in response to cytokine stimulation inhibits the lytic potential of these cells. Therefore, the development of NO inhibitors to circumvent its production and action could potentially contribute to the design of appropriate strategies for cytokine-based immune-intervention.

    FOOTNOTES

   Submitted November 3, 1997; accepted May 11, 1998.
   Supported by grant from INSERM, IGR, ARC (6227), ARC (6957), la Ligue Nationale Française de Recherche contre le Cancer. O.S. is supported by la Société de Secours des Amis des Sciences.
   Address reprint requests to Salem Chouaib, PhD, Laboratoire Cytokines et Immunologie des Tumeurs Humaines, U 487 INSERM, Institut Gustave-Roussy, 39 rue Camille Desmoulins, 94805 Villejuif Cedex, France; e-mail: chouaib{at}igr.fr.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors are indebted to Dr M. Sasportes and Dr Y. Zhang for kindly providing granzyme B antibody, to Dr J. Wietzerbin for anti-IFNgamma antibody, and to Dr R. Webber (R&D) for iNOS antibody. We acknowledge Dr A. Caignard, Dr F.M. Chouaib, and Dr V. Shatrov for critical reading of the manuscript and F. Gay for excellent technical assistance.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Trinchieri G: Biology of natural killer. Adv Immunol 47:187, 1989[Medline] [Order article via Infotrieve]

2. Robertson MJ, Ritz J: Biology and clinical relevance of human natural killer cells. Blood 76:2421, 1990[Free Full Text]

3. Henney CS, Kuribayashi K, Kern DE, Gillis S: Interleukin 2 augments natural killer cell activity. Nature 291:335, 1981[Medline] [Order article via Infotrieve]

4. Trinchieri G, Matsumoto-Kobayashi M, Clark SC, Sheehra J, London L, Perussia B: Response of resting human peripheral blood natural killer cells to interleukin-2. J Exp Med 160:1147, 1984[Abstract/Free Full Text]

5. Ellis TM, McKenzie RS, Simms PE, Helfrich BA, Fisher RI: Induction of human lymphokine-activated killer cells by IFN-alpha and IFN-gamma. J Immunol 143:4282, 1989[Abstract]

6. Robinet E, Kamoun M, Farace F, Chouaib S: Interleukin-4 differentially regulates interleukin-2-mediated and CD2-mediated induction of human lymphokine-activated killer effectors. Eur J Immunol 22:2861, 1992[Medline] [Order article via Infotrieve]

7. Chouaib S, Bertoglio J, Blay JY, Marchiol-Fournigault C, Fradelizi D: Lymphokine activated killers generation pathways: Synergism between tumor necrosis factor and interleukin-2. Proc Natl Acad Sci USA 85:6875, 1988[Abstract/Free Full Text]

8. Salvucci O, Mami-Chouaib F, Moreau JL, Thèze J, Chehimi J, Chouaib S: Differential regulation of interleukin-12 and interleukin-15-induced natural killer cell activation by interleukin-4. Eur J Immunol 26:2736, 1996[Medline] [Order article via Infotrieve]

9. Young JDE, Hengartener H, Podack ER, Cohn ZA: Purification and characterization of a cytolytic pore-forming protein from granules of cloned lymphocytes with natural killer activity. Cell 44:849, 1986[Medline] [Order article via Infotrieve]

10. Clark WR: Perforin-a primary or auxiliary lytic mechanism? Immunol Today 9:101, 1988[Medline] [Order article via Infotrieve]

11. Clement MV, Haddad P, Soulie A, Legros-Maida S, Guillet J, Cesar E, Sasportes M: Involvement of granzyme B and perforin gene expression in the lytic potential of human natural killer cells. Res Immunol 141:477, 1990[Medline] [Order article via Infotrieve]

12. Henkart PA: Lymphocyte-mediated cytotoxicity: Two pathways and multiple effector molecules. Immunity 1:343, 1994[Medline] [Order article via Infotrieve]

13. Berke G: The CTL's kiss of death. Cell 81:9, 1995[Medline] [Order article via Infotrieve]

14. Arase H, Arase N, Saito T: Fas-mediated cytotoxicity by freshly isolated natural killer cells. J Exp Med 181:1235, 1995[Abstract/Free Full Text]

15. Juretic A, Spagnoli GC, Von Bremen K, Hörig H, Filgueira L, Lüscher U, Babst R, Harder F, Heberer M: Generation of lymphokine-activated killer activity in rodents but not in humans is nitric oxide dependent. Cell Immunol 157:462, 1994[Medline] [Order article via Infotrieve]

16. Cifone MG, Festuccia C, Cironi L, Cavallo G, Chessa MA, Pensa V, Tubaro E, Santoni A: Induction of the nitric oxide-synthesizing pathway in fresh and Interleukin 2-cultured rat natural killer cells. Cell Immunol 157:181, 1994[Medline] [Order article via Infotrieve]

17. Filep JG, Baron C, Lachance S, Perreault C, Chan JS: Involvement of nitric oxide in target-cell lysis and DNA induced by murine natural killer cells. Blood 87:5136, 1996[Abstract/Free Full Text]

18. Nathan C: Nitric oxide as secretory product of mammalian cells. FASEB J 6:3051, 1992[Abstract]

19. Moncada S, Palmer RMJ, Higgs EA: Nitric oxide: Physiology, pathophysiology and pharmacology. Pharmacol Rev 43:109, 1991[Medline] [Order article via Infotrieve]

20. Dugas B, Debré P, Moncada S: Nitric oxide a vital poison inside the immune and inflammatory network. Res Immunol 146:664, 1996

21. Moncada S, Higgs EA: Molecular mechanisms and therapeutic strategies related to nitric oxide. FASEB J 9:1319, 1995[Abstract]

22. Nathan CF, Hibbs JB: Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr Opin Immunol 3:65, 1991[Medline] [Order article via Infotrieve]

23. Nussler AK, Billiar TR: Inflammation, immunoregulation and inducible nitric oxid synthase. J Leukoc Biol 54:171, 1993[Abstract]

24. Palmer RMJ, Ferrige AS, Moncada S: Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327:524, 1987[Medline] [Order article via Infotrieve]

25. Knowles RG, Moncada S: Nitric oxide synthases in mammals. Biochem J 298:249, 1994

26. Nathan C, Xie QW: Nitric oxide synthases: Roles, tolls, and controls. Cell 78:915, 1994[Medline] [Order article via Infotrieve]

27. Sotomayor EM, DiNapoli MR, Calderon C, Colsky A, Fu Y-X, Lopez DM: Decreased macrophage-mediated cytotoxicity in mammary-tumor-bearing mice is related to an alteration of nitric oxide production and/or release. Int J Cancer 60:660, 1995[Medline] [Order article via Infotrieve]

28. Misko TP, Moore WM, Kasten TP, Nickols GA, Corbett JA, Tilton RG, McDaniel ML, Williamson JR, Currie MG: Selective inhibition of the inducible nitric oxide synthase by aminoguanidine. Eur J Pharmacol 233:119, 1993[Medline] [Order article via Infotrieve]

29. Garvey EP, Oplinger JA, Tanoury GJ, Sherman PA, Fowler M, Marshall S, Harmon MF, Paith JE, Furfine ES: Potent and selective inhibition of human nitric oxide synthases. Inhibition by non-amino acid isothioureas. J Biol Chem 269:26669, 1994[Abstract/Free Full Text]

30. Hamid Q, Springall DR, Riveros-Moreno V, Chanez P, Howarth P, Redington A, Bousquet J, Godard P, Holgate S, Polak JM: Induction of nitric oxide synthase in asthma. Lancet 342:1510, 1993[Medline] [Order article via Infotrieve]

31. Miossec C, Faure F, Ferradini L, Roman-Roman S, Jitsukawa S, Ferrini S, Moretta A, Triebel F, Hercend T: Further analysis of the T cell receptor gamma/delta+ peripheral lymphocyte subset: The Vdelta1 gene segment is expressed with either Calpha or Cdelta. J Exp Med 171:1171, 1990[Abstract/Free Full Text]

32. Paul-Eugène N, Mossalayi MD, Sarfati M, Yamaoka K, Aubry JP, Bonnefoy JY, Dugas B, Kolb JP: Evidence for a role of Fcepsilon RII/CD23 in the IL-4-induced nitric oxide production by normal human mononuclear phagocytes. Cell Immunol 163:314, 1995[Medline] [Order article via Infotrieve]

33. Chomczynsky P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction. Anal Biochem 162:156, 1987[Medline] [Order article via Infotrieve]

34. Vouldoukis I, Riveros-Moreno V, Dugas B, Ouaaz F, Bécherel P, Debré P, Moncada S, Mossalayi MD: The killing of Leishmania major by human macrophages is mediated by nitric oxide induced after ligation of the Fcepsilon RII/CD23 surface antigen. Proc Natl Acad Sci USA 92:7804, 1995[Abstract/Free Full Text]

35. Reiling N, Ulmer AJ, Duchrow M, Ernst M, Flad HD, Hauschildt S: Nitric oxide synthase: mRNA expression of different isoforms in human monocytes/macrophages. Eur J Immunol 24:1941, 1994[Medline] [Order article via Infotrieve]

36. Riveros-Moreno V, Beddell C, Moncada S: Nitric oxide synthase. Structural studies using anti-peptides antibodies. Eur J Biochem 215:801, 1993[Medline] [Order article via Infotrieve]

37. Naume B, Johnsen A-C, Espevik T, Sundan A: Gene expression and secretion of cytokines and cytokine receptors from highly purified CD56+ natural killer cells stimulated with interleukin-2, interleukin-7 and interleukin-12. Eur J Immunol 23:1831, 1993[Medline] [Order article via Infotrieve]

38. Chan SH, Perussia B, Gupta JW, Kobayashi M, Pospísil M, Young HA, Wolf SF, Young D, Clark SC, Trinchieri G: Induction of interferon gamma  production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers. J Exp Med 173:869, 1991[Abstract/Free Full Text]

39. Krähenbühl O, Rey C, Jenne D, Lanzavecchia A, Grossurth P, Carrel S, Tschopp J: Characterization of granzymes A and B isolated from granules of cloned human cytotoxic T lymphocytes. J Immunol 141:3471, 1988[Abstract]

40. Clement MV, Haddad P, Soulie A, Legros-Maida S, Guillet J, Cesar E, Sasportes M: Involvement of granzyme B and perforin gene expression in the lytic potential of human natural killer cells. Res Immunol 141:477, 1990

41. Robertson MJ, Soiffer RJ, Wolf SF, Manley TJ, Donahue C, Young D, Herrmann SH, Ritz J: Response of human natural killer (NK) cells to NK cell stimulatory factor (NKSF): Cytolitic activity and proliferation of NK cells are differentially regulated by NKSF. J Exp Med 175:779, 1992[Abstract/Free Full Text]

42. Denis M: Human monocytes/macrophages: NO or NO? J Leukoc Biol 55:682, 1994[Abstract]

43. Albina JE: On the expression of nitric oxide synthase hy human macrophages. Why no NO? J Leukoc Biol 58:643, 1995[Abstract]

44. Dugas B, Mossalayi MD, Damais S, Kolb JP: Nitric oxide production by human monocytes: Evidence for a role of CD23. Immunol Today 16:574, 1995[Medline] [Order article via Infotrieve]

45. Hibbs JB, Westenfelder C, Taintor R, Vavrin Z, Kablitz C, Baranowski RL, Ward JH, Menlove RL, McMurry MP, Kushner JP, Samlowski WE: Evidence for cytokine-inducible nitric oxide from L-arginine in patients receiving interleukin-2 therapy. J Clin Invest 89:867, 1992

46. Ochoa JB, Curti B, Peitzman AB, Simmons RL, Billiar TR, Hoffman R, Rault R, Longo DL, Urba WJ, Ochoa AC: Increased circulating nitrogen oxides after human tumor immunotherapy: Correlation with toxic hemodynamic changes. J Natl Cancer Inst 84:864, 1992[Abstract/Free Full Text]

47. Huang FP, Feng GJ, Lindop G, DI, Liew FY: The role of interleukin 12 and nitric oxide in the development of spontaneous autoimmune disease in MRL/MP-lpr/lpr mice. J Exp Med 183:1447, 1996[Abstract/Free Full Text]

48. Ju DW, Cao X, Acres B: Intratumoral injection of GM-CSF gene encoded recombinant vaccinia virus elicits potent antitumor response in a mixture melanoma model. Cancer Gene Ther 4:139, 1997[Medline] [Order article via Infotrieve]

49. Garside P, Hutton AK, Severn A, Liew FY, Mowat AM: Nitric oxide mediates intestinal pathology in graft-vs.- host disease. Eur J Immunol 22:2141, 1992[Medline] [Order article via Infotrieve]

50. Mulé JJ, Krosnick JA, Rosenberg SA: rIL-4 regulation of murine lymphokine-activated killer activity in vitro. Effects on the rIL-2-induced expansion, cytotoxicity, and phenotype of lymphokine-activated killer effectors. J Immunol 142:726, 1989[Abstract]

51. Blay JY, Branellec D, Robinet E, Dugas B, Gay F, Chouaib S: Involvement of cyclic adenosine monophosphate in the interleukin 4 inhibitory effect on interleukin-2 induced lymphokine-activated killer generation. J Clin Invest 85:1909, 1990

52. Young HA: Regulation of IFN-gamma gene transcription. Semin Virol 6:175, 1995

53. Peng HB, Libby P, Liao JK: Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B. J Biol Chem 270:14214, 1995[Abstract/Free Full Text]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0021$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Nicolas, D. Cathelin, N. Larmonier, J. Fraszczak, P.-E. Puig, A. Bouchot, A. Bateman, E. Solary, and B. Bonnotte
Dendritic Cells Trigger Tumor Cell Death by a Nitric Oxide-Dependent Mechanism
J. Immunol., July 15, 2007; 179(2): 812 - 818.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Ferlito, K. Irani, N. Faraday, and C. J. Lowenstein
Nitric oxide inhibits exocytosis of cytolytic granules from lymphokine-activated killer cells
PNAS, August 1, 2006; 103(31): 11689 - 11694.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Bielawska-Pohl, C. Crola, A. Caignard, C. Gaudin, D. Dus, C. Kieda, and S. Chouaib
Human NK Cells Lyse Organ-Specific Endothelial Cells: Analysis of Adhesion and Cytotoxic Mechanisms
J. Immunol., May 1, 2005; 174(9): 5573 - 5582.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
G. S.M. Ramsaransing, A. Teelken, A. V. Arutjunyan, and J. De Keyser
Peripheral blood leukocyte NO production in MS patients with a benign vs progressive course
Neurology, January 27, 2004; 62(2): 239 - 242.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. W. Kang, S. Y. Choi, M. K. Cho, C. H. Lee, and S. G. Kim
Thrombin Induces Nitric-oxide Synthase via Galpha 12/13-coupled Protein Kinase C-dependent I-kappa Balpha Phosphorylation and JNK-mediated I-kappa Balpha Degradation
J. Biol. Chem., May 2, 2003; 278(19): 17368 - 17378.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Blesson, J. Thiery, C. Gaudin, R. Stancou, J.-P. Kolb, J.-L. Moreau, J. Theze, F. Mami-Chouaib, and S. Chouaib
Analysis of the mechanisms of human cytotoxic T lymphocyte response inhibition by NO
Int. Immunol., October 1, 2002; 14(10): 1169 - 1178.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. D. Joshi, D. V. Kalvakolanu, J. D. Hasday, R. J. Hebel, and A. S. Cross
IL-18 Levels and the Outcome of Innate Immune Response to Lipopolysaccharide: Importance of a Positive Feedback Loop with Caspase-1 in IL-18 Expression
J. Immunol., September 1, 2002; 169(5): 2536 - 2544.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
K. Hosohara, H. Ueda, S.-I. Kashiwamura, T. Yano, T. Ogura, S. Marukawa, and H. Okamura
Interleukin-18 Induces Acute Biphasic Reduction in the Levels of Circulating Leukocytes in Mice
Clin. Vaccine Immunol., July 1, 2002; 9(4): 777 - 783.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. S. Falk, E. Noessner, E. H. Weiss, and D. J. Schendel
Retaliation against Tumor Cells Showing Aberrant HLA Expression Using Lymphokine Activated Killer-derived T Cells
Cancer Res., January 1, 2002; 62(2): 480 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Furuke, P. R. Burd, J. A. Horvath-Arcidiacono, K. Hori, H. Mostowski, and E. T. Bloom
Human NK Cells Express Endothelial Nitric Oxide Synthase, and Nitric Oxide Protects Them from Activation-Induced Cell Death by Regulating Expression of TNF-{alpha}
J. Immunol., August 1, 1999; 163(3): 1473 - 1480.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. G. Cifone, S. D'Alo, R. Parroni, D. Millimaggi, L. Biordi, S. Martinotti, and A. Santoni
Interleukin-2-Activated Rat Natural Killer Cells Express Inducible Nitric Oxide Synthase That Contributes to Cytotoxic Function and Interferon-gamma Production
Blood, June 1, 1999; 93(11): 3876 - 3884.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salvucci, O.
Right arrow Articles by Chouaib, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salvucci, O.
Right arrow Articles by Chouaib, S.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020