|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 6 (September 15), 1998:
pp. 2123-2132
Characterization of Siglec-5, a Novel Glycoprotein Expressed on
Myeloid Cells Related to CD33
By
Ann L. Cornish,
Sylvie Freeman,
Gareth Forbes,
Jian Ni,
Mei Zhang,
Mario Cepeda,
Reiner Gentz,
Meena Augustus,
Kenneth C. Carter, and
Paul R. Crocker
From The Wellcome Trust Building, Department of Biochemistry,
University of Dundee, Dundee, Scotland, UK; the Institute of Molecular
Medicine, John Radcliffe Hospital, University of Oxford, Oxford, UK;
and Human Genome Sciences Inc, Rockville, MD.
 |
ABSTRACT |
We describe the characterization of siglec-5 (sialic acid-binding
Ig-like lectin-5), a novel transmembrane member of the immunoglobulin superfamily, highly related to the myeloid antigen, CD33. A full-length cDNA encoding siglec-5 was isolated from a human activated monocyte cDNA library. Sequencing predicted that siglec-5 contains four extracellular immunoglobulin-like domains, the N-terminal two of which
are 57% identical to the corresponding region of CD33. The cytoplasmic
tail is also related to that of CD33, containing two tyrosine residues
embodied in immunoreceptor tyrosine-based inhibitory motif-like motifs.
The siglec-5 gene was shown to map to chromosome 19q13.41-43, closely
linked to the CD33 gene. When siglec-5 was expressed on COS cells or as
a recombinant protein fused to the Fc region of human IgG1, it was able
to mediate sialic acid-dependent binding to human erythrocytes and
soluble glycoconjugates, suggesting that it may be involved in
cell-cell interactions. By using specific antibodies, siglec-5 was
found to have an expression pattern distinct from that of CD33, being
present at relatively high levels on neutrophils but absent from
leukemic cell lines representing early stages of myelomonocytic
differentiation. Western blot analysis of neutrophil lysates indicated
that siglec-5 exists as a disulfide-linked dimer of approximately 140 kD.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
APPROXIMATELY 34% of the cell surface
glycoproteins identified on leukocytes are members of the
immunoglobulin (Ig) superfamily.1 Proteins of this type
mediate a broad range of functions in cellular recognition often
involving protein-protein interactions. Recent work in our and other
laboratories has shown the existence of a novel subset of structurally
related Ig superfamily proteins that mediate protein-carbohydrate
interactions, specifically interacting with sialic acids in
glycoproteins and glycolipids.2 The group currently
comprises sialoadhesin, CD22, myelin-associated glycoprotein (MAG),
Schwann cell myelin protein (SMP), and CD33. Each of these proteins is
expressed by specific cell types and involved in distinct functions,
such as regulation of B-cell activation (CD22),3 cell-cell
interactions of macrophages (sialoadhesin),4 and maintenance of myelin-axon interactions (MAG).5 Each
protein has a particular preference for both the nature of sialic acid and its glycosidic linkage to adjacent sugars.6,7 Recently, these proteins have been designated "siglecs" (sialic
acid-binding Ig-like lectins) and, although there has been no proposal
to change their existing names, sialoadhesin, CD22, CD33, MAG, and SMP
have been classified as siglecs 1, 2, 3, 4a, and 4b,
respectively.8
Each of the siglecs has an N-terminal V-set domain followed by varying
numbers of C2-set domains ranging from 1 in CD33 to 16 in sialoadhesin.
Mutagenesis and structural studies have established that the sialic
acid binding site of sialoadhesin is on the V-set domain, with key
interactions between sialic acid substituents and amino acid
side-chains of the G, F, and A  -strands.9,10 In
particular, a conserved arginine on the F-strand of sialoadhesin's V-set domain has been shown by X-ray crystallography to form a salt-bridge with the carboxylate of sialic acid,10 and
site-directed mutagenesis studies with sialoadhesin, CD22, MAG, and
CD33 have shown that the corresponding arginine is essential for sialic acid-dependent binding by all siglecs.9,11-13 Other
important interactions shown by X-ray crystallography include
hydrophobic contacts between conserved aromatic amino acids on the A
and G -strands of the V-set domain with the N-acetyl and glycerol
side groups of N-acetyl neuraminic acid.10 All siglecs so
far characterized also have an unusual arrangement of conserved
cysteine residues in the V-set and adjacent C2-set
domains.2 These are predicted to result in the formation of
an intrasheet disulfide bond in the V-set domain and an interdomain
disulfide bond.10,14,15
Apart from MAG and SMP, the siglecs characterized to date are expressed
uniquely within the hematopoietic system and have been used extensively
as lineage-restricted markers. For example, CD33 is a useful marker of
early myeloid progenitor cells, being absent from pluripotential
hematopoietic stem cells.16 Likewise, CD22 is a specific
marker of B cells,17 and sialoadhesin is expressed uniquely
on macrophage subsets.18,19 In the cases of CD33 and CD22,
these restricted expression patterns are conserved in
myeloid20 and B lymphoid21 leukemias,
respectively, and their presence can provide useful diagnostic markers
as well as targets for immunotherapy, for example using
toxin-conjugated or radiolabeled monoclonal antibodies
(MoAbs).22,23
In this study we describe the characterization of a human cDNA that
encodes a new member of the siglec family, designated siglec-5. This
protein exhibits a high degree of sequence similarity with CD33 and
contains all of the key structural features of siglecs described above.
As predicted, siglec-5 is able to mediate sialic acid-dependent
binding to cells either when expressed on COS cells or as a recombinant
protein immobilized on plastic. By using polyclonal antisera raised to
the extracellular region of siglec-5, we show that, among human blood
leukocytes and leukemic cell lines, siglec-5 is expressed in a
myeloid-restricted manner that is distinct from that of CD33.
| |
MATERIALS AND METHODS |
Materials.
Unless indicated otherwise, all reagents and chemicals were purchased
from Sigma (Poole, UK or St Louis, MO). Protein A Sepharose and Factor
Xa were purchased from Pharmacia (St Albans, UK), Vibrio cholerae sialidase was purchased from Calbiochem (La Jolla, CA), and 125I-streptavidin (20-40 mCi/mg) and
125I-sheep antimouse IgG (750-3,000 Ci/mmol) were purchased
from Amersham (Little Chalfont, UK). Biotinylated polyacrylamide
glycoconjugates carrying either NeuAc 2,3Gal1,4Glc (2,3-PAA)
or NeuAc2,6Gal1,4Glc (2,6-PAA) were purchased from
Syntesome (Munich, Germany). Digoxygenin 11-dUTP,
4 -6-diamidino-2-phenylindole-2 HCl (DAPI) and
anti-digoxygenin-tagged rhodamine were purchased from Boehringer
Mannheim (Indianapolis, IN). Anti-CD33 MoAb LeuM9 was from Becton
Dickinson (Abingdon, UK). Immulon 3 microtiter plates were from
Dynatech Laboratories Inc (Chantilly, VA). NUNC tissue culture plastics
were purchased from Life Sciences (Paisley, UK). The pIGplus plasmid
was purchased from R & D Systems (Abingdon, UK) and pcDNA3 plasmid was
from British Biotechnology (Oxford, UK).
Identification and characterization of siglec-5 cDNA.
By using the amino acid sequence of CD33, a specific homology search
was performed against a database containing more than one million
expression sequence tags (ESTs) obtained from over 700 different cDNA
libraries.24-26 A full-length clone in pBluescript II
(SK ) encoding one of the CD33-like sequences
identified in the search was isolated from a human activated monocyte
library and designated pHMQCD14. A computer search of nucleotide and
protein sequence was performed by using the Blast GeneSearch (National
Center for Biotechnology Information, National Institutes of Health,
Bethesda, MD). Manipulation of sequences and alignments were performed
by using Baylor College of Medicine molecular biology software
available on the internet (Human Genome Center, Baylor College of
Medicine, Houston,
TX).
Northern blot analysis.
The cDNA insert from pHMQCD14 was labeled with 32P by using
the Rediprime DNA labeling system from Amersham Life Sciences according to the manufacturer's instructions. Unincorporated nucleotides were
removed from labeled probe by using CHROMA SPIN-100 columns (Clontech,
Palo Alto, CA). Two human multiple tissue Northern (MTN) blots
containing approximately 2 µg of poly (A)+ RNA per lane
from various human tissues were purchased from Clontech and hybridized
according to the manufacturer's instructions.
Chromosomal mapping by fluorescence in situ hybridization (FISH).
The chromosomal localization of the siglec-5 gene was determined by
single-copy gene FISH to human male metaphase chromosome spreads.
Briefly, a 2-kb HMQCD14 cDNA insert was nick-translated by using
digoxygenin 11-dUTP, and FISH was performed as detailed previously.27 Individual chromosomes were counterstained
with DAPI. Color digital images containing both DAPI bands and gene signals detected with anti-digoxygenin-tagged rhodamine were recorded by using a triple-band pass filter set (Chroma Technology Corp, Brattleboro, VT) in combination with a charged coupled-device camera
(Photometrics Inc, Tucson, AZ) and variable excitation wave length
filters.28 Images were analyzed using the ISEE software package (Inovision Corp, Durham, NC).
Preparation of recombinant siglec-5.
The extracellular region of siglec-5 was amplified by polymerase chain
reaction (PCR) with the following forward and reverse primers
(5 3): ACTCTAGAGTTCGATCTCCCTTGCAGCAG and
ACAGATCTGTTCGATCTCCCTTGCAGCAG. The PCR product was cloned in-frame into
the pIGplus vector, which encodes a Factor Xa cleavage site between the
extracellular region and the hinge region of the Fc portion of human
IgG1. Plasmids encoding other Fc-proteins used in this study were
prepared as described previously.7,29,30 To generate
recombinant proteins, plasmids were transfected into COS-1 cells by
diethylaminoethyl-dextran (DEAE) transfection and
Fc-proteins were purified from the conditioned supernatants as
described.31 Briefly, supernatant was passed over a
protein-A Sepharose column, and the bound protein was eluted with 0.1 mol/L glycine pH 3.0 followed by neutralization with 10% vol/vol 1.0 mol/L Tris pH 8.0. The proteins were dialyzed against 20 mmol/L Tris pH
8.0, and the concentrations were estimated by using the
bicinchoninic acid (BCA) assay kit (Pierce, Rockford, IL)
with bovine serum albumin (BSA) as a standard. Fc-proteins were shown
to be greater than 95% pure by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis.
Generation of antibodies to siglec-5 and enzyme-linked immunosorbent
assay (ELISA).
Purified recombinant siglec-5 Fc was dialyzed into 20 mmol/L Tris pH
8.0 with 100 mmol/L NaCl and 2 mmol/L CaCl2, and the protein concentration was adjusted to 1.0 mg/mL and digested overnight at room temperature with Factor Xa at a ratio of 1 µg Factor Xa:50 µg Fc-protein. Undigested material and Fc fragments were removed by
passage over a protein-A Sepharose column, and the purified extracellular region of siglec-5 was used to immunize a group of three
mice, using 10 µg protein per injection. Immune serum was collected
10 days after the third injection. To check for possible
cross-reactivity of the immune serum with CD33 and to establish the
saturating concentration, siglec-5 Fc and CD33 Fc were immobilized on
plastic via antihuman IgG as described7 and incubated for 1 hour with differing dilutions of preimmune or immune sera. After
washing, wells were then incubated with horse radish
peroxidase-conjugated goat antimouse IgG and washed and exposed to
O-phenylenediamine hydrochloride as substrate, followed by measurement
of absorbance at 450 nm. Anti-siglec-5 MoAbs 1A5 and 8H2 were
generated from one of the immune mice by standard techniques and shown
to react specifically with siglec-5 Fc by ELISA as described above.
Cells.
All cell lines were provided by the ICRF Cell Production Service (South
Mimms, UK). COS-1 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 5% heat-inactivated fetal calf
serum (FCS). Other cell lines were cultured in RPMI 1640 medium with
5% or 10% FCS. Human red blood cells (RBCs) were obtained from
healthy donors and stored at 4°C in Alsever's solution for up to 2 weeks. Neutrophils, monocytes, and lymphocytes were purified from human
blood as follows. Twenty milliliters of whole heparinized blood was
mixed 1:5 with 6% Dextran 500 solution made in RPMI 1640 plus 20 mmol/L HEPES and left at room temperature for 20 minutes for RBCs to
sediment. The RBC-free supernatant was overlaid onto 5 mL
Lymphoprep (Nycomed Pharma AS, Oslo, Norway) and
centrifuged at room temperature for 20 minutes. Mononuclear cells at
the interface were washed in RPMI plus 20 mmol/L HEPES and added to a
10-cm diameter plastic bacterial petri dish in RPMI plus 10% FCS and incubated for 1 hour at 37°C. Nonadherent cells (lymphocytes) were
removed and the adherent cells (monocytes) were detached by incubation
in phosphate-buffered saline (PBS) plus 5 mmol/L EDTA for 10 minutes at
4°C. To obtain purified neutrophils, the pellet from the Lymphoprep
step was resuspended in 1 mL ice-cold water for 20 seconds to lyse
contaminating RBCs. The mixture was diluted to 20 mL with PBS and the
neutrophils were washed twice in PBS before use.
Human RBC binding assays.
The full-length cDNA insert from pHMQCD14 was excised with
EcoRI and Xho I and subcloned into the corresponding
sites of pcDNA3. COS-1 cells were transiently transfected with this
plasmid or with the full-length CD33 plasmid in pCDM832 by
the DEAE-dextran method as described above, trypsinized 24 hours later,
and replated at 2 × 105/well on 6-well tissue culture
dishes (Falcon, Becton Dickinson UK Ltd, Oxford, UK) in
DMEM containing 1% FCS. COS cells treated identically but without
plasmid DNA (sham-transfected) were included in each assay. Binding
assays were performed 48 to 72 hours posttransfection. RBCs were washed
three times in PBS containing 0.25% BSA (PBA), resuspended at 0.25%
vol/vol in DMEM plus 0.2% BSA, and 1 mL of the cell suspension was
added to the wells. After 30 minutes at 37°C, nonadherent cells
were removed by three gentle washes in PBA, and cellular rosettes were
fixed in 0.25% glutaraldehyde. Sialidase pretreatment of COS cells or
RBCs was performed with 0.1 U/mL V cholerae sialidase in DMEM
for 2 to 3 hours at 37°C, followed by three washes in PBA. To
quantify the rosetting, the number of COS cells binding more than two
RBCs was scored from 20 fields in each well of duplicates using a Carl
Zeiss Axioskop (Carl Zeiss Ltd, Welwyn Garden City, UK)
fitted with a ×10 objective. Results were expressed as the mean
number of rosettes per field.
Solid-phase binding assays with human RBCs were performed as described
previously.7 Briefly, RBCs were added to wells of microtiter plates that had been coated with Fc proteins via antihuman Fc IgG. After 30 minutes at room temperature, unbound cells were removed by washing, and bound RBCs were fixed in methanol and quantified by incubation with peroxidase substrate and measurement of
absorbance at 450 nm.7
Binding assays with polyacrylamide glycoconjugates.
Fc proteins at 1 µg/mL were added for 1 hour to wells of Immulon-3
plates previously coated with antihuman Fc IgG as
described.7 Wells were blocked for nonspecific binding with
5% skimmed milk powder for 1 hour at room temperature and incubated
with varying dilutions of 2,3-PAA or 2,6-PAA dissolved in PBA for 1 hour at room temperature. Wells were washed in PBA and incubated with 125I-streptavidin diluted in PBA to 0.5 µCi/mL for 1 hour
at 4°C. After washing three times in PBA, bound radioactivity was
solubilized by addition of 0.1 mol/L NaOH and counted by using a
Beckman gamma-counter (Beckman Instruments, Fullerton,
CA).
Fluorescence-activated cell sorting (FACS) analysis.
All incubations were at 4°C. Cells were washed three times in PBA
and incubated at 107/mL with anti-CD33 MoAb at 1:50,
anti-siglec-5 polyclonal antibody at 1:1,000, or the preimmune serum
at 1:1,000 as a negative control. After 1 hour, cells were washed and
incubated with phycoerythrin-conjugated goat
F(ab)2-antimouse IgG for 1 hour on ice, washed, fixed in 2% paraformaldehyde, and analyzed on a Becton Dickinson FACS analyzer.
Western blotting.
Neutrophils purified from human blood were lysed in 1% Triton-X-100 at
a cellular concentration of 5 × 107/mL. Nuclei were
removed by centrifugation at 10,000g for 15 minutes, and a
quarter volume of 4X SDS-PAGE sample buffer, either reducing or
nonreducing, was added. Twenty microliters of lysate were separated by
SDS-PAGE on a Biorad (Hemel Hempstead, UK) minigel
apparatus and transferred to nitrocellulose. The blots were incubated
with 5% Marvel skimmed milk in PBS plus 0.1% Tween 20 to block
nonspecific binding sites and then incubated with either preimmune
serum diluted 1:1,000 or anti-siglec-5 antiserum at 1:2,000 for 1 hour
at 4°C. After washing in PBS plus 0.1% Tween 20, the blots were
incubated with 125I-sheep antimouse IgG at a concentration
of 0.5 µCi/mL for 1 hour, washed, and exposed to autoradiographic
film for 24 hours.
| |
RESULTS |
Characterization of siglec-5 as a CD33-related cDNA.
HMQCD14, a clone derived from a human macrophage cDNA library, was
initially characterized as an EST sharing a high degree of sequence
similarity with human CD33 cDNA. Examination of its full-length
sequence of 2,017 bp showed a single long open reading frame encoding a
type-1 transmembrane protein of 551 amino acids belonging to the Ig
superfamily. Based on its sequence similarity with other siglecs and
its ability to bind sialic acid (see below), this protein has been
designated siglec-5 (Fig 1). The extracellular region of
siglec-5 contains a hydrophobic signal peptide and four Ig-like
domains, which are made up of an N-terminal V-set domain and three
C2-set domains. There are eight potential N-linked glycosylation sites.
After the transmembrane region, there is a cytoplasmic tail of 89 amino
acids.
View larger version (41K):
[in this window]
[in a new window]
| Fig 1.
Predicted amino acid sequence of siglec-5. The leader
peptide and transmembrane region are double-underlined. Potential
N-linked glycosylation sites are single-underlined. The likely Ig
domain boundaries are indicated.
|
|
Homology of siglec-5 to other proteins.
Database searches showed that siglec-5 is 99.6% identical to OB-BP2, a
recently-deposited human sequence encoding a "leptin-binding protein" for which there is currently no published information. There are two amino acid differences: Glu 309 and Ser 403 in siglec-5 are Lys and Asn, respectively, in OB-BP2. It seems likely that siglec-5
and OB-BP2 are the product of the same gene, in which case the
differences could reflect genetic polymorphism or be caused by
sequencing errors. Apart from OB-BP2, the most related proteins in the
database were OB-BP1 and CD33 (Fig 2). OB-BP1, like
OB-BP2, is a recently-deposited human cDNA, which is almost identical
to a newly-described CD33-like cDNA, expressed specifically in placenta
and designated CD33-L.33 It contains three extracellular Ig-like domains that are 57% identical to the N-terminal three domains
of siglec-5. The two extracellular Ig-like domains of CD33 are 57%
identical to the two N-terminal domains of siglec-5 (Fig 2). The
membrane proximal Ig-like domain of siglec-5 was found to be most
similar to the fifth domain of MAG with 30% sequence identity (Fig 2).
View larger version (73K):
[in this window]
[in a new window]
| Fig 2.
Alignment of siglec-5, OB-BP1, human CD33, human MAG and
the first two domains of mouse sialoadhesin. Sialoadhesin is included
as a reference for amino acids that are important in sialic acid
binding.10 Alignment was performed with the ClustalW
multiple sequence alignment program, version 1.7 and optimized by
eye. Residues that are identical in at least half the proteins are
boxed in black, similar residues are in grey. Open boxes group
the characteristic cysteine residues of siglec proteins and the
residues that are important for interaction with sialic
acid.10 The positions of the strands in
domains 1 and 2 are indicated. The beginning of the transmembrane (TM)
and cytoplasmic (CYTO) regions are indicated. Genbank accession numbers
of OB-BP1, CD33, MAG, and sialoadhesin are U71382, M23197,
M29273, and Z36293, respectively.
|
|
Structural features characteristic of siglecs.
Examination of the two N-terminal Ig-like domains of siglec-5 showed
the presence of the characteristic structural features of the siglec
subgroup of Ig superfamily proteins (Fig 2). There is precise
conservation of the unusual pattern of cysteines found in these
proteins, in particular the cysteine residues on the B and E strands of
domain 1 that give rise to the unusual intrasheet disulfide
bond10,14 and the cysteines on the A-B loop of domain 1 and
the B-C loop of domain 2 that are thought to result in an interdomain
disulfide bond.14,15 There is also conservation of key
amino acids involved in sialic acid binding, in particular the critical
arginine at position 119 and the two conserved aromatic residues at
positions 21 and 128 on the A and G strands of the V-set domain. These
are both tyrosine in siglec-5 rather than tryptophan found in
sialoadhesin (Fig 2). It is also evident from the alignment that OB-BP1
exhibits the same structural features and therefore, is likely to be a
functional sialic acid-binding protein.
The transmembrane region and cytoplasmic tail of siglec-5 are very
similar to the corresponding regions of OB-BP1 and CD33 with overall
identities of 40% and 42%, respectively. Within the cytoplasmic tails
of these proteins, there are two highly-conserved regions of seven
amino acids centered in both cases around tyrosine residues. The first
region (LHYAS/VL) conforms well to the consensus immunoreceptor
tyrosine-based inhibitory motif (ITIM) (I/L/VxYxxL/V) defined in
several other leukocyte proteins, whereas the second motif
(TEYSEI/V) does not conform, but is similar to ITIM-like motifs described in other leukocyte cell surface
proteins.34
Chromosomal localization and expression of the siglec-5
gene.
The gene encoding siglec-5 was mapped by in situ hybridization on
chromosome 19q13.41-q13.43 (Fig 3A) and was closely
linked to the CD33 gene at 19q13.3-q13.4.35 Northern blot
analysis (Fig 3B) showed the presence of two major siglec-5 mRNA
transcripts of 2.4 kb and 3.4 kb in various tissues with highest levels
in hematopoietic organs, notably bone marrow and spleen. High levels were also detected in extracts of peripheral blood leukocytes, with
lower levels present in lymph node, lung, appendix, placenta, pancreas,
and thymus. Siglec-5 mRNA was undetectable in brain, heart, skeletal
muscle, and kidney.
View larger version (36K):
[in this window]
[in a new window]
View larger version (84K):
[in this window]
[in a new window]
| Fig 3.
Localization and expression of the siglec-5 gene. (A)
chromosomal mapping by FISH: Human male metaphase chromosome spreads
were hybridized with a 2-kb digoxygenin 11-dUTP-labeled HMQCD14 cDNA
insert and the individual chromosomes were counterstained with DAPI.
Digital images containing both DAPI bands and gene signal detected with
anti-digoxygenin-tagged rhodamine are shown. The position of the
siglec-5 gene on chromosome 19 is also shown schematically. (B)
Northern blot analysis of siglec-5 mRNA in human tissues. Each lane of
the Multiple Tissue Northern (MTN) Blot (Clontech) contains
approximately 2 µg of poly A plus RNA from the tissues indicated and
is normalized for levels of -actin mRNA. Two major forms of siglec-5
mRNA are seen at approximately 2.4 and 3.4 kb. The hybridization
pattern among the different tissue samples is consistent with
expression of the siglec-5 gene being restricted to myelomonocytic
cells.
|
|
Siglec-5 mediates sialic acid-dependent binding to human RBCs.
All siglecs so far characterized are able to mediate sialic
acid-dependent binding to human RBCs after transient expression of
their full-length cDNAs in COS cells.7,29,36 However, in
the case of CD33, binding was only shown after pretreating the
transfected COS cells with sialidase before adding the
RBCs.29 Because CD33 contains only two Ig-like domains, its
binding site at the N-terminus may not extend sufficiently from the
plasma membrane to avoid cis-interactions with sialic acids in
the glycocalyx, thus reducing its potential to interact with ligands
added in trans. Treatment of the transfected COS cells with sialidase
removes the inhibitory sialic acids in the glycocalyx, thereby allowing the protein to bind RBCs. In the present experiments, COS cells transfected with siglec-5 or CD33 cDNAs were either untreated or
treated with sialidase before addition of human RBCs. To check that
binding was sialic acid dependent, assays were also performed by using
sialidase-treated RBCs. COS cells transfected with siglec-5 cDNA bound
RBCs at low levels, and this could be increased substantially when the
transfected COS cells were pretreated with sialidase (Fig 4). In contrast, binding of RBCs to
CD33-transfected COS cells was only observed after sialidase treatment
of the COS cells, as shown previously29 (Fig 4). In all
cases, sialidase-pretreatment of the RBCs abrogated binding, indicating
that it was sialic acid dependent.
View larger version (18K):
[in this window]
[in a new window]
| Fig 4.
Binding of human RBCs to COS cells transfected with
siglec-5 or CD33 cDNAs. Three days after transfection, COS cells were
treated with sialidase or left untreated. Human RBCs, untreated or
sialidase-treated, were added and allowed to bind for 30 minutes. After
washing, cells were fixed and the number of rosettes (binding >2
RBCs) was determined by microscopy from counts of 20 fields in each
well. Results show mean ± range of counts from duplicate wells and
are representative of three experiments performed.
|
|
Sialic acid linkage preference of siglec-5.
It has been shown previously that siglecs exhibit a preference for the
glycosidic linkage of sialic acid to adjacent
sugars.7,29,37,38 Thus, sialoadhesin, CD33, and MAG bind
preferentially to oligosaccharides terminating with 2,3-linked
sialic acid, whereas CD22 binds only to the 2,6 linkage. To
investigate the sialic acid linkage preference of siglec-5, a fusion
protein was generated in which the entire extracellular region was
fused to the Fc portion of human IgG1. The recombinant protein was used
in solid-phase binding assays with biotinylated polyacrylamide
derivatized with either 3- or 6-sialyllactose and its
binding activity was compared with those of sialoadhesin, CD33, MAG,
CD22, and N-CAM as a negative control (Fig 5). Siglec-5
showed a unique specificity, binding equally to both 3-and
6-sialyllactose-conjugated polyacrylamide, unlike sialoadhesin
and MAG, which bound preferentially to 3 sialyllactose, or CD22,
which bound specifically to the 6 sialyllactose glycoconjugate (Fig 5). Unexpectedly, no binding was seen with CD33-Fc. This was not
caused by inactivity of the CD33-Fc protein because in solid-phase
binding assays with RBCs done in parallel, CD33-Fc and siglec-5-Fc
bound RBCs to a similar level (data not shown).
View larger version (26K):
[in this window]
[in a new window]
| Fig 5.
Binding of siglec-5 to polyacrylamide glycoconjugates in
comparison with other siglecs. Fc-siglecs at 1 µg/mL were immobilized
to plastic via anti-Fc antibody and biotinylated polyacrylamide (PAA)
glycoconjugates linked either to 3sialyllactose (2,3-PAA) or
6sialyllactose (2,6-PAA) was added at the indicated
concentrations. Unbound conjugate was washed off and binding detected
with 125I-streptavidin. Data show means ± standard
deviations of triplicates and are representative of four experiments
performed.
|
|
Expression of siglec-5 on human leukemic cell lines and human blood
leukocytes.
The pattern of mRNA expression observed in Northern blots of human
tissues (Fig 3A) is consistent with siglec-5 being a myeloid-restricted protein. Therefore, it was of interest to examine expression of siglec-5 protein in comparison to CD33, which is found predominantly on
myeloid cells. CD33 is first detected on mixed progenitors and
continuing down the myelomonocytic pathway until being downregulated on
granulocytes but retained on monocytes and some tissue
macrophages.39 Expression of siglec-5 on hematopoietic
cells was assessed by using a mouse polyclonal antiserum raised to the
extracellular region of siglec-5. ELISA experiments with immobilized Fc
proteins showed that the anti-siglec-5 antiserum did not cross-react
with CD33 (data not shown). This was confirmed in FACS analysis by using COS cells transiently transfected with either siglec-5 or CD33
full-length cDNAs (Fig 6A).
View larger version (25K):
[in this window]
[in a new window]
View larger version (34K):
[in this window]
[in a new window]
View larger version (37K):
[in this window]
[in a new window]
| Fig 6.
FACS analyses of siglec-5 expression on human
hematopoietic cells in comparison to CD33. (A) COS-1 cells transiently
transfected with either full-length CD33 cDNA or siglec-5 cDNA and
labeled with preimmune serum, mouse anti-siglec-5 antiserum or
anti-CD33 MoAb followed by phycoerythrin-conjugated F(ab)2
anti-mouse IgG. Values refer to the percentage of cells within the
indicated gate. (B) Human myeloid leukemic cell lines stained with
either preimmune serum (open histograms), anti-siglec-5 antiserum or
anti-CD33 MoAb (filled histograms). The mean fluorescence intensities
observed with either anti-siglec 5 or anti-CD33 antibodies are shown
in each box. (C) Human blood leukocytes, stained as described above for
(B).
|
|
Leukemic cell lines that are "fixed" at a particular stage of
hematopoietic differentiation are useful models to study expression of
lineage-restricted antigens. For this purpose we analyzed KG1A (CD34+ CD33), KG1
(CD34, CD33+), K562 (CD33+,
displays erythroid/megakaryocytic markers), HL60 (CD33+,
myelomonocytic), U937 (CD33+, promonocytic), and THP-1
(CD33+, monocytic). FACS analyses showed that the
expression pattern of siglec-5 was similar, yet clearly distinct from
that of CD33. Neither antigen was expressed on KG1A cells thought to
represent early progenitors. In contrast to CD33, siglec-5 expression
was not detected on KG1, K562, or HL-60 cells. Both CD33 and siglec-5 were readily detectable on U937 and THP-1 cells (Fig 6B). We next compared expression of CD33 and siglec-5 on human blood leukocytes (Fig
6C). Neither was expressed on peripheral blood lymphocytes (Fig 6C) nor
on a range of B and T lymphoblastic cell lines (data not shown). Both
were expressed at intermediate levels on monocytes, but only siglec-5
was present at high levels on neutrophils (Fig 6C). This pattern of
expression of siglec-5 on human leukocytes was confirmed by using
anti-siglec-5 MoAbs 1A5 and 8H2 (data not shown).
Molecular characterization of siglec-5 on neutrophils.
To determine the molecular weight of siglec-5 expressed by neutrophils,
Western blots of neutrophil lysates were probed with the anti-siglec-5
antiserum at 1:2,000 dilution. No bands were seen with preimmune serum
at 1:1,000 dilution (data not shown) but with the immune serum a
predominant band was observed at approximately 140 kD under nonreducing
conditions and at approximately 70 kD under reducing conditions
(Fig 7). This suggests that siglec-5, similar to CD33,
exists as a homodimer on the cell surface.
View larger version (65K):
[in this window]
[in a new window]
| Fig 7.
Western blot analyses of neutrophil lysates with
anti-siglec-5 antiserum. Samples, either reduced (R) or nonreduced
(NR), were separated on a 10% polyacrylamide gel and transferred to
nitrocellulose. The blot was incubated with anti-siglec-5 antiserum at
1:2,000 dilution or preimmune serum at 1:1,000 dilution, washed, and
incubated with 125I-antirabbit IgG. No signal was observed
with preimmune serum (not shown) but a predominant band at
approximately 70 kD and approximately 140 kD can be seen under reducing
and nonreducing conditions, respectively.
|
|
| |
DISCUSSION |
The recent availability of extensive EST databases has been of great
value in permitting the identification and characterization of new
members of preexisiting families of proteins.24 In the case
of the siglec-5 protein presented here, the high degree of sequence
similarity with CD33 and conservation of key residues implicated in
sialic acid recognition increased the possibility that this protein was
a new member of the siglec family of Ig superfamily proteins. In the
present study, we were able to show that the full-length cDNA expressed
in COS cells behaved similarly to all other previously characterized
siglecs in being able to bind human RBCs in a sialic acid-dependent
manner. Therefore, siglec-5 fulfills the criteria required for its
inclusion in the siglec subgroup of Ig superfamily
proteins.8
The high degree of sequence similarity within the two N-terminal
domains of siglec-5 and CD33 suggested that they might share similar
sialic acid-binding properties. However, two potentially important
differences were shown in our experiments. First, COS cells that
expressed siglec-5 were able to mediate binding to RBCs without
sialidase treatment, unlike CD33. Second, siglec-5 showed an unexpected
binding specificity, recognizing 2,3- and 2,6-linked sialic acid
equally. This is in contrast to all other previously-characterized
members of the family that preferentially bind to either 2,3- or
2,6-linked sialic acids.7,20,37 The specificity analysis
was performed by using polyacrylamide glycoconjugates rather than
resialylated human RBCs used extensively in our previous studies.
Although the polyacrylamide-based glycoconjugates exhibited good
binding to immobilized sialoadhesin, MAG, CD22, and siglec-5, there was
no measurable interaction with CD33, despite the fact that the
immobilized CD33 was able to bind human RBCs in a sialic
acid-dependent manner. This difference between CD33 and siglec-5 could
reflect weaker binding affinity of CD33 for sialylated oligosaccharides
or could point to a more stringent requirement of CD33 for
oligosaccharide presentation on appropriate carrier molecules.
The pattern of expression of siglec-5 on myeloid cell lines and blood
leukocytes was also different from that of CD33, being absent from cell
lines with an immature myeloid phenotype such as KG1 and K562, but was
expressed on cell lines with a more differentiated phenotype such as
U937 and THP-1 cells. Among blood leukocytes, a clear difference was
also seen with neutrophils that downregulate expression of CD33 but
express relatively high levels of siglec-5. This expression pattern
indicates that siglec-5 is more likely to be involved in effector
functions of myeloid cells rather than in the differentiation process
per se. In this respect, it is of interest that CD33 and siglec-5 share
two conserved tyrosine residues embedded in ITIM-like motifs that have
been found in a growing number of cell surface members of the Ig
superfamily.34,40 In many cases, such ITIM motifs have been
shown to mediate negative regulatory signals via recruitment and
activation of tyrosine phosphatases like SHP-1, SHP-2, and
SHIP.34,41 Future studies are needed to determine what
role, if any, the ITIM-like motifs have in potential signalling
functions of CD33 and siglec-5.
An emerging theme for siglecs is that their ability to mediate
cell-cell interactions can be influenced by the nature and extent of
sialylation on the host cell, the target cell, and also the relative
length of the siglec. Thus, sialoadhesin with 17 Ig domains is thought
to extend the binding site up to 35 nm from the plasma membrane,
thereby reducing inhibitory cis-interactions with sialic acids present
in the macrophage glycocalyx (Crocker, unpublished
observations).42,43 At the other end of the spectrum, CD33
with only two Ig domains appears unable to mediate trans interactions
unless the endogenous sialic acids on the cell surface are removed by
sialidase treatment.29 As shown in the present study,
siglec-5, with 4 Ig domains, is able to mediate modest binding to RBCs
on COS cells in the absence of sialidase treatment, unlike CD33. This
finding, together with the demonstration that siglec-5 is present at
high levels on neutrophils, raises the possibility that this receptor
could be involved in cellular interactions of neutrophils during acute
inflammatory responses.
The recent deposition in the Genbank database of leptin-binding
proteins OB-BP1 and OB-BP2 (virtually identical to siglec-5), as well
as a recent report of another CD33-like sequence expressed specifically
in placenta33 (virtually identical to OB-BP1), together
with our unpublished observations indicate the existence of a novel
subgroup of CD33-like genes that are likely to function as sialic
acid-binding proteins. Interestingly, siglec-5 maps to chromosome
19q13.4, a region where a large number of other hematopoietically
expressed Ig superfamily members have been localized. These include a
family of genes encoding killer cell inhibitory receptors expressed on
natural killer cells and subsets of T-lymphocytes, immunoglobulin-like
transcripts (ILT-1, -2, and -3) expressed on myeloid cells and subsets
of lymphoid cells, the gp49 family of receptors expressed on mast cells
and natural killer cells, and the gene encoding human myeloid
immunoglobulin A Fc receptor (CD89).44 An emerging theme
for these receptors is that they are involved in either activatory or
inhibitory signalling functions in hematopoietic cells.34 A
major challenge for the future will be to elucidate the functions of
the CD33-like subgroup of sialic acid-binding receptors and to
determine the significance of sialic acid recognition.
| |
FOOTNOTES |
Submitted March 23, 1998;
accepted April 29, 1998.
Supported by the Imperial Cancer Research Fund and the Wellcome Trust.
Address reprint requests to Paul R. Crocker, PhD, The Wellcome Trust
Building, Department of Biochemistry, University of Dundee, Dundee DD1
4HN, Scotland, UK; e-mail: prcrocker{at}bad.dundee.ac.uk.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We are grateful to Jane Steel for help with antibody production, to
Craig Stocks for assistance with FACS analysis, to Andy May for help
with sequence analysis and critical reading of the manuscript, and to
members of the haemopoiesis laboratory for discussions.
| |
REFERENCES |
1. Barclay AN, Brown MH, Law SKA, McKnight AJ, Tomlinson MG, van der
Merwe PA: The Leucocyte Antigen Facts Book. San Diego, CA, Academic
Press, 1997
2.
Crocker PR,
Kelm S,
Hartnell A,
Freeman S,
Nath D,
Vinson M,
Mucklow S:
Sialoadhesin and related cellular recognition molecules of the immunoglobulin superfamily.
Biochem Soc Trans
24:149,
1996
3.
Cyster J,
Goodnow C:
Tuning antigen receptor signaling by CD22: Integrating cues from antigens and the microenvironment.
Immunity
6:509,
1997[Medline]
[Order article via Infotrieve]
4.
Crocker PR,
Hartnell A,
Munday J,
Nath D:
The potential role of sialoadhesin as a macrophage recognition molecule in health and disease.
Glycoconj J
14:601,
1997[Medline]
[Order article via Infotrieve]
5.
Fruttiger M,
Montag D,
Schachner M,
Martini R:
Crucial role for the myelin-associated glycoprotein in the maintenance of axon-myelin integrity.
Eur J Neurosci
7:511,
1995[Medline]
[Order article via Infotrieve]
6.
Kelm S,
Schauer R,
Manuguerra J-C,
Gross H-J,
Crocker PR:
Modifications of cell surface sialic acids modulate cell adhesion mediated by sialoadhesin and CD22.
Glycoconj J
11:576,
1994[Medline]
[Order article via Infotrieve]
7.
Kelm S,
Pelz A,
Schauer R,
Filbin MT,
Tang S,
DeBellard M-E,
Schnaar RI,
Mahoney JA,
Hartnell A,
Bradfield P,
Crocker PR:
Sialoadhesin, MAG and CD22 define a new family of sialic acid-dependent adhesion molecules of the immunoglobulin superfamily.
Curr Biol
4:965,
1994[Medline]
[Order article via Infotrieve]
8. Crocker PR, Clark EA, Filbin M, Gordon S, Jones Y, Kehrl JH, Kelm
S, Douarin NL, Powell L, Roder J, Schnaar RL, Sgroi DC, Stamenkovic I,
Schauer R, Schachner M, van den Berg TK, van der Merwe PA, Watt SM,
Varki A: Siglecs: A new family of sialic acid-binding lectins.
Glycobiology 8:v, 1998
9.
Vinson M,
van der Merwe PA,
Kelm S,
May A,
Jones EY,
Crocker PR:
Characterization of the sialic acid-binding site in sialoadhesin by site-directed mutagenesis.
J Biol Chem
271:9267,
1996[Abstract/Free Full Text]
10.
May AP,
Robinson RC,
Vinson M,
Crocker PR,
Jones EY:
Crystal structure of the N-terminal domain of sialoadhesin in complex with 3 sialyllactose at 1.85A resolution.
Molecular Cell
1:719,
1998[Medline]
[Order article via Infotrieve]
11.
van der Merwe PA,
Crocker PR,
Vinson M,
Barclay AN,
Schauer R,
Kelm S:
Localization of the putative sialic acid-binding site on the immunoglobulin superfamily cell-surface molecule CD22.
J Biol Chem
271:9273,
1996[Abstract/Free Full Text]
12. Freeman SD: Studies on the myeloid antigens CD33 and
sialoadhesin. PhD thesis, Oxford University, Oxford, UK, 1996
13.
Tang S,
Shen YJ,
DeBellard ME,
Mukhopadhyay G,
Salzer JL,
Crocker PR,
Filbin MT:
Myelin-associated glycoprotein (MAG) interacts with neurons via a sialic acid binding site at arg118 and a distinct neurite inhibition site.
J Cell Biol
138:1355,
1997[Abstract/Free Full Text]
14. Williams AF, Davis SJ, He Q, Barclay AN: Structural diversity in
domains of the immunoglobulin superfamily. Cold Spring Harbor Symp
Quant Biol LIV:637, 1989
15.
Pedraza L,
Owens GC,
Green LAD,
Salzer JL:
The myelin-associated glycoproteins: Membrane disposition, evidence of a novel disulfide linkage between immunoglobulin-like domains, and posttranslational palmitylation.
J Cell Biol
111:2651,
1990[Abstract/Free Full Text]
16.
Pierelli L,
Teofili L,
Menichella G,
Rumi C,
Paoloni A,
Iovino S,
Puggioni PL,
Leone G,
Bizzi B:
Further investigations on the expression of HLA-DR, CD33 and CD13 surface antigens in purified bone marrow and peripheral blood CD34+ haematopoietic progenitor cells.
Br J Haematol
84:24,
1993[Medline]
[Order article via Infotrieve]
17.
Dorken B,
Moldenhauer G,
Pezzutto A,
Schwartz R,
Feller A,
Kiesel S,
Nadler L:
HD39 (B3), a B lineage-restricted antigen whose cell surface expression is limited to resting and activated human B lymphocytes.
J Immunol
136:4470,
1986[Abstract]
18.
Crocker PR,
Gordon S:
Mouse macrophage hemagglutinin (sheep erythrocyte receptor) with specificity for sialylated glycoconjugates characterised by a monoclonal antibody.
J Exp Med
169:1333,
1989[Abstract/Free Full Text]
19.
Steiniger B,
Barth P,
Harbst B,
Hartnell A,
Crocker PR:
The species-specific structure of microanatomical compartments in the human spleen: Strongly sialoadhesin-positive macrophages occur in the perifollicular zone, but not in the marginal zone.
Immunology
92:307,
1997[Medline]
[Order article via Infotrieve]
20.
Griffin JD,
Linch D,
Sabbath K,
Larcom P,
Schlossman SF:
A monoclonal antibody reactive with normal and leukaemic human myeloid progenitor cells.
Leukaemia Res
8:521,
1984[Medline]
[Order article via Infotrieve]
21.
Mason DY,
Stein H,
Gerdes J,
Pulford KA,
Ralfkiaer E,
Falini B,
Erber WN,
Micklem K,
Gatter KC:
Value of monoclonal anti-CD22 (p135) antibodies for the detection of normal and neoplastic B lymphoid cells.
Blood
69:836,
1987[Abstract/Free Full Text]
22.
McGraw KJ,
Rosenblum MG,
Cheung L,
Scheinberg DA:
Characterization of murine and humanized anti-CD33, gelonin immunotoxins reactive against myeloid leukemias.
Cancer Immunol Immunother
39:367,
1994[Medline]
[Order article via Infotrieve]
23.
Mansfield E,
Amlot P,
Pastan I,
FitzGerald DJ:
Recombinant RFB4 immunotoxins exhibit potent cytotoxic activity for CD22-bearing cells and tumors.
Blood
90:2020,
1997[Abstract/Free Full Text]
24.
Adams MD,
Kerlavage AR,
Fleischmann RD,
Fuldner RA,
Bult CJ,
Lee NH,
Kirkness EF,
Weinstock KG,
Gocayne JD,
White O,
Sutton G,
Blake JA,
Brandon RG,
Chiu MW,
Clayton RA,
Cline RT,
Cotton MD,
Earle-Hughes J,
Fine LD,
Fitzgerald LM,
Fitzhugh WM,
Fritchman JL,
Goeghagen NSM,
Glodek A,
Gnehm CL,
Hanna MC,
Hedblom E,
Hinkle PS,
Kelley JM,
Klimek KM,
Kelley JC,
Liu LI,
Marmaros SM,
Merrick JM,
Moreno-Palanques RF,
McDonald LA,
Nguyen DT,
Pellegrino SM,
Phillips CA,
Ryder SE,
Scott JL,
Saudek DM,
Shirley R,
Small KV,
Spriggs TA,
Utterback TR,
Weldman JF,
Li Y,
Barthlow R,
Bednarik DP,
Cao LA,
Cepeda MA,
Coleman TA,
Collins EJ,
Dimke D,
Feng P,
Ferrie A,
Fischer C,
Hastings GA,
He WW,
Hu JS,
Huddleston KA,
Greene JM,
Gruber J,
P H,
Kim MA,
Kozak DL,
Kunsch C,
Ji HJ,
Li HD,
Meissner PS,
Olson H,
Raymond L,
Wei YF,
Wing J,
Xu C,
Yu GL,
Ruben SM,
Dillon PJ,
Fannon MR,
Rosen CA,
Haseltine WA,
Fields C,
Fraser CM,
Venter JC:
Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence.
Nature
377:3,
1995[Medline]
[Order article via Infotrieve]
25.
Ni J,
Abrahamson M,
Zhang M,
Fernandez MA,
Grubb A,
Su J,
Yu GL,
Li Y,
Parmelee D,
Xing L,
Coleman TA,
Gentz S,
Thotakura R,
Nguyen N,
Hesselberg M,
Gentz R:
Cystatin E is a novel human cysteine proteinase inhibitor with structural resemblance to family 2 cystatins.
J Biol Chem
272:10853,
1997[Abstract/Free Full Text]
26.
Feng GS,
Ouyang YB,
Hu DP,
Shi ZQ,
Gentz R,
Ni J:
Grap is a novel SH3-SH2-SH3 adaptor protein that couples tyrosine kinases to the Ras pathway.
J Biol Chem
271:12129,
1996[Abstract/Free Full Text]
27.
Johnson CV,
Singer RH,
Lawrence JB:
Fluorescent detection of nuclear RNA and DNA: Implications for genome organization.
Methods Cell Biol
35:73,
1991[Medline]
[Order article via Infotrieve]
28.
Johnson CV,
McNeil JA,
Carter KC,
Lawrence JB:
A simple, rapid technique for precise mapping of multiple sequences in two colors using a single optical filter set.
Genet Anal Tech Appl
8:75,
1991[Medline]
[Order article via Infotrieve]
29.
Freeman SD,
Kelm S,
Barber EK,
Crocker PR:
Characterisation of CD33 as a new member of the Sialoadhesin family of cellular interactions molecules.
Blood
85:2005,
1995[Abstract/Free Full Text]
30.
Nath D,
van der Merwe PA,
Kelm S,
Bradfield P,
Crocker PR:
The amino-terminal immunoglobulin-like domain of sialoadhesin contains the sialic acid binding site. Comparison with CD22.
J Biol Chem
270:26184,
1995[Abstract/Free Full Text]
31.
Simmons DL:
Cloning cell surface molecules by transient expression in mammalian cells
, in Hartley DA
(ed):
Cellular Interactions in Development A Practical Approach.
Oxford, UK, IRL Press
, 1993
, p 93
32.
Simmons DL,
Seed B:
Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells.
J Immunol
141:2797,
1988[Abstract]
33.
Takei Y,
Sasaki S,
Fujiwara T,
Takahashi E,
Muto T,
Nakamura Y:
Molecular cloning of a novel gene similar to myeloid antigen CD33 and its specific expression in placenta.
Cytogenet Cell Genet
78:295,
1997[Medline]
[Order article via Infotrieve]
34.
Vely F,
Vivier E:
Conservation of structural features reveals the existence of a large family of inhibitory cell surface receptors and noninhibitory/activatory counterparts.
J Immunol
159:2075,
1997[Abstract/Free Full Text]
35.
Trask BFA,
Christensen M,
Youngblom J,
Bergmann A,
Copeland A,
de Jong P,
Mohrenweiser H,
Olsen A,
Carrano A,
Tynan K:
Fluorescence in situ hybridization mapping of human chromosome 19: Cytogenetic band location of 540 cosmids and 70 genes or DNA markers.
Genomics
15:133,
1993[Medline]
[Order article via Infotrieve]
36.
Tropak MB,
Roder JC:
Regulation of myelin-associated glycoprotein binding by sialylated cis-ligands.
J Neurochem
68:1753,
1997[Medline]
[Order article via Infotrieve]
37.
Powell LD,
Varki A:
The oligosaccharide binding specificities of CD22-beta, a sialic acid-specific lectin of B-cells.
J Biol Chem
269:10628,
1994[Abstract/Free Full Text]
38.
Collins BE,
Kiso M,
Hasegawa A,
Tropak MB,
Roder JC,
Crocker PR,
Schnaar RL:
Binding specificities of the sialoadhesin family of I-type lectins. Sialic acid linkage and substructure requirements for binding of myelin-associated glycoprotein, Schwann cell myelin protein, and sialoadhesin.
J Biol Chem
272:16889,
1997[Abstract/Free Full Text]
39.
Look TA:
Report on the CD33 cluster workshop: Biochemical and genetic characterisation of gp67
, in Knapp W,
Dorken B,
Gilks WR,
Rieber EP,
Schmidt RE,
Stein H,
von dem Borne AEG
(eds):
Leucocyte Typing IV. White Cell Differentiation Antigens.
Oxford, UK, Oxford University Press
, 1989
, p 814
40.
Borges L,
Hsu M-L,
Fanger N,
Kubin M,
Cosman D:
A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules.
J Immunol
159:5192,
1997[Abstract]
41.
Unkeless JC,
Jin J:
Inhibitory receptors, ITIM sequences and phosphatases.
Curr Opin Immunol
9:338,
1997[Medline]
[Order article via Infotrieve]
42.
Crocker PR,
Kelm S,
Dubois C,
Martin B,
McWilliam AS,
Shotton DM,
Paulson JC,
Gordon S:
Purification and properties of sialoadhesin, a sialic acid-binding receptor of murine tissue macrophages.
EMBO J
10:1661,
1991[Medline]
[Order article via Infotrieve]
43.
Crocker PR,
Mucklow S,
Bouckson V,
McWilliam A,
Willis AC,
Gordon S,
Milon G,
Kelm S,
Bradfield P:
Sialoadhesin, a macrophage-specific adhesion molecule for haemopoietic cells with 17 immunoglobin-like domains.
EMBO J
13:4490,
1994[Medline]
[Order article via Infotrieve]
44.
Dupont B,
Selvakumar A,
Steffens U:
The killer cell inhibitory receptor genomic region on human chromosome 19q13.4.
Tissue Antigens
49:557,
1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Yamanaka, Y. Kato, T. Angata, and H. Narimatsu
Deletion polymorphism of SIGLEC14 and its functional implications
Glycobiology,
August 1, 2009;
19(8):
841 - 846.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Gunnarsson, L. Levander, P. Pahlsson, and M. Grenegard
The acute-phase protein {alpha}1-acid glycoprotein (AGP) induces rises in cytosolic Ca2+ in neutrophil granulocytes via sialic acid binding immunoglobulin-like lectins (Siglecs)
FASEB J,
December 1, 2007;
21(14):
4059 - 4069.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. F. Arthur, Y. Shen, M. L. Kahn, M. C. Berndt, R. K. Andrews, and E. E. Gardiner
Ligand Binding Rapidly Induces Disulfide-dependent Dimerization of Glycoprotein VI on the Platelet Plasma Membrane
J. Biol. Chem.,
October 19, 2007;
282(42):
30434 - 30441.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Angata, T. Hayakawa, M. Yamanaka, A. Varki, and M. Nakamura
Discovery of Siglec-14, a novel sialic acid receptor undergoing concerted evolution with Siglec-5 in primates
FASEB J,
October 1, 2006;
20(12):
1964 - 1973.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. von Gunten and H.-U. Simon
Sialic acid binding immunoglobulin-like lectins may regulate innate immune responses by modulating the life span of granulocytes
FASEB J,
April 1, 2006;
20(6):
601 - 605.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Varki and T. Angata
Siglecs--the major subfamily of I-type lectins
Glycobiology,
January 1, 2006;
16(1):
1R - 27R.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Tateno, P. R. Crocker, and J. C. Paulson
Mouse Siglec-F and human Siglec-8 are functionally convergent paralogs that are selectively expressed on eosinophils and recognize 6'-sulfo-sialyl Lewis X as a preferred glycan ligand
Glycobiology,
November 1, 2005;
15(11):
1125 - 1135.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. J. Feldman, J. Brandwein, R. Stone, M. Kalaycio, J. Moore, J. O'Connor, N. Wedel, G. J. Roboz, C. Miller, R. Chopra, et al.
Phase III Randomized Multicenter Study of a Humanized Anti-CD33 Monoclonal Antibody, Lintuzumab, in Combination With Chemotherapy, Versus Chemotherapy Alone in Patients With Refractory or First-Relapsed Acute Myeloid Leukemia
J. Clin. Oncol.,
June 20, 2005;
23(18):
4110 - 4116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Avril, S. D. Freeman, H. Attrill, R. G. Clarke, and P. R. Crocker
Siglec-5 (CD170) Can Mediate Inhibitory Signaling in the Absence of Immunoreceptor Tyrosine-based Inhibitory Motif Phosphorylation
J. Biol. Chem.,
May 20, 2005;
280(20):
19843 - 19851.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Muthumani, D. S. Hwang, A. Y. Choo, S. Mayilvahanan, N. S. Dayes, K. P. Thieu, and D. B. Weiner
HIV-1 Vpr inhibits the maturation and activation of macrophages and dendritic cells in vitro
Int. Immunol.,
February 1, 2005;
17(2):
103 - 116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Avril, H. Floyd, F. Lopez, E. Vivier, and P. R. Crocker
The Membrane-Proximal Immunoreceptor Tyrosine-Based Inhibitory Motif Is Critical for the Inhibitory Signaling Mediated by Siglecs-7 and -9, CD33-Related Siglecs Expressed on Human Monocytes and NK Cells
J. Immunol.,
December 1, 2004;
173(11):
6841 - 6849.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Blixt, B. E. Collins, I. M. van den Nieuwenhof, P. R. Crocker, and J. C. Paulson
Sialoside Specificity of the Siglec Family Assessed Using Novel Multivalent Probes: IDENTIFICATION OF POTENT INHIBITORS OF MYELIN-ASSOCIATED GLYCOPROTEIN
J. Biol. Chem.,
August 15, 2003;
278(33):
31007 - 31019.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. C. M. Brinkman-Van der Linden, T. Angata, S. A. Reynolds, L. D. Powell, S. M. Hedrick, and A. Varki
CD33/Siglec-3 Binding Specificity, Expression Pattern, and Consequences of Gene Deletion in Mice
Mol. Cell. Biol.,
June 15, 2003;
23(12):
4199 - 4206.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. E. Collins, O. Blixt, N. V. Bovin, C.-P. Danzer, D. Chui, J. D. Marth, L. Nitschke, and J. C. Paulson
Constitutively unmasked CD22 on B cells of ST6Gal I knockout mice: novel sialoside probe for murine CD22
Glycobiology,
September 1, 2002;
12(9):
563 - 571.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Angata, S. C. Kerr, D. R. Greaves, N. M. Varki, P. R. Crocker, and A. Varki
Cloning and Characterization of Human Siglec-11. A RECENTLY EVOLVED SIGNALING MOLECULE THAT CAN INTERACT WITH SHP-1 AND SHP-2 AND IS EXPRESSED BY TISSUE MACROPHAGES, INCLUDING BRAIN MICROGLIA
J. Biol. Chem.,
June 28, 2002;
277(27):
24466 - 24474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Grobe and L. D. Powell
Role of protein kinase C in the phosphorylation of CD33 (Siglec-3) and its effect on lectin activity
Blood,
May 1, 2002;
99(9):
3188 - 3196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. T. Doyle, A. J. O'Neill, P. Newsholme, J. M. Fitzpatrick, and R. W. G. Watson
The loss of IAP expression during HL-60 cell differentiation is caspase-independent
J. Leukoc. Biol.,
February 1, 2002;
71(2):
247 - 254.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. K. van den Berg, D. Nath, H. J. Ziltener, D. Vestweber, M. Fukuda, I. van Die, and P. R. Crocker
Cutting Edge: CD43 Functions as a T Cell Counterreceptor for the Macrophage Adhesion Receptor Sialoadhesin (Siglec-1)
J. Immunol.,
March 15, 2001;
166(6):
3637 - 3640.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Scholler, M. Hayden-Ledbetter, K.-E. Hellstrom, I. Hellstrom, and J. A. Ledbetter
CD83 Is a Sialic Acid-Binding Ig-Like Lectin (Siglec) Adhesion Receptor that Binds Monocytes and a Subset of Activated CD8+ T Cells
J. Immunol.,
March 15, 2001;
166(6):
3865 - 3872.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Hartnell, J. Steel, H. Turley, M. Jones, D. G. Jackson, and P. R. Crocker
Characterization of human sialoadhesin, a sialic acid binding receptor expressed by resident and inflammatory macrophage populations
Blood,
January 1, 2001;
97(1):
288 - 296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Fournier, L. Chalus, I. Durand, E. Garcia, J.-J. Pin, T. Churakova, S. Patel, C. Zlot, D. Gorman, S. Zurawski, et al.
FDF03, a Novel Inhibitory Receptor of the Immunoglobulin Superfamily, Is Expressed by Human Dendritic and Myeloid Cells
J. Immunol.,
August 1, 2000;
165(3):
1197 - 1209.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. P. Paul, L. S. Taylor, E. K. Stansbury, and D. W. McVicar
Myeloid specific human CD33 is an inhibitory receptor with differential ITIM function in recruiting the phosphatases SHP-1 and SHP-2
Blood,
July 15, 2000;
96(2):
483 - 490.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. C. M. Brinkman-Van der Linden and A. Varki
New Aspects of Siglec Binding Specificities, Including the Significance of Fucosylation and of the Sialyl-Tn Epitope
J. Biol. Chem.,
March 17, 2000;
275(12):
8625 - 8632.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. C. M. Brinkman-Van der Linden, E. R. Sjoberg, L. R. Juneja, P. R. Crocker, N. Varki, and A. Varki
Loss of N-Glycolylneuraminic Acid in Human Evolution. IMPLICATIONS FOR SIALIC ACID RECOGNITION BY SIGLECS
J. Biol. Chem.,
March 17, 2000;
275(12):
8633 - 8640.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Floyd, J. Ni, A. L. Cornish, Z. Zeng, D. Liu, K. C. Carter, J. Steel, and P. R. Crocker
Siglec-8. A NOVEL EOSINOPHIL-SPECIFIC MEMBER OF THE IMMUNOGLOBULIN SUPERFAMILY
J. Biol. Chem.,
January 14, 2000;
275(2):
861 - 866.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Nicoll, J. Ni, D. Liu, P. Klenerman, J. Munday, S. Dubock, M.-G. Mattei, and P. R. Crocker
Identification and Characterization of a Novel Siglec, Siglec-7, Expressed by Human Natural Killer Cells and Monocytes
J. Biol. Chem.,
November 26, 1999;
274(48):
34089 - 34095.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Falco, R. Biassoni, C. Bottino, M. Vitale, S. Sivori, R. Augugliaro, L. Moretta, and A. Moretta
Identification and Molecular Cloning of p75/AIRM1, A Novel Member of the Sialoadhesin Family That Functions as an Inhibitory Receptor in Human Natural Killer Cells
J. Exp. Med.,
September 20, 1999;
190(6):
793 - 802.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Takematsu, S. Diaz, A. Stoddart, Y. Zhang, and A. Varki
Lysosomal and Cytosolic Sialic Acid 9-O-Acetylesterase Activities Can Be Encoded by One Gene via Differential Usage of a Signal Peptide-encoding Exon at the N Terminus
J. Biol. Chem.,
September 3, 1999;
274(36):
25623 - 25631.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Patel, E. C. M. B.-V. d. Linden, S. W. Altmann, K. Gish, S. Balasubramanian, J. C. Timans, D. Peterson, M. P. Bell, J. F. Bazan, A. Varki, et al.
OB-BP1/Siglec-6. A LEPTIN- AND SIALIC ACID-BINDING PROTEIN OF THE IMMUNOGLOBULIN SUPERFAMILY
J. Biol. Chem.,
August 6, 1999;
274(32):
22729 - 22738.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. C. Taylor, C. D. Buckley, M. Douglas, A. J. Cody, D. L. Simmons, and S. D. Freeman
The Myeloid-specific Sialic Acid-binding Receptor, CD33, Associates with the Protein-tyrosine Phosphatases, SHP-1 and SHP-2
J. Biol. Chem.,
April 23, 1999;
274(17):
11505 - 11512.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Angata and A. Varki
Cloning, Characterization, and Phylogenetic Analysis of Siglec-9, a New Member of the CD33-related Group of Siglecs. EVIDENCE FOR CO-EVOLUTION WITH SIALIC ACID SYNTHESIS PATHWAYS
J. Biol. Chem.,
July 14, 2000;
275(29):
22127 - 22135.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Q. Zhang, G. Nicoll, C. Jones, and P. R. Crocker
Siglec-9, a Novel Sialic Acid Binding Member of the Immunoglobulin Superfamily Expressed Broadly on Human Blood Leukocytes
J. Biol. Chem.,
July 14, 2000;
275(29):
22121 - 22126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ulyanova, D. D. Shah, and M. L. Thomas
Molecular Cloning of MIS, a Myeloid Inhibitory Siglec, That Binds Protein-tyrosine Phosphatases SHP-1 and SHP-2
J. Biol. Chem.,
April 20, 2001;
276(17):
14451 - 14458.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Vinson, P. J. L. M. Strijbos, A. Rowles, L. Facci, S. E. Moore, D. L. Simmons, and F. S. Walsh
Myelin-associated Glycoprotein Interacts with Ganglioside GT1b. A MECHANISM FOR NEURITE OUTGROWTH INHIBITION
J. Biol. Chem.,
June 1, 2001;
276(23):
20280 - 20285.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Li, W. Zhang, T. Wan, J. Zhang, T. Chen, Y. Yu, J. Wang, and X. Cao
Cloning and Characterization of Siglec-10, a Novel Sialic Acid Binding Member of the Ig Superfamily, from Human Dendritic Cells
J. Biol. Chem.,
July 20, 2001;
276(30):
28106 - 28112.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Yu, C.-M. Lai, M. Maoui, D. Banville, and S.-H. Shen
Identification and Characterization of S2V, a Novel Putative Siglec That Contains Two V Set Ig-like Domains and Recruits Protein-tyrosine Phosphatases SHPs
J. Biol. Chem.,
June 22, 2001;
276(26):
23816 - 23824.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Sato, Z. Yasukawa, N. Honda, T. Matsuda, and K. Kitajima
Identification and Adipocyte Differentiation-dependent Expression of the Unique Disialic Acid Residue in an Adipose Tissue-specific Glycoprotein, Adipo Q
J. Biol. Chem.,
July 27, 2001;
276(31):
28849 - 28856.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Angata, R. Hingorani, N. M. Varki, and A. Varki
Cloning and Characterization of a Novel Mouse Siglec, mSiglec-F. DIFFERENTIAL EVOLUTION OF THE MOUSE AND HUMAN (CD33) Siglec-3-RELATED GENE CLUSTERS
J. Biol. Chem.,
November 21, 2001;
276(48):
45128 - 45136.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract