Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kritzik, M.
Right arrow Articles by Kunicki, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kritzik, M.
Right arrow Articles by Kunicki, T. J.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 7 (October 1), 1998: pp. 2382-2388

Nucleotide Polymorphisms in the alpha 2 Gene Define Multiple Alleles That Are Associated With Differences in Platelet alpha 2beta 1 Density

By Marcie Kritzik, Brian Savage, Diane J. Nugent, Sentot Santoso, Zaverio M. Ruggeri, and Thomas J. Kunicki

From the Roon Research Center for Arteriosclerosis and Thrombosis, Division of Experimental Hemostasis and Thrombosis of the Department of Molecular and Experimental Medicine and The Department of Vascular Biology, The Scripps Research Institute, La Jolla; the Children's Hospital of Orange County, Orange, CA; and the Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University, Giessen, Germany.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Three allelic differences in the alpha 2 gene are associated with expression levels of the alpha 2beta 1 integrin on the platelet surface. We have previously defined two linked silent polymorphisms in the alpha 2 gene coding region at nucleotides 807 (C or T) and 873 (G or A). We have now identified one rarer nucleotide polymorphism in the coding region at nucleotide 837 (T or C) and four additional linked polymorphisms within the introns that flank these coding sequences. Moreover, we have determined that the alloantigenic Br polymorphism, which resides in a distal coding region at nucleotide 1648, is also linked to the 837 polymorphism. Thus, three alpha 2 gene alleles, defined by eight nucleotide polymorphisms, have now been discovered. Allele 1 (807T/837T/873A/Brb) is associated with increased levels of alpha 2beta 1; allele 2 (807C/837T/873G/Brb) and allele 3 (807C/837C/873G/Bra) are each associated with lower levels of alpha 2beta 1. Finally, we also show here that the rate of platelet attachment to type I collagen in whole blood under conditions of high shear rate (1,500/s) is proportional to the density of alpha 2beta 1 receptors on the platelet surface. Thus, the density of platelet alpha 2beta 1 could have an important impact on platelet adhesion to collagen in whole blood and therefore on platelet function in vivo, contributing to an increased risk of thrombosis or to bleeding in relevant disease states.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

INTEGRINS ARE heterodimeric molecules composed of noncovalently associated alpha  and beta  subunits that mediate cell-cell and cell-matrix adhesion.1 The integrin receptor for collagen/laminin, alpha 2beta 1 (also known as the platelet membrane glycoprotein Ia-IIa complex,2 the very late activation antigen-2 [VLA-2],3 and the class II extracellular matrix receptor [ECMII] 4), is expressed on a wide variety of cell types, including megakaryocytes, platelets, fibroblasts, endothelial cells, and epithelial cells.5 Although alpha 2beta 1 serves as a collagen receptor on platelets and fibroblasts,6 it functions as both a collagen and laminin receptor on endothelial cells and on many epithelial cell types.7

Previous studies in our laboratory have shown that platelet levels of alpha 2beta 1 vary significantly among normal individuals, whereas the levels of other integrins do not. 8 Because alpha 2beta 1 mediates platelet adhesion to collagen in vivo, variation in its expression levels could have a significant impact on platelet function. Significantly, our recent analyses have shown that DNA sequence polymorphisms in the alpha 2 gene are linked to expression levels of alpha 2beta 1 on platelets.9 The DNA sequence variants identified include two conservative changes in the amino acid coding region of alpha 2 at nucleotides 807 (TTT/TTC at codon Phe224) and 873 (ACA/ACG at codon Thr246) of the cDNA sequence. Although these particular variants do not change the amino acid sequence of the alpha 2 protein, we have found a significant correlation between these DNA sequence polymorphisms and expression levels of alpha 2beta 1. We have found that the 807C/873G sequences are associated with lower levels of alpha 2beta 1, while the 807T/873A sequences are associated with higher levels of this integrin. In addition, familial studies confirm that regulation of alpha 2beta 1 levels is an inherited trait linked to these two silent polymorphisms. These alleles were referred to as 807C (for the 807C/873G pair) and 807T (for the 807T/873A pair).

In this report, we have extended our analysis of the alpha 2 gene to include the introns surrounding the nucleotide polymorphisms at bp 807 and 873. As a result of this work, we are now able to define three alpha 2 gene alleles; two of these alleles are associated with lower levels of alpha 2beta 1, whereas one is associated with higher levels of this integrin. These allelic differences in alpha 2beta 1 levels could modulate platelet function in vivo by influencing the critical initial phase of stabilized platelet adhesion to collagen, which is mediated by alpha 2beta 1. Indeed, we show here that differences in alpha 2beta 1 receptor levels are reflected in the rate of platelet attachment to type I collagen under conditions of high shear.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Identification of the polymorphism at bp 837.   The polymorphism at bp 837 was identified after analysis of mRNA or DNA from 85 individuals. The mRNA was amplified and sequenced, whereas the DNA was analyzed by Southern dot blot hybridization for determination of the base at position 837. Procedures were performed as previously described.9 Oligonucleotides used for dot blot analysis of the 837 sequence were: 837 C: GCTGAATAGGCATATTT; 837 T: GCTGAATAAGCATATTT.

Sequence analysis.   DNA was either sequenced manually by the dideoxy termination method using Sequenase 2.0 (US Biochemical Corp, Cleveland, OH) or with an automated sequencer at The Scripps Research Institute DNA Core Laboratory.

Isolation of introns F, G, and H from genomic DNA.   The primers used for amplification possessed either an Xba I site or an Xho I site to facilitate subcloning into pGEM (Promega, Madison, WI). Intron G was amplified and isolated as previously described.9 Intron F was amplified using the following primer pair: 5' primer (cDNA bp 634-665): GAACTCGAGGTACAAGGCCTTGATATAGGCCC; 3' primer (cDNA bp 764-786): AGGTCTAGACCATATTGGGATGTCTGGGATG. Intron H was amplified using the following primer pair: 5' primer (intron G bp 3506-3532): AATCTCGAGCGAATACTGGGATAAATACATGCAC; 3' primer (cDNA bp 1090-1114): TCCTCTAGACCCAGCCTTTTCTAGTAGAGCTGC.

The polymerase chain reaction (PCR) products were ligated into pGEM (Promega) after digestion with Xba I and Xho I. Intron F was found to possess an internal Xba I site. Therefore, each segment of intron F was subcloned into pGEM separately.

Br polymorphism analysis.   Determination of Br genotype was performed as described.10 Sixty-three individuals were typed for this polymorphism; of these, 13 were heterozygous for this polymorphism, whereas the remainder were homozygous for the Brb polymorphism.

Determination of alpha 2 genotype using the Bgl II/Nde I restriction fragment length polymorphism (RFLP) assays.   The ~600-bp segment of intron G encompassing the Bgl II and Nde I sites was amplified from genomic DNA using the following primer pair: 5' primer (intron G bp 2789-2812): GATTTAACTTTCCCGACTGCCTTC; 3' primer (intron G bp 3346-3369): CATAGGTTTTTGGGGAACAGGTGG.

The PCR product (5 µL) was digested in a 15 µL reaction volume using 0.5 µL of Bgl II or Nde I (NEB) in the recommended reaction buffer at 37°C overnight. Reaction products were analyzed on a 1.4% agarose gel.

Preparation of collagen-coated cover slips.   Acid soluble type I collagen from human placenta (Sigma, St Louis, MO) was diluted to a concentration of 200 mg/mL in phosphate-buffered saline (PBS), pH 7.4, and applied evenly over a horizontal glass cover slip (Corning, Inc, Corning, NY; 24 mm × 50 mm), covering all but the first 10 mm, which remained uncoated to facilitate handling. Coated cover slips were then placed in a humid environment at room temperature for 60 minutes. Excess collagen was removed by four sequential rinses with PBS, pH 7.4, and assembled in the flow chamber. Blocking the cover slips with bovine serum albumin (0.1 mg/mL) did not affect initial platelet adhesion or subsequent thrombus formation, and uncoated cover slips did not support platelet adhesion.11,12

Perfusion chamber and epifluorescence video microscopy.   Platelet interaction with immobilized collagen was studied using a modification of a Hele-Shaw flow chamber described elsewhere.11,12 Collagen-coated cover slips formed the lower surface of the chamber with a flow path height of 254 mm (determined by a silicone rubber gasket). The flow chamber was assembled and filled with PBS, pH 7.4. A syringe pump (Harvard Apparatus Inc, Holliston, MA) was used to aspirate blood through the flow chamber. A flow rate of 1.94 mL/min produced a wall shear rate of 1,500/s at the inlet of the flow chamber. All measurements of platelet adhesion and thrombus formation were made at a position adjacent to the inlet of the chamber so as to avoid prior exposure of flowing platelets to the thrombogenic surface and preformed thrombi. Platelets were labeled in whole blood by direct incubation with the fluorescent dye mepacrine (quinacrine dihydrochloride; 10 mmol/L, final concentration). Although this dye also labels leukocytes, these cells could be readily distinguished from platelets by their relatively large size and scarcity; moreover, permanent leukocyte attachment to collagen was negligible at wall shear rates above 500/s. Red cells were not visualized due to fluorescence quenching by hemoglobin. Mepacrine concentrates in the dense granules of platelets and has no effect on normal platelet function at the concentration used.13 Platelet secretion after adhesion does not prevent their visualization. Furthermore previous studies have shown that mepacrine does not interfere with platelet adhesion.12 The flow chamber, mounted on an epifluorescence microscope (Axiovert 135M inverted microscope, Carl Zeiss Inc, New York, NY), allowed direct visualization in real time of the platelet adhesion process, which was recorded on a video cassette recorder.

Platelet surface coverage measurements.   The total area occupied by adherent platelets in an area of 16,384 mm2 was measured by capturing images from the video tape using a frame grabber (Matrox Image LC; Matrox Electronics System Ltd, Dorval, Quebec, Canada) and processing using the Metamorph software package (Universal Imaging Corporation, Westchester, PA). A threshold was applied to the image to distinguish platelets from the background. The microscope settings (including contrast, brightness, and magnification settings) were maintained at constant values to facilitate valid comparisons between different experiments.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Additional nucleotide polymorphisms linked to expression levels of alpha 2beta 1 define three alleles of the alpha 2 gene.   We have previously described the variation in alpha 2beta 1 levels that exists among individuals. In studying this variability in expression levels, our analysis of mRNA from six individuals expressing different levels of alpha 2beta 1 revealed two linked nucleotide polymorphisms, separated by almost seventy nucleotides, at bp 807 and 873 in the alpha 2 coding region. These were the only two nucleotide polymorphisms identified within the ~3.5-kb alpha 2 coding region that consistently varied among the samples studied. Based on this work, subsequent analyses of 30 individuals showed that the 807/873 nucleotide polymorphisms were associated with differences in expression levels of alpha 2beta 1; the 807C/873G pair was found to be associated with lower levels of alpha 2beta 1 , the 807T/873A pair with higher levels of this integrin.

In the present study, we have continued our analysis of the alpha 2 gene to determine if additional sequence polymorphisms exist that are associated with the 807 and 873 polymorphisms and with expression levels of alpha 2beta 1. Analysis of a larger group of individuals has now led to the identification of an additional, rarer nucleotide polymorphism (C or T) in the coding region of the alpha 2 gene, at bp 837. As with the polymorphisms at bp 807 and 873, the polymorphism at bp 837 does not change the alpha 2 coding sequence. In this variant, a C rather than a T is found at bp 837 in a small subset of individuals (Fig 1). In our study group, 13 out of 85 individuals screened were heterozygous C/T at this position; all 13 of these individuals were either heterozygous or homozygous for 807C/873G, indicating strong linkage with the 837C polymorphism.


View larger version (20K):
[in this window]
[in a new window]
 
Fig 1. Structure of the alpha 2 gene surrounding the 807 and 873 polymorphisms. Three alpha 2 gene alleles, defined by eight nucleotide polymorphisms, are indicated in the figure. Exons 6 through 9 are shown in boxes; positions of the exons in the cDNA sequence and the length of each exon are indicated beneath each exon box. The polymorphisms at bp 807, 837, and 873 are shown in bold. The Br polymorphism at bp 1648 is also shown in bold to the right. Introns F, G, and H are indicated. The length of each intron is shown in parentheses. The frequency (f) of each allele was determined from a random pool of 85 individuals. cDNA and intron positions of the polymorphisms are indicated. The ability of each allele to be cleaved by Nde I or Bgl II (+ or -) is indicated in tabular form next to each allele. The precise bp differences that change susceptibility to cleavage by Nde I or Bgl II within intron G are indicated.

This nucleotide variation therefore defines a third allele of the alpha 2 gene, which is present at a frequency of approximately 8% in the population. It is striking that the three nucleotide polymorphisms we have identified are clustered in one segment of the alpha 2 coding region. For this reason, we extended our analysis of the alpha 2 gene to include the three introns flanking bp 807, 837, and 873 (introns F, G, and H). We have cloned these introns, and the sequences of this region have been deposited with GenBank (Accession No. AF035968).

We have identified several sequence variations in the ~4 kb intron that separates bp 807 and 873 (intron G). Each of these additional nucleotide polymorphisms is always found associated with the particular alpha 2 allele indicated in Fig 1, thereby establishing their linkage to the 807 and 873 polymorphisms. Of particular interest for screening purposes (see below) is a Bgl II restriction site created by the nucleotide sequence present in intron G of allele 1. As depicted in Table 1, this Bgl II site is found associated only with allele 1. Seventy nucleotides upstream of the Bgl II site, we have also identified an Nde I site, present in alleles 1 and 2, but are absent in allele 3. Interestingly, this nucleotide variation is linked to the polymorphism at bp 837, where only individuals carrying a C at bp 837 were found to lack the Nde I site. The previously defined Br polymorphism at nucleotide 164810 also appears to be linked to these polymorphisms; only individuals carrying a C at bp 837 were found to carry the Bra polymorphism.

 
View this table:
[in this window] [in a new window]
 
Table 1. Association Between the Presence of the Bgl II Site and Expression of alpha 2 Allele 1 

The linkage associations between the polymorphisms at bp 807/873/837, the Nde I site, and the Br polymorphisms are given in Table 2. Two additional nucleotide polymorphisms linked to bp 807/873 were also identified, one near the 5' end of intron G and one in the 300 bp intron that lies downstream of bp 873 (intron H), although our analysis is limited to only a few individuals at the present time. Finally, our preliminary data indicate that nine additional base variations in intron F, which lies upstream of bp 807, may be linked to the already defined alleles. However, these particular base changes (determined for just one 807T allele and one 807C allele) need to be confirmed among a larger pool of 807C and 807T individuals.

 
View this table:
[in this window] [in a new window]
 
Table 2. Association Between the Presence of the Nde I Site and alpha 2 Genotype

Thus, three alpha 2 gene alleles, defined by eight nucleotide polymorphisms, have now been defined. We had previously shown that alleles 1 and 2 of the alpha 2 gene, defined only by the polymorphisms at bp 807 and 873, were associated with high or low alpha 2beta 1 levels, respectively. The third allele we now define carries the 807C/873G polymorphisms and would have therefore been associated with lower levels of alpha 2beta 1 in our previous studies. Individuals homozygous for allele 3 have not yet been identified by us, precluding a direct analysis of alpha 2beta 1 levels associated with that genotype. Nonetheless, the clustering of nucleotide polymorphisms identified so far suggests that this region of the alpha 2 gene might harbor elements important in the regulation of alpha 2 expression.

alpha 2 allele genotyping using Bgl II/Nde I restriction analysis.   We have developed a strategy to type individuals for each of the three alleles using the polymorphic Bgl II and Nde I restriction sites described above. The region of intron G encompassing these sites was amplified from genomic DNA as described in Materials and Methods, and the resulting PCR products were digested with Bgl II or Nde I. Analysis by agarose gel electrophoresis resulted in clearly resolved patterns from which the genotype of individuals could be readily determined (Fig 2). As seen in panel A, the 600-bp PCR product amplified from individuals expressing alleles 2 and/or 3 (lanes 5 and 6) or from the control sequence (lane 7) remained undigested by Bgl II. The PCR product produced from individuals homozygous for allele 1 (lanes 1 and 2) or from the control sequence (lane 8) was completely digested by Bgl II to produce fragments of 200 bp and 400 bp, whereas that produced from individuals expressing allele 1 and either allele 2 or 3 yielded fragments of 200 bp, 400 bp, and 600 bp (lanes 3 and 4).


View larger version (43K):
[in this window]
[in a new window]
 
Fig 2. alpha 2 allele genotyping using Bgl II/Nde I digestion. The region of the alpha 2 gene encompassing the Bgl II and Nde I sites was amplified from genomic DNA as described in Materials and Methods. The 600-bp PCR product was digested with Bgl II (A) or Nde I (B), and the resulting products were analyzed by agarose gel electrophoresis. Lanes 1 and 2, homozygous (allele 1); lane 3, heterozygous (allele 1, allele 3); lane 4, heterozygous (allele 1, allele 2); lanes 5 and 6, homozygous (allele 2); lane 7, control sequence 807C/837C/873G; lane 8, control sequence 807T/837T/873A; lane 9, molecular weight (MW) lambda Hind III/diamond X174Hae III; lane 10 (B only), heterozygous (allele 2, allele 3). The 807, 837, and 873 designations refer to the genotype as determined by Southern dot blot analysis of genomic DNA.9 Size of MW markers (in bp) is indicated to the right of the figure.

The same PCR products were digested with Nde I to permit determination of allele 3. As seen in panel B, only those products generated from individuals carrying allele 3 or from the control sequence remained undigested by Nde I (lanes 3, 7, and 10). As none of the individuals screened were homozygous for allele 3, Nde I in each case cuts some product (excluding the control sequence in lane 7). Thus, we describe here a novel RFLP method for rapidly determining the alpha 2 genotype at positions 807, 837, and 873 from genomic DNA. This technique therefore provides a simple method for discriminating among the three alpha 2 gene alleles described above.

Sequence analysis of intron G.   Sequence analysis of intron G has further revealed the presence of a unique inverted repeat in this region (Fig 1). Separated by ~2.5 kb, the inverted repeat sequences, which do not have significant homology with sequences currently in the database, are 275 bp long, have the potential to form a stem loop structure based on sequence analysis, and are present in all of the gene alleles described above.

The rate of platelet adhesion to collagen at high shear rate increases with increasing alpha 2beta 1 receptor density.   We compared the behavior of platelets from individuals homozygous for allele 1 with those expressing only alleles 2 or 3 to assess the influence of alpha 2beta 1 receptor density on adhesion to type I collagen. Whole blood was perfused over immobilized type I collagen under high shear rate conditions (1,500/s). The results from one representative comparison between an individual homozygous for allele 1 (807T) and an individual homozygous for allele 2 (807C) are depicted in Fig 3. Coverage of the collagen-coated surface increased over time with platelets from both individuals, and by 3 minutes there was essentially no difference in the total surface coverage between the two samples. However, the rate at which platelet deposition occurred differed significantly between paired donor samples. The results from a comparison of three 807T and three 807C donors are summarized in Fig 4. In the case of the 807T donors, the rate of platelet attachment was significantly faster, particularly within the first 2 minutes of adhesion (Fig 4). Thus, at high shear rates in whole blood, the rate of platelet attachment to type I collagen increases with increasing density of alpha 2beta 1.


View larger version (71K):
[in this window]
[in a new window]
 
Fig 3. Video microscopy of platlet attachment to human type I collagen at high shear (1,500/s). Real-time epifluorescence video microscopy showing the time courses of platelet adhesion in whole blood to surface-bound solubilized human type I collagen at 1,500/s. Single-frame images obtained during a typical comparison are depicted. These data, derived from one donor pairwise analysis, are representative of results obtained from six donors. Upper row: normal donor, homozygous allele 1 (807T) genotype, High platelet alpha 2beta 1 density; bottom row: normal donor, homozygous allele 2 (807C) genotype, Low platelet alpha 2beta 1 density. Time after initiation of whole blood flow is shown above each column. Platelet alpha 2beta 1 density was determined by flow cytometry and is expressed as a normalized mean fluorescence intensity (nMFI).9 The range of nMFI for 32 normal subjects is 1.0 to 9.4. In the experiment depicted here, the nMFI values for each donor are: High, 9.2; Low, 2.2.


View larger version (15K):
[in this window]
[in a new window]
 
Fig 4. Time course of platelet adhesion to human type I collagen at 1,500/s. Time course of platelet attachment to surface-bound solubilized human type I collagen. The area (square microns) covered by platelets is depicted on the ordinate as a function of time after initiation of blood flow, in minutes (abscissa). The results of three paired comparisons are shown (n = 3; mean ± SEM). (open circle ) High-density donors (mean nMFI = 6.5); (bullet ) low-density donors (mean nMFI = 2.1). The levels of expression of alpha 2beta 1 in high-density donors was threefold that in low-density donors. Differences at 1.5, 2.0, and 2.5 minutes are statistically significant (P < 0.01).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

We have previously defined two linked, silent polymorphisms in the alpha 2 gene that are associated with variable expression levels of alpha 2beta 1 on platelets and that define two alleles of the alpha 2 gene.9 In this report, we describe the identification of five additional nucleotide polymorphisms in the region surrounding bp 807 and 873. These polymorphisms are linked to those previously described and to expression levels of alpha 2. Indeed, three alpha 2 gene alleles, defined by eight nucleotide polymorphisms, have now been confirmed.

It is not clear whether these sequence changes are themselves involved in differential alpha 2 expression or if they are merely physically linked to the region responsible for modulating alpha 2 levels. Studies are currently underway to investigate this question. In the discussion that follows, we describe several possible mechanisms through which these exonic and/or intronic polymorphisms might be linked to expression levels of the alpha 2beta 1 integrin; other mechanisms are certainly possible.

There are a number of ways in which DNA sequence alterations could influence gene expression. For example, changes in specific promoter elements could influence promoter activity, resulting in increased or decreased mRNA levels. Expression of alpha 2beta 1 in hematopoietic cells is restricted to megakaryocytes and platelets.14 Zutter et al15 have shown that induced expression of alpha 2beta 1 during megakaryocytic differentiation is due to transcriptional activation of the alpha 2 gene; no changes in the level of beta 1 mRNA expression were detected during megakaryocytic differentiation. Approximately 5 kb of the 5' sequence flanking the alpha 2 transcriptional start site has been cloned, and regions critical for alpha 2 expression have been identified.16 Although a strong core promoter region located in the first ~100 bp upstream of the transcriptional start site was found to be necessary for gene activity, it was not found to be cell-type specific. A silencer element located upstream of this region (between -92 and -351) was found to function in cells of hematopoietic lineage, and enhancer elements identified further upstream (between -1426 and -2592) were found to be megakaryocyte-specific and were required for high-level expression of the alpha 2 gene in megakaryocytic cells. In addition, a number of sites for transcription factors and other regulatory molecules have been identified in the region upstream of the transcriptional start site. Sequence variations in these or other regulatory elements could have a profound impact on expression levels of alpha 2.

In addition to promoter variations influencing gene expression, the 3' untranslated region (3'UTR) of alpha 2, which is approximately 5 kb, might modulate protein expression; 3'untranslated regions have been shown to influence mRNA stability as well as message translation.17 It is also possible that the polymorphisms at bp 807 and 873 are directly related to allelic differences in alpha 2 expression. Modulation of expression levels by sequences within the coding region of RNA has been described previously.18-20 Differences in intragenic sequences could also influence alpha 2 gene expression. There are numerous reports of enhancer or repressor elements located in intronic sequences.21-23 Indeed, the fact that the polymorphisms so far identified are clustered in one region of the alpha 2 gene suggests that this region might harbor critical control elements involved in the regulation of alpha 2 expression.

In whole blood, under a broad range of shear rates (50 to 1,500/s), alpha 2beta 1 mediates the initial phase of stabilized platelet adhesion to collagen that will lead to accelerated prothrombin conversion on the platelet surface and thrombus formation supported by the integrin alpha IIbbeta 3.24-26 However, even when the function of alpha IIbbeta 3 is completely inhibited and thrombus formation is blocked, alpha 2beta 1-mediated adhesion itself still induces the cellular changes that catalyze prothrombin conversion to the same extent as one would otherwise see in the absence of inhibitors.26 Consequently, alpha 2beta 1 has the potential to play a major role in platelet function in vivo both as a primary mediator of adhesion to collagen and as a primary stimulus for prothrombin conversion at the platelet surface.

As shown here, the density of platelet alpha 2beta 1 has an important impact on platelet adhesion to collagen in whole blood even under conditions of high shear rate (1,500/s), such that the rate of adhesion to type I collagen increases with increasing receptor density. This stage of adhesion, occurring between 30 seconds and 3 minutes, is likely to be a critical period of thrombus formation in vivo, because there are many compensatory antithrombotic mechanisms that would come into play to inhibit thrombus expansion or to dissociate the nascent thrombus. Within 3 to 5 minutes, a sufficient number of stimuli have been received, regardless of alpha 2beta 1 density, and mature thrombi begin to cover the collagen surface. The expansion of the initial platelet clusters to form larger thrombi is certainly mediated by the binding of integrin alpha IIbbeta 3, because macroaggregate formation (but not surface attachment) is inhibited by monoclonal antibodies specific for that integrin.

The expression of alpha 2beta 1 by platelets is critical in promoting platelet adhesion to the subendothelium; adhesion of platelets to collagen is critical for normal platelet activity, in hemostasis, and in wound repair. Hereditary variation in platelet levels of alpha 2beta 1, defined by the existence of multiple alleles of the alpha 2 gene that are associated with variable alpha 2beta 1 expression levels, could therefore have a significant impact on platelet function, contributing to an increased risk of thrombosis or bleeding in relevant disease states.

    FOOTNOTES

   Submitted December 31, 1997; accepted June 2, 1998.
   Supported by a grant from the Gustavus and Louise Pfeiffer Research Foundation (Denville, NJ) awarded to T.J.K. and NHLBI grants HL-31950 and HL-42846 awarded to Z.M.R. This is manuscript number 11124-MEM from The Scripps Research Institute.
   Address reprint requests to Thomas J. Kunicki, PhD, Associate Professor, Department of Molecular and Experimental Medicine, The Scripps Research Institute, 10666 N Torrey Pines Rd, Maildrop SBR13, La Jolla, CA 92037.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Hynes RO: Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69:11, 1992[Medline] [Order article via Infotrieve]

2. Pischel KD, Bluestein HG, Woods VL: Platelet glycoprotein Ia,Ic, and IIa are physicochemically indistinguishable from the very late activation antigens adhesion-related proteins of lymphocytes and other cell types. J Clin Invest 81:505, 1988

3. Takada Y, Wayner EA, Carter WG, Hemler ME: Extracellular matrix receptors, ECMRII and ECMRI, for collagen and fibronectin correspond to VLA-2 and VLA-3 in the VLA family of heterodimers. J Cell Biochem 37:385, 1988[Medline] [Order article via Infotrieve]

4. Kunicki TJ, Nugent DJ, Staats SJ, Orchekowski RP, Wayner EA, Carter WG: The human fibroblast class II extracellular matrix receptor mediates platelet adhesion to collagen and is identical to the platelet glycoprotein Ia-IIa complex. J Biol Chem 263:4516, 1988[Abstract/Free Full Text]

5. Zutter MM, Santoro SA: Widespread histologic distribution of the alpha 2beta 1 integrin cell-surface collagen receptor. Am J Pathol 137:113, 1990[Abstract]

6. Elices MJ, Hemler ME: The human integrin VLA-2 is a collagen receptor on some cells and a collagen/laminin receptor on others. Proc Natl Acad Sci USA 86:9906, 1990

7. Kirchhofer D, Languino LR, Ruoslahti E, Pierschbacher MD: alpha 2beta 1 integrins from different cell types show different binding specificities. J Biol Chem 265:615, 1990[Abstract/Free Full Text]

8. Kunicki TJ, Orchekowski R, Annis D, Honda Y: Variability of integrin alpha 2 beta 1activity on human platelets. Blood 82:2693, 1993[Abstract/Free Full Text]

9. Kunicki TJ, Kritzik M, Annis DS, Nugent DJ: Hereditary variation in platelet integrin alpha 2beta 1 copy number is associated with two silent polymorphisms in the alpha 2 gene coding sequence. Blood 89:1939, 1997[Abstract/Free Full Text]

10. Kalb R, Santoso S, Unkelbach K, Kiefel V, Mueller-Eckhardt C: Localization of the Br polymorphism on a 144 bp Exon of the GPIa gene and its application in platelet DNA typing. Thromb Haemost 71:651, 1994[Medline] [Order article via Infotrieve]

11. Usami S, Chen HH, Zhao Y, Chien S, Skalak R: Design and construction of a linear shear stress flow chamber. Ann Biomed Eng 21:77, 1993[Medline] [Order article via Infotrieve]

12. Savage B, Saldivar E, Ruggeri ZM: Initiation of platelet adhesion by arrest onto fibrinogen or translocation on von Willebrand factor. Cell 84:289, 1996[Medline] [Order article via Infotrieve]

13. Dise CA, Burch JW, Goodman DBP: Direct interaction of mepacrine with erythrocyte and platelet membrane phospholipid. J Biol Chem 257:4701, 1982[Abstract/Free Full Text]

14. Santoro SA, Zutter MM: The alpha 2beta 1 integrin: A collagen receptor on platelets and other cells. Thromb Haemost 74:813, 1995[Medline] [Order article via Infotrieve]

15. Zutter MM, Fong AM, Krigman HR, Santoro SA: Differential regulation of the alpha 2beta 1 and alpha IIbbeta 3 integrin genes during megakaryocytic differentiation of pluripotential K562 cells. J Biol Chem 267:20233, 1992[Abstract/Free Full Text]

16. Zutter MM, Painter AA, Staatz WD, Tsung YL: Regulation of alpha 2 integrin gene expression in cells with megakaryocytic features: A common theme of three necessary elements. Blood 86:3006, 1995[Abstract/Free Full Text]

17. Jackson RJ: Cytoplasmic regulation of mRNA function: The importance of the 3' untranslated region. Cell 74:9, 1993[Medline] [Order article via Infotrieve]

18. Burstein KL, Jewell CM, Sar M, Cidlowski JA: Intragenic sequences of the human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor messenger RNA down-regulation through multiple mechanisms. Mol Endocrinol 8:1764, 1994[Abstract/Free Full Text]

19. Kaludov NK, Pabon-Pena L, Hurt MM: Identification of a second conserved element within the coding sequence of a mouse H3 histone gene that interacts with nuclear factors and is necessary for normal expression. Nucleic Acids Res 24:523, 1996[Abstract/Free Full Text]

20. Beattie DT, Mahan MJ, Mekalanos JJ: Repressor binding to a regulatory site in the DNA coding sequence is sufficient to confer transcriptional regulation of the vir-repressed genes (vrg genes) in Bordetella pertussis. J Bacteriol 175:519, 1993[Abstract/Free Full Text]

21. Ottavio L, Chang C-D, Rizzo M-G, Travali S, Casadevall C, Baerga R: Importance of introns in the growth regulation of mRNA levels of the proliferating cell nuclear antigen gene. Mol Cell Biol 10:303, 1990[Abstract/Free Full Text]

22. Frenkel B, Montecino M, Stein JL, Lian JB, Stein GS: A composite intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: Promoter and cell type requirements. Proc Natl Acad Sci USA 91:10923, 1994[Abstract/Free Full Text]

23. Jeffers M, Pellicer A: Multiple intragenic elements regulate the expression of the murine N-ras gene. Oncogene 7:2115, 1992[Medline] [Order article via Infotrieve]

24. Coller BS, Beer JH, Scudder LE, Steinberg MH: Collagen-platelet interactions: Evidence for a direct interaction of collagen with platelet GPIa/IIa and an indirect interaction with platelet GPIIb/IIIa mediated by adhesive proteins. Blood 74:182, 1989[Abstract/Free Full Text]

25. Savage B, Marzec UM, Chao BH, Harker LA, Maraganore JM, Ruggeri ZM: Binding of the snake venom-derived proteins applaggin and echistatin to the arginine-glycine-aspartic acid recognition site(s) on platelet glycoprotein IIb.IIIa complex inhibits receptor function. J Biol Chem 265:11766, 1990[Abstract/Free Full Text]

26. Kirchhofer D, Tschopp TB, Steiner B, Baumgartner HR: Role of collagen-adherent platelets in mediating fibrin formation in flowing whole blood. Blood 86:3815, 1995[Abstract/Free Full Text]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0019$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
R. Yamamoto, Y. Nagasawa, T. Shoji, K. Inoue, T. Uehata, T. Kaneko, T. Okada, A. Yamauchi, Y. Tsubakihara, E. Imai, et al.
A candidate gene approach to genetic prognostic factors of IgA nephropathy--a result of Polymorphism REsearch to DIstinguish genetic factors Contributing To progression of IgA Nephropathy (PREDICT-IgAN)
Nephrol. Dial. Transplant., December 1, 2009; 24(12): 3686 - 3694.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
J. Rivera, M. L. Lozano, L. Navarro-Nunez, and V. Vicente
Platelet receptors and signaling in the dynamics of thrombus formation
Haematologica, May 1, 2009; 94(5): 700 - 711.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. W. Miller, S. Basra, D. W. Kulp, P. C. Billings, S. Choi, M. P. Beavers, O. J. T. McCarty, Z. Zou, M. L. Kahn, J. S. Bennett, et al.
Small-molecule inhibitors of integrin {alpha}2{beta}1 that prevent pathological thrombus formation via an allosteric mechanism
PNAS, January 20, 2009; 106(3): 719 - 724.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. E. Herrera-Galeano, D. M. Becker, A. F. Wilson, L. R. Yanek, P. Bray, D. Vaidya, N. Faraday, and L. C. Becker
A Novel Variant in the Platelet Endothelial Aggregation Receptor-1 Gene Is Associated With Increased Platelet Aggregability
Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1484 - 1490.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. M. Ruggeri and G. L. Mendolicchio
Adhesion Mechanisms in Platelet Function
Circ. Res., June 22, 2007; 100(12): 1673 - 1685.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
E. Lim, S. Carballo, J. Cornelissen, Z. A. Ali, R. Grignani, S. Bellm, and S. Large
Dose-Related Efficacy of Aspirin After Coronary Surgery in Patients With PlA2 Polymorphism (NCT00262275)
Ann. Thorac. Surg., January 1, 2007; 83(1): 134 - 138.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
G. Okumus, E. Kiyan, O. Arseven, L. Tabak, E. K. Bayrak, N. E. Unaltuna, and H. Issever
Platelet Glycoprotein Ia 807c/T and 873g/A Polymorphisms in Patients With Venous Thromboembolism
Clinical and Applied Thrombosis/Hemostasis, January 1, 2007; 13(1): 101 - 103.
[Abstract] [PDF]


Home page
BloodHome page
Y. Cheli and T. J. Kunicki
hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1
Blood, June 1, 2006; 107(11): 4391 - 4398.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. V. Vijayan and P. F. Bray
Molecular Mechanisms of Prothrombotic Risk Due to Genetic Variations in Platelet Genes: Enhanced Outside-In Signaling Through the Pro33 Variant of Integrin {beta}3.
Experimental Biology and Medicine, May 1, 2006; 231(5): 505 - 513.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
M. Ogino, J. Kido, M. Bando, N. Hayashi, C. Wada, T. Nagata, F. Nishimura, Y. Soga, S. Takashiba, T. Kubota, et al.
{alpha}2 Integrin +807 Polymorphism in Drug-induced Gingival Overgrowth
Journal of Dental Research, December 1, 2005; 84(12): 1183 - 1186.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Ajzenberg, C. Berroeta, I. Philip, B. Grandchamp, P. Ducellier, V. Huart, P. Verpillat, M.-C. Guillin, and J. Benessiano
Association of the -92C/G and 807C/T Polymorphisms of the {alpha}2 Subunit Gene With Human Platelets {alpha}2{beta}1 Receptor Density
Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): 1756 - 1760.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
J. Mikkelsson, M. Perola, and P. J. Karhunen
Genetics of Platelet Glycoprotein Receptors: Risk of Thrombotic Events and Pharmacogenetic Implications
Clinical and Applied Thrombosis/Hemostasis, April 1, 2005; 11(2): 113 - 125.
[Abstract] [PDF]


Home page
Diabetes and Vascular Disease ResearchHome page
B. Stratmann and D. Tschoepe
Pathobiology and cell interactions of platelets in diabetes
Diabetes and Vascular Disease Research, February 1, 2005; 2(1): 16 - 23.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Cattaneo
Aspirin and Clopidogrel: Efficacy, Safety, and the Issue of Drug Resistance
Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 1980 - 1987.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Kunicki, A. B. Federici, D. R. Salomon, J. A. Koziol, S. R. Head, T. S. Mondala, J. D. Chismar, L. Baronciani, M. T. Canciani, and I. R. Peake
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees
Blood, October 15, 2004; 104(8): 2359 - 2367.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Kunicki
Of men; why not mice?
Blood, May 1, 2004; 103(9): 3251 - 3252.
[Full Text] [PDF]


Home page
BloodHome page
T.-T. Li, S. Larrucea, S. Souza, S. M. Leal, J. A. Lopez, E. M. Rubin, B. Nieswandt, and P. F. Bray
Genetic variation responsible for mouse strain differences in integrin {alpha}2 expression is associated with altered platelet responses to collagen
Blood, May 1, 2004; 103(9): 3396 - 3402.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A. Lepantalo, K. S Virtanen, J. Heikkila, U. Wartiovaara, and R. Lassila
Limited early antiplatelet effect of 300 mg clopidogrel in patients with aspirin therapy undergoing percutaneous coronary interventions
Eur. Heart J., March 2, 2004; 25(6): 476 - 483.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Gruner, M. Prostredna, V. Schulte, T. Krieg, B. Eckes, C. Brakebusch, and B. Nieswandt
Multiple integrin-ligand interactions synergize in shear-resistant platelet adhesion at sites of arterial injury in vivo
Blood, December 1, 2003; 102(12): 4021 - 4027.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. He, L. K. Pappan, D. G. Grenache, Z. Li, D. M. Tollefsen, S. A. Santoro, and M. M. Zutter
The contributions of the {alpha}2{beta}1 integrin to vascular thrombosis in vivo
Blood, November 15, 2003; 102(10): 3652 - 3657.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. G. Grenache, T. Coleman, C. F. Semenkovich, S. A. Santoro, and M. M. Zutter
{alpha}2{beta}1 Integrin and Development of Atherosclerosis in a Mouse Model: Assessment of Risk
Arterioscler Thromb Vasc Biol, November 1, 2003; 23(11): 2104 - 2109.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Best, Y. A. Senis, G. E. Jarvis, H. J. Eagleton, D. J. Roberts, T. Saito, S. M. Jung, M. Moroi, P. Harrison, F. R. Green, et al.
GPVI levels in platelets: relationship to platelet function at high shear
Blood, October 15, 2003; 102(8): 2811 - 2818.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Dupont, P. Fontana, C. Bachelot-Loza, J.-L. Reny, I. Bieche, F. Desvard, M. Aiach, and P. Gaussem
An intronic polymorphism in the PAR-1 gene is associated with platelet receptor density and the response to SFLLRN
Blood, March 1, 2003; 101(5): 1833 - 1840.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Chen, T. G. Diacovo, D. G. Grenache, S. A. Santoro, and M. M. Zutter
The {alpha}2 Integrin Subunit-Deficient Mouse : A Multifaceted Phenotype Including Defects of Branching Morphogenesis and Hemostasis
Am. J. Pathol., July 1, 2002; 161(1): 337 - 344.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Maeno, H. Koyama, H. Tahara, M. Komatsu, M. Emoto, T. Shoji, M. Inaba, T. Miki, Y. Okuno, and Y. Nishizawa
The 807T Allele in {alpha}2 Integrin Is Protective Against Atherosclerotic Arterial Wall Thickening and the Occurrence of Plaque in Patients With Type 2 Diabetes
Diabetes, May 1, 2002; 51(5): 1523 - 1528.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
G. Benze, J. Heinrich, H. Schulte, S. Rust, U. Nowak-Gottl, M.-C. Tataru, E. Kohler, G. Assmann, and R. Junker
Association of the GPIa C807T and GPIIIa PlA1/A2 polymorphisms with premature myocardial infarction in men
Eur. Heart J., February 2, 2002; 23(4): 325 - 330.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler Thromb Vasc Biol, January 1, 2002; 22(1): 14 - 20.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Cadroy, K. S. Sakariassen, J.-P. Charlet, C. Thalamas, B. Boneu, and P. Sie
Role of 4 platelet membrane glycoprotein polymorphisms on experimental arterial thrombus formation in men
Blood, November 15, 2001; 98(10): 3159 - 3161.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
W. R. P. Agema, J. W. Jukema, S. N. Pimstone, and J. J. P. Kastelein
Genetic aspects of restenosis after percutaneous coronary interventions;towards more tailored therapy
Eur. Heart J., November 2, 2001; 22(22): 2058 - 2074.
[PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Furihata, K. J. Clemetson, H. Deguchi, and T. J. Kunicki
Variation in Human Platelet Glycoprotein VI Content Modulates Glycoprotein VI-Specific Prothrombinase Activity
Arterioscler Thromb Vasc Biol, November 1, 2001; 21(11): 1857 - 1863.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. S. Williams and P. F. Bray
Genetics of Arterial Prothrombotic Risk States
Experimental Biology and Medicine, May 1, 2001; 226(5): 409 - 419.
[Abstract] [Full Text]


Home page
BloodHome page
B. Jacquelin, M. D. Tarantino, M. Kritzik, D. Rozenshteyn, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Allele-dependent transcriptional regulation of the human integrin {alpha}2 gene
Blood, March 15, 2001; 97(6): 1721 - 1726.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Roest, J. D. Banga, D. E. Grobbee, P. G. de Groot, J. J. Sixma, M. J. Tempelman, and Y. T. van der Schouw
Homozygosity for 807 T Polymorphism in {alpha}2 Subunit of Platelet {alpha}2{beta}1 Is Associated With Increased Risk of Cardiovascular Mortality in High-Risk Women
Circulation, October 3, 2000; 102(14): 1645 - 1650.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Meisel, I. Cascorbi, A. Herrmann, I. Roots, M. Laule, V. Stangl, and K. Stangl
The platelet glycoprotein Ia C807T polymorphism as risk factor for coronary catheter interventions.
Blood, September 1, 2000; 96(5): 2002 - 2003.
[Full Text] [PDF]


Home page
BloodHome page
M. Roest, J. J. Sixma, Y.-P. Wu, M. J. W. Ijsseldijk, M. Tempelman, P. J. Slootweg, P. G. de Groot, and G. H. van Zanten
Platelet adhesion to collagen in healthy volunteers is influenced by variation of both alpha 2beta 1 density and von Willebrand factor
Blood, August 15, 2000; 96(4): 1433 - 1437.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. von Beckerath, W. Koch, J. Mehilli, C. Bottiger, A. Schomig, and A. Kastrati
Glycoprotein Ia gene C807T polymorphism and risk for major adverse cardiac events within the first 30 days after coronary artery stenting
Blood, June 1, 2000; 95(11): 3297 - 3301.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Jung and M. Moroi
Signal-transducing Mechanisms Involved in Activation of the Platelet Collagen Receptor Integrin alpha 2beta 1
J. Biol. Chem., March 10, 2000; 275(11): 8016 - 8026.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Matsubara, M. Murata, T. Maruyama, M. Handa, N. Yamagata, G. Watanabe, T. Saruta, and Y. Ikeda
Association between diabetic retinopathy and genetic variations in alpha 2beta 1 integrin, a platelet receptor for collagen
Blood, March 1, 2000; 95(5): 1560 - 1564.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. B. Bussel, T. J. Kunicki, and A. D. Michelson
Platelets: New Understanding of Platelet Glycoproteins and Their Role in Disease
Hematology, January 1, 2000; 2000(1): 222 - 240.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Santoso, J. Amrhein, H. A. Hofmann, U. J.H. Sachs, M. M. Walka, H. Kroll, and V. Kiefel
A Point Mutation Thr799Met on the alpha 2 Integrin Leads to the Formation of New Human Platelet Alloantigen Sita and Affects Collagen-Induced Aggregation
Blood, December 15, 1999; 94(12): 4103 - 4111.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. A. Santoro
Platelet Surface Collagen Receptor Polymorphisms: Variable Receptor Expression and Thrombotic/Hemorrhagic Risk
Blood, June 1, 1999; 93(11): 3575 - 3577.
[Full Text] [PDF]


Home page
BloodHome page
J. Di Paola, A. B. Federici, P.M. Mannucci, M. T. Canciani, M. Kritzik, T. J. Kunicki, and D. Nugent
Low Platelet alpha 2beta 1 Levels in Type I von Willebrand Disease Correlate With Impaired Platelet Function in a High Shear Stress System
Blood, June 1, 1999; 93(11): 3578 - 3582.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. E. Carlsson, S. Santoso, C. Spitzer, C. Kessler, and A. Greinacher
The alpha 2 Gene Coding Sequence T807/A873 of the Platelet Collagen Receptor Integrin alpha 2beta 1 Might Be a Genetic Risk Factor for the Development of Stroke in Younger Patients
Blood, June 1, 1999; 93(11): 3583 - 3586.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Santoso, T.J. Kunicki, H. Kroll, W. Haberbosch, and A. Gardemann
Association of the Platelet Glycoprotein Ia C807T Gene Polymorphism With Nonfatal Myocardial Infarction in Younger Patients
Blood, April 15, 1999; 93(8): 2449 - 2453.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Jacquelin, D. Rozenshteyn, S. Kanaji, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Characterization of Inherited Differences in Transcription of the Human Integrin alpha 2 Gene
J. Biol. Chem., June 22, 2001; 276(26): 23518 - 23524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kritzik, M.
Right arrow Articles by Kunicki, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kritzik, M.
Right arrow Articles by Kunicki, T. J.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020