|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 7 (October 1), 1998:
pp. 2382-2388
Nucleotide Polymorphisms in the 2 Gene Define Multiple
Alleles That Are Associated With Differences in Platelet
2 1 Density
By
Marcie Kritzik,
Brian Savage,
Diane J. Nugent,
Sentot Santoso,
Zaverio M. Ruggeri, and
Thomas J. Kunicki
From the Roon Research Center for Arteriosclerosis and Thrombosis,
Division of Experimental Hemostasis and Thrombosis of the Department of
Molecular and Experimental Medicine and The Department of Vascular
Biology, The Scripps Research Institute, La Jolla; the Children's
Hospital of Orange County, Orange, CA; and the Institute for Clinical
Immunology and Transfusion Medicine, Justus Liebig University, Giessen,
Germany.
 |
ABSTRACT |
Three allelic differences in the 2 gene
are associated with expression levels of the
2 1 integrin on the platelet surface. We
have previously defined two linked silent polymorphisms in the
2 gene coding region at nucleotides 807 (C or T) and 873 (G or A). We have now identified one rarer nucleotide polymorphism in
the coding region at nucleotide 837 (T or C) and four additional linked
polymorphisms within the introns that flank these coding sequences.
Moreover, we have determined that the alloantigenic Br polymorphism,
which resides in a distal coding region at nucleotide 1648, is also
linked to the 837 polymorphism. Thus, three 2 gene alleles, defined by eight nucleotide polymorphisms, have now been discovered. Allele 1 (807T/837T/873A/Brb) is associated
with increased levels of 2 1; allele 2 (807C/837T/873G/Brb) and allele 3 (807C/837C/873G/Bra) are each associated with lower levels
of 2 1. Finally, we also show here that
the rate of platelet attachment to type I collagen in whole blood under
conditions of high shear rate (1,500/s) is proportional to the density
of 2 1 receptors on the platelet surface.
Thus, the density of platelet 2 1 could
have an important impact on platelet adhesion to collagen in whole
blood and therefore on platelet function in vivo, contributing to an
increased risk of thrombosis or to bleeding in relevant disease states.
 |
INTRODUCTION |
INTEGRINS ARE heterodimeric molecules
composed of noncovalently associated and subunits that mediate
cell-cell and cell-matrix adhesion.1 The integrin receptor
for collagen/laminin, 2 1 (also known as
the platelet membrane glycoprotein Ia-IIa complex,2 the
very late activation antigen-2 [VLA-2],3 and the class II
extracellular matrix receptor [ECMII] 4), is expressed on
a wide variety of cell types, including megakaryocytes, platelets,
fibroblasts, endothelial cells, and epithelial cells.5 Although 2 1 serves as a collagen receptor
on platelets and fibroblasts,6 it functions as both a
collagen and laminin receptor on endothelial cells and on many
epithelial cell types.7
Previous studies in our laboratory have shown that platelet levels of
2 1 vary significantly among normal
individuals, whereas the levels of other integrins do not.
8 Because 2 1 mediates platelet
adhesion to collagen in vivo, variation in its expression levels could
have a significant impact on platelet function. Significantly, our
recent analyses have shown that DNA sequence polymorphisms in the
2 gene are linked to expression levels of
2 1 on platelets.9 The DNA
sequence variants identified include two conservative changes in the
amino acid coding region of 2 at nucleotides 807 (TTT/TTC at codon Phe224) and 873 (ACA/ACG at codon
Thr246) of the cDNA sequence. Although these particular
variants do not change the amino acid sequence of the 2
protein, we have found a significant correlation between these DNA
sequence polymorphisms and expression levels of
2 1. We have found that the 807C/873G sequences are associated with lower levels of
2 1, while the 807T/873A sequences are
associated with higher levels of this integrin. In addition, familial
studies confirm that regulation of 2 1
levels is an inherited trait linked to these two silent polymorphisms.
These alleles were referred to as 807C (for the 807C/873G pair) and
807T (for the 807T/873A pair).
In this report, we have extended our analysis of the 2
gene to include the introns surrounding the nucleotide polymorphisms at
bp 807 and 873. As a result of this work, we are now able to define
three 2 gene alleles; two of these alleles are
associated with lower levels of 2 1,
whereas one is associated with higher levels of this integrin. These
allelic differences in 2 1 levels could
modulate platelet function in vivo by influencing the critical initial
phase of stabilized platelet adhesion to collagen, which is mediated by
2 1. Indeed, we show here that differences
in 2 1 receptor levels are reflected in
the rate of platelet attachment to type I collagen under conditions of
high shear.
 |
MATERIALS AND METHODS |
Identification of the polymorphism at bp 837.
The polymorphism at bp 837 was identified after analysis of mRNA or DNA
from 85 individuals. The mRNA was amplified and sequenced, whereas the
DNA was analyzed by Southern dot blot hybridization for determination
of the base at position 837. Procedures were performed as previously
described.9 Oligonucleotides used for dot blot analysis of
the 837 sequence were: 837 C: GCTGAATAGGCATATTT; 837 T:
GCTGAATAAGCATATTT.
Sequence analysis.
DNA was either sequenced manually by the dideoxy termination method
using Sequenase 2.0 (US Biochemical Corp, Cleveland, OH) or with an automated sequencer at The Scripps Research Institute DNA
Core Laboratory.
Isolation of introns F, G, and H from genomic DNA.
The primers used for amplification possessed either an Xba I
site or an Xho I site to facilitate subcloning into pGEM
(Promega, Madison, WI). Intron G was amplified and
isolated as previously described.9 Intron F was amplified
using the following primer pair: 5 primer (cDNA bp
634-665): GAACTCGAGGTACAAGGCCTTGATATAGGCCC; 3 primer
(cDNA bp 764-786): AGGTCTAGACCATATTGGGATGTCTGGGATG. Intron H was
amplified using the following primer pair: 5 primer (intron G bp
3506-3532): AATCTCGAGCGAATACTGGGATAAATACATGCAC; 3 primer (cDNA
bp 1090-1114): TCCTCTAGACCCAGCCTTTTCTAGTAGAGCTGC.
The polymerase chain reaction (PCR) products were ligated into pGEM
(Promega) after digestion with Xba I and Xho I. Intron F was found to possess an internal Xba I site. Therefore, each segment of intron F was subcloned into pGEM separately.
Br polymorphism analysis.
Determination of Br genotype was performed as described.10
Sixty-three individuals were typed for this polymorphism; of these, 13 were heterozygous for this polymorphism, whereas the remainder were
homozygous for the Brb polymorphism.
Determination of 2 genotype using the Bgl
II/Nde I restriction fragment length polymorphism
(RFLP) assays.
The ~600-bp segment of intron G encompassing the Bgl II and
Nde I sites was amplified from genomic DNA using the following primer pair: 5 primer (intron G bp 2789-2812):
GATTTAACTTTCCCGACTGCCTTC; 3 primer (intron G bp 3346-3369):
CATAGGTTTTTGGGGAACAGGTGG.
The PCR product (5 µL) was digested in a 15 µL reaction volume
using 0.5 µL of Bgl II or Nde I (NEB) in the
recommended reaction buffer at 37°C overnight. Reaction products
were analyzed on a 1.4% agarose gel.
Preparation of collagen-coated cover slips.
Acid soluble type I collagen from human placenta (Sigma, St Louis,
MO) was diluted to a concentration of 200 mg/mL in
phosphate-buffered saline (PBS), pH 7.4, and applied evenly over a
horizontal glass cover slip (Corning, Inc, Corning, NY; 24 mm × 50 mm), covering all but the first 10 mm, which remained uncoated to
facilitate handling. Coated cover slips were then placed in a humid
environment at room temperature for 60 minutes. Excess collagen was
removed by four sequential rinses with PBS, pH 7.4, and assembled in
the flow chamber. Blocking the cover slips with bovine serum albumin (0.1 mg/mL) did not affect initial platelet adhesion or subsequent thrombus formation, and uncoated cover slips did not support platelet adhesion.11,12
Perfusion chamber and epifluorescence video microscopy.
Platelet interaction with immobilized collagen was studied using a
modification of a Hele-Shaw flow chamber described
elsewhere.11,12 Collagen-coated cover slips formed the
lower surface of the chamber with a flow path height of 254 mm
(determined by a silicone rubber gasket). The flow chamber was
assembled and filled with PBS, pH 7.4. A syringe pump (Harvard
Apparatus Inc, Holliston, MA) was used to aspirate blood
through the flow chamber. A flow rate of 1.94 mL/min produced a wall
shear rate of 1,500/s at the inlet of the flow chamber. All
measurements of platelet adhesion and thrombus formation were made at a
position adjacent to the inlet of the chamber so as to avoid prior
exposure of flowing platelets to the thrombogenic surface and preformed
thrombi. Platelets were labeled in whole blood by direct incubation
with the fluorescent dye mepacrine (quinacrine dihydrochloride; 10 mmol/L, final concentration). Although this dye also labels leukocytes,
these cells could be readily distinguished from platelets by their
relatively large size and scarcity; moreover, permanent leukocyte
attachment to collagen was negligible at wall shear rates above 500/s.
Red cells were not visualized due to fluorescence quenching by
hemoglobin. Mepacrine concentrates in the dense granules of platelets
and has no effect on normal platelet function at the concentration used.13 Platelet secretion after adhesion does not prevent
their visualization. Furthermore previous studies have shown that
mepacrine does not interfere with platelet adhesion.12 The
flow chamber, mounted on an epifluorescence microscope (Axiovert 135M
inverted microscope, Carl Zeiss Inc, New York, NY), allowed direct
visualization in real time of the platelet adhesion process, which was
recorded on a video cassette recorder.
Platelet surface coverage measurements.
The total area occupied by adherent platelets in an area of 16,384 mm2 was measured by capturing images from the video tape
using a frame grabber (Matrox Image LC; Matrox Electronics
System Ltd, Dorval, Quebec, Canada) and processing using the Metamorph
software package (Universal Imaging Corporation, Westchester, PA). A
threshold was applied to the image to distinguish platelets from the
background. The microscope settings (including contrast, brightness,
and magnification settings) were maintained at constant values to
facilitate valid comparisons between different experiments.
 |
RESULTS |
Additional nucleotide polymorphisms linked to expression levels of
2 1 define three alleles of the
2 gene.
We have previously described the variation in
2 1 levels that exists among individuals.
In studying this variability in expression levels, our analysis of mRNA
from six individuals expressing different levels of
2 1 revealed two linked nucleotide
polymorphisms, separated by almost seventy nucleotides, at bp 807 and
873 in the 2 coding region. These were the only two
nucleotide polymorphisms identified within the ~3.5-kb
2 coding region that consistently varied among the
samples studied. Based on this work, subsequent analyses of 30 individuals showed that the 807/873 nucleotide polymorphisms were
associated with differences in expression levels of
2 1; the 807C/873G pair was found to be
associated with lower levels of 2 1 , the
807T/873A pair with higher levels of this integrin.
In the present study, we have continued our analysis of the
2 gene to determine if additional sequence polymorphisms
exist that are associated with the 807 and 873 polymorphisms and with expression levels of 2 1. Analysis of a
larger group of individuals has now led to the identification of an
additional, rarer nucleotide polymorphism (C or T) in the coding region
of the 2 gene, at bp 837. As with the polymorphisms at
bp 807 and 873, the polymorphism at bp 837 does not change the
2 coding sequence. In this variant, a C rather than a T
is found at bp 837 in a small subset of individuals (Fig 1). In our study group, 13 out of 85 individuals screened were heterozygous C/T at this position; all 13 of
these individuals were either heterozygous or homozygous for 807C/873G,
indicating strong linkage with the 837C polymorphism.

View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
Structure of the 2 gene surrounding the
807 and 873 polymorphisms. Three 2 gene alleles, defined
by eight nucleotide polymorphisms, are indicated in the figure. Exons 6 through 9 are shown in boxes; positions of the exons in the cDNA
sequence and the length of each exon are indicated beneath each exon
box. The polymorphisms at bp 807, 837, and 873 are shown in bold. The
Br polymorphism at bp 1648 is also shown in bold to the right. Introns
F, G, and H are indicated. The length of each intron is shown in
parentheses. The frequency (f) of each allele was determined from a
random pool of 85 individuals. cDNA and intron positions of the
polymorphisms are indicated. The ability of each allele to be cleaved
by Nde I or Bgl II (+ or ) is indicated in tabular
form next to each allele. The precise bp differences that change
susceptibility to cleavage by Nde I or Bgl II within
intron G are indicated.
|
|
This nucleotide variation therefore defines a third allele of the
2 gene, which is present at a frequency of approximately 8% in the population. It is striking that the three nucleotide polymorphisms we have identified are clustered in one segment of the
2 coding region. For this reason, we extended our
analysis of the 2 gene to include the three introns
flanking bp 807, 837, and 873 (introns F, G, and H). We have cloned
these introns, and the sequences of this region have been deposited
with GenBank (Accession No. AF035968).
We have identified several sequence variations in the ~4 kb intron
that separates bp 807 and 873 (intron G). Each of these additional
nucleotide polymorphisms is always found associated with the particular
2 allele indicated in Fig 1, thereby establishing their
linkage to the 807 and 873 polymorphisms. Of particular interest for
screening purposes (see below) is a Bgl II restriction site
created by the nucleotide sequence present in intron G of allele 1. As
depicted in Table 1, this Bgl II
site is found associated only with allele 1. Seventy nucleotides
upstream of the Bgl II site, we have also identified an
Nde I site, present in alleles 1 and 2, but are absent in
allele 3. Interestingly, this nucleotide variation is linked to the
polymorphism at bp 837, where only individuals carrying a C at bp 837 were found to lack the Nde I site. The previously defined Br
polymorphism at nucleotide 164810 also appears to be linked
to these polymorphisms; only individuals carrying a C at bp 837 were
found to carry the Bra polymorphism.
The linkage associations between the polymorphisms at bp 807/873/837,
the Nde I site, and the Br polymorphisms are given in Table 2. Two additional nucleotide
polymorphisms linked to bp 807/873 were also identified, one near the
5 end of intron G and one in the 300 bp intron that lies
downstream of bp 873 (intron H), although our analysis is limited to
only a few individuals at the present time. Finally, our preliminary
data indicate that nine additional base variations in intron F, which
lies upstream of bp 807, may be linked to the already defined alleles.
However, these particular base changes (determined for just one 807T
allele and one 807C allele) need to be confirmed among a larger pool of
807C and 807T individuals.
Thus, three 2 gene alleles, defined by eight nucleotide
polymorphisms, have now been defined. We had previously shown that alleles 1 and 2 of the 2 gene, defined only by the
polymorphisms at bp 807 and 873, were associated with high or low
2 1 levels, respectively. The third allele
we now define carries the 807C/873G polymorphisms and would have
therefore been associated with lower levels of
2 1 in our previous studies. Individuals
homozygous for allele 3 have not yet been identified by us, precluding
a direct analysis of 2 1 levels associated
with that genotype. Nonetheless, the clustering of nucleotide
polymorphisms identified so far suggests that this region of the
2 gene might harbor elements important in the regulation
of 2 expression.
2 allele genotyping using Bgl II/Nde
I restriction analysis.
We have developed a strategy to type individuals for each of the three
alleles using the polymorphic Bgl II and Nde I restriction sites described above. The region of intron G encompassing these sites
was amplified from genomic DNA as described in Materials and Methods,
and the resulting PCR products were digested with Bgl II or
Nde I. Analysis by agarose gel electrophoresis resulted in
clearly resolved patterns from which the genotype of individuals could
be readily determined (Fig 2). As seen in
panel A, the 600-bp PCR product amplified from individuals expressing
alleles 2 and/or 3 (lanes 5 and 6) or from the control sequence
(lane 7) remained undigested by Bgl II. The PCR product
produced from individuals homozygous for allele 1 (lanes 1 and 2) or
from the control sequence (lane 8) was completely digested by
Bgl II to produce fragments of 200 bp and 400 bp, whereas that
produced from individuals expressing allele 1 and either allele 2 or 3 yielded fragments of 200 bp, 400 bp, and 600 bp (lanes 3 and 4).

View larger version (43K):
[in this window]
[in a new window]
| Fig 2.
2 allele genotyping using Bgl
II/Nde I digestion. The region of the 2 gene
encompassing the Bgl II and Nde I sites was amplified
from genomic DNA as described in Materials and Methods. The 600-bp PCR
product was digested with Bgl II (A) or Nde I (B), and
the resulting products were analyzed by agarose gel electrophoresis.
Lanes 1 and 2, homozygous (allele 1); lane 3, heterozygous (allele 1, allele 3); lane 4, heterozygous (allele 1, allele 2); lanes 5 and 6, homozygous (allele 2); lane 7, control sequence 807C/837C/873G; lane 8, control sequence 807T/837T/873A; lane 9, molecular weight
(MW) Hind III/ X174Hae III; lane 10 (B only),
heterozygous (allele 2, allele 3). The 807, 837, and 873 designations
refer to the genotype as determined by Southern dot blot analysis of
genomic DNA.9 Size of MW markers (in bp) is indicated to
the right of the figure.
|
|
The same PCR products were digested with Nde I to permit
determination of allele 3. As seen in panel B, only those products generated from individuals carrying allele 3 or from the control sequence remained undigested by Nde I (lanes 3, 7, and 10). As none of the individuals screened were homozygous for allele 3, Nde
I in each case cuts some product (excluding the control sequence in
lane 7). Thus, we describe here a novel RFLP method for rapidly determining the 2 genotype at positions 807, 837, and
873 from genomic DNA. This technique therefore provides a simple method for discriminating among the three 2 gene alleles
described above.
Sequence analysis of intron G.
Sequence analysis of intron G has further revealed the presence of a
unique inverted repeat in this region (Fig 1). Separated by ~2.5 kb,
the inverted repeat sequences, which do not have significant homology
with sequences currently in the database, are 275 bp long, have the
potential to form a stem loop structure based on sequence analysis, and
are present in all of the gene alleles described above.
The rate of platelet adhesion to collagen at high shear rate
increases with increasing 2 1 receptor
density.
We compared the behavior of platelets from individuals homozygous for
allele 1 with those expressing only alleles 2 or 3 to assess the
influence of 2 1 receptor density on
adhesion to type I collagen. Whole blood was perfused over immobilized
type I collagen under high shear rate conditions (1,500/s). The results
from one representative comparison between an individual homozygous for allele 1 (807T) and an individual homozygous for allele 2 (807C) are
depicted in Fig 3. Coverage of the
collagen-coated surface increased over time with platelets from both
individuals, and by 3 minutes there was essentially no difference in
the total surface coverage between the two samples. However, the rate
at which platelet deposition occurred differed significantly between paired donor samples. The results from a comparison of three 807T and
three 807C donors are summarized in Fig 4.
In the case of the 807T donors, the rate of platelet attachment was
significantly faster, particularly within the first 2 minutes of
adhesion (Fig 4). Thus, at high shear rates in whole blood, the rate of
platelet attachment to type I collagen increases with increasing
density of 2 1.

View larger version (71K):
[in this window]
[in a new window]
| Fig 3.
Video microscopy of platlet attachment to human type I
collagen at high shear (1,500/s). Real-time epifluorescence video
microscopy showing the time courses of platelet adhesion in whole blood
to surface-bound solubilized human type I collagen at 1,500/s.
Single-frame images obtained during a typical comparison are depicted.
These data, derived from one donor pairwise analysis, are
representative of results obtained from six donors. Upper row: normal
donor, homozygous allele 1 (807T) genotype, High platelet
2 1 density; bottom row: normal donor,
homozygous allele 2 (807C) genotype, Low platelet
2 1 density. Time after initiation of
whole blood flow is shown above each column. Platelet
2 1 density was determined by flow
cytometry and is expressed as a normalized mean fluorescence intensity
(nMFI).9 The range of nMFI for 32 normal subjects is 1.0 to
9.4. In the experiment depicted here, the nMFI values for each donor
are: High, 9.2; Low, 2.2.
|
|

View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Time course of platelet adhesion to human type I collagen
at 1,500/s. Time course of platelet attachment to surface-bound
solubilized human type I collagen. The area (square microns) covered by
platelets is depicted on the ordinate as a function of time after
initiation of blood flow, in minutes (abscissa). The results of three
paired comparisons are shown (n = 3; mean ± SEM). ( )
High-density donors (mean nMFI = 6.5); ( ) low-density donors (mean
nMFI = 2.1). The levels of expression of
2 1 in high-density donors was threefold
that in low-density donors. Differences at 1.5, 2.0, and 2.5 minutes
are statistically significant (P < 0.01).
|
|
 |
DISCUSSION |
We have previously defined two linked, silent polymorphisms in the
2 gene that are associated with variable expression
levels of 2 1 on platelets and that define
two alleles of the 2 gene.9 In this report,
we describe the identification of five additional nucleotide
polymorphisms in the region surrounding bp 807 and 873. These
polymorphisms are linked to those previously described and to
expression levels of 2. Indeed, three 2
gene alleles, defined by eight nucleotide polymorphisms, have now been
confirmed.
It is not clear whether these sequence changes are themselves involved
in differential 2 expression or if they are merely physically linked to the region responsible for modulating
2 levels. Studies are currently underway to investigate
this question. In the discussion that follows, we describe several
possible mechanisms through which these exonic and/or intronic
polymorphisms might be linked to expression levels of the
2 1 integrin; other mechanisms are
certainly possible.
There are a number of ways in which DNA sequence alterations could
influence gene expression. For example, changes in specific promoter
elements could influence promoter activity, resulting in increased or
decreased mRNA levels. Expression of 2 1
in hematopoietic cells is restricted to megakaryocytes and
platelets.14 Zutter et al15 have shown that
induced expression of 2 1 during
megakaryocytic differentiation is due to transcriptional activation of
the 2 gene; no changes in the level of 1
mRNA expression were detected during megakaryocytic differentiation.
Approximately 5 kb of the 5 sequence flanking the
2 transcriptional start site has been cloned, and
regions critical for 2 expression have been
identified.16 Although a strong core promoter region
located in the first ~100 bp upstream of the transcriptional start
site was found to be necessary for gene activity, it was not found to
be cell-type specific. A silencer element located upstream of this
region (between 92 and 351) was found to function in
cells of hematopoietic lineage, and enhancer elements identified
further upstream (between 1426 and 2592) were found to be
megakaryocyte-specific and were required for high-level expression of
the 2 gene in megakaryocytic cells. In addition, a
number of sites for transcription factors and other regulatory
molecules have been identified in the region upstream of the
transcriptional start site. Sequence variations in these or other
regulatory elements could have a profound impact on expression levels
of 2.
In addition to promoter variations influencing gene expression, the
3 untranslated region (3 UTR) of 2, which
is approximately 5 kb, might modulate protein expression;
3 untranslated regions have been shown to influence mRNA
stability as well as message translation.17 It is also
possible that the polymorphisms at bp 807 and 873 are directly related
to allelic differences in 2 expression. Modulation of
expression levels by sequences within the coding region of RNA has been
described previously.18-20 Differences in intragenic
sequences could also influence 2 gene expression. There
are numerous reports of enhancer or repressor elements located in
intronic sequences.21-23 Indeed, the fact that the
polymorphisms so far identified are clustered in one region of the
2 gene suggests that this region might harbor critical
control elements involved in the regulation of 2
expression.
In whole blood, under a broad range of shear rates (50 to 1,500/s),
2 1 mediates the initial phase of
stabilized platelet adhesion to collagen that will lead to accelerated
prothrombin conversion on the platelet surface and thrombus formation
supported by the integrin
IIb 3.24-26 However, even when
the function of IIb 3 is completely
inhibited and thrombus formation is blocked,
2 1-mediated adhesion itself still induces
the cellular changes that catalyze prothrombin conversion to the same
extent as one would otherwise see in the absence of inhibitors.26 Consequently,
2 1 has the potential to play a major role
in platelet function in vivo both as a primary mediator of adhesion to
collagen and as a primary stimulus for prothrombin conversion at the
platelet surface.
As shown here, the density of platelet 2 1
has an important impact on platelet adhesion to collagen in whole blood
even under conditions of high shear rate (1,500/s), such that the rate
of adhesion to type I collagen increases with increasing receptor density. This stage of adhesion, occurring between 30 seconds and 3 minutes, is likely to be a critical period of thrombus formation in
vivo, because there are many compensatory antithrombotic mechanisms that would come into play to inhibit thrombus expansion or to dissociate the nascent thrombus. Within 3 to 5 minutes, a sufficient number of stimuli have been received, regardless of
2 1 density, and mature thrombi begin to
cover the collagen surface. The expansion of the initial platelet
clusters to form larger thrombi is certainly mediated by the binding of
integrin IIb 3, because macroaggregate formation (but not surface attachment) is inhibited by monoclonal antibodies specific for that integrin.
The expression of 2 1 by platelets is
critical in promoting platelet adhesion to the subendothelium; adhesion
of platelets to collagen is critical for normal platelet activity, in
hemostasis, and in wound repair. Hereditary variation in platelet
levels of 2 1, defined by the existence of
multiple alleles of the 2 gene that are associated with
variable 2 1 expression levels, could therefore have a significant impact on platelet function, contributing to an increased risk of thrombosis or bleeding in relevant disease states.
 |
FOOTNOTES |
Submitted December 31, 1997;
accepted June 2, 1998.
Supported by a grant from the Gustavus and Louise Pfeiffer Research
Foundation (Denville, NJ) awarded to T.J.K. and NHLBI grants HL-31950
and HL-42846 awarded to Z.M.R. This is manuscript number 11124-MEM from
The Scripps Research Institute.
Address reprint requests to Thomas J. Kunicki, PhD, Associate
Professor, Department of Molecular and Experimental Medicine, The
Scripps Research Institute, 10666 N Torrey Pines Rd, Maildrop SBR13, La
Jolla, CA 92037.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
REFERENCES |
1.
Hynes RO:
Integrins: Versatility, modulation, and signaling in cell adhesion.
Cell
69:11,
1992[Medline]
[Order article via Infotrieve]
2.
Pischel KD,
Bluestein HG,
Woods VL:
Platelet glycoprotein Ia,Ic, and IIa are physicochemically indistinguishable from the very late activation antigens adhesion-related proteins of lymphocytes and other cell types.
J Clin Invest
81:505,
1988
3.
Takada Y,
Wayner EA,
Carter WG,
Hemler ME:
Extracellular matrix receptors, ECMRII and ECMRI, for collagen and fibronectin correspond to VLA-2 and VLA-3 in the VLA family of heterodimers.
J Cell Biochem
37:385,
1988[Medline]
[Order article via Infotrieve]
4.
Kunicki TJ,
Nugent DJ,
Staats SJ,
Orchekowski RP,
Wayner EA,
Carter WG:
The human fibroblast class II extracellular matrix receptor mediates platelet adhesion to collagen and is identical to the platelet glycoprotein Ia-IIa complex.
J Biol Chem
263:4516,
1988[Abstract/Free Full Text]
5.
Zutter MM,
Santoro SA:
Widespread histologic distribution of the 2 1 integrin cell-surface collagen receptor.
Am J Pathol
137:113,
1990[Abstract]
6.
Elices MJ,
Hemler ME:
The human integrin VLA-2 is a collagen receptor on some cells and a collagen/laminin receptor on others.
Proc Natl Acad Sci USA
86:9906,
1990
7.
Kirchhofer D,
Languino LR,
Ruoslahti E,
Pierschbacher MD:
2 1 integrins from different cell types show different binding specificities.
J Biol Chem
265:615,
1990[Abstract/Free Full Text]
8.
Kunicki TJ,
Orchekowski R,
Annis D,
Honda Y:
Variability of integrin alpha 2 beta 1activity on human platelets.
Blood
82:2693,
1993[Abstract/Free Full Text]
9.
Kunicki TJ,
Kritzik M,
Annis DS,
Nugent DJ:
Hereditary variation in platelet integrin 2 1 copy number is associated with two silent polymorphisms in the 2 gene coding sequence.
Blood
89:1939,
1997[Abstract/Free Full Text]
10.
Kalb R,
Santoso S,
Unkelbach K,
Kiefel V,
Mueller-Eckhardt C:
Localization of the Br polymorphism on a 144 bp Exon of the GPIa gene and its application in platelet DNA typing.
Thromb Haemost
71:651,
1994[Medline]
[Order article via Infotrieve]
11.
Usami S,
Chen HH,
Zhao Y,
Chien S,
Skalak R:
Design and construction of a linear shear stress flow chamber.
Ann Biomed Eng
21:77,
1993[Medline]
[Order article via Infotrieve]
12.
Savage B,
Saldivar E,
Ruggeri ZM:
Initiation of platelet adhesion by arrest onto fibrinogen or translocation on von Willebrand factor.
Cell
84:289,
1996[Medline]
[Order article via Infotrieve]
13.
Dise CA,
Burch JW,
Goodman DBP:
Direct interaction of mepacrine with erythrocyte and platelet membrane phospholipid.
J Biol Chem
257:4701,
1982[Abstract/Free Full Text]
14.
Santoro SA,
Zutter MM:
The 2 1 integrin: A collagen receptor on platelets and other cells.
Thromb Haemost
74:813,
1995[Medline]
[Order article via Infotrieve]
15.
Zutter MM,
Fong AM,
Krigman HR,
Santoro SA:
Differential regulation of the 2 1 and IIb 3 integrin genes during megakaryocytic differentiation of pluripotential K562 cells.
J Biol Chem
267:20233,
1992[Abstract/Free Full Text]
16.
Zutter MM,
Painter AA,
Staatz WD,
Tsung YL:
Regulation of 2 integrin gene expression in cells with megakaryocytic features: A common theme of three necessary elements.
Blood
86:3006,
1995[Abstract/Free Full Text]
17.
Jackson RJ:
Cytoplasmic regulation of mRNA function: The importance of the 3 untranslated region.
Cell
74:9,
1993[Medline]
[Order article via Infotrieve]
18.
Burstein KL,
Jewell CM,
Sar M,
Cidlowski JA:
Intragenic sequences of the human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor messenger RNA down-regulation through multiple mechanisms.
Mol Endocrinol
8:1764,
1994[Abstract/Free Full Text]
19.
Kaludov NK,
Pabon-Pena L,
Hurt MM:
Identification of a second conserved element within the coding sequence of a mouse H3 histone gene that interacts with nuclear factors and is necessary for normal expression.
Nucleic Acids Res
24:523,
1996[Abstract/Free Full Text]
20.
Beattie DT,
Mahan MJ,
Mekalanos JJ:
Repressor binding to a regulatory site in the DNA coding sequence is sufficient to confer transcriptional regulation of the vir-repressed genes (vrg genes) in Bordetella pertussis.
J Bacteriol
175:519,
1993[Abstract/Free Full Text]
21.
Ottavio L,
Chang C-D,
Rizzo M-G,
Travali S,
Casadevall C,
Baerga R:
Importance of introns in the growth regulation of mRNA levels of the proliferating cell nuclear antigen gene.
Mol Cell Biol
10:303,
1990[Abstract/Free Full Text]
22.
Frenkel B,
Montecino M,
Stein JL,
Lian JB,
Stein GS:
A composite intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: Promoter and cell type requirements.
Proc Natl Acad Sci USA
91:10923,
1994[Abstract/Free Full Text]
23.
Jeffers M,
Pellicer A:
Multiple intragenic elements regulate the expression of the murine N-ras gene.
Oncogene
7:2115,
1992[Medline]
[Order article via Infotrieve]
24.
Coller BS,
Beer JH,
Scudder LE,
Steinberg MH:
Collagen-platelet interactions: Evidence for a direct interaction of collagen with platelet GPIa/IIa and an indirect interaction with platelet GPIIb/IIIa mediated by adhesive proteins.
Blood
74:182,
1989[Abstract/Free Full Text]
25.
Savage B,
Marzec UM,
Chao BH,
Harker LA,
Maraganore JM,
Ruggeri ZM:
Binding of the snake venom-derived proteins applaggin and echistatin to the arginine-glycine-aspartic acid recognition site(s) on platelet glycoprotein IIb.IIIa complex inhibits receptor function.
J Biol Chem
265:11766,
1990[Abstract/Free Full Text]
26.
Kirchhofer D,
Tschopp TB,
Steiner B,
Baumgartner HR:
Role of collagen-adherent platelets in mediating fibrin formation in flowing whole blood.
Blood
86:3815,
1995[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Yamamoto, Y. Nagasawa, T. Shoji, K. Inoue, T. Uehata, T. Kaneko, T. Okada, A. Yamauchi, Y. Tsubakihara, E. Imai, et al.
A candidate gene approach to genetic prognostic factors of IgA nephropathy--a result of Polymorphism REsearch to DIstinguish genetic factors Contributing To progression of IgA Nephropathy (PREDICT-IgAN)
Nephrol. Dial. Transplant.,
December 1, 2009;
24(12):
3686 - 3694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rivera, M. L. Lozano, L. Navarro-Nunez, and V. Vicente
Platelet receptors and signaling in the dynamics of thrombus formation
Haematologica,
May 1, 2009;
94(5):
700 - 711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Miller, S. Basra, D. W. Kulp, P. C. Billings, S. Choi, M. P. Beavers, O. J. T. McCarty, Z. Zou, M. L. Kahn, J. S. Bennett, et al.
Small-molecule inhibitors of integrin {alpha}2{beta}1 that prevent pathological thrombus formation via an allosteric mechanism
PNAS,
January 20, 2009;
106(3):
719 - 724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Herrera-Galeano, D. M. Becker, A. F. Wilson, L. R. Yanek, P. Bray, D. Vaidya, N. Faraday, and L. C. Becker
A Novel Variant in the Platelet Endothelial Aggregation Receptor-1 Gene Is Associated With Increased Platelet Aggregability
Arterioscler Thromb Vasc Biol,
August 1, 2008;
28(8):
1484 - 1490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. M. Ruggeri and G. L. Mendolicchio
Adhesion Mechanisms in Platelet Function
Circ. Res.,
June 22, 2007;
100(12):
1673 - 1685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lim, S. Carballo, J. Cornelissen, Z. A. Ali, R. Grignani, S. Bellm, and S. Large
Dose-Related Efficacy of Aspirin After Coronary Surgery in Patients With PlA2 Polymorphism (NCT00262275)
Ann. Thorac. Surg.,
January 1, 2007;
83(1):
134 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Okumus, E. Kiyan, O. Arseven, L. Tabak, E. K. Bayrak, N. E. Unaltuna, and H. Issever
Platelet Glycoprotein Ia 807c/T and 873g/A Polymorphisms in Patients With Venous Thromboembolism
Clinical and Applied Thrombosis/Hemostasis,
January 1, 2007;
13(1):
101 - 103.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cheli and T. J. Kunicki
hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1
Blood,
June 1, 2006;
107(11):
4391 - 4398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. V. Vijayan and P. F. Bray
Molecular Mechanisms of Prothrombotic Risk Due to Genetic Variations in Platelet Genes: Enhanced Outside-In Signaling Through the Pro33 Variant of Integrin {beta}3.
Experimental Biology and Medicine,
May 1, 2006;
231(5):
505 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ogino, J. Kido, M. Bando, N. Hayashi, C. Wada, T. Nagata, F. Nishimura, Y. Soga, S. Takashiba, T. Kubota, et al.
{alpha}2 Integrin +807 Polymorphism in Drug-induced Gingival Overgrowth
Journal of Dental Research,
December 1, 2005;
84(12):
1183 - 1186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ajzenberg, C. Berroeta, I. Philip, B. Grandchamp, P. Ducellier, V. Huart, P. Verpillat, M.-C. Guillin, and J. Benessiano
Association of the -92C/G and 807C/T Polymorphisms of the {alpha}2 Subunit Gene With Human Platelets {alpha}2{beta}1 Receptor Density
Arterioscler Thromb Vasc Biol,
August 1, 2005;
25(8):
1756 - 1760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mikkelsson, M. Perola, and P. J. Karhunen
Genetics of Platelet Glycoprotein Receptors: Risk of Thrombotic Events and Pharmacogenetic Implications
Clinical and Applied Thrombosis/Hemostasis,
April 1, 2005;
11(2):
113 - 125.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Stratmann and D. Tschoepe
Pathobiology and cell interactions of platelets in diabetes
Diabetes and Vascular Disease Research,
February 1, 2005;
2(1):
16 - 23.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cattaneo
Aspirin and Clopidogrel: Efficacy, Safety, and the Issue of Drug Resistance
Arterioscler Thromb Vasc Biol,
November 1, 2004;
24(11):
1980 - 1987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kunicki, A. B. Federici, D. R. Salomon, J. A. Koziol, S. R. Head, T. S. Mondala, J. D. Chismar, L. Baronciani, M. T. Canciani, and I. R. Peake
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees
Blood,
October 15, 2004;
104(8):
2359 - 2367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kunicki
Of men; why not mice?
Blood,
May 1, 2004;
103(9):
3251 - 3252.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.-T. Li, S. Larrucea, S. Souza, S. M. Leal, J. A. Lopez, E. M. Rubin, B. Nieswandt, and P. F. Bray
Genetic variation responsible for mouse strain differences in integrin {alpha}2 expression is associated with altered platelet responses to collagen
Blood,
May 1, 2004;
103(9):
3396 - 3402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lepantalo, K. S Virtanen, J. Heikkila, U. Wartiovaara, and R. Lassila
Limited early antiplatelet effect of 300 mg clopidogrel in patients with aspirin therapy undergoing percutaneous coronary interventions
Eur. Heart J.,
March 2, 2004;
25(6):
476 - 483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gruner, M. Prostredna, V. Schulte, T. Krieg, B. Eckes, C. Brakebusch, and B. Nieswandt
Multiple integrin-ligand interactions synergize in shear-resistant platelet adhesion at sites of arterial injury in vivo
Blood,
December 1, 2003;
102(12):
4021 - 4027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. He, L. K. Pappan, D. G. Grenache, Z. Li, D. M. Tollefsen, S. A. Santoro, and M. M. Zutter
The contributions of the {alpha}2{beta}1 integrin to vascular thrombosis in vivo
Blood,
November 15, 2003;
102(10):
3652 - 3657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Grenache, T. Coleman, C. F. Semenkovich, S. A. Santoro, and M. M. Zutter
{alpha}2{beta}1 Integrin and Development of Atherosclerosis in a Mouse Model: Assessment of Risk
Arterioscler Thromb Vasc Biol,
November 1, 2003;
23(11):
2104 - 2109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Best, Y. A. Senis, G. E. Jarvis, H. J. Eagleton, D. J. Roberts, T. Saito, S. M. Jung, M. Moroi, P. Harrison, F. R. Green, et al.
GPVI levels in platelets: relationship to platelet function at high shear
Blood,
October 15, 2003;
102(8):
2811 - 2818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Dupont, P. Fontana, C. Bachelot-Loza, J.-L. Reny, I. Bieche, F. Desvard, M. Aiach, and P. Gaussem
An intronic polymorphism in the PAR-1 gene is associated with platelet receptor density and the response to SFLLRN
Blood,
March 1, 2003;
101(5):
1833 - 1840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, T. G. Diacovo, D. G. Grenache, S. A. Santoro, and M. M. Zutter
The {alpha}2 Integrin Subunit-Deficient Mouse : A Multifaceted Phenotype Including Defects of Branching Morphogenesis and Hemostasis
Am. J. Pathol.,
July 1, 2002;
161(1):
337 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Maeno, H. Koyama, H. Tahara, M. Komatsu, M. Emoto, T. Shoji, M. Inaba, T. Miki, Y. Okuno, and Y. Nishizawa
The 807T Allele in {alpha}2 Integrin Is Protective Against Atherosclerotic Arterial Wall Thickening and the Occurrence of Plaque in Patients With Type 2 Diabetes
Diabetes,
May 1, 2002;
51(5):
1523 - 1528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Benze, J. Heinrich, H. Schulte, S. Rust, U. Nowak-Gottl, M.-C. Tataru, E. Kohler, G. Assmann, and R. Junker
Association of the GPIa C807T and GPIIIa PlA1/A2 polymorphisms with premature myocardial infarction in men
Eur. Heart J.,
February 2, 2002;
23(4):
325 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler Thromb Vasc Biol,
January 1, 2002;
22(1):
14 - 20.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cadroy, K. S. Sakariassen, J.-P. Charlet, C. Thalamas, B. Boneu, and P. Sie
Role of 4 platelet membrane glycoprotein polymorphisms on experimental arterial thrombus formation in men
Blood,
November 15, 2001;
98(10):
3159 - 3161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. P. Agema, J. W. Jukema, S. N. Pimstone, and J. J. P. Kastelein
Genetic aspects of restenosis after percutaneous coronary interventions;towards more tailored therapy
Eur. Heart J.,
November 2, 2001;
22(22):
2058 - 2074.
[PDF]
|
 |
|

|
 |

|
 |
 
K. Furihata, K. J. Clemetson, H. Deguchi, and T. J. Kunicki
Variation in Human Platelet Glycoprotein VI Content Modulates Glycoprotein VI-Specific Prothrombinase Activity
Arterioscler Thromb Vasc Biol,
November 1, 2001;
21(11):
1857 - 1863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Williams and P. F. Bray
Genetics of Arterial Prothrombotic Risk States
Experimental Biology and Medicine,
May 1, 2001;
226(5):
409 - 419.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Jacquelin, M. D. Tarantino, M. Kritzik, D. Rozenshteyn, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Allele-dependent transcriptional regulation of the human integrin {alpha}2 gene
Blood,
March 15, 2001;
97(6):
1721 - 1726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Roest, J. D. Banga, D. E. Grobbee, P. G. de Groot, J. J. Sixma, M. J. Tempelman, and Y. T. van der Schouw
Homozygosity for 807 T Polymorphism in {alpha}2 Subunit of Platelet {alpha}2{beta}1 Is Associated With Increased Risk of Cardiovascular Mortality in High-Risk Women
Circulation,
October 3, 2000;
102(14):
1645 - 1650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Meisel, I. Cascorbi, A. Herrmann, I. Roots, M. Laule, V. Stangl, and K. Stangl
The platelet glycoprotein Ia C807T polymorphism as risk factor for coronary catheter interventions.
Blood,
September 1, 2000;
96(5):
2002 - 2003.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Roest, J. J. Sixma, Y.-P. Wu, M. J. W. Ijsseldijk, M. Tempelman, P. J. Slootweg, P. G. de Groot, and G. H. van Zanten
Platelet adhesion to collagen in healthy volunteers is influenced by variation of both alpha 2beta 1 density and von Willebrand factor
Blood,
August 15, 2000;
96(4):
1433 - 1437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. von Beckerath, W. Koch, J. Mehilli, C. Bottiger, A. Schomig, and A. Kastrati
Glycoprotein Ia gene C807T polymorphism and risk for major adverse cardiac events within the first 30 days after coronary artery stenting
Blood,
June 1, 2000;
95(11):
3297 - 3301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jung and M. Moroi
Signal-transducing Mechanisms Involved in Activation of the Platelet Collagen Receptor Integrin alpha 2beta 1
J. Biol. Chem.,
March 10, 2000;
275(11):
8016 - 8026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Matsubara, M. Murata, T. Maruyama, M. Handa, N. Yamagata, G. Watanabe, T. Saruta, and Y. Ikeda
Association between diabetic retinopathy and genetic variations in alpha 2beta 1 integrin, a platelet receptor for collagen
Blood,
March 1, 2000;
95(5):
1560 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Bussel, T. J. Kunicki, and A. D. Michelson
Platelets: New Understanding of Platelet Glycoproteins and Their Role in Disease
Hematology,
January 1, 2000;
2000(1):
222 - 240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Santoso, J. Amrhein, H. A. Hofmann, U. J.H. Sachs, M. M. Walka, H. Kroll, and V. Kiefel
A Point Mutation Thr799Met on the alpha 2 Integrin Leads to the Formation of New Human Platelet Alloantigen Sita and Affects Collagen-Induced Aggregation
Blood,
December 15, 1999;
94(12):
4103 - 4111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Santoro
Platelet Surface Collagen Receptor Polymorphisms: Variable Receptor Expression and Thrombotic/Hemorrhagic Risk
Blood,
June 1, 1999;
93(11):
3575 - 3577.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Di Paola, A. B. Federici, P.M. Mannucci, M. T. Canciani, M. Kritzik, T. J. Kunicki, and D. Nugent
Low Platelet alpha 2beta 1 Levels in Type I von Willebrand Disease Correlate With Impaired Platelet Function in a High Shear Stress System
Blood,
June 1, 1999;
93(11):
3578 - 3582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Carlsson, S. Santoso, C. Spitzer, C. Kessler, and A. Greinacher
The alpha 2 Gene Coding Sequence T807/A873 of the Platelet Collagen Receptor Integrin alpha 2beta 1 Might Be a Genetic Risk Factor for the Development of Stroke in Younger Patients
Blood,
June 1, 1999;
93(11):
3583 - 3586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Santoso, T.J. Kunicki, H. Kroll, W. Haberbosch, and A. Gardemann
Association of the Platelet Glycoprotein Ia C807T Gene Polymorphism With Nonfatal Myocardial Infarction in Younger Patients
Blood,
April 15, 1999;
93(8):
2449 - 2453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Jacquelin, D. Rozenshteyn, S. Kanaji, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Characterization of Inherited Differences in Transcription of the Human Integrin alpha 2 Gene
J. Biol. Chem.,
June 22, 2001;
276(26):
23518 - 23524.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|