|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 7 (October 1), 1998:
pp. 2399-2409
Distinct Regulatory Mechanisms for Interferon- /
(IFN-/)- and IFN- -Mediated Induction of Ly-6E Gene in B
Cells
By
Mehran M. Khodadoust,
Khuda Dad Khan,
Eun-ha Park, and
Alfred L.M. Bothwell
From the Section of Immunobiology, Yale University School of
Medicine, New Haven, CT; and the Department of Medicine, Division of
Hematology and Oncology, Duke University Medical Center, Durham, NC.
 |
ABSTRACT |
The murine Ly6-E gene is transcriptionally induced by
interferon- / (IFN-/) and IFN- in a variety of distinct
cell types. The mechanism of IFN inducibility in B-cell lines was
investigated by deletion analysis of the promoter and by identifying
DNA binding proteins in mobility shift assays. A region located in the
distal part of the promoter at  2.3 kb contributed to inducibility by both types of IFNs. This region contains a novel element in addition to
the previously well-characterized IFN-stimulated response element (ISRE). The probes containing ISRE detected IFN-inducible complexes in
mobility shift assays and the signal transducer and activator of
transcripition-1 was found to be in these complexes
from cells treated with either type of IFN. An additional element
present in the proximal part of the promoter at position 109 is also required for IFN-/-mediated induction. These data suggested a
cooperative interaction between these physically disparate regulatory regions. A crucial role for HMGI(Y) protein in this cooperative multiprotein complex is supported by the evidence that inhibition of
HMGI(Y) expression via antisense RNA results in the loss of IFN-/-mediated induction of the Ly6-E gene. These results show the complexity involved in achieving cell-type specificity in IFN-mediated gene regulation.
| |
INTRODUCTION |
INTERFERONS (IFNs) ARE a heterogenous
family of cytokines which regulate a number of cellular functions
including antiviral, antiproliferative, and immunoregulatory
activities. Most of these activities are accomplished by the products
of genes that are transcriptionally activated by IFNs.1 The
study of the mechanism of activation of IFN-inducible genes has led to
the dramatic discovery of the JAK-STAT pathway involved in signal
transduction pathways of numerous cytokines and growth factors. The
latent transcription factors termed "signal transducers and
activators of transcription" (STATs) preexist in the
cytoplasm2 and on stimulation with IFN they are activated
by tyrosine phosphorylation catalyzed by Janus kinases
(JAK).3 On activation they multimerize and translocate to
the nucleus where they bind to the target DNA sequences and enhance the
transcription of regulated genes.2
Two of the best characterized regulatory elements are IFN-stimulated
response element (ISRE)4 and IFN- activation site (GAS).5 IFN-/ induces the formation of ISGF3 complex
which binds ISRE and is composed of three subunits: STAT1, STAT2, and a
48-kD DNA binding protein (ISGF3). IFN- treatment leads to the
formation of -activated factor (GAF) that binds to the GAS element
and is responsible for the upregulation of the IFN--inducible primary response genes. This response occurs within minutes and without
synthesis of intermediate signaling molecules. GAF is formed by the
dimerization of STAT1 subunits via SH2 domain-phosphotyrosine interactions.6 ISRE has been shown to be essential for
responsiveness to IFN-/2 but for certain genes such
as major histocompatibility complex (MHC) class I7 and
Ig light chain,8 the response to IFN- is also
mediated by an ISRE. An IFN--inducible complex containing STAT1
homodimers and p48 (ISGF3) has been shown to bind ISRE.9
Immunoregulatory functions of IFNs include induction of various
cell surface molecules crucial for cell-to-cell interactions, eg, MHC
class I and class II molecules. In addition to the essential interaction between antigen receptors on T lymphocytes and MHC molecules on antigen presenting cells, a number of accessory molecules are also required for T-cell activation. Among these accessory molecules expressed on T cells is the Ly-6A/E antigen, a member of a
murine multigene family. The Ly-6-encoded proteins are anchored on the
cell surface via a carboxyterminal phosphatidylinositol moiety10 and various members are expressed at crucial times during hematopoiesis and immune responses. The Ly-6A/E is one of the
best characterized markers for the hematopoietic pluripotent stem cells
in fetal and adult mice.11
Given their suspected important roles in leukocyte development, it was
reasonable to expect human homologues of some of these molecules. In
fact, recently the E48 gene homologous to mouse ThB
antigen12 and the 9804 gene homologous to mouse
differentiation antigen TSA-1/Sca-213 were characterized
and found to be localized on human chromosome 8, the syntenic locus of
mouse chromosome 15, where the murine Ly-6 genes have been
mapped.14 Like some of their murine counterparts, the 9804 gene is also responsive to IFNs.13 Interestingly, this gene
is also inducible by retinoic acid during differentiation of acute
promyelocytic leukemia cells.15
The Ly-6E antigen is found to be associated with tyrosine kinases in T
cells16 and reduced expression of Ly-6E via antisense RNA
in a T-cell clone causes impairment of functional responses as well as
the inhibition of enzymatic activity of fyn tyrosine kinase.17 Interaction of Ly-6E with tyrosine kinases
provides an explanation for signal transduction properties of these
molecules in lymphocytes. Cross-linking of the Ly-6E molecules on
murine B lymphocytes causes a marked increase in the concentration of intracellular free calcium in the absence of phosphatidylinositol turnover. This rise in calcium, in the presence of a costimulator like
interleukin-4, IFN-,18 or protein kinase C activator
phorbol myristate acetate,19 provides a signal for
Ly-6E-mediated B-cell proliferation.
Because IFNs are the principal physiological inducers of the Ly-6E
gene, we have been studying the underlying molecular mechanism. We
previously characterized a GAS element necessary for IFN-/- and
IFN--mediated induction in fibroblasts.20,21 Almost all of the studies which have characterized the IFN signal transduction pathway have been performed in fibroblast and epithelial cell lines.
Although the general biological effects of IFNs are quite similar,
several observations suggest some important differences in the
mechanism of gene activation by IFNs in different cell types. In some
cell lines the IFN-mediated induction of certain genes is a primary
response without the need for ongoing protein synthesis,22
whereas an intermediate protein(s) needs to be synthesized for the
induction of the same genes in other cell types.23
Furthermore, the sizes of proteins isolated from myeloid and lymphoid
cells that bind to the same ISRE were different.24 Unlike
fibroblasts, the analysis of Ly-6E gene expression in the B-cell line
A20-2J by Northern blots showed very delayed kinetics of induction by
IFNs. Moreover, a genomic construct lacking the GAS site of the Ly-6E
promoter was inducible by IFNs in this cell line.25 These
results suggested that distinct regulatory elements of the Ly-6E
promoter mediate IFN responsiveness in this cell line.
To define these elements we used a combination of genomic deletions and
a reporter gene linked to various fragments of the Ly-6E promoter. This
analysis has identified a 56-bp regulatory region located at 2.3
kb that contains a functional ISRE and an additional novel element
necessary for the IFN- responsiveness in A20-2J cells. This region
binds IFN-/- and IFN--inducible complexes which contain
STAT1. However, for IFN-/ inducibility an additional element
located in the proximal part of the promoter at position 109 is
also required. One interpretation of these results is that a
cooperative interaction between the protein complexes binding to these
physically disparate regions is required for IFN-mediated induction of
Ly-6E gene in B cells. The supportive evidence for the assembly of such
a multiprotein complex promoted by the HMGI(Y) protein is provided by
the direct binding of HMGI(Y) to one of the regulatory sequences and by
the lack of IFN-/ inducibility after inhibition of HMGI(Y)
expression accomplished by antisense RNA. In summary, distinct
regulatory mechanisms exist for the IFN-/- and IFN--mediated
induction of Ly-6E gene in B cells.
| |
MATERIALS AND METHODS |
Cell lines.
A20-2J and BALB/3T3 cells were obtained from the American Type Culture
Collection (Rockville, MD). Murine B lymphoma (A20-2J) and fibroblast
(BALB3T3) cell lines were grown in Dulbecco's modified Eagle's medium
(DMEM) supplemented with 10% fetal calf serum.
Cytokines.
Recombinant murine IFN- was purchased from GIBCO-BRL (Gaithersburg,
MD). Recombinant murine IFN-/ was provided by LEE Biomolecular (San Diego, CA).
Stable transfections.
Stable transfection was achieved by cotransfection with 20 µg of the
test plasmid and 2 µg of the pSV2neo plasmid. Approximately 2 × 107 cells in phosphate-buffered saline (PBS) containing 2 mmol/L -mercaptoethanol were electroporated at 320 V and 960 microfarads with a Bio-Rad Gene pulser (Hercules, CA). The
cells were then plated in DMEM containing 10% fetal bovine serum.
After 36 to 48 hours the cells were collected, counted, and replated in
fresh medium containing 3 mg/mL G418 in 96-well culture plates at a density of 104 per well. After 2 weeks individual
transfectants could be expanded for analysis.
Transient transfections.
Cells (3 × 106) were obtained and resuspended in 1 mL
serum-free DMEM with 10 mmol/L HEPES, pH 7.4. DNA (10 µg),
DEAE-Dextran (250 µg/mL), and chloroquine (0.1 mmol/L) were added to
the cells. After incubation at 37°C for 30 minutes the cells were
washed twice with serum-free DMEM containing HEPES. The cells were
resuspended in 10 mL complete DMEM and split into two separate flasks,
one for a control and the other for treatment with IFN. Cells treated with IFN- received 500 U/mL of IFN 20 hours after the transfection was initiated and assays were performed after 48 hours. Assays for chloramphenicol acetyl transferase (CAT) activity were
as previously described.21 For luciferase assays the cells
were collected by centrifugation and rinsed twice in PBS. The cell pellets were resuspended in 400 µL of 1× Lysis Reagent
(Luciferase Assay System; Promega Corp, Madison, WI) and the suspension
was incubated at room temperature for 15 minutes. The lysate was
centrifuged for 1 minute in a microfuge to pellet cell debris. After
measurement of protein concentration by Bradford assay, appropriate
aliquots of the cell lysate were mixed with 100 µL of the luciferase
substrate at room temperature and activity measured in a luminometer.
DNA mobility shift assays (DMSA).
DMSA were performed with nuclear extracts prepared as described
(Khodadoust and Bothwell, submitted). Probes were prepared using
synthetic oligonucleotides or restriction fragments and end labeled
with 32P using Klenow DNA polymerase. Desired fragments
were gel purified on an 8% nondenaturing polyacrylamide gel and eluted
by soaking in Tris EDTA (TE) buffer. Nuclear extract
(protein concentration, ~2 µg/µL) was incubated with the probe in
the presence of 1 µg of nonspecific competitor poly
(dI.dC):poly(dI.dC) duplex in a 10-µL binding reaction. The binding
buffer was 20 mmol/L HEPES (pH 7.9), 4% ficoll, 1 mmol/L
MgCl2, 40 mmol/L KCl, 0.1 mmol/L EGTA, and 0.5 mmol/L
dithiothreitol (DTT). Bound complexes were separated from
free probe by electrophoresis for 2 hours at 180 V on a 4%
nondenaturing polyacrylamide gel in 0.25× Tris-borate EDTA (TBE)
buffer and identified by autoradiography. The sequences of
the duplex oligonucleotides used for competition were as follows (consensus sequences are underlined): for the high-affinity
sis-inducible factor binding element (SIE), 5
GTCGACATTTCCCGTAAATC
3 26; for the ISRE element (O15), 5
GATCCTTCAGTTTCGGTTTCCCT 3 27; for the G
element, 5 AAGCTTCTGCTC
AGAATTTATGCATATTCCTGTAAGTGAGATCT3 (Khodadoust and Bothwell,
submitted). Bacterially derived rhuHMG-I was a gift from Dr Nancy
Ruddle (Yale University). Binding assays involving
rhuHMG-I consisted of about 15 ng of purified protein, 0.5 µg of Poly
(dG-dC), and 1.25 µg of acetylated bovine serum albumin. In some
experiments nuclear extracts were incubated with anti-STAT1 or
anti-STAT3 sera for 120 minutes at 4°C before addition to the
binding reactions.
Antibodies.
Anti-STAT1 and anti-STAT3 peptide polyclonal antibodies were from Santa
Cruz Biotechnology (Santa Cruz, CA).
Cytofluorometric analysis.
Transfected cells were analyzed for surface expression of Ly-6A by
immunofluorescence using a FACSscan (Becton Dickinson, Mountain View,
CA). Monoclonal antibody (MoAb) 34-11-3 recognizes Ly-6A antigen and
MoAb SK70.94 recognizes Ly-6E antigen. Binding was detected with
fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse
secondary antibody.
Intact gene deletion constructs.
The intact gene described in Khan et al20 was the parent
construct for six deletions made in the 5 flanking region with enzymes that cleaved the construct only once. Thus a double digest followed by religation was used to generate the following constructs diagrammed in Fig 1: Ly-6A/E.3,
KpnI + AvaI produces a 850-bp deletion;
Ly-6A/E.2, SpeI + KpnI produces a 1,150-bp deletion; Ly-6A/E.1, SpeI + AvaI produces a 2,000-bp deletion;
Ly-6A/E.19, SpeI + ApaI produces a 379-bp deletion;
Ly-6A/E.18, ApaI + BstEII produces a 387-bp deletion;
and Ly-6A/E.20, BstEII + KpnI produces a 383-bp
deletion.
View larger version (10K):
[in this window]
[in a new window]
| Fig 1.
Schematic representation of genomic deletion constructs
used to define the IFN responsive region in the 3.2-kb 5
flanking sequence of the Ly-6E gene. The map shows the intact gene
coding for the Ly-6A antigen that was present in all these constructs.
The region between the two PstI sites is the PstI
fragment used for further subcloning. Restriction sites in the map are
abbreviated as follows: H, HindIII; S, SpeI; Ap,
ApaI; Ps, PstI; Bs, BstEII; K, KpnI; Av,
AvaI; R, EcoRI.
|
|
Reporter constructs.
Construction of Ly-6E-CAT plasmids, which are derivatives of pUC-CAT
and contain deletions of the Ly-6E promoter, was described previously.20 The TKCAT construct was obtained from B.M.
Peterlin28 and the pTKLuxbu+ was obtained from
J. Hambor (unpublished) and incorporated in the study by Gao and
Kavathas.29 Both contain the basal
thymidine kinase promoter linked to the reporter gene. Tri-TKCAT was
derived by subcloning a DNA fragment containing the trimer
sequence20 into the HindIII-XbaI sites of
the polylinker of TKCAT upstream of the TK promoter. Five constructs
were made by polymerase chain reaction (PCR) using the HaeIII
(150) pTKLuxbu+ as template. The PCR products were cloned
directly into HindIII-BglII of
pTKLuxbu+. All five constructs had the same 5 primer
and differed by the following 3 primers: 5 wildtype+Xho
CTCAAGCTTAGGTTTCTGTTTCCCCTCGAGAGAACTCT, 3 + B TCTAGATCTTAGGGGGATTCCAAGTG, 3 B
TCTAGATCTAAGTGTATCAGGTAGTTG, 3 GMb*
TCTAGATCTAGGGGGATTCCAAGTGTATGTCGACGGTTATCAGAC,
3 BG1 TCTAGATCTGACTGCCAGTCACATGAT, 3 BG2
TCTAGATCTGGTT ATCAGACTGCCAGTCGACATGATTT. BglII, XhoI, and SalI sites are
underlined. BG1 results in a deletion of sequence relative to BG2. BG2
contains a SalI site as a consequence of a single insertion of
C residue.
CAT assay.
Cell extracts were made from untreated and IFN-treated cells and
assayed for CAT activity as described by Gorman et al30 with some modifications.20 Cells were treated with 1,000 U/mL of IFN-/ or 500 U/mL of
IFN-. Acetyl coenzyme A
was from Sigma Chemical Co (St Louis, MO) and [14C]
chloramphenicol (60 mCi/mmol) from Dupont NEN Products (Boston, MA).
View larger version (37K):
[in this window]
[in a new window]
| Fig 2.
IFN inducibility of transfected chimeric Ly-6A/E deletion
constructs (shown in Fig 1). Stable clones derived from A20-2J cells
were analyzed by cell surface staining with MoAb 34-11-3 directed
specifically against Ly-6A antigen. Cells were mock treated or treated
with IFN-/ (1,000 U/mL for 24 hours) or IFN- (500 U/mL for 24 hours). Plain lines indicate cells stained with secondary antibody only
as control (FITC-conjugated rabbit anti-mouse Ig); bold lines indicate
cells stained with 34-11-3 followed by secondary antibody.
|
|
| |
RESULTS |
Identification and localization of regulatory elements necessary for
the IFN response of the Ly-6E gene in the A20-2J B cells.
The A20-2J B cells express no detectable endogenous Ly6-E antigen on
the cell surface in the absence of IFN, but treatment with IFN-/
or IFN- for a period of about 16 hours leads to very high levels of
expression as can be shown by staining with a MoAb. The Ly6-A is the
allelic counterpart of Ly-6E and differs from it by a single amino acid
which can be distinguished by specific MoAbs. To take advantage of
this, we constructed chimeric constructs containing various deletions
of the Ly-6E promoter linked with exons 2-4 of the Ly-6A genomic clone
(Fig 1). This allowed us to distinguish the expression of the
transfected Ly-6E/A chimeric gene from the endogenous Ly-6E gene
product. Stable A20-2J transfectants of these genomic clones were
generated and response to IFN was assayed by cell surface expression of
Ly6-A antigen by specific MoAb 34-11-3. Previous analysis of the Ly-6E
promoter in fibroblasts had identified the region between 1760
and 900 (KpnI-AvaI) to be required for induction
by both types of IFNs.19,20 By contrast, deletion of this
region (Ly-6A/E.3 construct) had no adverse effect on the inducibility
of the transfected gene by IFN-/ or IFN- in A20-2J cells
(Fig 2, Table 1). On the other hand, the
Ly-6A/E.2 construct which contains a deletion between 2900 to
1760 (SpeI-KpnI) showed no response to either
IFN.
Because the region between 2900 and 1760 contained the
necessary elements for IFN responsiveness in A20-2J cells, it was dissected further by deletion analysis. The deletion construct (Ly-6A/E.19) which lacks the region between 2900 to 2519
(SpeI-ApaI) was IFN inducible, whereas both deletion
constructs Ly-6A/E.20 and Ly6A/E.18 were unable to respond to either
IFN treatment. These results localized the crucial sequences for
IFN-/- and IFN--mediated induction between 2519 and
1760. The next question was whether this region alone was
sufficient for IFN inducibility. Because most of this region is
contained within a PstI fragment (2400 to 1800),
this fragment was subcloned into plasmids TK-CAT and pCAT-5 which
contain viral thymidine kinase promoter and the minimal Ly-6E promoter
(900) linked to a CAT reporter gene,20 respectively.
This fragment conferred IFN- inducibility to the heterologous TK
promoter, but no induction was observed with IFN-/.25 However, when the same PstI fragment was linked to the
homologous Ly-6E minimal promoter sequence, a response to IFN-/
was readily observed.25 These results suggested that all
the sequences required for IFN- response are localized in the
PstI fragment, whereas the additional element(s) required for
IFN-/ response is present in the basal promoter region downstream
of 900. These regions were further analyzed separately.
Analysis of the distal regulatory region to define the minimal
sequence essential for IFN- inducibility.
To characterize the sequences for IFN- response contained within
the PstI fragment, several smaller fragments from this region were subcloned upstream of the TK promoter linked to a luciferase reporter gene (TK-Luxbu+). These constructs were then
analyzed in transient transfections in A20-2J cells. Among the various
fragments examined, only an HaeIII 150-bp fragment was capable
of a strong response to IFN- (Fig 3).
Computer analysis of this region identified an ISRE, NF-B, NF-GMb,
and CAT box sites (Fig 3). Several constructs were generated to
determine functional significance of each of these elements in IFN
responsiveness. Initially, we hypothesized the involvement of NF-B
site in combination with ISRE. To test this we used PCR to generate
three different NF-B site constructs: B contains ISRE and NF-B
site, B* contains mutated NF-B site, and -B construct lacks
NF-B site. As shown in Fig 3, the HaeIII (150 bp) fragment
showed 11-fold induction in response to IFN-. To our surprise, all
three B constructs showed very similar inducible activities, which
suggests the lack of any contribution from NF-B site to IFN-
response. Similarly disruption of the NF-GMb site by substitution with
a SalI site did not cause any impairment of the IFN response.
View larger version (10K):
[in this window]
[in a new window]
View larger version (7K):
[in this window]
[in a new window]
| Fig 3.
Map of the distal regulatory region responsible for IFN
inducibility of the Ly-6E promoter in B cells. (A) Various constructs
used to characterize this region and their response to IFN- assayed
by luciferase activity is shown as well as the HaeIII 150-bp
fragment showing maximum IFN inducibility. Computer analysis of this
sequence identified potential sites for three DNA binding proteins: a
CAT box, NF-B, and a GMb site defined in the promoter of the GM-CSF
gene. Constructs B, B*, B, and GMb* were designed to
address their function. Astericks represent mutated sites and b
construct lacks NF-B site. BG1 and BG2 sequences were generated by
PCR to further define the functional sites. BG2 contains additional 8 bp relative to BG1 and an insertion of a nucleotide (C) 3 to
NlaIII site to generate SalI site. BG1 was fully inducible,
whereas BG2 was completely devoid of inducibility. The increase in
luciferase activity is shown on the right and is representative of five
experiments. (B) At the bottom, the minimal sequence required for
IFN- inducibility is shown.
|
|
Because both the constructs PstI-NlaIII and
NlaIII-PvuII (Fig 3) lacked IFN inducibility, the
region around NlaIII site seemed to be crucial. The constructs
BG1, BG2, and BG3 (Fig 3) were used to further define the necessary
element around NlaIII site. The BG1 construct had full IFN-
inducibility, whereas the BG2 construct was completely devoid of
IFN- responsiveness. This result is quite significant considering
the only difference between the two constructs is the insertion of a
single C (underlined below) immediately 3 to the NlaIII
site to create a SalI site. This result confirmed the necessity
of this sequence located around the NlaIII site. The BG3
construct was generated via a HindIII-Xho1 deletion of
BG1 to eliminate the ISRE sequence. Loss of IFN- response confirmed
the functional importance of this ISRE. In summary, this extensive
deletion analysis identified a minimal 56-bp regulatory region of the
Ly-6E promoter for IFN- inducibility in A20 cells. The sequence of
this region is shown below:
The involvement of the ISRE in IFN- responsiveness is not
surprising, but the need for an additional novel element in A20-2J B
cells is quite interesting. The cell-type specificity of this region
for IFN- responsiveness was assessed by transient transfections in
other cell lines and results are summarized in
Table 2. Consistent strong responses were
observed in two B-cell lines, A20-2J and M12. Weaker but significant
activity was observed in two T-cell lines, BW5147 and EL-4. No
inducible activity was observed in J774 macrophage cell line or
BALB/3T3 fibroblast cell line.
Detection of IFN-/- and
IFN--inducible nuclear factors with probes derived from the distal
regulatory region.
DNA mobility shift analysis was performed using the BG1 probe and
nuclear extracts from untreated, IFN-/-treated and
IFN--treated BALB/3T3 cells. This analysis identified induced
complexes from both IFN-/- and IFN--treated cells
(Fig 4). A similar complex was also
observed in IFN-/-treated A20-2J nuclear extracts. Pretreatment
of A20-2J cell with IFN- (24 hours) before stimulating with
IFN-/ for 15 minutes resulted in tremendous enhancement of this
inducible complex. The binding specificity of this complex was shown by
the complete inhibition of this complex in the presence of a competitor
sequence derived from the ISRE of the ISG-15 gene designated O15 in Fig
4. ISG-15 ISRE is the highest affinity site known for ISGF3 (p48). A
sequence corresponding to the c-fos SIE did not inhibit this complex.
The electrophoretic mobility of the induced complex detected by BG1
probe is identical to the ISGF-3 complex that binds to the O15 probe
(Fig 5). Cross-competition with BG1
sequence inhibited the formation of ISGF-3 complex by O15 probe.
Furthermore, formation of the complex by Ly-6E BG1 probe was
specifically inhibited by anti-STAT1 antibody (Fig 5). No inhibition
was observed with anti-STAT3 antibody (Fig 5) or anti-STAT2 antibody
(data not shown). No complexes having the expected mobility of IRF-1 or
IRF-2 were observed and no supershifts were observed with anti-IRF-1
or anti-IRF-2 antibodies (data not shown).
View larger version (78K):
[in this window]
[in a new window]
| Fig 4.
INF-/- and INF--inducible complexes detected
in DMSA using BG1 probe and nuclear extracts from BALB/3T3 or A20-2J
cells. Cells were treated with IFN-/ or IFN- for 15 minutes
where indicated. The specificity of these complexes is shown by
competition with O15 or SIE oligonucleotides. **, Inducible complex.
|
|
View larger version (74K):
[in this window]
[in a new window]
| Fig 5.
IFN-inducible DNA binding complex detected by BG1 probe
of Ly-6E is identical to the inducible complex detected by O15 probe
derived from ISG-15 gene. Identity and specificity of the binding
complex is shown by the ability of these sequences to cross-compete
with each other when present in a 100-fold molar excess (lanes 6 and
9). Effect of anti-STAT1 and anti-STAT3 antibodies on the formation of
these complexes by BG1 probe is also shown (lanes 10 and 11).
|
|
The constitutive DNA protein interactions observed with BG1 probe are
lost as a consequence of the BG2 mutation, but inducible ISRE binding
proteins are still detected with BG2 probe
(Fig 6). Because the BG2 mutation lacks
functional responsiveness, the constitutive proteins that bind to this
region might play a role in IFN inducibility.
View larger version (60K):
[in this window]
[in a new window]
| Fig 6.
Lack of effect of BG2 mutation on the binding of
IFN-inducible complex in DMSA. The constitutive proteins, detected by
BG1 probe, do not bind the mutated BG2 probe.
|
|
Binding of HMGI(Y) protein to the distal regulatory region.
Our analysis of the Ly-6E gene in T cells led to the identification of
a distinct regulatory region (designated G region) which contains a
binding site for high-mobility group protein HMGI(Y) as well as a GAS
and octamer sites (Khodadoust and Bothwell, submitted).
To investigate its role in B cells, conditions favorable for detection
of HMGI(Y)-like protein binding were used in DNA mobility shift assays.
A fast migrating complex charasteristic of HMGI(Y) was detected with
BG1 probe from nuclear extracts of A20-2J cells
(Fig 7). This complex can be specifically
competed by oligonucleotides corresponding to the HMGI(Y) binding site from the G region active in T cells. Presence of HMGI(Y) binding site
in the BG1 probe was further confirmed by the specific binding of a
recombinant human HMGI(Y) protein in DMSA. Recombinant protein was used
to further localize the binding site by two different probes
derived from this region. HindIII-SalI probe was bound whereas HindIII-XhoI probe which contains ISRE failed
to bind rhuHMGI(Y) protein (Fig 7). Hence, HMGI(Y) binding sequence
exists in a 23-bp fragment immediately 3 to the ISRE between
XhoI and SalI sites. The above-mentioned G region DNA
sequence competed with this interaction as well in a dose-dependent
manner.
View larger version (25K):
[in this window]
[in a new window]
| Fig 7.
Localization of HMG-I binding region. (A) Detection of an
HMGI(Y)-like protein by BG1 probe from nuclear extracts of A20-2J
cells. Competition with increasing amounts (30- and 100-fold molar
excess) of unlabeled G region oligonucleotide shows specificity of the
retarded band. (B) Recombinant human HMGI(Y) protein binds only to the
HindIII-SalI probe (sequence shown in Fig 3) derived
from the regulatory region. HindIII-XhoI probe
containing ISRE was unable to bind rhHMGI(Y) protein. Competition with
unlabeled G region oligonucleotide inhibited the complex in a
dose-dependent fashion.
|
|
Identification of an additional IFN-/-responsive element
within the Ly-6E minimal promoter.
Comparison of the results of constructs containing distal regulatory
region (PstI fragment) linked to homologous minimal Ly-6E promoter with that of heterologous TK promoter suggested an additional element for IFN-/ responsiveness in the minimal promoter
downstream of 900. Chimeric constructs containing successive
deletions of the Ly-6E promoter linked to CAT gene were used to derive
stable transfectants of A20-2J cells. Individual clones were used for basal and IFN-inducible expression. Figure
8 and Table 3 show comparison of CAT
activities from extracts of untreated, IFN-/- and IFN--
treated cells. All the chimeric constructs with deletions from
900 to 113 were inducible by IFN-/ but not by
IFN-.
View larger version (63K):
[in this window]
[in a new window]
| Fig 8.
Localization of an IFN-/-responsive element within
the Ly-6E minimal promoter. Comparison of CAT activities from
representative stable clones derived from transfection of A20-2J cells
with constructs containing fragments of Ly-6E promoter linked to CAT
reporter gene. Plasmids pCAT-4 and pCAT-2 contain sequences up to
420 and 167, respectively. Plasmids pCAT-8 and pCAT-1 contain
sequences up to 113 and 81, respectively. Tri-TK-CAT has a triple
repeat of the sequence between 113 and 88.
|
|
There is an element (TGGAAAAGGTTAAG) with homology to the ISRE located
between 109 and 95 of the Ly-6E promoter. To determine whether this element was responsible for the observed
IFN-/-mediated induction, a recombinant construct containing
three tandem repeats of the sequence between 113 and 88
fused to the same TK promoter (TK-CAT) was generated. Plasmids TK-CAT
and Tri-TK-CAT were used in stable transfections. Although there was
some clonal variation in the transfectants derived from TK-CAT, none of
the clones showed any significant induction by either IFN-/ or
IFN- treatment. All the clones transfected with Tri-TK-CAT showed
marked inducibility after treatment with IFN-/ only; none of them
responded to IFN- (Fig 9 and Table 3).
In summary, this analysis identified a functional element for
IFN-/ response in A20-2J cells located between 113 and
88 of the Ly-6E promoter. Similar results were obtained in M12
B-cell line as well (data not shown). However, none of the deletion
constructs containing sequences from 900 to 113 of the
Ly-6E promoter or the Tri-TK-CAT showed any responsiveness to
IFN-/ in BALB/3T3 fibroblast or BW5147 T-cell lines in transient or stable transfections (data not shown).
View larger version (22K):
[in this window]
[in a new window]
| Fig 9.
Effect of antisense HMGI-C on IFN inducibility of
endogenous Ly-6E gene in A20-2J cells. Wild-type cells and clones
stably transfected with antisense plasmid DNA were analyzed by cell
surface staining with Sca-1 antibody. Plain lines indicate control
cells stained with secondary antibody (FITC-conjugated rabbit anti-rat
Ig) only; bold lines indicate cells stained with Sca-1 before secondary
antibody.
|
|
Transfection of A20-2J cells with antisense HMGI-C construct prevents
IFN-/ inducibility of the endogenous Ly-6E gene.
HMGI(Y) protein is essential for the transcriptional activity and IFN
inducibility of the Ly-6E gene in T cells (Khodadoust and Bothwell,
submitted). We suspected a functional role for the HMGI(Y) protein in B cells as well because of its binding site in the
distal regulatory region necessary for IFN inducibility. The synthesis
of HMGI(Y) proteins can be successfully blocked by using an antisense
cDNA construct.31 This construct was used to derive stable
transfectants of A20-2J B cells and cell surface expression of
endogenous Ly-6E antigen was analyzed by fluorescence-activated cell
sorting (FACS) (Fig 9). In 5 out of 11 clones IFN- inducibility of
the Ly-6E gene was normal but IFN-/ inducibility was completely abolished (Table 3).
Because IFN- was able to induce endogenous Ly-6E genes in five
clones, it is very unlikely that these results are due to some
nonspecific effects of antisense RNA on some other aspect of Ly-6 gene
expression. The specific loss of IFN-/ inducibility is quite
interesting because only this response requires two distinct elements
located more than 2 kb apart in the Ly-6E promoter. Assembly of a
multiprotein complex between proteins binding to these elements mediated by the binding of HMGI(Y) protein is suggested.
| |
DISCUSSION |
Ly-6 genes are regulated in a complex fashion, as shown by the
diversity of both the tissues and the various developmental stages in
which these antigens are expressed. This complexity is further
highlighted by the recent discovery of human homologues of some of
these antigens. The human E48 antigen homologue of mouse ThB antigen is
involved in keratinocyte cell-cell adhesion and is expressed at high
levels in squamous cell carcinomas.12 The other homologous
gene 9804 is not only inducible by IFNs, but interestingly, is
expressed in acute promyelocytic leukemia cells after they are induced
to differentiate by retinoic acid.15 These characteristics
of the Ly-6 gene expression make them an interesting model for studying
gene regulation.
We previously characterized a GAS-containing region of the Ly-6E
promoter located at 1.2 kb responsible for induction by both
IFN-/ and IFN- in murine fibroblasts.20,21 To our
surprise, this region of the Ly-6E promoter was dispensable for
IFN-mediated induction in A20-2J B lymphocytes as shown by genomic
deletions.25 In this study we have identified two novel
overlapping regulatory mechanisms in the A20-2J B cells used by the
Ly-6E gene for IFN-/ and IFN- inducibility. A distal
regulatory region located at 2.3 kb is important for response to
both types of IFNs and contains two functional elements: an ISRE that
plays a role in inducibility by either IFN, and a novel element that is
necessary only for IFN--mediated induction. Further analysis of the
promoter identified a third element with homology to ISRE in the
proximal minimal promoter for IFN-/ responsiveness in B cells. An
interaction between the proteins binding to these physically disparate
elements was suggested by the presence of a binding site for
high-mobility group HMGI(Y) protein in the distal regulatory region.
The functional significance of this protein for the IFN-/
inducibility of Ly-6E gene in A20-2J cells was investigated by
antisense RNA-mediated inhibition of HMGI(Y) expression.
Interestingly, the induction of endogenous of Ly-6E gene by IFN-/
was completely abrogated, whereas the response to IFN- was preserved
as analyzed by FACS staining of surface expression of the protein on
stable transfectants.
IFN- inducibility.
Genomic deletion analysis in the A20-2J cell line has shown that a
region spanning from 2519 to 1760 of the Ly-6E promoter is necessary for both IFN-/ and IFN- inducibility. By reporter gene analysis a minimal region of 56 bp essential for IFN-
inducibility was localized at position 2300. This
region contains two functional elements, an ISRE at its 5 end
and a novel element at its 3 end. The sequence of this ISRE
GGTTTCTGTTTTC is very similar to the consensus sequence
YAGTTTCNNTTTYY.32,33 This region detected IFN-/- and
IFN--inducible complexes from nuclear extracts. These complexes can
be competed by a typical ISRE site derived from ISG-15 gene. The
presence of STAT-1 in this complex is shown by the ability of
anti-STAT1 antibody to disrupt this complex. However, the sequence
derived from a conventional STAT1 binding site was not able to compete,
illustrating the lack of direct DNA binding of STAT1 in this region.
Presence of STAT1 has been reported previously in a number of complexes
(eg, GAF, IRBF, IRBF, and FCRF) involved in IFN-
responsiveness.34
As expected, deletion of the ISRE resulted in the loss of IFN-
inducibility of the reporter gene and abolished the binding of
IFN--inducible complex as well. Our functional data is consistent with previous reports showing that IFN- inducibility of MHC class I,
9-27, and guanylate-binding protein (GBP) genes require
an ISRE element. However, for these genes IFN- inducibility was attributed to the binding of IRF-1 and no IFN--inducible complexes have been reported for these genes.7,35-37 The consensus
core recognition sequence, considered necessary for the binding of IRF-1 and IRF-2, is not present in the Ly-6E ISRE element. In addition,
no complexes having the expected mobilities of IRF-1 or IRF-2 were
detected with probes from this region in DMSA and antibodies against
IRF-1 and IRF-2 failed to cause any supershifts (data not shown). The
most likely explanation for these data is that the Ly-6E ISRE is
detecting an IFN--inducible complex consisting of STAT1 homodimers
and DNA-binding subunit p48 as described.9 This conclusion
is supported by the ability of Ly-6 BG1 oligonucleotide to inhibit the
binding of ISGF-3 complex to the ISG-15 ISRE-containing probe.
The role of an additional novel element present at the 3 end of
this distal regulatory region for IFN- response in B cells remains
unclear, but its functional importance cannot be ignored because
insertion of a single nucleotide in this element completely abolished
IFN- inducibility. This element failed to detect any IFN-inducible
complex, but it is the site for the binding of specific constitutive
proteins in DMSA. Further characterization of this element might
provide insights in cell-type specificity observed in the IFN-
response of Ly-6E gene.
IFN-/ inducibility.
The above-mentioned ISRE located in the distal regulatory region of the
Ly-6E promoter was found to be required for IFN-/ inducibility as
well. An IFN-/-induced protein complex bound this region and
could be competed with a sequence derived from the ISRE of ISG-15 gene.
Furthermore, anti-STAT1 antibody was able to disrupt this complex.
Quite unexpectedly, this distal region was unable to confer IFN-/
inducibility to a heterologous TK promoter. However, linking this
fragment with minimal proximal Ly-6E promoter restored responsiveness
to IFN-/. This result suggested a necessary cooperative
interaction between the distal ISRE and an additional element within
the minimal promoter of the Ly-6E gene. This second element was
identified by stable transfections of A20-2J cells with recombinant
plasmids containing progressive 5 deletions of the Ly-6E
promoter linked to a reporter CAT gene.
All the constructs with sequences from 900 to 113 bp were
inducible with IFN-/. Sequence comparison showed a stretch of homology to the ISRE at 109 to 95 bp. To address the
functional significance of this element, a triple repeat of the
sequence between 113 and 88 was linked to the same TK
promoter. This trimerized element conferred strong IFN-/
inducibility to TK promoter in B cells only. The deletion constructs
containing the sequences downstream of 900, which include this
ISRE-like region or the Tri-TK-CAT plasmid, were not inducible by
IFN-/ in the two fibroblast cell lines BALB/3T3 and
Ltk 20 and the BW5147 T-cell line.
This extensive analysis of the Ly-6E promoter identified two elements,
one distal and one proximal, essential for IFN-/ inducibility in
B cells. The distal element is present in the context of a broad
regulatory region. This regulatory region is comprised of at least
three distinct functional elements: an ISRE at its 5 end
required for response to both types of IFNs, a novel element at its
3 end necessary only for IFN- inducibility, and a site for
HMGI(Y) binding in the middle. Because the two elements required for
IFN-/ inducibility are physically located more than 2 kb from
each other in the Ly-6E promoter, a cooperative interaction between the
proteins binding to these elements might be mediated by protein-protein
interactions. The presence of an HMGI(Y) binding site in the distal
regulatory region was curious because it had been shown to mediate such
interactions by bending DNA to bring physically disparate regions in
close proximity.38 Moreover, our analysis of the Ly-6E gene
in T cells also defined the need for the binding of HMGI(Y) protein for
the assembly of an enhanceosome-like complex required for IFN-inducible
expression (Khodadoust and Bothwell, submitted). To test
its function in B cells, inhibition of expression of HMGI(Y) protein
was achieved by antisense HMGI-C RNA in A20-2J cells as
described.31 Surprisingly, this led to the specific loss of
IFN-/-mediated induction of the endogenous Ly-6E gene while
leaving IFN- responsiveness intact. The preservation of IFN-
responsiveness in the same stable clones argues strongly against any
nonspecific effects of antisense RNA on some other aspect of Ly-6 gene
expression. This result provides support for the hypothesis that
assembly of a multiprotein complex mediated by HMGI(Y)-like protein is
required for IFN-/ inducibility of Ly-6E gene in B lymphocytes.
These data highlight the complex fashion in which multiple constitutive
and inducible proteins binding to different regulatory elements
interact with each other to achieve cell-type specific IFN-regulated
transcription of a single gene.
| |
FOOTNOTES |
Submitted February 12, 1998;
accepted May 24, 1998.
Supported by Public Health Service Grant No. GM40924 from the National
Institutes of Health.
Address reprint requests to Alfred L.M. Bothwell, PhD, Section of
Immunobiology, Yale University School of Medicine, 310 Cedar St, New
Haven, CT 06520-8011; e-mail: alfred.bothwell{at}yale.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Ray Reeves for the recombinant HMGI protein and Alfredo Fusco
for the antisense HMGI-C plasmid.
| |
REFERENCES |
1.
Lengyel P:
Biochemistry of interferons and their actions.
Annu Rev Biochem
51:251,
1982[Medline]
[Order article via Infotrieve]
2.
Darnell JE Jr,
Kerr IM,
Stark GR:
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science
264:1415,
1994[Abstract/Free Full Text]
3.
Valazquez L,
Fellous M,
Stark GR,
Pellegrini S:
A protein tyrosine kinase in interferon alpha/beta signaling pathway.
Cell
70:313,
1992[Medline]
[Order article via Infotrieve]
4.
Fu XY,
Kessler DS,
Veals SA,
Levy DE,
Darnell JE Jr:
ISGF3, the transcriptional activator induced by interferon consists of multiple interacting polypeptide chains.
Proc Natl Acad Sci USA
87:8555,
1990[Abstract/Free Full Text]
5.
Decker T,
Lew DJ,
Mirkovitch J,
Darnell JE Jr:
Cytoplasmic activation of GAF, an IFN- regulated DNA-binding factor.
EMBO J
10:927,
1991[Medline]
[Order article via Infotrieve]
6.
Shuai K,
Horvath CM,
Tsai Huang LH,
Qureshi SA,
Cowburn D,
Darnell JE:
Interferon activation of the transcriptional factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions.
Cell
76:821,
1994[Medline]
[Order article via Infotrieve]
7.
Israel A,
Kimura A,
Fournier A,
Fellous M,
Kourilsky P:
Interferon response sequence potentiates activity of an enhancer in the promoter region of a mouse H-2 gene.
Nature
322:743,
1986[Medline]
[Order article via Infotrieve]
8.
Damore M,
Omori SA,
Wall R:
IFN- induces the intron enhancer via an IFN-stimulated response element.
J Immunol
156:2451,
1996[Abstract]
9.
Bluyssen HAR,
Muzaffar R,
Vlieststra R,
Van Der Made AC,
Leung S,
Stark GR,
Kerr IM,
Trapman J,
Levy DE:
Combination association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses.
Proc Natl Acad Sci USA
92:5645,
1995[Abstract/Free Full Text]
10.
Su B,
Bothwell ALM:
Biosynthesis of a phosphatidylinositol-glycan linked membrane protein: Signals for posttranslational processing of the Ly-6E antigen.
Mol Cell Biol
9:3369,
1989[Abstract/Free Full Text]
11.
Spangrude GJ,
Brooks DM:
Mouse strain variability in the expression of the hematopoietic stem cell antigen Ly-6A/E by bone marrow cells.
Blood
82:3327,
1993[Abstract/Free Full Text]
12.
Brakenhoff RH,
Gerretsen M,
Knippels EMC,
van Dijk MH:
vE, Weghuis DO, Sinke RJ, Snow GB, van Dongen GAMS: The human E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI-anchored molecule apparently involved in keratinocyte cell-cell adhesion.
J Cell Biol
129:1677,
1995[Abstract/Free Full Text]
13.
Shan X,
Bourdeau A,
Rhoton A,
Wells DE,
Cohen EH,
Landgraf BE,
Palfree RGE:
Characterization and mapping to human chromosome 8q24.3 of Ly-6-related gene 9804 encoding an apparent homologue of mouse TSA-1.
J Immunol
160:197,
1998[Abstract/Free Full Text]
14.
LeClair KP,
Rabin M,
Nesbitt M,
Pratcheva D,
Ruddle FH,
Palfree RGE,
Bothwell ALM:
Murine Ly-6 multigene family is located on chromosome 15.
Proc Natl Acad Sci USA
84:1638,
1987[Abstract/Free Full Text]
15.
Mao M,
Yu M,
Tong J,
Ye J,
Zhu J,
Huang Q,
Fu G,
Yu L,
Zhao S,
Waxman S,
Lanotte M,
Wang Z,
Tan J,
Chan S,
Chen Z:
RIG-E, a human homolog of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell.
Proc Natl Acad Sci USA
93:5910,
1996[Abstract/Free Full Text]
16.
Stefanova I,
Horejsi V,
Ansotegui IJ,
Knapp W,
Stockinger H:
GPI-anchored cell-surface molecules complexed to protein tyrosine kinases.
Science
254:1016,
1991[Abstract/Free Full Text]
17.
Lee S-K,
Su B,
Maher SE,
Bothwell ALM:
Ly-6A is required for antigen-specific T cell responses and expression of T cell receptors.
EMBO J
13:2167,
1994[Medline]
[Order article via Infotrieve]
18.
Codias EK,
Malek TR:
Regulation of B lymphocyte responses to IL-4 and IFN- by activation through Ly-6A/E molecules.
J Immunol
144:2197,
1990[Abstract]
19.
Snapper CM,
Yamaguchi H,
Urban JF Jr,
Finkelman FD:
Induction of Ly-6A/E expression by murine lymphocytes after in vivo immunization is strictly dependent upon the action of IFN-/ and/or IFN-.
Int Immunol
3:845,
1991[Abstract/Free Full Text]
20.
Khan KD,
Lindwall G,
Maher SE,
Bothwell ALM:
Characterization of promoter elements of an interferon-inducible Ly-6E/A differentiation antigen, which is expressed on activated T cells and hematopoietic stem cells.
Mol Cell Biol
10:5150,
1990[Abstract/Free Full Text]
21.
Khan KD,
Shuai K,
Lindwall G,
Maher SE,
Darnell JE Jr,
Bothwell ALM:
Induction of the Ly-6A/E gene by both interferon / and requires a single DNA element to which a tyrosine phosphorylated 91 kDa protein binds.
Proc Natl Acad Sci USA
90:6806,
1993[Abstract/Free Full Text]
22.
Basta PV,
Sherman PA,
Ting JP:
Detailed delineation of an interferon--responsive element in human HLA-DRA gene expression in a glioblastoma multiform line.
Proc Natl Acad Sci USA
85:8618,
1988[Abstract/Free Full Text]
23.
Blanar MA,
Boettger EC,
Flavell RA:
Transcriptional activation of HLA-DR by interferon requires a trans-acting protein.
Proc Natl Acad Sci USA
85:4672,
1988[Abstract/Free Full Text]
24.
Wedrychowski A,
Seong D,
Paslidis N,
Johnson E,
Howard OMZ,
Sims S,
Talpaz M,
Kantarjian H,
Hester J,
Turpin J,
Lopez-Berestein G,
Gutterman J,
Freirich EJ,
Deisseroth A:
Characterization of nuclear proteins which bind to interferon-inducible transcriptional enhancers in hematopoietic cells.
J Biol Chem
265:21433,
1990[Abstract/Free Full Text]
25. Khan KD: Distinct regulatory elements for the tissue specific
interferon-inducible expression of the Ly-6A/E gene. PhD dissertation,
Yale University, New Haven, CT, 1992
26.
Wagner BJ,
Hayes TE,
Hoban CJ,
Cochran BH:
The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter.
EMBO J
9:4477,
1990[Medline]
[Order article via Infotrieve]
27.
Levy DE,
Kessler DS,
Pine R,
Darnell JE Jr:
Cytoplasmic activation of ISGF-3, the positive regulator of interferon--stimulated transcription, reconstituted in vitro.
Genes Dev
3:1362,
1989[Abstract/Free Full Text]
28.
Tsang SY,
Nakanishi M,
Peterlin BM:
B-cell-specific and interferon--inducible regulation of the HLA-DR gene.
Proc Natl Acad Sci USA
85:8598,
1988[Abstract/Free Full Text]
29.
Gao M-H,
Kavathas PB:
Functional importance of the cyclic AMP response element-like decamer motif in the CD8 promoter.
J Immunol
150:4376,
1993[Abstract]
30.
Gorman CM,
Moffat LF,
Howard BH:
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol Cell Biol
2:1044,
1982[Abstract/Free Full Text]
31.
Berlingieri MT,
Manfioletti G,
Santoro M,
Bandiera A,
Visconti R,
Giancotti V,
Fusco A:
Inhibition of HMGI-C protein synthesis suppresses retrovirally induced neoplastic transformation of rat thyroid cells.
Mol Cell Biol
15:1545,
1995[Abstract]
32.
Kessler DE,
Levy DE,
Darnell JE Jr:
Two interferon-induced nuclear factors bind a single promoter element in interferon-stimulated genes.
Proc Natl Acad Sci USA
85:8521,
1988[Abstract/Free Full Text]
33.
Cohen B,
Vaiman D,
Chebath J:
Enhancer functions and in vitro protein binding of native and mutated interferon responsive sequences.
Nucleic Acids Res
4:1679,
1989
34.
Haque SJ,
Williams RG:
Identification and characterization of an interferon (IFN)-stimulated response element-IFN-stimulated gene factor 3-independent signalling pathway for IFN-.
J Biol Chem
269:19523,
1994[Abstract/Free Full Text]
35.
Au WC,
Raj NBK,
Pine R,
Pitha PM:
Distinct activation of murine interferon- promoter region by IRF-1/ISGF-2 and virus infection.
Nucleic Acids Res
11:2877,
1992
36.
Harada H,
Takahashi E-I,
Itoh S,
Harada K,
Hori T-A,
Taniguchi T:
Structure and regulation of the human interferon regulatory factor (IRF-1) and IRF-2 genes: Implications for a gene network in the interferon system.
Mol Cell Biol
14:1500,
1994[Abstract/Free Full Text]
37.
Reis LF,
Harada HL,
Wolchok JD,
Taniguchi T,
Vilcek J:
Critical role of a common transcription factor, IRF-1, in the regulation of IFN- and IFN-inducible genes.
EMBO J
11:185,
1992[Medline]
[Order article via Infotrieve]
38.
Falvo JV,
Thanos D,
Maniatis T:
Reversal of intrinsic DNA bends in the IFN- gene enhancer by transcription factors and the architectural protein HMGI(Y).
Cell
83:1100,
1995
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. Virtaneva, F. A. Wright, S. M. Tanner, B. Yuan, W. J. Lemon, M. A. Caligiuri, C. D. Bloomfield, A. de la Chapelle, and R. Krahe
Expression profiling reveals fundamental biological differences in acute myeloid leukemia with isolated trisomy 8 and normal cytogenetics
PNAS,
January 30, 2001;
98(3):
1124 - 1129.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Gongora, R. P. Stephan, R. D. Schreiber, and M. D. Cooper
Stat-1 Is Not Essential for Inhibition of B Lymphopoiesis by Type I IFNs
J. Immunol.,
September 1, 2000;
165(5):
2362 - 2366.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. L. Pflugh, S. E. Maher, and A. L. M. Bothwell
Ly-6I, a New Member of the Murine Ly-6 Superfamily with a Distinct Pattern of Expression
J. Immunol.,
July 1, 2000;
165(1):
313 - 321.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. M. Khodadoust, K. D. Khan, and A. L. M. Bothwell
Complex Regulation of Ly-6E Gene Transcription in T Cells by IFNs
J. Immunol.,
July 15, 1999;
163(2):
811 - 819.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract
