|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 7 (October 1), 1998:
pp. 2421-2434
Mutations of the CD40 Ligand Gene and Its Effect on CD40
Ligand Expression in Patients With X-Linked Hyper IgM Syndrome
By
Kuniaki Seyama,
Shigeaki Nonoyama,
Ingvild Gangsaas,
Diane Hollenbaugh,
Henry F. Pabst,
Alejandro Aruffo, and
Hans D. Ochs
From the Department of Pediatrics and Biological Structure,
University of Washington Medical School, Seattle, WA; the Department of
Pediatrics, Tokyo Medical and Dental University, Tokyo, Japan;
Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA;
and the Department of Pediatrics, University of Alberta, Alberta,
Canada.
 |
ABSTRACT |
X-linked hyper IgM syndrome (XHIM) is a primary immunodeficiency
disorder caused by mutations of the gene encoding CD40 ligand (CD40L).
We correlated mutations of the CD40L gene, CD40L
expression, and the clinical manifestations observed in XHIM patients
from 30 families. The 28 unique mutations identified included 9 missense, 5 nonsense, 9 splice site mutations, and 5 deletions/insertions. In 4 of 9 splice site mutations, normally spliced
and mutated mRNA transcripts were simultaneously expressed. RNase
protection assay demonstrated that 5 of 17 mutations tested resulted in
decreased levels of transcript. The effect of the mutations on CD40L
expression by activated peripheral blood mononuclear cells (PBMC) and
T-cell lines or clones was assessed using one polyclonal and four
monoclonal antibodies and a CD40-Ig fusion protein. In most patients,
the binding of at least one antibody but not of CD40-Ig was observed, suggesting nonfunctional CD40L. However, activated PBMC from three patients and activated T-cell lines from two additional patients, each
with different genotype, bound CD40-Ig at low intensity, suggesting
functional CD40L. Thus, failure of activated PBMC to bind CD40-Ig is
not an absolute diagnostic hallmark of XHIM and molecular analysis of
the CD40L gene may be required for the correct diagnosis.
Patients with genotypes resulting in diminished expression of wild-type
CD40L or mutant CD40L that can still bind CD40-Ig appear to have milder
clinical consequences.
| |
INTRODUCTION |
X-LINKED HYPER IgM syndrome (XHIM) is a
primary immunodeficiency syndrome, characterized by recurrent
infections, hypogammaglobulinemia, and normal or elevated serum levels
of IgM.1,2 Most patients with XHIM become symptomatic
during the first or second year of life when they present with
recurrent infections including otitis media, respiratory tract
infections, or Pneumocystis carinii pneumonia (PCP).1,2 Transient or chronic neutropenia, present in
about half of XHIM patients, may contribute to the development of
infections.1,2 Cryptosporidium infection causing
chronic diarrhea and possibly cholangiopathy or liver
cirrhosis,3 malignancies,1,3 and autoimmune
disorders1 are other known complications.
The CD40 ligand (CD40L, CD154, gp39, TRAP, or
T-BAM) gene, encoding a type II membrane
glycoprotein of 261 amino acids mainly expressed by activated
CD4+ T cells,4-6 has been identified as the
gene responsible for XHIM.7-11 The gene, mapped to
Xq26,5,7 consists of five exons and four introns spreading
over 12 kb.12,13 CD40L is a member of the tumor necrosis
factor (TNF) superfamily4 and its functional unit consists
of a trimer.7 The crystal structure of soluble CD40L,
representing the extracellular region of CD40L with the entire TNF
homology domain, has recently been elucidated,14 and
computer-assisted structural analysis has been instrumental in
assessing the effect of mutations on CD40L structure and CD40L-CD40 interaction.15 CD40, a counter-receptor of CD40L, is
expressed by B cells,16 macrophages, and
monocytes,17-19 dendritic cells,20 and vascular
endothelial cells.21,22 The interaction of CD40L on
activated T cells and CD40 on B cells induces B-cell proliferation and
Ig isotype switching, is important for the formation of germinal centers, and prevents B cells from undergoing apoptosis.16
CD40L expressed by activated CD4+ T cells from normal
individuals is easily detected by immunostaining using anti-CD40L
monoclonal antibodies (MoAbs) or CD40-Ig, a fusion protein consisting
of the extracellular region of human CD40 and the Fc portion of Ig. In
contrast, activated T cells from XHIM patients fail to express functional CD40L.7-11 The failure of properly activated T
cells to bind anti-CD40L MoAbs and CD40-Ig, respectively, is considered a diagnostic hallmark of XHIM, along with a family history and clinical
manifestations characteristic of XHIM. The diagnosis of XHIM is
confirmed by sequence analysis of the CD40L gene.
A total of 75 unique mutations, affecting the transmembrane and
extracellular domains of CD40L, have been collected by the European
XHIM registry23 and include missense and nonsense
mutations, and mutations affecting splicing of mRNA transcripts, and
insertions and deletions. To date, no apparent genotype
and phenotype relationship has been reported.
In this study, we have examined 30 unrelated families with XHIM,
identified a mutation of the CD40L gene in each family,
explored various diagnostic strategies, and attempted to correlate
genotype with phenotype.
| |
MATERIALS AND METHODS |
Study population.
Thirty unrelated families with 45 affected males were included in this
study. They consist of 19 white families (30 affected males), 9 Asian
families (13 affected males), and 2 African-American families (2 affected males). Thirty-five patients are alive. All participating
patients including those reported previously by us3,7,13,15,24-26 or others11,27-29 are
described in Table 1. Ten patients died
during the course of this study (between 1991 and 1997); 4 died of
malignancies3 including carcinoid (GS, family 16), bile
duct carcinoma (MC, family 22), and adenocarcinoma of unknown origin
(JJ and CJ, family 30); 2 died of liver failure (CF, family 4 and DS,
family 16); 1 (JW, family 6) had a stroke at age 26 due to severe
hypertension caused by acute onset nephritis at 10 years of age; 1 (KyS, family 13) died of generalized cryptococcosis27; and
1 patient (KA, family 24) died in a traffic accident. One patient (JoC,
family 22) died of PCP at 8 months of age before this study was begun.
The current ages of the living patients, shown in Table 1, range from 1 to 28 years (median, 13 years). Serum Ig levels at onset were available
from 32 affected males. IgG was consistently low (mean, 92 mg/dL,
range, 12 to 267 mg/dL). IgA (<10 mg/dL in 21 patients, 10 to 30 mg/dL in 4 patients, and >30 mg/dL in 7 patients; range <10 to 93 mg/dL) and IgM levels (<50 mg/dL in 4 patients; 50 to 150 mg/dL in 15 patients; >150 mg/dL in 13 patients; range 36 to 1,524 mg/dL) varied
considerably.
Cell preparations and culture.
Peripheral blood mononuclear cells (PBMC) were isolated from
heparinized venous blood by Ficoll-Hypaque (Pharmacia Biotech, Piscataway, NJ) centrifugation. RPMI1640 supplemented with 10% fetal
calf serum (FCS; Hyclone, Logan, UT), 2 mmol/L glutamine, 100 U/mL
penicillin, and 100 µg/mL of streptomycin (complete media) was used
for cell culture. To establish and maintain cultures of interleukin-2
(IL-2)-dependent T-cell lines and clones, we decreased FCS
concentration to 8% and added 2% human AB serum (Biowhittaker,
Walkersville, MD) in complete media. T-cell lines were established from
PBMC using a standard method30 and CD4+ T-cell
clones were established by limiting dilution. CD4+ T-cell
lines, prepared from established T-cell lines using a magnetic cell
sorting (MACS) system (Miltenyi Biotec Inc, Auburn, CA), were
maintained throughout the study period at greater than 95% purity.
Detection of CD40L expression with anti-CD40L antibodies and
biotinylated CD40-Ig by flow cytometry.
The expression of CD40L was evaluated by immunostaining as described
previously.31 We used four different preparations of anti-human CD40L MoAbs including MoAb 106 and MoAb 1.7 (both mouse IgG1, provided by Dr Tony Siadak, Bristol-Myers Squibb Co,
Pharmaceutical Research Institute, Seattle, WA), MoAb 5c8 (mouse IgG2a,
provided by Biogen, Cambridge, MA), and MoAb TRAP (mouse IgG1), and a
polyclonal antibody (pAb) (rabbit anti-human CD40L antiserum) (the
latter two reagents were provided by Dr Richard A. Kroczek, Robert
Koch-Institute, Berlin, Germany). In addition, we identified CD40L
expression with an Ig fusion protein consisting of its natural
counterpart, biotinylated CD40-Ig (bCD40-Ig) (provided by Dr Stephen J
Klaus, Department of Microbiology, University of Washington, Seattle). After activation for 8 hours with phorbol 12-myristate 13-acetate (PMA) at 10 ng/mL (GIBCO-BRL, Gaithersburg, MD) and
ionomycin at 1 µg/mL (Sigma, St Louis, MO), immunostaining of PBMC
was performed using three MoAbs (106, 1.7, and 5c8) and bCD40-Ig. For
the immunostaining of T-cell lines and CD4+ T-cell lines or
clones, cells were activated for 4 hours with the same stimulants and
immunostaining was performed using four MoAbs, one pAb, and bCD40-Ig.
The following fluorochrome-conjugated reagents were used: fluorescein
isothiocyanate (FITC)-conjugated goat anti-mouse IgG to detect MoAb
binding, FITC-conjugated goat anti-rabbit IgG to detect pAb binding,
and phycoerythrin-conjugated streptavidin to detect bCD40-Ig binding
(all reagents were purchased from Biosource International, Camarillo,
CA). The cell suspensions were then analyzed by flow cytometry
(FACScan; Becton Dickinson, San Jose, CA); a minimum of 10,000 events
were collected and analyzed by Lysis II software (Becton Dickinson).
Propidium iodide staining was used to eliminate nonviable cells from
the analysis.
Sequence analysis of the CD40L gene in XHIM patients.
Total RNA was isolated from activated PBMC (6 hours incubation with PMA
at 10 ng/mL and ionomycin at 1 µg/mL) with TRIzol (GIBCO-BRL).
Reverse transcription of mRNA followed by polymerase chain reaction
(RT-PCR) was performed as follows: 10 µg of RNA in a total volume of
20 µL was reverse-transcribed into cDNA using oligo-dT primer and
SuperScript RNaseH reverse transcriptase (GIBCO-BRL)
and amplification was performed using 1 µL of cDNA in a total volume
of 50 µL containing 10 mmol/L Tris-HCl (pH 9.0 at 25°C), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 500 nmol/L of each oligonucleotide primer, 200 µmol/L dNTP, and 1.25 U of
Taq DNA polymerase (Promega, Madison, WI). Two oligonucleotide
primers were selected, P1 (5 GCCAGAAGATACCATTTCAAC3, sense) and P2 (5CCGCTGTGCTGTATTATGAA3, antisense), to
cover the entire coding region of the CD40L gene.
Amplification was performed with 30 cycles of denaturation (93°C, 1 minute), annealing (55°C, 1 minute), and extension (72°C, 2 minutes). The PCR products were size-fractionated by agarose gel
electrophoresis, purified, and subjected to direct sequencing using the
Thermo Sequenase cycle sequencing kit (Amersham, Arlington
Heights, IL) according to the manufacturer's instruction. Because the
CD40L gene is relatively small, we directly sequenced the
entire coding region to determine a mutation. When DNA fragments with
different sizes were generated by RT-PCR, each population was cloned
into the pCR 2.1 vector (Invitrogen, Carlsbad, CA) and subsequently
sequenced; at least 10 to 20 clones were analyzed. After a specific
mutation was identified in the CD40L cDNA, we amplified the
corresponding exons/introns by PCR using genomic DNA isolated from
peripheral blood leukocytes.13 The PCR products were
directly sequenced to confirm the mutations, including splice site
mutations.
CD40L mutations affecting splice donor sites.
Multiple DNA fragments present in RT-PCR products suggest a splicing
abnormality. To further characterize these multiple splicing products
by RT-PCR, we designed different pairs of primers for each intron
containing splice donor site mutation (summarized in Fig 3A): for
intron 1, we selected P1 and P3 (5CTTTCTCCTGTGTTGCATCTC3, antisense), which generate a DNA fragment of 262 bp; for intron 2, we
selected P4 (5ATAGAAGATGAAAGGAATCT3, sense) and P5
(5CTTTTTGCATTTCAAAGCTGT3, antisense), resulting in a
fragment of 190 bp; for intron 3, we designed P6
(5GATATAATGTTAAACAAAGAGG3, sense) and P7
(5ACTTTAGGCAGAGGCTGGCT3, antisense), generating a 301-bp
fragment; for intron 4, we selected P7 and P8
(5GTGATCAGAATCCTCAAAATT3, sense), which generate a fragment of 243 bp. PCR was performed as described above with 30 cycles
of denaturation (93°C, 30 seconds), annealing (55°C, 30 seconds), and extension (72°C, 1 minute).
View larger version (7K):
[in this window]
[in a new window]
View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR in patients with splice donor site mutations of
the CD40L gene. (A) Design and location of primers used in RT-PCR.
Shown are the coding regions of CD40L cDNA only. The numbers on top
indicate the starting nucleotide number of each exon. The location of
primers are shown by arrows [sense ( ) and antisense ( )]. Note
that sense primers used for amplification of introns 2, 3 , and 4 splice donor site mutations were designed to be localized in an exon
that may be skipped. (B) Agarose gel electrophoresis of RT-PCR
products. RT-PCR was performed using primer pairs P1 and P3 (lanes 1 through 3), P4 and P5 (lanes 4 through 7), and P6 and P7 (lanes 8 through 11), and P7 and P8 (lanes 12 through 15) (see Materials and
Methods). An aliquot of the RT-PCR product was size-fractionated on 2%
agarose gel and stained with ethidium bromide. DNA size markers are
shown on the left. cDNA used for RT-PCR was derived from a normal
control (lanes 1, 4, 8, and 12), DB (family 16) in lane 2, PS (family
18) in lane 5, TaA (family 17) in lane 6, MS (family 20) in lane 9, AM
(family 19) in lane 10, SeC (family 22) in lane 13, RA (family 23) in
lane 14; lanes 3, 7, 11, and 15 are negative controls (no cDNA in the
reaction mixture). Note that patients with splice donor site mutations
involving introns 1 (lane 2) and 3 (lanes 9 and 10) but not those
involving introns 2 (lanes 5 and 6) and 4 (lanes 13 and 14) have bands
which are indistinguishable from those derived from normally spliced
mRNA.
|
|
RNase protection assay.
To detect and quantitate the CD40L mRNA transcripts, we used the RNase
protection assay (RPA) originally described by Melton et
al.32 Since the mutations of the CD40L gene are
highly heterogeneous, three different regions were selected for
designing probes (summarized in Fig 4A). Probe A (nucleotides
[nt] 163-571), was used in all XHIM patients for which
total RNA from activated PBMC was available, except those with splice
site mutations affecting introns 2 and 3. Probe B (nt 1-275) was used
to specifically quantitate mRNA transcripts in patients with intron 2 splice site mutations (families 17 and 18) causing exon 2 skipping, and
probe C (nt 163-367) for quantitating normally spliced mRNA transcripts
in patients with mutations affecting intron 3 splicing (families 19 and
20). The template plasmids for the synthesis of these probes, which was prepared by in vitro transcription, were constructed as follows. For
probe A, the RT-PCR product generated with primers P9
(5GCGGGATCCAGAAGGTTGGACAAGATAGAA3, sense,
BamHI recognition sequence underlined) and P2 (antisense) was
digested with BamHI and HindIII and the fragment cloned
into pTRIamp19 (Ambion, Austin, TX). For probe B, the RT-PCR products generated with P10
(5CGCGGATCCATTTCAACTTTAACACAGC3, sense,
BamHI recognition sequence underlined) and P11
(5TCACAGTTCAGTAAGGATAAG3, antisense) were digested with
BamHI, then ligated into the same vector linearized with
BamHI and HincII. For probe C, the RT-PCR products
generated with primers P9 and P5 were cloned as described for probe B. As an internal control, we selected a probe for the CD3 chain, using
the BamHI-Xba I fragment of CD3 cDNA33
(nt 393-635) cloned into pTRIamp19. The plasmid constructs were
individually sequenced to confirm the correct sequence. Cloned plasmids
were linearized by EcoRI digestion before synthesizing the
radiolabeled probes.
View larger version (12K):
[in this window]
[in a new window]
View larger version (56K):
[in this window]
[in a new window]
View larger version (16K):
[in this window]
[in a new window]
| Fig 4.
Quantitation of CD40L mRNA transcripts by RNase
protection assay. (A) Design of probes used in the RNase protection
assay (RPA). The upper open bar shows the domain structure of the CD40L
molecule; IC, intracellular tail; TM, transmembrane domain; ECU,
extracellular unique region; and TNFH, TNF-homology domain. The numbers
above the upper open bars indicate the starting amino acid residue for
each domain. The lower open bar shows the contribution of each exon to
the CD40L domains. The three closed bars indicate the locations and
nucleotide borders of the RPA probes used. (B) Autoradiograms of
representative RPAs using probes A, B, and C. In each autoradiogram,
arrowheads indicate the protected bands derived from CD40L mRNA
transcripts and horizontal bars indicate those derived from CD3 mRNA
transcripts. Total RNA was isolated from activated PBMC of normal
controls in lanes 1, 3, and 5, and selected XHIM patients: JG (family
28) in lane 2, PS (family 18) in lane 4, and AM (family 19) in lane 6. Radioactivity of protected CD40L and CD3 mRNA transcripts was
quantitated by the PhosphorImager analysis system and the ratio of
CD40L/CD3 mRNA transcripts calculated as follows: lane 1, 0.883;
lane 2, 0.205; lane 3, 1.021; lane 4, total 1.072 (0.692 for 275 bp and
0.380 for 178 bp); lane 5, 0.837; and lane 6, total 0.838 (0.290 for
205 bp and 0.548 for 147 bp). (C) Quantitation of CD40L mRNA
transcripts isolated from activated PBMC of XHIM patients. The ratio of
CD40L/CD3 mRNA transcripts was plotted on the ordinate. The number
attached to each symbol (representing an individual XHIM patient)
corresponds to the patient's family number (see Table 1). In patients
with intron 2 splice site mutations (families 17 and 18), mRNA
transcripts in which exon 2 was skipped ( ) or 19 nucleotides were
inserted ( ) were quantitated separately using probe B; the total
amount of transcripts is indicated by an open diamond ( ). In
patients with intron 3 splice site mutations (families 19 and 20),
normally spliced ( ) and exon 3-skipped ( ) mRNA transcripts were
quantitated separately using probe C; the total amount is indicated by
a closed diamond ( ).
|
|
Total RNA was isolated by ultracentrifugation on CsCl cushion from
guanidium isothiocyanate lysate of activated PBMC (3 µg/mL phytohemagglutinin [PHA] and 10 ng/mL PMA for 6 hours).
The ethanol precipitated RNA preparations were stored at
 20°C until use. RPA was performed using in vitro
transcription and an RPA kit (Pharmingen, San Diego, CA), according to
the manufacturer's instruction. Protected RNA bands were quantitated
by the PhosphorImager (Model 400S; Molecular Dynamics, Sunnyvale, CA)
analysis system.34
Immunization with bacteriophage  X174.
To assess the effect of CD40L mutations on in vivo antibody responses
to a T-cell-dependent neoantigen, we immunized normal controls and a
selected group of XHIM patients with bacteriophage X174, after
Institutional Review Board (IRB) approval (University of
Washington) and informed consent were obtained. Bacteriophage X174
was cloned, harvested, and purified as previously
described.35,36 The material was adjusted to a final
concentration of 1 × 1011 plaque-forming units
(PFU)/mL and, after obtaining informed consent, administered
intravenously at a dose of 2 × 109 PFU/kg
body weight. A second dose was given 6 weeks later. Blood samples for
antibody titers were collected immediately before immunization and at
1, 2, and 4 weeks after immunization. Serum was stored at
20°C until analyzed. Antibody activity was determined by a
neutralizing antibody assay and expressed as the first-order rate
constant (Kv) of phage inactivation using a standard formula. Neutralizing antibodies resistant to 2-mercaptoethanol were considered to be IgG.
| |
RESULTS |
CD40L expression by PBMC.
CD40L expression by ionomycin/PMA activated PBMC using MoAbs and
bCD40-Ig was studied in normal controls and in affected members of all
XHIM families. Representative immunostainings using MoAb 106 and
bCD40-Ig are shown in Fig 1. Activated
control PBMC expressed CD40L at high intensity (Fig 1A and B); in
contrast, very low levels of CD40L expression were detected in
unstimulated control PBMC (Fig 1C). Similarly activated PBMC of most
XHIM patients from our study group could not express functional CD40L
and failed to bind bCD40-Ig (data not shown). However, activated PBMC
of patients from families 11, 19, and 21 showed binding of bCD40-Ig, although at reduced intensity. Mutations identified in these families included a nonsense mutation resulting in a deletion of the cytoplasmic domain of CD40L (family 11) and splice site mutations allowing the
generation of normally spliced and mutated transcripts (families 19 and
21). Representative immunostaining of patient AM from family 19 are
shown in Fig 1D and E. The pattern of CD40L expression by activated
PBMC of this subgroup of patients is similar to that observed in a
group of patients with common variable immunodeficiency (CVI)
previously reported.37 An example of CD40L expression by a
CVI patient with normal CD40L gene based on sequence analysis is shown
in Fig 1F and G.
View larger version (37K):
[in this window]
[in a new window]
| Fig 1.
CD40L expression by activated PBMC, T-cell lines, and
CD4+ T-cell clones. After stimulation with ionomycin and
PMA for 8 hours (PBMC) or 4 hours (T-cell lines and CD4+
T-cell clones), immunostaining of cells was performed using MoAb 106 or
bCD40-Ig. The immunostaining with MoAb 106 or bCD40-Ig is shown by a
bold line and the immunostaining with isotype-matched control reagent
is indicated by a thin line. The fluorescence intensity is expressed on
the abscissa on a log scale and the number of events is expressed on
the ordinate. (A and B) Activated PBMC from a normal control; (C) PBMC
from a normal control without activation; (D and E) activated PBMC from
patient AM (family 19) with the splice site mutation in exon 3 (nt 367G
A); (F and G) activated PBMC from a CVI patient with confirmed
normal CD40L sequence; (H, I, and K) patient TA (family 7) with the
missense mutation T254M and includes activated PBMC (H), an activated
T-cell line (I), and an activated CD4+ T-cell clone
(K).
|
|
CD40L expression by cultured T cells.
To avoid repeated shipments of fresh blood from patients not directly
under our care, we analyzed CD40L expression by activated IL-2-dependent T-cell lines, CD4+ T-cell lines, or
CD4+ T-cell clones. As shown for patient TA from family 7, activated T-cell lines (Fig 1I) and CD4+ T-cell lines or
clones (Fig 1K) showed more pronounced CD40L expression than activated
PBMC (Fig 1H). A similar increase in CD40L expression was observed if
T-cell lines or clones from normal controls
(Fig 2) were studied. Based on these
observations, we established T-cell lines and CD4+ T-cell
lines/clones from affected members of 27 unrelated XHIM families.
View larger version (42K):
[in this window]
[in a new window]
| Fig 2.
Representative histograms of CD40L expression in patients
with XHIM using an anti-CD40L pAb, four MoAbs, and bCD40-Ig. The
histograms are similar to those described in Fig 1. The reagents used
for immunostaining are indicated on the left and the mutations
represented by the cell lines and the assigned staining type are listed
at the top. See Table 2 for the definition of the immunostaining
type.
|
|
To assess the quality and quantity of CD40L expression by activated
T-cell lines or clones, we performed the immunostaining using one pAb,
four different MoAbs, and bCD40-Ig. Based on the staining pattern of
these cultured T-cell populations, five different types of
immunostaining were recognized (Table 2).
Representative histograms and mutations are shown in Fig 2. Type 1 pattern, observed in five families and represented by the splice site
mutation nt 367G A, is characterized by the binding of all
reagents, suggesting the expression of functional CD40L molecules. In
type 2, exemplified by the missense mutation T147N, all antibodies
bind, but CD40-Ig does not, suggesting expression of nonfunctional
protein due to its inability to bind CD40. Type 3, represented by the
missense mutation G227V, that leads to a more severe alteration of the CD40L molecule, is characterized by the binding of the pAb and one or
more MoAbs (in this example, the binding of MoAb 106). In type 4, represented by the nonsense mutation W140X, only the pAb binds. Whereas
types 2, 3, and 4 suggest that nonfunctional CD40L is expressed,
patients with type 5 pattern lack protein expression, as is the case in
the two affected cousins of family 26 who have a large genomic
deletion. Mutations of the CD40L gene and the immunostaining patterns
found in 30 XHIM families are summarized in Table 1. Type 1 staining is
observed in normal individuals whose activated T cells express
wild-type CD40L or a normal variant (polymorphism) of CD40L, as
exemplified by R181W,15 and in XHIM patients with mutations
of lesser consequences such as: (1) the nonsense mutation in a
cytoplasmic domain (R11X) resulting in the generation of CD40L that
lacks a cytoplasmic domain; (2) leaky splice site mutations (nt 367G
A, nt 367 + 2t c, and nt 367 + 5g
a) that allow activated T cells to generate reduced amounts
of wild type CD40L; and (3) intron 2 splice site mutation (nt 309 + 2t
a) that causes in-frame amino acid deletion and generates a
truncated CD40L that can still bind CD40-Ig. Three genotypes (T147N,
T254M, and nt 309 + 1g a) were classified as type
2 and 5 genotypes (1 double missense, 2 missense and 2 splice site
mutations) as type 3. Type 4 staining was the most common with 10 (42%) of 24 genotypes tested. Only one mutation was identified that
resulted in complete absence of CD40L. When comparing the
immunostaining between activated PBMC and cultured T-cell lines/clones,
although we did not perform the immunostaining of PBMC with pAb and
TRAP, the only difference noticed was the intensity but not the type of
immunostaining, with three exceptions: activated PBMC from patient CF
of family 4 (immunostaining type 3) failed to bind any of the MoAbs
tested, and those from patient PS of family 18 and MS of family 20 (both immunostaining type 1) failed to bind bCD40-Ig. Two mutations
affecting intron 2 splice donor site, nt 309 + 1g a (family
17) and nt 309 + 2t a (family 18), were classified as type 2 and type 1, respectively, although the effect on the splicing of CD40L
mRNA transcripts is identical. In both instances, exon 2 is skipped,
generating a truncated CD40L which lacks the exon 2-encoded
extracellular stalk, but preserving the entire TNF homology domain of
CD40L. This truncated CD40L retains some functional qualities; however,
the fact that if expressed in COS cells the mutant binds bCD40-Ig with
less intensity compared with wild-type CD40L (data not shown), suggests
that the biological function of this mutated CD40L is decreased.
Quantitation of mRNA transcripts suggests that the difference observed
in immunostaining is a direct consequence of variations in gene
expression (see below).
Mutations of the CD40L gene.
The 28 unique mutations identified in 30 unrelated families include 9 missense (1 double mutation found in family 1 was counted as 2 mutations, but 1 genotype) and 5 nonsense mutations, 9 splice site
mutations, and 5 deletions or insertions in genomic DNA (Table 1). The
mutations were distributed throughout the entire CD40L molecule and
affected all but the transmembrane domain. Ten of the 28 unique
mutations identified here are novel and unreported, and the remaining
18 mutations identified in our patients were published
previously,7,13,15,25,26 or reported by
others.8,9,11,29,38-40
All nine missense mutations were located in the TNF homology domain,
underscoring its functional significance for CD40L-CD40 interaction.
Using the classification of Bajorath et al15 based on the
effect of the missense mutation on the CD40L monomer structure, 4 missense mutations observed (L231S, A235P, T254M, and L258S) affect the
internal core packaging of the CD40L monomer (class I), 2 (Y170C and
G227V) interfere with trimer formation (class II), and 3 (S128R, E129G,
and T147N) compromise directly or indirectly the CD40 binding site
(class III). Four of the 5 nonsense mutations identified are expected
to result in the premature termination of translation and the
generation of truncated proteins. In contrast, R11X, a nonsense
mutation in the cytoplasmic domain, is expected to generate a CD40L
molecule that lacks the cytoplasmic domain by using a new initiation
site near the end of the cytoplasmic domain. This possibility was
further supported by the fact that activated T cells with the mutation
R11X (patient DJ, family 11) were able to bind all four MoAbs tested
and the bCD40-Ig construct (Tables 1 and 2), and finally confirmed by
[35S]-methionine metabolic labeling experiments followed
by immunoprecipitation (data not shown).
Mutations of the CD40L gene affecting splicing were found in
the splice donor site (5 splice site) of each intron and in the
splice acceptor site (3 splice site) of intron 4 (Table 1). Three groups of patients with splice donor site mutations affecting introns 2, 3, and 4, respectively, were identified. Although the families within each group had different alterations of the consensus sequence in a given splice donor site, their splicing products were
identical: families 17 and 18 had mutations affecting the intron 2 splice donor site; families 19, 20, and 21 had mutations affecting the
intron 3 splice donor site; and families 22 and 23 had mutations
affecting the intron 4 splice donor site. Using RT-PCR and subsequent
cloning, multiple species of mRNA transcripts were identified in
activated PBMC from all patients with splice donor site mutations. In
patient KA (family 24) who has a mutation affecting a splice acceptor
site of intron 4, only one species of mRNA transcripts was detected. In
addition to variously misspliced mRNA transcripts, normally spliced
(wild-type) mRNA transcripts were identified in patients carrying the
mutation nt 177 + 1g t in intron 1, the mutations nt 367 + 2t c and nt 367 + 5g a in intron 3, and the
mutation nt 367G A in exon 3. The normally spliced mRNA
transcripts found in patient AM (family 19) with the nt 367G A mutation generate a glycine to serine substitution at position 116 (G116S); however, this amino acid substitution did not affect CD40-Ig
binding becaue COS cells transfected with the cDNA carrying G116S
mutation showed normal staining intensity with bCD40-Ig (data not
shown). Wild-type mRNA transcripts were not found in activated
patients' cells with mutations affecting splice donor sites within
introns 2 and 4. These latter mutations resulted in mRNA transcripts
that skipped exon 2 (families 17 and 18) or exon 4 (families 22 and 23)
and contained insertions derived from intron 2 (families 17 and 18) or
intron 4 (families 22 and 23) by using cryptic splice sites. The
finding of multiple splicing products in all splice donor site
mutations and of normally spliced mRNA transcripts in mutations
affecting the splice donor site of introns 1 and 3 were further
confirmed by RT-PCR using a pair of primers designed to flank each
corresponding exon (Fig 3A). Although the
mRNA transcript level in patients with intron 1 splice donor site
mutation (family 16) was determined to be extremely low by RNase
protection assay (see below), RT-PCR successfully detected both
normally spliced and misspliced products as shown in Fig 3B (lane 2),
whereas a negative control reaction of RT-PCR yielded nothing (Fig 3B,
lane 3).
Three unique insertions (in four families) and two unique deletions (in
two families) were identified in genomic DNA (Table 1). In all but one
family, a premature termination of translation and generation of a
truncated protein are predicted. A deletion of more than 10 kb with a
breakpoint upstream of exon 4 of the CD40L gene was found in
genomic DNA of two affected cousins of family 26. RT-PCR in affected
members of this family failed to yield DNA fragments while DNA
fragments derived from glyceraldehyde-3-phosphate dehydrogenase mRNA
transcripts were amplified normally. PCR of the genomic DNA
successfully generated DNA fragments derived from exons 4 and 5 but not
from exons 1, 2, and 3. Southern blotting confirmed a large deletion of
more than 10 kb in genomic DNA (data not shown).
Quantitation of the CD40L mRNA transcript by RPA.
CD40L mRNA transcripts were quantitated in activated PBMC from 19 XHIM
patients with 17 different mutations using RPA
(Fig 4). CD3 mRNA transcripts were
analyzed for quantitative normalization. To determine the normal levels
of CD40L mRNA transcripts, we isolated total RNA from activated PBMC of
20 normal controls and estimated the quantity of mRNA transcripts using
probe A (Fig 4A and B). The mean (geometric) CD40L/CD3 mRNA
transcripts ratio of controls was 1.064 (95% confidence interval 0.409 to 2.772) (Fig 4C). The CD40L/CD3 mRNA transcript ratio of
unstimulated PBMC, determined in five normal controls, was 0.064 (geometric mean) (Fig 4C), indicating that transcription of the
CD40L gene increases approximately 17-fold after in
vitro activation with PHA and PMA.
Analyses of missense (6 genotypes) and nonsense (4 genotypes)
mutations, one intron 1 splice donor site mutation, and insertions (2 genotypes) were performed using probe A. Most of these mutations did
not affect transcription of the CD40L gene and allowed
generation of mRNA transcripts comparable to those of normal controls
(Fig 4C). However, CD40L/CD3 mRNA transcript ratio was low in five mutations including two nonsense mutations (0.235 in family 11 and
0.385 in family 14), the intron 1 splice donor site mutation (0.008 in
family 16), and two insertions (0.296/0.205 in families 27/28 with
identical mutation, and 0.389 in family 30) (Fig 4C). Activated T-cell
lines from all patients belonging to these five families with low
CD40L/CD3 mRNA transcript ratio were found to bind pAb, although at
very low intensity. These results were reproducible and did not seem to
be a background immunostaining since activated T-cell lines from
affected members of family 26, who had most of the CD40L
gene deleted, consistently failed to bind pAb.
For patients with intron 2 splice donor site mutations (families 17 and
18), we used probe B to quantitate separately the two species of
transcripts, one with exon 2-skipped, the other with a 19 nucleotide
insertion (Fig 4A and B). The former mRNA transcripts are expected to
generate a truncated protein with an in-frame deletion of 44 amino
acids that is capable of CD40-Ig binding, but less efficiently than
wild-type CD40L. Although the two different intron 2 splice donor site
mutations have identical effects on the splicing of mRNA transcripts,
they have a markedly different impact on the level of transcripts:
total CD40L/CD3 mRNA transcript ratio of activated PBMC was 0.464 in
the mutation nt 309 + 1g a (family 17) and 1.072 in the
mutation nt 309 + 2t a (family 18). In both of these
mutations, the transcripts with a 19-nt insertion are dominant;
however, the exon 2-skipped transcripts were threefold more abundant
in nt 309 + 2t a (PS, family 18) than in nt 309 + 1g
a (TaA, family 17) (0.380 in PS v 0.128 in TaA) (Fig
4C). Interestingly, the clinical phenotype of patient PS with the
mutation nt 309 + 2t a is mild whereas patients YA and TaA
of family 17 with the mutation nt 309 + 1g a had classic
XHIM. A similar situation was observed in families 19 and 20 with
different mutations affecting the intron 3 splice donor site. We used
probe C to quantitate separately the normally spliced transcripts and
the exon 3-skipped transcripts (Figs 4A and B). Exon 3-skipped
transcripts were the dominant mRNA species in both of the two splice
site mutations; however, patient AM (family 19) with a mild phenotype
and the mutation nt 367G A had almost twice the amount of
normally spliced transcript than patient MS of family 20 (0.290 in AM
v 0.156 in MS) (Fig 4C). In all XHIM patients with splice site
mutations that allow the generation of normally spliced mRNA
transcripts, the levels of normally spliced mRNA transcripts were
decreased. Patient DB of family 16 (nt 177 + 1g t) had less
than 1%, patient MS of family 20 (nt 367 + 2t c) had 15%,
and patient AM of family 19 (nt 367G A) had 27% of the mean
level of mRNA transcripts from normal controls (n = 20). Similarly, the
levels of the mRNA transcripts encoding the mutants that retain the
ability to bind CD40-Ig were decreased: patient DJ of family 11 (R11X)
had 22%; the levels of exon 2-skipped transcripts in patient TaA of
family 17 (nt 309 + 1g a) and in patient PS of family 18 (nt
309 + 2t a) were 12% and 36%, respectively.
Antibody responses to bacteriophage X174.
To assess in vivo antibody production to a T-cell-dependent antigen,
we immunized with bacteriophage X174 nine XHIM patients from seven
families with unique genotypes. After primary immunization, normal
controls reach a peak antibody titer (Kv) at 2 weeks and produce
phage-specific antibody that is almost entirely of the IgM isotype.
After a second immunization 6 weeks later, antibody titers increase
briskly, more than 10-fold, reaching a peak at 1 week
(Fig 5). During the secondary response,
half of the antibody is of the IgG type. All XHIM patients studied to
date, independent of phenotype, had quantitatively and qualitatively
abnormal antibody responses to bacteriophage X174 (Fig 5). After
primary immunization, five XHIM patients reached peak antibody titers
at 1 week and then decreased. However, three patients with a mild
phenotype (TA of family 7, DJ of family 11, and PS of family 18) were
able to increase titers between weeks 1 and 2, reaching values that remained within the normal range of controls for the first 2 weeks. Titers decreased less rapidly in these three patients than in the
others. After a secondary immunization, all XHIM patients failed to
amplify antibody responses and the titers remained below 2 SD of normal
controls. Compared with the six classic XHIM patients, the three milder
cases responded with higher titers, but only one, patient DJ, produced
phage specific IgG antibody (10%).
View larger version (31K):
[in this window]
[in a new window]
| Fig 5.
Antibody responses to bacteriophage X174.
Bacteriophage X174 was injected twice ( ), 6 weeks apart and
antibody titers determined in 12 normal male controls ( ,
geometric mean; the hatched area, ± 2 SD), and in nine XHIM patients.
Neutralizing antibody is expressed as rate of phage inactivation or K
value (Kv) on a log scale. The mean percentage of phage-specific IgG
antibody in serum collected 2 weeks after secondary immunization is
shown on the right. Antibody responses to bacteriophage X174 were
quantitatively and qualitatively abnormal in all XHIM patients studied.
They characteristically failed to amplify and to switch from IgM to
IgG. The three patients with a mild phenotype, PS, DJ, and TA (open
symbols), had the highest titers, and one (DJ) was able to produce
phage-specific IgG antibody, although at a low concentration (10%).
|
|
Phenotype and genotype.
The clinical characteristics of 45 affected males from 30 unrelated
XHIM families were analyzed and the findings summarized in
Table 3. More than half of the patients
were diagnosed before they reached 1 year of age and only three
patients, all with mild disease, were older than 5 years at the time
the diagnosis was established. Intravenous Ig (IVIg) therapy was
started in more than half of the patients before 1 year of age. PCP,
often the presenting symptom during the first year of life, was
observed in 38% of patients. Neutropenia was reported in 27 patients
(60%) and was described as transient or intermittent in 15, and
chronic in 11 patients. Cholangiolitis and liver cirrhosis were
diagnosed in 4 patients; 1 was 3 years at diagnosis (MC, family 22), 2 were 23 years (GS, family 16 and CJ, family 30), and 1 was 24 years (DS, family 16). Five patients developed tumors of the gastrointestinal tract, including hepatic/pancreatic carcinoid (GS, family 16 and DG,
family 29), bile duct carcinoma (MC, family 22), and adenocarcinoma of
unknown origin (JJ and CJ, family 30); DG, the most recent patient
diagnosed with a tumor is the only survivor. All but two patients (IN,
family 8 and DJ, family 11) are receiving regular IVIg infusions, with
good or fair response in 88%.
Five unrelated patients, all teenagers or young adults, had phenotypes
that clearly distinguished them from patients with classic XHIM
(Table 4). Two had identical missense
mutations affecting exon 5 (T254M), one had a nonsense mutation (R11X), and two had splice site mutations affecting intron 2 (nt 309 + 2t
a) and exon 3 (nt 367G A), respectively. All were
older at onset, never had PCP, and neutropenia was observed in only two
cases, one intermittently and one during parvovirus B19 infection. Parvovirus B19-induced red blood cell aplasia was the presenting illness in three of the five patients with a mild phenotype, but was
not observed in patients with classic XHIM. In the latter group of
patients, Ig therapy was started at a mean age of 1.5 years. In the
five patients with mild disease, IVIg therapy was started much later.
None of the patients presenting with parvovirus B19-induced anemia had
received IVIg prophylaxis at the time they developed symptoms, and at
present only three of our patients with a milder phenotype receive
regular IVIg infusions. It is conceivable that patients with classic
XHIM avoid infection with parvovirus B19 because they are recognized
earlier and started on IVIg at a younger age than those XHIM patients
with a milder phenotype. Of those with mild disease, none had any
problems with recurrent infections regardless of treatment with IVIg.
Activated T-cell lines from patients with a mild phenotype were able to bind all four anti-CD40L MoAbs tested (immunostaining type 2) and three
could bind CD40-Ig (immunostaining type 1); in contrast, activated
T-cell lines from most patients (80%) with a classic XHIM phenotype
were classified as immunostaining type 3, 4, or 5 and did not bind
CD40-Ig.
| |
DISCUSSION |
The discovery of the molecular defect causing the X-linked form of the
hyper IgM syndrome has allowed the precise definition of XHIM. Affected
males have mutations in the CD40L gene resulting in the
inability of T cells to express functional CD40L molecules, and as a
consequence, lack B-cell signaling via the CD40 receptor. Mutations
responsible for XHIM are distributed throughout the CD40L gene and are
highly heterogeneous.7-13,25-29,38-40 A recent report from
the XHIM Registry of the European Society for Immunodeficiencies, based
on mutation data from 53 families,23 indicated that the most common CD40L mutations were missense mutations, present in 39.5%
of XHIM patients, followed by nonsense mutations (18.6%), deletions
(19.8%), insertions (10.5%), and splice site mutations (9.3%). Here,
we report the individual mutations and their effects on CD40L
expression in 30 unrelated families. Of the 28 unique mutations
identified, 10 have not been previously described. Although missense
mutations of the CD40L gene were the most common with 33%
(10 of 30 families), splice site mutations were nearly as frequent (9 of 30 families). Mutations affecting the splice donor site were found
in each intron of the CD40L gene. Four of these splice donor
site mutations (nt 177 + 1g t, nt 367G A, nt 367 + 2t c, and nt 367 + 5g a) were leaky and
produced both normally and abnormally spliced CD40L mRNA transcripts.
The consensus sequence at the 5 end of introns that is
recognized efficiently by the spliceosome is
(A/C)AG(1)g(+1)taagt in which the cleavage occurs between the G
nucleotides at positions 1 and +141: the gt
dinucleotides located at the 5 end of each intron is considered
invariant and the most preserved sequence. One possible exception is
the substitution of the invariant gt dinucleotides with gc
dinucleotides as long as the other nucleotides match the consensus.41 In vitro studies of the rabbit
 -globin gene showed that the gt gc mutation at the splice donor site merely reduced the efficiency of
splicing.42 Such a situation was observed in patient MS
(family 20) with the mutation nt 367 + 2t c that generated
wild-type transcripts, at a reduced amount, as well as transcripts that
skipped exon 3. Because the 5 cleavage site is not determined
solely by the invariant gt dinucleotides but rather by the 5
splice region as a whole,42 it is likely to find normally
spliced transcripts whenever multiple RT-PCR products are identified.
This is further underscored by the finding that three different
mutations affecting the intron 3 splice donor site (mutations at
position 1, +2, and +5) allow activated T cells to generate
normally spliced CD40L transcripts in addition to misspliced
transcripts. An RT-PCR strategy designed to amplify the entire CD40L
coding region has the advantage of identifying multiple splicing
products, which may be missed if single-strand conformational
polymorphism43 or dideoxy fingerprinting44 screening, preceded by amplification of several overlapping segments, is used.7,11,29 This RT-PCR strategy used here may explain the high frequency of multiple splicing products, including wild-type CD40L mRNA transcripts, we have observed in patients with splice site
mutations.
Using a previously described three-dimensional model of the CD40L
extracellular region, we have explored the effect of amino acid
substitutions resulting from missense mutations on the structure and
function of CD40L.15 Missense mutations affecting the core packaging of the CD40L monomer (class I), found in four of nine unique
missense mutations, were the most common, followed by three missense
mutations known to interfere directly or indirectly with CD40 binding
(class III). Class II missense mutations, thought to affect trimer
formation, were found twice. Although most missense mutations resulted
in mutants that were recognized by pAb and at least one MoAb (usually
MoAb 106) (immunostaining type 3) or by pAb only (immunostaining type
4), mutant T254M (class I) and T147N (class III) were recognized by all
four MoAbs tested. Although the immunostaining intensity of
cells with the T254M mutation was much lower than that observed in
normal controls (Fig 1H, I, and K), the finding that all four MoAbs
could bind to this mutant suggests that this amino acid substitution
affects CD40L monomer structure less profoundly. The T147N mutant, on
the other hand, was able to bind all MoAbs with almost normal intensity (Fig 2). Five residues located along the interface between CD40L monomers (K143, Y145, Y146, R203, Q220) contribute substantially to the
interaction with CD40.45 The proximity of codon 147 to the
CD40 binding site is the most likely explanation for the interference of T147N with CD40 binding, despite the fact that the resulting amino
acid change is conservative and the mutant retains binding activity to
four MoAbs. Thus, the classification of missense mutations combined
with the immunostaining pattern provides insight into the structural
and functional abnormalities of mutated CD40L.
To explore a possible correlation between phenotype and immunostaining
type, we selected XHIM patients who presented with a mild phenotype
based on clinical characteristics, including age at onset of symptoms,
frequency of infections requiring antibiotic therapy, the presence of
complications (neutropenia, PCP, and cholangiolitis), and response to
IVIg therapy. Five XHIM patients with mild phenotype could be clearly
delineated (Table 4): all had late onset of symptoms and never PCP; in
three patients the presenting illness was chronic anemia due to red
blood cell aplasia caused by parvovirus B19 infection; they had few
complications and a good response to IVIg therapy. The mutations
identified in these patients were heterogeneous and allowed the
generation either of mutant CD40L that can bind CD40-Ig (R11X, nt 309 +2t a, and nt 367G A), or of a class I missense
mutation (T254M, present in two unrelated patients) resulting in an
extracellular domain that can bind all four anti-CD40L MoAbs tested. In
contrast, two additional patients (MS of family 20, nt 367 + 2t
c, and JE of family 21, nt 367 + 5g a) with
splice site mutations that allow the generation of wild-type CD40L mRNA
transcripts, at reduced amounts, developed PCP during the first 6 months of life, similar to a patient, described by Ameratunga et
al,46 who developed PCP in early infancy and was found to
have a splice site mutation that resulted in the expression of very low
amounts of wild-type CD40L mRNA transcripts. After recovery, patient
JE, now 6 years old, has remained asymptomatic on IVIg therapy, and
patient MS's subsequent clinical course cannot be evaluated because of
successful bone marrow transplantation at the age of 9 months. Although
PCP is most often associated with an impaired host defense system and
is considered a frequent complication of primary or secondary T-cell
deficiencies, Pneumocystis carinii has been identified as an
important cause of pneumonia in normal infants. In a prospective study,
Stagno et al47 found P carinii antigenemia in 10 of
67 infants, none of which had received immunosuppressive drugs.
Possible reasons for this susceptibility include the decreased ability of lymphocytes from young infants to produce interferon- and IL-4,
and to express CD40L.31 The majority of our XHIM patients who had developed PCP during the first year of life did not develop PCP
again, even after PCP prophylaxis was discontinued. We conclude that
the patients whose genotypes result in immunostaining types 1 and 2 often present with a mild XHIM phenotype, although they may still be at
risk of developing PCP because other factors apart from defective CD40L
contribute to the development of PCP.
To confirm the diagnosis of XHIM, a mutated, nonfunctional CD40L
protein has to be demonstrated. The most widely accepted techniques
include (1) immunostaining of activated T cells with anti-CD40L
antibodies; (2) binding of a CD40-Ig construct designed to specifically
interact with CD40L; and (3) mutation analysis of the CD40L
gene. Using polyclonal and monoclonal anti-CD40L antibodies, we were
able to detect mutated CD40L on the surface of activated T cells of all
XHIM patients except those from one family with a large deletion, and
to distinguish five immunostaining types. Thus, our study expands the
observation of Callard et al,48 who, using a CD40-Ig
construct and MoAbs 5c8 and TRAP, have described two different staining
patterns for CD40L expression in a group of XHIM patients. In addition,
we have identified five mutations (R11X, nt 309 + 2t a, nt
367G A, nt 367 + 2t c, and nt 367 + 5g a) that allow the binding of a CD40-Ig construct by activated patients' T-cell lines. In three of them (R11X, nt 367G
A, and nt 367 + 5g a), the binding of CD40-Ig
was noted in activated PBMC, the cell preparation most commonly used
for the diagnostic immunostaining in patients with XHIM. Nevertheless,
patients whose activated lymphocytes bind CD40-Ig must express
functional CD40L. The fact that these patients are symptomatic
indicates that their activated T cells are not capable of engaging CD40
on B cells effectively. This may be due to a sub-threshold expression
of CD40L, a depressed affinity or avidity for CD40 or the formation of
"heterotrimers," consisting of wild-type and mutated CD40L monomers, as is expected in splice site mutations that result in
multiple splicing products. All these possibilities will result in
deficient cross-linking of CD40. It is important to note that in the
genotypes resulting in the immunostaining type 1, 2, or 3, found in 13 of 24 genotypes (54%) from our study group, CD40L expression by
activated PBMC may be detected by anti-CD40L MoAbs or CD40-Ig. Indeed,
at least one MoAb, usually MoAb 106, has bound to activated PBMC in 12 genotypes and bCD40-Ig has bound to activated PBMC in three genotypes.
Thus, 12 genotypes (50%) would have been missed if only one of the
four MoAbs available to us had been used for immunostaining of
activated PBMC. If immunostaining with MoAbs, together with CD40-Ig
binding by activated PBMC, had been used without sequence analysis, 3 of 24 genotypes tested (12.5%) would have been missed. As previously
described37 and shown in Fig 1F and G, decreased binding of
anti-CD40L MoAbs (and pAb) and CD40-Ig is observed in a subgroup of
patients with CVI who have a staining pattern similar to the
immunostaining type 1 of XHIM patients. To discriminate XHIM patients
from CVI patients (both with an immunostaining type 1), molecular
analysis of the CD40L gene is required. Nevertheless, it is
reasonable to study CD40L expression by activated T cells with one or
two MoAb(s) and with the CD40-Ig construct because this technique will
identify approximately 90% of XHIM patients.
Although activated T cells from XHIM patients with certain mutations of
the CD40L gene can express either wild-type or mutant CD40L
that can bind CD40-Ig, they do so at low density. Carrier females, on
the other hand, have been identified with extremely skewed CD40L
expression, favoring the X chromosome carrying the abnormal gene, and
whose immunologic status nevertheless has been completely
normal.26 In these carrier females, a small number of T
cells in which the normal X chromosome is active is expected to express
CD40L at normal density, suggesting that a relatively small number of T
cells with a normal density of CD40L molecules is sufficient for the
normal function of the immune system. There is most likely a threshold
density of CD40L that is required to ligate CD40 on B lymphocytes
efficiently to transduce signals that will ultimately result in
increased Ig production and class switching. The reciprocal dialogue
between T and B cells through CD40L/CD40 and B7-1 or B7-2/CD28 is
important for T cells to be fully activated and exert their effector
functions.49-51 Without a sufficient density of functional
CD40L expressed by activated T cells, this reciprocal dialogue between
T and B cells may not occur or may be inadequate. As a result, T cells
may fail to produce IL-4 and IL-10, which are important cytokines for B
cells to undergo Ig isotype switching and to produce high-affinity
antibody.52,53 On the other hand, CD40 is not only
expressed by B cells but also by a variety of cells including
monocytes/macrophages,16-19 dendritic cells,20
vascular endothelial cells,21,22 and transformed cells.54 These observations suggest that CD40L/CD40
interaction can influence many aspects of T-cell-mediated inflammatory
responses, such as cell extravasation, production of inflammatory
cytokines, apoptosis of transformed cells or rescue of macrophages from
apoptosis, as well as activation of macrophage effector
functions.19,54,55 Signaling via CD40 activates monocytes
to produce nitric oxide 56,57 involved in the protection
from intracellular pathogens.58 Differences in CD40L
requirement are suggested by the observation that monocytes can be
activated to produce IL-1, TNF- , IL-6, and IL-8 in the presence
of a soluble CD40L-CD8 fusion protein alone, without the need for other
costimulatory molecules.19 Therefore, it is possible that
the low density of CD40L expressed on activated T cells in patients
with immunostaining type 1 (eg, R11X and several splice site mutations)
are able to activate some CD40-expressing cells, eg, monocytes, but not
B lymphocytes, because B cells require contact-independent help
provided by activated T cells in addition to CD40 ligation. This could
explain the fact that PCP and persistent Cryptosporidium
infection, characteristic for classic XHIM patients, are rarely
observed in mild cases whereas persistent parvovirus B19 infection,
dependent on specific IgG production for elimination, is a frequent
complication. However, other genetic or environmental factors may
explain the milder phenotype observed in this subgroup of XHIM
patients.
| |
FOOTNOTES |
Submitted February 3, 1998;
accepted June 3, 1998.
Supported in part by the University of Washington Clinical Research
Center (RR-37), and by grants from the National Institutes of Health
(HD17427 and AI40102), the March of Dimes Birth Defects Foundation
(6-FY96-0330), and the Immune Deficiency Foundation.
Address reprint requests to Hans D. Ochs, MD, Department of Pediatrics,
University of Washington, School of Medicine, Box 356320, Seattle, WA
98195-6320; e-mail: allgau{at}u.washington.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank the following physicians for referring patients: A.J. Apter,
N.K. Day, A. Dorenbaum, R. Good, H. Hasle, H. Hill, A. Huttenlocher, R. Kagan, R. Kobayashi, B. Mazer, R. Roberts, D. Rosen, F.T. Saulsbury,
M.J. Schumacher, J. Slater, E.R. Stiehm, K. Sullivan, K. Terada, J. Winkelstein, and D. Williams-Herman. We thank Drs Christopher Wilson
and Brian Smart for their critical reading of the manuscript.
| |
REFERENCES |
1.
Notarangelo,
LD,
Duse M,
Ugazio AG:
Immunodeficiency with hyper-IgM (HIM).
Immunodefic Rev
3:101,
1992[Medline]
[Order article via Infotrieve]
2.
Levy J,
Espanol-Boren T,
Thomas C,
Fischer A,
Tovo P,
Bordigoni P,
Resnick I,
Fasth A,
Baer M,
Gomez L,
Sanders EAM,
Tabone MD,
Plantaz D,
Etzioni A,
Monafo V,
Abinun M,
Hammarström L,
Abrabamsen T,
Jones A,
Finn A,
Klemola T,
DeVries E,
Sanal O,
Peitsch MC,
Notarangelo LD:
Clinical spectrum of X-linked hyper-IgM syndrome.
J Pediatr
131:44,
1997
3. Hayward AR, Levy L, Facchetti F, Notarangelo L, Ochs HD, Etzioni
A, Bonnefoy JY, Cosyns M, Weinberg A: Cholangiopathy and tumors of the
pancreas, liver, and biliary tree in boys with X-linked
immunodeficiency with hyper-IgM. J Immunol 158:977, 1997
4.
Hollenbaugh D,
Grosmaire LS,
Kullas CD,
Chalupny NJ,
Braesch AS,
Noelle RJ,
Stamenkovic I,
Ledbetter JA,
Aruffo A:
The human T cell antigen gp39, a member of the TNF gene family, is a ligand for the CD40 receptor: Expression of a soluble form of gp39 with B cell co-stimulatory activity.
EMBO J
11:4313,
1992[Medline]
[Order article via Infotrieve]
5.
Graf D,
Korthauer U,
Mages HW,
Senger G,
Kroczek RA:
Cloning of TRAP, a ligand for CD40 on human T cells.
Eur J Immunol
22:3191,
1992[Medline]
[Order article via Infotrieve]
6.
Spriggs MK,
Armitage RJ,
Strockbine L,
Clifford KN,
Macduff BM,
Sato TA,
Maliszewski CR,
Fanslow WC:
Recombinant human CD40 ligand stimulates B cell proliferation and immunoglobulin E secretion.
J Exp Med
176:1543,
1992[Abstract/Free Full Text]
7.
Aruffo A,
Farrington M,
Hollenbaugh D,
Li X,
Milatovich A,
Nonoyama S,
Bajorath J,
Grosmaire LS,
Stenkamp R,
Neubauer M,
Roberts RL,
Noelle RJ,
Ledbetter JA,
Francke U,
Ochs HD:
The CD40 ligand, gp39, is defective in activated T cells from patients with X-linked hyper-IgM syndrome.
Cell
72:291,
1993[Medline]
[Order article via Infotrieve]
8.
Korthauer U,
Graf D,
Mages HW,
Briere F,
Padayachee M,
Malcolm S,
Ugazio AG,
Notarangelo LD,
Levinsky RJ,
Kroczek RA:
Defective expression of T-cell CD40 ligand causes X-linked immunodeficiency with hyper-IgM.
Nature
361:539,
1993[Medline]
[Order article via Infotrieve]
9.
Fuleihan R,
Ramesh N,
Loh R,
Jabara H,
Rosen FS,
Chatila T,
Fu SM,
Stamenkovic I,
Geha RS:
1993. Defective expression of the CD40 ligand in X chromosome-linked immunoglobulin deficiency with normal or elevated IgM.
Proc Natl Acad Sci USA
90:2170,
1993[Abstract/Free Full Text]
10.
DiSanto JP,
Bonnefoy JY,
Gauchat JF,
Fischer A,
Basile GDS:
CD40 ligand mutations in x-linked immunodeficiency with hyper-IgM.
Nature
361:541,
1993[Medline]
[Order article via Infotrieve]
11.
Allen RC,
Armitage RJ,
Conley ME,
Rosenblatt H,
Jenkins NA,
Copeland NG,
Bedell MA,
Edelhoff S,
Disteche CM,
Simoneaux DK,
Fanslow WC,
Belmont J,
Spriggs MK:
CD40 ligand gene defects responsible for X-linked hyper-IgM syndrome.
Science
259:990,
1993[Abstract]
12.
Villa A,
Notarangelo LD,
DiSanto JP,
Macchi PP,
Strina D,
Frattini A,
Lucchini F,
Patrosso CM,
Giliani S,
Mantuano E,
Agosti S,
Nocera G,
Kroczek RA,
Fischer A,
Ugazio AG,
Basile GDS,
Vezzoni P:
Organization of the human CD40L gene: Implications for molecular defects in X chromosome-linked hyper-IgM syndrome and prenatal diagnosis.
Proc Natl Acad Sci USA
91:2110,
1994[Abstract/Free Full Text]
13.
Seyama K,
Kira S,
Ishidoh K,
Souma S,
Miyakawa T,
Kominami E:
Genomic structure and PCR-SSCP analysis of the human CD40 ligand gene: Its application to prenatal screening for X-linked hyper-IgM syndrome.
Hum Genet
97:180,
1996[Medline]
[Order article via Infotrieve]
14.
Karpusas M,
Hsu YM,
Wang JH,
Thompson J,
Lederman S,
Chess L,
Thomas D:
2 A crystal structure of an extracellular fragment of human CD40 ligand.
Structure
3:1031,
1995[Medline]
[Order article via Infotrieve]
15.
Bajorath J,
Seyama K,
Nonoyama S,
Ochs HD,
Aruffo A:
Classification of mutations in the human CD40 ligand, gp39, that are associated with X-linked hyper IgM syndrome.
Protein Sci
5:531,
1996[Medline]
[Order article via Infotrieve]
16.
Durie FH,
Foy TM,
Masters SR,
Laman JD,
Noelle RJ:
The role of CD40 in the regulation of humoral and cell-mediated immunity.
Immunol Today
15:406,
1994[Medline]
[Order article via Infotrieve]
17. Alderson MR, Armitage RJ, Tough TW, Strockbine L, Fanslow WC,
Spriggs MK: CD40 expression by human monocytes: Regulation by cytokines
and activation of monocytes by the ligand for CD40. J Exp Med
178:669, 1993
18.
Wagner JDH,
Stout RD,
Suttles J:
Role of the CD40-CD40 ligand interaction in CD4+ T cell contact-dependent activation of monocyte interleukin-1 synthesis.
Eur J Immunol
24:3148,
1994[Medline]
[Order article via Infotrieve]
19.
Kiener PA,
Moran DP,
Rankin BM,
Wahl AF,
Aruffo A,
Hollenbaugh D:
Stimulation of CD40 with purified soluble gp39 induces proinflammatory responses in human monocytes.
J Immunol
155:4917,
1995[Abstract]
20.
Caux C,
Massacrier C,
Vanbervliet B,
Dubois B,
Van Kooten C,
Durand I,
Banchereau J:
Activation of human dendritic cells through CD40 cross-linking.
J Exp Med
180:1263,
1994[Abstract/Free Full Text]
21.
Hollenbaugh D,
Mischel PN,
Edwards CP,
Simon JC,
Denfeld RW,
Kiener PA,
Aruffo A:
Expression of functional CD40 by vascular endothelial cells.
J Exp Med
182:33,
1995[Abstract/Free Full Text]
22.
Yellin MJ,
Brett J,
Baum D,
Matsushima A,
Szabolcs M,
Stern D,
Chess L:
Functional interactions of T cells with endothelial cells: The role of CD40L-CD40-mediated signals.
J Exp Med
182:1857,
1995[Abstract/Free Full Text]
23.
Notarangelo LD,
Peitsch MC:
CD40lbase: A database of CD40L gene mutations causing X-linked hyper-IgM syndrome.
Immunol Today
17:511,
1996[Medline]
[Order article via Infotrieve]
24.
Pabst HF,
Chung GSH,
Segal D,
Dolen J:
Mild combined immunodeficiency in identical twins.
J Pediatr
89:425,
1976[Medline]
[Order article via Infotrieve]
25.
Nonoyama S,
Shimadzu M,
Toru H,
Seyama K,
Nunoi H,
Neubauer M,
Yata J,
Ochs HD:
Mutations of the CD40 ligand gene in 13 Japanese patients with X-linked hyper-IgM syndrome.
Hum Genet
99:624,
1997[Medline]
[Order article via Infotrieve]
26.
Hollenbaugh D,
Wu LH,
Ochs HD,
Nonoyama S,
Grosmaire LS,
Ledbetter JA,
Noelle RJ,
Hill H,
Aruffo A:
The random inactivation of the X chromosome carrying the defective gene responsible for X-linked hyper IgM syndrome (X-HIM) in female carriers of HIGM1.
J Clin Invest
94:616,
1994
27.
Iseki M,
Anzo M,
Yamashita N,
Matsuo N:
Hyper-IgM immunodeficiency with disseminated cryptococcosis.
Acta Paediatr
83:780,
1994[Medline]
[Order article via Infotrieve]
28.
Saiki O,
Tanaka T,
Wada Y,
Uda H,
Inoue A,
Katada Y,
Izeki M,
Iwata M,
Nunoi H,
Matsuda I,
Kinoshita N,
Kishimoto T:
Signaling through CD40 rescues IgE but not IgG or IgA secretion in X-linked immunodeficiency with hyper-IgM.
J Clin Invest
95:510,
1995
29.
Lin Q,
Rohrer J,
Allen RC,
Larch'e M,
Greene JM,
Shigeoka AO,
Gatti RA,
Derauf DC,
Belmont JW,
Conley ME:
A single strand conformation polymorphism study of CD40 ligand. Efficient mutation analysis and carrier detection for X-linked hyper IgM syndrome.
J Clin Invest
97:196,
1996[Medline]
[Order article via Infotrieve]
30. Nutman TB: Generation and maintenance of T cell lines and
clones, in Coligan JE, Kruisbeek AM, Margulies DH, Shevach EH, Strober
W (eds): Current Protocols in Immunology, vol 2. Somerset, NJ, Wiley,
Current Protocols, 1992, p7.19.1
31.
Nonoyama S,
Penix LA,
Edwards CP,
Lewis DB,
Ito S,
Aruffo A,
Wilson CB,
Ochs HD:
Diminished expression of CD40 ligand by activated neonatal T cells.
J Clin Invest
95:66,
1995
32.
Melton DA,
Krieg PA,
Rebagliati MR,
Maniatis T,
Zinn K,
Green MR:
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res
12:7035,
1984[Abstract/Free Full Text]
33.
Elsen PVD,
Shepley BA,
Borst J,
Coligan JE,
Markham AF,
Orkin S,
Terhorst C:
Isolation of cDNA clones encoding the 20K T3 glycoprotein of human T-cell receptor complex.
Nature
312:413,
1984[Medline]
[Order article via Infotrieve]
34.
Johnston RF,
Pickett SC,
Barker DL:
Autoradiography using storage phosphor technology.
Electrophoresis
11:355,
1990[Medline]
[Order article via Infotrieve]
35.
Ochs HD,
Davis SD,
Wedgwood RJ:
Immunologic responses to bacteriophage X174 in immunodeficiency diseases.
J Clin Invest
50:2559,
1971
36.
Pyun KH,
Ochs HD,
Wedgwood RJ,
Yang X,
Heller SR,
Reimer CB:
Human antibody responses to bacteriophage X 174: Sequential induction of IgM and IgG subclass antibody.
Clin Immunol Immunopathol
51:252,
1989[Medline]
[Order article via Infotrieve]
37.
Farrington M,
Grosmaire LS,
Nonoyama S,
Fischer SH,
Hollenbaugh D,
Ledbetter JA,
Noelle RJ,
Aruffo A,
Ochs HD:
CD40 ligand expression is defective in a subset of patients with common variable immunodeficiency.
Proc Natl Acad Sci USA
91:1099,
1994[Abstract/Free Full Text]
38.
Villa A,
Strina D,
Macchi P,
Patrosso MC,
Vezzoni P,
Tovo PA,
Giliani S,
Ugazio AG,
Notarangelo LD:
C to T mutation causing premature termination of CD40 ligand at amino acid 221 in a patient affected by hyper IgM syndrome.
Hum Mutat
3:73,
1994[Medline]
[Order article via Infotrieve]
39.
Macchi P,
Villa A,
Strina D,
Sacco MG,
Morali F,
Brugnoni D,
Giliani S,
Mantuano E,
Fasth A,
Andersson B,
Zergers BJM,
Cavagni G,
Reznick I,
Levy J,
Zan-Bar I,
Porat Y,
Airo P,
Plebani A,
Vezzoni P,
Notarangelo LD:
Characterization of nine novel mutations in the CD40 ligand gene in patients with X-linked hyper IgM syndrome of various ancestry.
Am J Hum Genet
56:898,
1995[Medline]
[Order article via Infotrieve]
40.
Katz F,
Hinshelwood S,
Rutland P,
Jones A,
Kinnon C,
Morgan G:
Mutation analysis in CD40 ligand deficiency leading to X-linked hypogammaglobulinemia with hyper IgM syndrome.
Hum Mutat
8:223,
1996[Medline]
[Order article via Infotrieve]
41.
Jackson IJ:
A reappraisal of non-consensus mRNA splice sites.
Nucleic Acids Res
19:3795,
1991[Free Full Text]
42.
Aebi M,
Hornig H,
Weissmann C:
5 Cleavage site in eukaryotic pre-mRNA splicing is determined by the overall 5 splice region, not by the conserved 5 GU.
Cell
50:237,
1987[Medline]
[Order article via Infotrieve]
43.
Orita M,
Suzuki Y,
Sekiya T,
Hayashi K:
Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction.
Genomics
5:874,
1989[Medline]
[Order article via Infotrieve]
44.
Sarkar G,
Yoon HS,
Sommer,
SS:
Dideoxy fingerprinting (ddF): A rapid and efficient screen for the presence of mutations.
Genomics
13:441,
1992[Medline]
[Order article via Infotrieve]
45.
Bajorath J,
Marken JS,
Chalupny NJ,
Spoon TL,
Siadak AW,
Gordon M,
Noelle RJ,
Hollenbaugh D,
Aruffo A:
Analysis of gp39/CD40 interactions using molecular models and site-directed mutagenesis.
Biochemistry
34:9884,
1995[Medline]
[Order article via Infotrieve]
46.
Ameratunga R,
McKee J,
French J,
Prestidge R,
Fanslow W,
Marbrook J:
Molecular pathology of the X-linked hyper-immunoglobulin M syndrome: Detection of wild-type transcripts in a patient with a complex splicing defect of the CD40 ligand.
Clin Diagn Lab Immunol
3:722,
1996[Abstract]
47.
Stagno S,
Pifer LL,
Hughes WT,
Brasfield DM,
Tiller RE:
Pneumocystis carinii pneumonitis in young immunocompetent infants.
Pediatrics
66:56,
1980[Abstract/Free Full Text]
48.
Callard RE,
Smith SH,
Herbert J,
Morgan G,
Padayachee M,
Lederman S,
Chess L,
Kroczek RA,
Fanslow WC,
Armitage RJ:
CD40 ligand (CD40L) expression and B cell function in agammaglobulinemia with normal or elevated levels of IgM (HIM): Comparison of X-linked, autosomal recessive, and non-X-linked forms of the disease, and obligate carriers.
J Immunol
153:3295,
1994[Abstract]
49.
Grewal IS,
Flavell,
RA:
A central role of CD40 ligand in the regulation of CD4+ T-cell responses.
Immunol Today
17:410,
1996[Medline]
[Order article via Infotrieve]
50.
Yang Y,
Wilson JM:
CD40 ligand-dependent T cell activation: Requirement of B7-CD28 signaling through CD40.
Science
273:1862,
1996[Abstract/Free Full Text]
51.
Grewal IS,
Foellmer HG,
Grewal KD,
Xu J,
Hardardottir F,
Baron JL,
Janeway CAJ,
Flavell RA:
Requirement for CD40 ligand in costimulation induction, T cell activation, and experimental allergic encephalomyelitis.
Science
273:1864,
1996[Abstract/Free Full Text]
52.
Durandy A,
Schiff C,
Bonnefoy JY,
Forveille M,
Rousset F,
Mazzei G,
Milili M,
Fischer A:
Induction by anti-CD40 antibody or soluble CD40 ligand and cytokines of IgG, IgA and IgE production by B cells from patients with X-linked hyper IgM syndrome.
Eur J Immunol
23:2294,
1993[Medline]
[Order article via Infotrieve]
53.
Nonoyama S,
Hollenbaugh D,
Aruffo A,
Ledbetter JA,
Ochs HD:
B cell activation via CD40 is required for specific antibody production by antigen-stimulated human B cells.
J Exp Med
178:1097,
1993[Abstract/Free Full Text]
54.
Hess S,
Engelmann H:
A novel function of CD40: Induction of cell death in transformed cells.
J Exp Med
183:159,
1996[Abstract/Free Full Text]
55.
Stout RD,
Suttles J:
The many roles of CD40 in cell-mediated inflammatory responses.
Immunol Today
17:487,
1996[Medline]
[Order article via Infotrieve]
56.
Tian L,
Noelle RJ,
Lawrence DA:
Activated T cells enhance nitric oxide production by murine splenic macrophages through gp39 and LFA-1.
Eur J Immunol
25:306,
1995[Medline]
[Order article via Infotrieve]
57.
Stout RD,
Suttles J,
Xu J,
Grewal IS,
Flavell RA:
Impaired T cell-mediated macrophage activation in CD40 ligand-deficient mice.
J Immunol
156:8,
1996[Abstract]
58.
Soong L,
Xu JC,
Grewal IS,
Kima P,
Sun J,
Longley BJJ,
Ruddle NH,
McMahon PD,
Flavell RA:
Disruption of CD40-CD40 ligand interactions results in an enhanced susceptibility to Leishmania amazonensis infection.
Immunity
4:263,
1996[Medline]
[Order article via Infotrieve]
59.
Morosawa H,
Yamazaki M,
Sugita K,
Saitoh H,
Komiyama A,
Akabane T:
Intrinsic neutrophil defects in a child with impaired neutrophil chemotaxis and immunodeficiency.
Am J Hematol
8:403,
1980[Medline]
[Order article via Infotrieve]
60.
Hasle H,
Kerndrup G,
Jacobsen BB,
Heegaard ED,
Hornsleth A,
Lillevang ST:
Chronic parvovirus infection mimicking myelodysplastic syndrome in a child with subclinical immunodeficiency.
Am J Pediatr Hematol Oncol
16:329,
1994[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
W.-I Lee, T. R. Torgerson, M. J. Schumacher, L. Yel, Q. Zhu, and H. D. Ochs
Molecular analysis of a large cohort of patients with the hyper immunoglobulin M (IgM) syndrome
Blood,
March 1, 2005;
105(5):
1881 - 1890.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M L Prasad, M Velickovic, S A Weston, and E M Benson
Mutational screening of the CD40 ligand (CD40L) gene in patients with X linked hyper-IgM syndrome (XHIM) and determination of carrier status in female relatives
J. Clin. Pathol.,
January 1, 2005;
58(1):
90 - 92.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Lim and K. S.J. Elenitoba-Johnson
The Molecular Pathology of Primary Immunodeficiencies
J. Mol. Diagn.,
May 1, 2004;
6(2):
59 - 83.
[Full Text]
[PDF]
|
|
|
|
|
|
|
K C Gilmour, D Walshe, S Heath, G Monaghan, S Loughlin, T Lester, G Norbury, and C M Cale
Immunological and genetic analysis of 65 patients with a clinical suspicion of X linked hyper-IgM
Mol. Pathol.,
October 1, 2003;
56(5):
256 - 262.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Junt, H. Nakano, T. Dumrese, T. Kakiuchi, B. Odermatt, R. M. Zinkernagel, H. Hengartner, and B. Ludewig
Antiviral Immune Responses in the Absence of Organized Lymphoid T Cell Zones in plt/plt Mice
J. Immunol.,
June 15, 2002;
168(12):
6032 - 6040.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K Khawaja, A R Gennery, T J Flood, M Abinun, and A J Cant
Bone marrow transplantation for CD40 ligand deficiency: a single centre experience
Arch. Dis. Child.,
June 1, 2001;
84(6):
508 - 511.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
T. Sakai, M. Matsuoka, M. Aoki, K. Nosaka, and H. Mitsuya
Missense mutation of the interleukin-12 receptor {beta}1 chain-encoding gene is associated with impaired immunity against Mycobacterium avium complex infection
Blood,
May 1, 2001;
97(9):
2688 - 2694.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Weller, A. Faili, C. Garcia, M. C. Braun, F. Le Deist, G. de Saint Basile, O. Hermine, A. Fischer, C.-A. Reynaud, and J.-C. Weill
CD40-CD40L independent Ig gene hypermutation suggests a second B cell diversification pathway in humans
PNAS,
January 30, 2001;
98(3):
1166 - 1170.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Garber, L. Su, B. Ehrenfels, M. Karpusas, and Y.-M. Hsu
CD154 Variants Associated with Hyper-IgM Syndrome Can Form Oligomers and Trigger CD40-mediated Signals
J. Biol. Chem.,
November 19, 1999;
274(47):
33545 - 33550.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Grammer, R. D. McFarland, J. Heaney, B. F. Darnell, and P. E. Lipsky
Expression, Regulation, and Function of B Cell-Expressed CD154 in Germinal Centers
J. Immunol.,
October 15, 1999;
163(8):
4150 - 4159.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. de Vries, J. G. Noordzij, E. G. Davies, N. Hartwig, J. J.M. van Dongen, M. J.D. van Tol;, H. D. Ochs, and K. Seyama
The 782C right-arrow T (T254M) XHIM Mutation: Lack of a Tight Phenotype-Genotype Relationship
Blood,
August 15, 1999;
94(4):
1488 - 1490.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Perez-Melgosa, D. Hollenbaugh, and C. B. Wilson
Cutting Edge: CD40 Ligand Is a Limiting Factor in the Humoral Response to T Cell-Dependent Antigens
J. Immunol.,
August 1, 1999;
163(3):
1123 - 1127.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Seyama, W. R. A. Osborne, and H. D. Ochs
CD40 Ligand Mutants Responsible for X-linked Hyper-IgM Syndrome Associate with Wild Type CD40 Ligand
J. Biol. Chem.,
April 16, 1999;
274(16):
11310 - 11320.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. E. Morris, R. L. Remmele Jr., R. Klinke, B. M. Macduff, W. C. Fanslow, and R. J. Armitage
Incorporation of an Isoleucine Zipper Motif Enhances the Biological Activity of Soluble CD40L (CD154)
J. Biol. Chem.,
January 1, 1999;
274(1):
418 - 423.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Su, E. A. Garber, and Y.-M. Hsu
CD154 Variant Lacking Tumor Necrosis Factor Homologous Domain Inhibits Cell Surface Expression of Wild-type Protein
J. Biol. Chem.,
January 12, 2001;
276(3):
1673 - 1676.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract