|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 8 (October 15), 1998:
pp. 2766-2770
The Val34Leu Polymorphism in the A Subunit of Coagulation Factor XIII
Contributes to the Large Normal Range in Activity and Demonstrates
That the Activation Peptide Plays a Role in Catalytic Activity
By
S. Kangsadalampai and
P.G. Board
From the Molecular Genetics Group, John Curtin School of Medical
Research, Australian National University, Canberra, Australia.
 |
ABSTRACT |
There is a wide normal range of coagulation factor XIII activity
that has never been adequately explained. A polymorphism substituting
leucine for valine at position 34 in the activation peptide of the A
subunit of factor XIII has recently been discovered in nondeficient
individuals, and the present studies indicate that the leucine
substitution results in a significant increase in transglutaminase
activity. The frequency of the Leu34 allele in the Australian Caucasian
population is 0.27, which is high enough to suggest that the
inheritance of either the Val34 or Leu34 alleles may contribute to the
wide normal range of activity. Although there has been structural
evidence indicating that the activation peptide does not dissociate
from the enzyme after thrombin cleavage, the discovery of elevated
activity resulting from the Leu34 substitution is the first direct
evidence that the activation peptide plays a continuing role in the
function of factor XIII.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
COAGULATION FACTOR XIII has a
transglutaminase activity that forms  glutamyl  lysine isopeptide
bonds between fibrin monomers.1 This cross-linking confers
added strength to the clot and increases its resistance to degradation
by plasmin. Inherited deficiencies of factor XIII lead to delayed
bleeding after trauma and poor wound healing. In the absence of
replacement therapy, intracranial bleeding can result in severe
neurological impairment or death.2
Factor XIII in plasma is a heterotetramer composed of two A subunits
arranged as a dimer in association with two B subunits.2,3 The A subunits are responsible for the transglutaminase activity after
the thrombolytic cleavage of an N-terminal activation
peptide.4 The B subunit is a glycoprotein and has no known
enzymatic activity. It is thought that the B subunit forms a complex
with the A subunit dimer and protects it from elimination from the
circulation.5-8 This view is supported by the observation
that genetic deficiency of B subunits leads to a secondary deficiency
of A subunits in the plasma.8
Previous studies have shown that the A subunit is genetically
heterogeneous and a number of polymorphisms have been identified in the
protein sequence.9-12 Several studies have shown that there is a large range of plasma A subunit transglutaminase activity in the
normal population, and it is possible that the different levels of
activity are related to the inheritance of different allelic
variants.13-17 Little is known about the effects of most polymorphisms on the enzymatic activity of the A subunit. To our knowledge, this has only been investigated in one study and there was
no apparent difference in the transglutaminase activity of FXIIIA*1 and FXIIIA*2, two previously studied
electrophoretically detectable variants.18
The factor XIII A subunit is a zymogen that is activated by the
cleavage of a 37 residue N-terminal peptide by thrombin. In this study,
we have shown that a polymorphic Val34Leu substitution in the
activation peptide has a significant effect on activity, demonstrating
that the activation peptide contributes to catalytic activity after its
cleavage. Furthermore, this polymorphism contributes to the wide range
of activity found in the normal population. This variation in activity
may also contribute to an explanation of the recently reported
association between the Val34Leu polymorphism and myocardial
infarction.19
| |
MATERIALS AND METHODS |
DNA and plasma samples.
The blood samples were collected from Australian Caucasian blood donors
(N = 150) through the Canberra Red Cross Blood Transfusion Service
(Canberrra, Australia). The donors were composed of 53% males and 47%
females, with an average age of 39 years (range, 16 to 69 years). Plasma was collected after centrifugation of a
whole blood sample at 3,000 rpm for 5 minutes and kept at
 20°C in small aliquots until used. DNA was isolated from the
buffy coat by phenol/chloroform extraction.
DNA amplification and genotyping.
The Val34Leu polymorphism was detected by a previously undescribed
method that used a modified primer to introduce a restriction site into
one allele during amplification of the DNA. The polymerase chain
reaction (PCR) was used to amplify a 192-bp fragment from the factor XIII A subunit gene extending from intron A to exon II and
encompassing codon 34. A pair of specific primers (forward primer,
5 CATGCCTTTTCTGTTGTCTTC 3; reverse primer,
5TACCTTGCAGGTTGACGCCCCGGGGCACTA 3) were used in
a 100 µL reaction mix containing 100 to 200 ng genomic DNA, 50 mmol/L
KCl, 10 mmol/L Tris-HCl, pH 9.0, 0.1% Triton X-100, 1.5 mmol/L
MgCl2, 50 µmol/L dNTPs, 20 pmol of each primer, and 2 U
Taq DNA polymerase. Amplification was performed for 1 cycle at 94°C
for 3 minutes, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing for 1 minute at 56°C, and extension at 72°C
for 1 minute. A final extension at 72°C was performed for 5 minutes. In the case of the reverse primer, a modification (C to T,
underlined) was introduced to add a Dde I restriction enzyme
site in the Leu34 variant amplified DNA. This Dde I cleavage site is created by an alteration of the Leu34 sequence (CTTGG) to the modified sequence (CTTAG) and allows the
PCR-restriction fragment length polymorphism (RFLP)
genotyping of a G to T transversion (shown in italics) that causes the
Val34Leu polymorphism. Modification of the Val34 sequence (CGTGG to
CGTAG) does not create the site for Dde I. The PCR
product was digested with Dde I and the fragments were
separated by 8% polyacrylamide gel electrophoresis and stained with
ethidium bromide. To confirm the accuracy of this method, exon II was
amplified and sequenced from several samples shown to be either
homozygous for Val34, heterozygous, or homozygous for Leu34. No
discordant samples were identified.
Plasma factor XIII activity assay.
Plasma samples were assayed for their factor XIII activity by the
method of Dvilansky et al.13 In brief, 100 µL of plasma sample was incubated at 56°C for 3 minutes to remove fibrinogen and
centrifuged at 10,000 rpm for 5 minutes. Twenty-five microliters of the
defibrinated plasma was then added to an assay reaction containing 10 mmol/L CaCl2, 20 mmol/L dithiothreitol, 5 U/mL human thrombin, 3 mg/mL  casein, and 1 mmol/L putrescine (containing 0.625 µCi [1,4-14C] putrescine dihydrochloride; Amersham,
Arlington Heights, IL) in 0.3 mol/L Tris, pH 7.5. Transglutaminase activity was detected between 60 and 90 minutes after
the addition of the defibrinated plasma by spotting an aliquot of the
reaction mixture onto a 3MM filter paper disc followed by TCA
precipitation.20 Transglutaminase activity was expressed as
nanomoles of putrescine incorporated into casein by 1 mg of total
plasma protein in 1 hour. The activity of the purified enzyme was
determined in a similar manner, with the omission of the heat
denaturation. Protein concentration was determined using bovine serum
albumin as a standard.21
Expression and purification of recombinant factor XIII A subunit.
To express and purify recombinant factor XIII A subunit, we generated a
yeast plasmid pYF13AH that expressed A subunit with 6 histidine
residues at the C-terminal (Fig 1). In
brief, the plasmid included a 2.3-kb Pst I cDNA fragment
encoding the factor XIII A subunit from pKKF13A. The C-terminal 6 × His sequence was originally derived from pQE-70 (QIAGEN,
Clifton Hill, Victoria, Australia). The expression was regulated
by a Gal I promoter. The expression plasmid pYF13AH was
transfected into the Saccharomyces cerevisiae strain AH22 and
recombinants were selected on synthetic media without leucine.
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
A diagram showing the structure of the plasmid used to
express recombinant factor XIII with an extension of 6 histidine
residues at the C-terminal.
|
|
For factor XIII expression, cultures were grown in YPD22
broth overnight and then transferred to SD/galactose-Leu22
broth for 24 hours at 30°C. The yeast pellet from 1 L of culture
was washed twice with sterile water and then resuspended in 50 mL yeast
lysis buffer (50 mmol/L HEPES, pH 7.5, 150 mmol/L NaCl, 5 mmol/L EDTA,
1% Triton X-100, 1 mmol/L phenylmethylsulphonyl fluoride) and lysed by
passage through a Ribi cell disrupter (Sorval). The supernatant ( 50
mL) was collected by centrifugation at 10,000g for 10 minutes
at 4°C and was mixed with 4 mL of a 50% suspension of nickel
nitrilotriacetic acid agarose beads (Ni-NTA agarose; QIAGEN) at 4°C
for 2 to 3 hours. The beads were then washed three times in 4 vol of 50 mmol/L Na-phosphate buffer, pH 7.5, 300 mmol/L NaCl by centrifugation.
The beads were subsequently packed in a small column and then eluted
with 20 mL steps of 50, 100, and 500 mmol/L imidazole in the washing
buffer. Fractions containing transglutaminase activity were checked for
purity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) with Coomassie Blue staining and pooled.
Mutagenesis.
A 2.3-kb Xba I-HindIII fragment containing the A
subunit cDNA was transferred from pYF13AH and cloned into M13 mp18. The
single-stranded DNA derived from the M13 clone was used as a template
to introduce a Leu codon at position 34 by the use of a Sculptor
mutagenesis kit (Amersham) and the oligonucleotide primer F13V34L
5-CCGGGGCACCAAGCCCTGAAG-3. Mutant clones were identified
by sequencing and the modified 2.3-kb Xba I-HindIII
cDNA fragment was recloned into pYF13AH to become pYF13Leu34.
| |
RESULTS |
To determine if the Val34Leu polymorphism in factor XIII A subunit
affected activity, recombinant factor XIII A subunits with either a
valine or a leucine residue in position 34 have been expressed in
yeast. The incorporation of an extension of 6 histidine residues at the
C-terminal has permitted the purification of the two forms of factor
XIII by affinity chromatography on Ni-NTA agarose. The resultant
proteins appear to be highly purified and largely free of contaminating
yeast proteins as judged by Coomassie Blue staining after SDS-PAGE
(Fig 2). Both recombinant enzymes were
found to have transglutaminase activity; however, the Leu variant had a
significantly higher specific activity than the Val form
(Table 1).
View larger version (60K):
[in this window]
[in a new window]
| Fig 2.
SDS-PAGE analysis of purified recombinant factor XIII A
subunits. Lane 1, molecular weight makers; lane 2, factor XIII 34Val;
lane 3, factor XIII 34Leu.
|
|
Although both forms of A subunit are found in clinically normal
individuals, little is known about the frequency of this polymorphism. To resolve this question, a modified PCR-RFLP procedure was developed to enable the rapid genotyping of individuals. Because there were no
restriction enzyme sites associated with this polymorphism, a primer
was designed containing a G to A substitution that created a
Dde I site in the Leu allele but not in the Val allele. After amplification of exon II DNA with the modified primer, the genotype could be readily determined by Dde I digestion and acrylamide gel electrophoresis (Fig 3). The technique
was checked by the random sequencing of the region from several
individuals and the results were always in complete agreement. This
technique was used to genotype a sample of 150 Caucasian blood donors
(Table 2). Clearly the Val34 allele is more frequent
than the Leu34 allele in this population. The distribution of genotypes
is not significantly different from that expected in a Hardy-Weinberg equilibrium. The frequency of these two alleles in other populations has not been published; however, we have calculated these values for
several other population samples from previously published haplotype
data12 (Table 3). This analysis shows that
the Val34 allele is the most frequent in all of the racial groups
studied so far. The Leu allele is rare in Japanese, suggesting that the gene frequency may vary significantly between major racial groups.
View larger version (47K):
[in this window]
[in a new window]
| Fig 3.
(A) PCR-RFLP analysis of the Val34Leu polymorphism in
exon II of the factor XIII A subunit gene. The fragment amplified from
exon II was digested with Dde I. This fragment is 192 bp in
length and does not normally contain a Dde I site in either
allele. The Dde I site was selectively introduced into the
Leu34 allele by the use of a modified primer (see Materials and
Methods). Lane 1, molecular size markers; lane 2, DNA from a Val34
homozygote; lane 3, DNA from a Val34/Leu34 heterozygote; lane 4, DNA
from a Leu34 homozygote. The expected sizes of the DNA fragments after
digestion are shown on the right and schematically at the bottom of the
figure. (B) Direct sequencing of amplified exon II from individuals
with each genotype. The Val34 and Leu34 sequences are given on the
right. The substituted nucleotide G to T causing the Val34Leu
substitution is shown in bold type and the position of the base
substitution is marked (*).
|
|
View this table:
[in this window]
[in a new window]
|
Table 2.
Gene Frequency of the Factor XIII A Subunit Val34Leu
Polymorphism in the Australian Caucasian Population (n = 150)
|
|
It was of interest to determine if the difference in activity of the
recombinant proteins was also found in human plasma factor XIII.
Comparison of the factor XIII transglutaminase activity in the plasma
from individuals with the different genotypes indicated that those that
are homozygous for the Leu34 allele have significantly higher activity
(P = .016) than those that are homozygous for the Val34 allele,
and heterozygotes have an intermediate value (Table 4).
This difference in activity is in agreement with the difference found
between the purified recombinant Leu34 and Val34 enzymes.
| |
DISCUSSION |
Although a number of previous studies have noted a wide range of factor
XIII activity in the normal population,13-17 there have
been few attempts to explain this phenomena. Because of the wide normal
range, it has not been possible to use activity measurements to
reliably identify heterozygotes in families in which factor XIII
deficiency is segregating. This has presented problems for genetic
counselling in affected families. Several genetic polymorphisms in the
A subunit of factor XIII have been described, and it is possible that
some amino acid substitutions may influence activity.9-12 In a previous study, the electrophoretically detectable variants FXIIIA*1 and FXIIIA*2 were purified and characterized.18
However, there was no difference in the specific activity of these two isoenzymes. To further investigate the origin of the wide range of
normal activity, we have studied the influence of the Val34Leu substitution.11 The specific activity of the purified
recombinant Leu34 enzyme was notably higher than that of the Val34
form. To confirm this difference, the investigation was extended to the evaluation of factor XIII activity in plasma from normal blood donors
with different genotypes. The blood donors were genotyped by a modified
PCR-RFLP method that generated a Dde I site in the Leu34
allele. The activity of Leu34 homozygotes was significantly higher than
the activity of the Val34 homozygotes, confirming the difference found
between the purified recombinant proteins. Because the site of this
polymorphism in the activation peptide is only 4 residues from the
thrombin cleavage site, it is possible that the particular residue at
this position may influence the rate of activation and this could
account for the differences in activity. However, in a previously
published study13 and our own unpublished work, it has been
shown that, under the conditions used, plasma A subunit is fully
activated after 30 minutes. In the present study, the activity was
determined between 60 and 90 minutes after thrombin activation. This
delay therefore provided adequate time for complete
activation.
The frequency of the two alleles in the Australian population is
sufficiently high that the difference in activity between their
products may contribute substantially to the wide range of factor XIII
activity observed in the normal population. However, because a number
of polymorphisms have been detected in the A subunit gene, including a
tetranucleotide short tandem repeat in the 5 flanking
region,23 the possibility that other polymorphisms in the A
subunit gene may also contribute to the wide normal range cannot be
ruled out.
Because a polymorphism in the prothrombin gene was found to be
associated with elevated plasma prothrombin levels and an increase in
venous thrombosis,24 it is possible that the Val34Leu
polymorphism in the factor XIII A subunit gene may be another risk
factor for venous thrombosis and cardiovascular disease. The recent
study of Kohler et al19 suggests that the Leu34 allele
protects against myocardial infarction. The mechanism of this
protection is not immediately obvious, because the higher level of
activity of the Leu34 enzyme might be expected to create a greater risk
by increasing resistance of fibrin clots to plasmin degradation. Thus,
further study in patients with thrombosis and other forms of
cardiovascular disease is required.
It was originally considered that, after thrombin cleavage, the
activation peptide played no further part in the activity of the A
subunit. However, there are now several lines of evidence to suggest
that the activation peptide of factor XIII A might play a continuing
role in enzymatic catalysis. First, there is crystallographic evidence
that, following thrombin cleavage after Arg37, the activation peptide
fragment still remains associated with the A subunit
molecule.25 Second, in the A subunit dimer, Arg11 in the
activation peptide of one subunit forms a salt-bridge with Asp343 of
the other subunit; this interaction may contribute to the proposed role
of Asp343 in guiding the lysine substrate to the active
site.26 The third line of evidence is the effect described
in this study of the amino acid substitution Val34Leu on the
transglutaminase activity of the A subunit. This is the first direct
evidence indicating the involvement of the activation peptide in the
transglutaminase reaction of factor XIII.
The thrombin cleavage site and the Val/Leu34 residue are positioned in
a loop that is not clearly defined in the available crystal structures.
Thus, it is difficult to even speculate on the mechanism by which this
substitution influences transglutaminase activity. However, it is clear
that, in the available crystal structures, the active site is buried
and inaccessible.25-27 It therefore seems likely that there
is a structural change to accommodate the entry of fibrin into the
active site and this could involve the activation peptide. The
resolution of this question may depend on the solution of the crystal
structure with fibrin in the active site.
| |
FOOTNOTES |
Submitted March 20, 1998;
accepted June 10, 1998.
Address reprint requests to P.G. Board, PhD, Molecular Genetics Group,
John Curtin School of Medical Research, GPO Box 334, Canberra ACT 2601, Australia.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors are grateful to the Canberra Red Cross Blood Transfusion
Service for providing the blood samples used in this study and to Dr G. Chelvanayagam for advice on the structural implications of this
polymorphism.
| |
REFERENCES |
1.
Folk JE,
Finlayson JS:
The -(-glutamyl)lysine crosslink and the catalytic role of transglutaminases.
Adv Protein Chem
31:1,
1977[Medline]
[Order article via Infotrieve]
2.
Board PG,
Losowsky MS,
Miloszewski KJA:
Factor XIII: Inherited and acquired deficiency.
Blood Rev
7:229,
1993[Medline]
[Order article via Infotrieve]
3.
Schwartz ML,
Pizzo SV,
Hill RL,
McKee PA:
Human factor XIII from plasma and platelets. Molecular weights, subunit structures, proteolytic activation, and cross-linking of fibrinogen and fibrin.
J Biol Chem
248:1395,
1973[Abstract/Free Full Text]
4.
Lorand L,
Gray AJ,
Brown K,
Credo RB,
Curtis CG,
Domanik RA,
Stenberg P:
Dissociation of the subunit structure of fibrin stabilizing factor during activation of the zymogen.
Biochem Biophys Res Commun
56:914,
1974[Medline]
[Order article via Infotrieve]
5.
Schwartz ML,
Pizzo SV,
Hill RL,
McKee PA:
The subunit structures of human plasma and platelet factor XIII (fibrin-stabilizing factor).
J Biol Chem
246:5851,
1971[Abstract/Free Full Text]
6.
Bohn H,
Becker W,
Trobisch H:
Molecular structure of fibrin stabilizing factors in man. II. Comparative immunologic studies on factor XIII deficient plasma and normal plasma.
Blut
26:303,
1973[Medline]
[Order article via Infotrieve]
7.
Mary A,
Achyuthan KE,
Greenberg CS:
b-chains prevent the proteolytic inactivation of the a-chains of plasma factor XIII.
Biochim Biophys Acta
966:328,
1988[Medline]
[Order article via Infotrieve]
8.
Hashiguchi T,
Saito M,
Morishita E,
Matsuda T,
Ichinose A:
Two genetic defects in a patient with complete deficiency of the b-subunit for coagulation factor XIII.
Blood
82:145,
1993[Abstract/Free Full Text]
9.
Board PG:
Genetic polymorphism of the A subunit of human coagulation factor XIII.
Am J Hum Genet
31:116,
1979[Medline]
[Order article via Infotrieve]
10.
Ichinose A,
Davie EW:
Characterization of the gene for the A subunit of human factor XIII (plasma transglutaminase), a blood coagulation factor.
Proc Natl Acad Sci USA
85:5829,
1988[Abstract/Free Full Text]
11.
Mikkola H,
Syrjälä M,
Rasi V,
Vahtera A,
Hämäläinen E,
Peltonen L,
Palotie A:
Deficiency in the A subunit of coagulation factor XIII: Two novel point mutations demonstrate different effects on transcript levels.
Blood
84:517,
1994[Abstract/Free Full Text]
12.
Suzuki K,
Henke J,
Iwata M,
Henke L,
Tsuji H,
Fukunaga T,
Ishimoto G,
Szekelyi M,
Ito S:
Novel polymorphisms and haplotypes in the human coagulation factor XIII A subunit gene.
Hum Genet
98:393,
1996[Medline]
[Order article via Infotrieve]
13.
Dvilansky A,
Britten AFH,
Loewy AG:
Factor XIII assay by an isotope method. I. Factor XIII (transamidase) in plasma, serum, leucocytes, erythrocytes and platelets and evaluation of screening tests of clot solubility.
Br J Haematol
18:399,
1970[Medline]
[Order article via Infotrieve]
14.
Castle S,
Board PG,
Anderson RAM:
Genetic heterogeneity of factor XIII deficiency: First description of unstable A subunit.
Br J Haematol
48:337,
1981[Medline]
[Order article via Infotrieve]
15.
Fickenscher K,
Aab A,
Stuber W:
A photometric assay for blood coagulation factor XIII.
Thromb Haemost
65:535,
1991[Medline]
[Order article via Infotrieve]
16.
Dempfle CE,
Harenberg J,
Hochreuter K,
Heene DL:
Microtiter assay for measurement of factor XIII activity in plasma.
J Lab Clin Med
119:522,
1992[Medline]
[Order article via Infotrieve]
17.
Wagner B,
Seyfert UT,
Gosse M,
Wenzel E,
Fickenscher K,
Ruhl HG:
Determination of factor XIII activity by a new photometric assay in plasma and platelets of healthy blood donors.
Thromb Res
74:169,
1994[Medline]
[Order article via Infotrieve]
18.
Castle SL,
Board PG:
Biochemical characterization of genetically variant and abnormal blood coagulation factor XIII A subunits.
Clin Chim Acta
133:141,
1983[Medline]
[Order article via Infotrieve]
19.
Kohler HP,
Stickland MH,
Ossei-Gerning N,
Carter A,
Mikkola H,
Grant PJ:
Association of a common polymorphism in the factor XIII gene with myocardial infarction.
Thromb Haemost
79:8,
1998[Medline]
[Order article via Infotrieve]
20.
Mans R,
Novelli GD:
Measurement of the incorporation of radioactive amino acids into protein by a filter paper disk method.
Arch Biochem Biophys
94:48,
1961
21.
Lowry OH,
Rosenbrough NJ,
Farr AL,
Randall RJ:
Protein measurement with the folin phenol reagent.
J Biol Chem
193:265,
1951[Free Full Text]
22.
Sherman F:
Getting started with yeast.
Methods Enzymol
194:3,
1991[Medline]
[Order article via Infotrieve]
23.
Polymeropoulos MH,
Rath DS,
Xiao H,
Merril CR:
Tetranucleotide repeat polymorphism at the human coagulation factor XIII A subunit gene (F13A1).
Nucleic Acids Res
19:4306,
1991[Free Full Text]
24.
Poort SR,
Rosendaal FR,
Reitsma PH,
Bertina RM:
A common genetic variation in the 3 untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis.
Blood
88:3698,
1996[Abstract/Free Full Text]
25.
Yee VC,
Pedersen LC,
Bishop PD,
Stenkamp RE,
Teller DC:
Structural evidence that the activation peptide is not released upon thrombin cleavage of factor XIII.
Thromb Res
78:389,
1995[Medline]
[Order article via Infotrieve]
26.
Yee VC,
Le Trong I,
Bishop PD,
Pedersen LC,
Stenkamp RE,
Teller DC:
Structure and function studies of factor XIIIa by x-ray crystallography.
Semin Thromb Hemost
22:377,
1996[Medline]
[Order article via Infotrieve]
27.
Yee VC,
Pedersen LC,
Le Trong I,
Bishop PD,
Stenkamp RE,
Teller DC:
Three dimensional structure of a transglutaminase: Human blood coagulation factor XIII.
Proc Natl Acad Sci USA
91:7296,
1994[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
N. Akar, B. Donmez, and G. Deda
FXIII Gene Val34Leu Polymorphism in Turkish Children with Cerebral Infarct
J Child Neurol,
February 1, 2007;
22(2):
222 - 224.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. de Lange, T. Andrew, H. Snieder, D. Ge, T. S. Futers, K. Standeven, T. D. Spector, P. J. Grant, and R. A.S. Ariens
Joint Linkage and Association of Six Single-Nucleotide Polymorphisms in the Factor XIII-A Subunit Gene Point to V34L As the Main Functional Locus
Arterioscler Thromb Vasc Biol,
August 1, 2006;
26(8):
1914 - 1919.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. S. Wells, J. L. Anderson, D. K. Scarvelis, S. P. Doucette, and F. Gagnon
Factor XIII Val34Leu Variant Is Protective against Venous Thromboembolism: A HuGE Review and Meta-Analysis
Am. J. Epidemiol.,
July 15, 2006;
164(2):
101 - 109.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R Diz-Kucukkaya, V S Hancer, M Inanc, M Nalcaci, and Y Pekcelen
Factor XIII Val34Leu polymorphism does not contribute to the prevention of thrombotic complications in patients with antiphospholipid syndrome
Lupus,
January 1, 2004;
13(1):
32 - 35.
[Abstract]
[PDF]
|
|
|
|
|
|
|
C. Butt, H. Zheng, E. Randell, D. Robb, P. Parfrey, and Y.-G. Xie
Combined carrier status of prothrombin 20210A and factor XIII-A Leu34 alleles as a strong risk factor for myocardial infarction: evidence of a gene-gene interaction
Blood,
April 15, 2003;
101(8):
3037 - 3041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Aleksic, C. Ahn, Y.-W. Wang, H. Juneja, A. R. Folsom, E. Boerwinkle, and K. K. Wu
Factor XIIIA Val34Leu Polymorphism Does Not Predict Risk of Coronary Heart Disease: The Atherosclerosis Risk in Communities (ARIC) Study
Arterioscler Thromb Vasc Biol,
February 1, 2002;
22(2):
348 - 352.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Weger, W. Renner, O. Stanger, O. Schmut, H. Deutschmann, T. C. Wascher, and A. Haas
Role of Factor XIII Val34Leu Polymorphism in Retinal Artery Occlusion
Stroke,
December 1, 2001;
32(12):
2759 - 2761.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. P. Reiner, S. M. Schwartz, M. B. Frank, W.T. Longstreth Jr, L. A. Hindorff, G. Teramura, F. R. Rosendaal, L. K. Gaur, B. M. Psaty, D. S. Siscovick, et al.
Polymorphisms of Coagulation Factor XIII Subunit A and Risk of Nonfatal Hemorrhagic Stroke in Young White Women Editorial Comment
Stroke,
November 1, 2001;
32(11):
2580 - 2587.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Karpati, B. Penke, E. Katona, I. Balogh, G. Vamosi, and L. Muszbek
A Modified, Optimized Kinetic Photometric Assay for the Determination of Blood Coagulation Factor XIII Activity in Plasma
Clin. Chem.,
December 1, 2000;
46(12):
1946 - 1955.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Balogh, G. Szoke, L. Karpati, U. Wartiovaara, E. Katona, I. Komaromi, G. Haramura, G. Pfliegler, H. Mikkola, and L. Muszbek
Val34Leu polymorphism of plasma factor XIII: biochemistry and epidemiology in familial thrombophilia
Blood,
October 1, 2000;
96(7):
2479 - 2486.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. S. Ariens, H. Philippou, C. Nagaswami, J. W. Weisel, D. A. Lane, and P. J. Grant
The factor XIII V34L polymorphism accelerates thrombin activation of factor XIII and affects cross-linked fibrin structure
Blood,
August 1, 2000;
96(3):
988 - 995.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood,
March 1, 2000;
95(5):
1517 - 1532.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Elbaz, O. Poirier, S. Canaple, F. Chedru, F. Cambien, and P. Amarenco
The association between the Val34Leu polymorphism in the factor XIII gene and brain infarction
Blood,
January 15, 2000;
95(2):
586 - 591.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. S. Ariens, H. P. Kohler, M. W. Mansfield, and P. J. Grant
Subunit Antigen and Activity Levels of Blood Coagulation Factor XIII in Healthy Individuals : Relation to Sex, Age, Smoking, and Hypertension
Arterioscler Thromb Vasc Biol,
August 1, 1999;
19(8):
2012 - 2016.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Anwar, L. Gallivan, S. D. Edmonds, and A. F. Markham
Genotype/Phenotype Correlations for Coagulation Factor XIII: Specific Normal Polymorphisms Are Associated With High or Low Factor XIII Specific Activity
Blood,
February 1, 1999;
93(3):
897 - 905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. A. Trumbo and M. C. Maurer
Examining Thrombin Hydrolysis of the Factor XIII Activation Peptide Segment Leads to a Proposal for Explaining the Cardioprotective Effects Observed with the Factor XIII V34L Mutation
J. Biol. Chem.,
June 30, 2000;
275(27):
20627 - 20631.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Sadasivan and V. C. Yee
Interaction of the Factor XIII Activation Peptide with alpha -Thrombin. CRYSTAL STRUCTURE OF ITS ENZYME-SUBSTRATE ANALOG COMPLEX
J. Biol. Chem.,
November 17, 2000;
275(47):
36942 - 36948.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract