|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 8 (October 15), 1998:
pp. 2844-2855
A High Frequency of Circulating B Cells Share Clonotypic Ig
Heavy-Chain VDJ Rearrangements With Autologous Bone Marrow Plasma Cells
in Multiple Myeloma, as Measured by Single-Cell and In Situ Reverse
Transcriptase-Polymerase Chain Reaction
By
Agnieszka J. Szczepek,
Karen Seeberger,
Juanita Wizniak,
Michael
J. Mant,
Andrew R. Belch, and
Linda M. Pilarski
From the Departments of Oncology and Medicine, University of Alberta
and the Cross Cancer Institute, Edmonton, Alberta T6G1Z2 Canada.
 |
ABSTRACT |
In multiple myeloma (MM), the VDJ rearrangement of the
immunoglobulin heavy chain expressed by MM plasma cells provides a unique clonotypic marker. Although clonotypic MM cells have been found
in the circulation, their number has been controversial. Our objective
was to provide direct evidence, using single-cell assays, for the
frequency of clonotypic cells in blood of 18 MM patients, and to
confirm their identity as B cells. The clonotypic Ig heavy-chain
(IgH) VDJ was determined from single plasma cells using
consensus reverse transcriptase-polymerase chain reaction (RT-PCR),
subcloning, and sequencing. For all patients, using patient-specific
primers, clonotypic transcripts were amplified from 10 or more
individual plasma cells. Using in situ RT-PCR, for all patients greater
than 80% of plasma cells were found to be clonotypic. Three separate
methods, RT-PCR, single-cell RT-PCR, and in situ RT-PCR, were used to
analyze clonotypic cells in peripheral blood mononuclear cells (PBMC)
from MM patients. Sequencing of the IgH transcripts expressed by
individual cells obtained by limiting dilution of freshly isolated PBMC
from a MM patient showed that all B cells expressed an identical CDR3.
This intraclonal homogeneity indicates an escape from
antigenic-selection, characteristic of malignant B cells. For this
patient, the frequency of clonotypic PBMC, about 25%, was comparable
to the number of PBMC B cells (34%). Because the PBMC included less
than 1% plasma cells, virtually all clonotypic PBMC must be B cells.
Using single-cell RT-PCR, clonotypic IgH transcripts were identified in
individual sorted B cells from blood. To accurately quantify the number
of clonotypic B cells, sorted B cells derived from 18 MM patients (36 samples) and 18 healthy donors (53 samples) were analyzed using in situ RT-PCR with patient-specific primers. Clonotypic transcripts were not
detectable among normal B cells. For the 18 MM patients, a mean of 66% ± 4% (SE) of blood B cells were clonotypic (range, 9% to 95%),
with mean absolute number of 0.15 ± .02 × 109/L blood.
Over time in individual patients, conventional chemotherapy transiently
decreased circulating clonotypic B cells. Their numbers were increased
in granulocyte colony-stimulating factor (G-CSF)- mobilized
blood of one patient. However, clonotypic B cells of a one patient
became undetectable after allogeneic transplant, correlating with
complete remission. Although contributions to MM spread and progression
is likely, their malignant status and impact has yet to be clarified.
Their high frequency in the blood, and their resistence to conventional
chemotherapy suggests that the number of circulating clonotypic cells
should be clinically monitored, and that therapeutic targeting of these
B cells may benefit myeloma patients.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
MULTIPLE MYELOMA (MM), a B-cell
neoplasia, is characterized by the presence of monoclonal
immunoglobulin in the blood, lytic bone lesions, and often large
numbers of monoclonal plasma cells in the bone marrow (BM). Although
many patients respond initially, nearly all relapse and become
refractory to treatment.1,2 While it is clear that
monoclonal plasma cells located in the BM directly or indirectly
mediate most symptoms of myeloma, these cells do not appear to have the
qualities of growth and spread required of a malignant progenitor cell.
A number of observations have led to the view that the generative
compartment in myeloma includes B-lineage cells found in the BM, the
blood, or both, at a stage of differentiation preceding that of plasma
cells.3-15
For B-lineage malignancies, unique sequences within the Ig genes,
termed complementarity determining regions (CDR1, CDR2, CDR3), provide
a consistent molecular marker for unequivocal identification of clonal
B-lineage cells. Many studies have shown cells in the blood of myeloma
patients with an Ig heavy-chain (IgH) rearrangement identical to that
of autologous BM plasma cells.4,8,9,16-23 Although the
differentiation stage of these blood cells and their number is
controversial, the sharing of IgH rearrangements with the malignant
plasma cells is widely accepted as indicative of a clonal relationship,
termed clonotypic. A first step towards evaluating the extent to which
peripheral blood mononuclear cells (PBMC) include myeloma-associated or
precursor cells is to quantitate the number of clonotypic B cells in
the circulation. Previous work showing the presence in PBMC of cells
with clonotypic rearrangements have provided a wide range of
numbers.4,16,17,23,24 Most of these numbers are estimates
based on the frequency of a given sequence in nucleic acids purified
from heterogeneous cell populations. Circulating plasma cells cannot
account for the sometimes large numbers of clonotypic blood cells in
myeloma.17 To assess the number of individual cells with
clonotypic transcripts in myeloma PBMC and BM cells (BMC), single-cell
assays are required. Analysis of myeloma PBMC, using marker sequences
confirmed as clonal, indicate a large subset of circulating clonotypic
CD19+ cells.24,25 These B cells are
morphologically and functionally distinct from plasma
cells.4,5,24,25,27 They are CD19+,
CD11b+ CD34+ cells4,24,25 that
express messenger RNA (mRNA) encoding IgH, CD19, and
CD34.24,26 This clonotypic B cell subset has properties
consistent with malignant status.24,25,28-31
CD34+ CD11b+ B cells are the predominant clonotypic subset
in blood, with an average of 81% to 87% clonotypic
cells.24,25 The drug resistance of these
cells,25,28,32 and their persistence after chemotherapy4,28 implicates them in the events underlying relapse. The frequency of myeloma B cells is most accurately determined using methods that analyze individual B-lineage cells. In this report,
using single-cell reverse transcriptase-polymerase chain reaction
(RT-PCR) assays and in situ RT-PCR with patient-specific primers, we show that a large proportion of individual myeloma B cells
are clonotypic.
 |
MATERIALS AND METHODS |
Patients and samples.
Blood and BM were obtained after informed consent from 19 patients with
MM, at diagnosis, during intermittent chemotherapy and after treatment
(Table 1). Blood was also obtained from 18 healthy donors, and BM from 5 healthy donors. BM aspirates used for
deriving the clonotypic IgH VDJ sequence had 11% to 80% plasma cells
as identified morphologically and phenotypically. BMC were purified
using Ficoll Paque (Pharmacia, Dorval, Quebec, Canada). Peripheral
blood was drawn into heparinized tubes and purified over Ficoll Paque
(Pharmacia) to give PBMC. Because no EDTA was added, cell-free DNA or
RNA from serum would be immediately degraded33 and thus
could not be a source of contamination in the analysis described below.
All samples were purified immediately after being drawn. For RT-PCR,
PBMC were lysed in Trizol (GIBCO-BRL, Burlington, Ontario,
Canada) immediately after purification. For in situ RT-PCR, cells were
antibody labeled and stored for 18 hours in fixative before sorting.
For single-cell RT-PCR, cells were either used immediately in the
limiting dilution assay or were antibody labeled, sorted, and processed
within 3 to 4 hours after collection of the sample. For limiting
dilution analysis, PBMC were diluted to an appropriate concentration as
indicated in Results, and immediately deposited into PCR tubes
containing lysis buffer (see below). This study analyzed all myeloma
patients presenting at our institution for whom a BM sample had been
obtained during the course of the study.
Antibodies and reagents.
FMC63 (CD19)34,35 was conjugated to fluorescein
isothiocyanate (FITC). Leu17-phycoerythrin (PE) (CD38) was from Becton Dickinson (San Jose, CA). Ig2aPE, antihuman Ig F(ab)2
fragments coupled to FITC and F(ab)2 fragments of
goat-antimouse PE were purchased from Southern Biotech (Birmingham,
AL).
Immunofluorescence (IF) and sorting.
Staining for surface phenotype used one- or two-color IF with CD19-FITC
or CD38-PE/antihuman Ig-FITC, as well as all relevant isotype controls,
as described previously.4,24,28 BMC were stained with
CD38-PE and antihuman Ig-FITC followed by sorting of CD38hi
Ig+ BMC with high forward and side scatter. PBMC were
sorted for CD19+ cells with no gates set on scatter beyond
those used to exclude red and dead cells. The CD19+ B cells
sorted here were detected by their staining with either FMC63 or B4
(Coulter, Oakville, Ontario, Canada) but were not detected by Leu12
(Becton Dickinson)1A,5,36 (International Myeloma Workshop,
Boston, 1997), or by monoclonal antibody (MoAb) to CD19 from Sigma
(Oakville, Ontario, Canada), Dako (Detroit,
MI), or Immunotech/Coulter (Burlington, Ontario, Canada).
Neuraminidase treatment shows Leu12 epitopes indicating they are
present but cryptic on these B cells.36 For single-cell experiments, individual CD19+ PBMC or
CD38hiIg+ large BMC were sorted directly into
0.2 mL thin-walled PCR tubes or onto slides. On reanalysis, sorted
populations had a purity of 96% or greater for the defining phenotype.
Less than 1% of morphologically identifiable plasma cells were
observed in cytospins of sorted B cells (performed for six patients),
in cytospins of PBMC (for four patients), or in smears of patient blood
(all patients).
Identification of patient-specific (clonotypic) IgH sequences and
primer selection.
The clonotypic sequence was determined from mRNA of 1 to 1000 BM plasma
cells using consensus RT-PCR, followed by sequencing of the amplified
product from at least 3 individual plasma cells or from 6 subclones of
the consensus product. Primers to histone, a housekeeping mRNA, were
used as a positive control to ensure mRNA integrity. IgH VDJ region
primers to FR2, J region, or to Vh3 family4,37 were as
previously described. CDR2 and CDR3 patient-specific primers are given
in Results. Histone primers were as follows: 5' CCACTGAACTTCTGATTCGC,
3' GCGTGCTAGCTGGATGTCTT. The V, D, and J families of clonotypic IgH
sequences were analyzed, and patient-specific primers annealing to the
CDR2 and CDR3 portions of the identified IgH sequence were chosen using
the V-base sequence directory
(http://www.mrc-cpe.cam.ac.uk/imt-doc/vbase-home-page.html), DNAPLOT (http://www.mrc-cpe.cam.ac. uk/imt-doc/DNAsearch.html), and
Primer3 (Picks PCR primers from nucleotide sequence)
(http://www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi). Primers were
synthesized on ABI PCR mate 391 (Perkin Elmer, Applied Biosystems,
Mississauga, Ontario, Canada). To confirm the specificity of the chosen primers, they were used in PCR to identify a product of
the expected size from complementary DNA (cDNA) of individual autologous BM plasma cells, but not from cDNA of plasma cells or PBMC
of unrelated myeloma patients.
Patient-specific amplification (PSA).
For amplification of PS sequences, primers to the CDR2 and the CDR3
regions of the rearranged IgH VDJ from individual BM plasma cells were
designed and used for in situ RT-PCR. The size of PCR product varied in
individual patients within the range of 120 to 180 bp, and gave a
discrete single band when mRNA was analyzed. For all patients, the
specificity of the PSA was confirmed by testing the primers using RNA
isolated from PBMC B cells of healthy donors,
CD38hicIg+ BM plasma cells of healthy donors,
and unrelated myeloma B and plasma cells as negative controls.
RT-PCR: (consensus and specific).
Using Trizol according to manufacturers directions (GIBCO-BRL,
Burlington, Ontario, Canada), RNA was prepared from 0.1 to 10 × 106 unfractionated BMC, PBMC or sorted
populations of B cells from myeloma patients and normal donors. After
purification, 1 µg of RNA was reverse transcribed using SuperScript
reverse transcriptase (GIBCO-BRL) and universal primer oligo
dT15, according to the manufacturers instructions. PCR was
performed under standard conditions. Briefly, 2 µL of cDNA was added
to 48 µL of PCR buffer (GIBCO-BRL), 2 mmol/L MgCl2, mixed
with 0.2 µmol/L consensus primers FR2 and Jh, and 1 U/reaction tube
of TAQ polymerase: 25 cycles of 30 seconds at 94°C, 30 seconds at
50°C, and 45 seconds at 72°C were performed on the PCR Thermal
Cycler Perkin Elmer 9600 (Perkin Elmer). For consensus RT-PCR, a second
round of amplification used FR2 and a nested Jh consensus primer. For
PSA, as described above, the second round of amplification used
patient-specific primers (CDR2 and CDR3) for 25 cycles at an annealing
temperature of 60°C. The PCR product was analyzed on a 2% agarose
gel in tris-borate/EDTA (TBE) buffer, soaked in ethidium
bromide, and visualized under ultraviolet light.
Single-cell RT-PCR.
Using the ELITE flow cytometer with an Autoclone Cell Deposition Unit
(Coulter, Hiale, FL), single cells were sorted into 0.2 mL PCR tubes
containing 8 µL of RT-Lysis solution (SuperScript first-strand
buffer, 0.5% NP-40 (vol/vol), 0.01 mol/L dithiothreitol (DTT), 0.25 mmol/L dNTPs, 0.006 mmol/L dT16, 200 U of RNAse inhibitor (GIBCO-BRL).
Immediately after the sort, tubes were centrifuged for 1 minute and
then frozen at 80°C. After thawing, samples were heated to
70°C for 10 minutes, placed on ice, and 2 µL (100 U) of reverse
transcriptase SuperScript (GIBCO-BRL) was added into each tube and
incubated at 42°C for 60 minutes. The reaction was stopped by
heating at 99°C for 3 minutes. Alternatively, immediately after
purification, within 1 to 2 hours after the sample was drawn, PBMC were
diluted to an appropriate concentration as indicated in results and 1 µL of this suspension was deposited into 9 µL of lysis buffer
containing the reverse transcriptase, in PCR tubes. This step was
followed by an immediate incubation at 42°C for 60 minutes and next
at 99°C for 3 minutes. For either method, all of the obtained
single-cell cDNA was then used in a two-step nested PCR. Briefly, PCR
mix (0.2 mmol/L dNTPs, 10 mmol/L Tris-HCL pH 8.3, 0.2 µmol/L each of
sense and antisense primers, 2 mmol/L MgCl2, and 2 U of TAQ
polymerase) in a final volume of 50 µL was added to tubes, followed
by 30 cycles of 30 seconds at 94°C, 30 seconds at 52°C and 1 minute at 72°C. Four percent (vol/vol) of this PCR amplified
mixture was transferred into a secondary PCR mix with 2 mmol
MgCl2, FR2, and JH2 primers and cycled as previously for 35 cycles. Finally, 20% of the product was analyzed on 2% agarose gels
(GIBCO/BRL). For all samples, amplified products were subcloned into a
TA cloning vector (Invitrogen, Mississauga, Ontario, Canada) and cycle
sequenced with universal M13 forward and reverse primers. For
the PSA, 25 cycles were performed using CDR2 and CDR3 primers and an
annealing temperature of 60°C. The final product was analyzed on
2% agarose gel in 0.5 × TBE buffer.
For the limiting dilution analysis of single PBMC from patient 19, for
the first 30 cycles of PCR the Vh-3 (family specific) primer was used
in combination with the Jh consensus primer. For the next 35 cycles of
nested PCR, patient-specific primers for CDR2 and CDR3 were used
(expected product size = 176 bp). Samples were analyzed by
electrophoresis on 2% agarose gels and the product visualized by
ethidium bromide staining. To permit sequencing of the CDR3 region, the
PCR product from the first-stage PCR reaction (Vh3 and Jh primers) was
reamplified with a second set of primers, using a patient-specific
primer to CDR2 and a consensus Jh2 primer. For analysis of clonotypic
sequences from individual B cells, the product of the nested PCR was
subcloned into TA cloning vector. Plasmids were isolated from three to
five randomly chosen colonies from each transformation and sequenced
using dRhodamine terminator cycle sequencing ready reaction kit (PE
Applied Biosystems, Mississauga, Ontario, Canada). The sequencing
products were analyzed on a capillary sequencer ABI 310 (PE Applied
Biosystems).
In situ RT-PCR.
In situ RT-PCR was performed as previously described.24,25
 |
RESULTS |
Generation of patient-specific IgH VDJ sequences using single plasma
cell RT-PCR.
To identify clonotypic IgH VDJ sequences for individual myeloma
patients, single BM plasma cells were sorted directly into PCR tubes
containing RT-lysis buffer, followed by reverse transcription and
amplification of cDNA with consensus primers to FR2 and Jh of
IgH.4,24,25 For all patients analyzed, a PCR product was obtained from the majority of these sorted plasma cells
(Fig 1A).

View larger version (18K):
[in this window]
[in a new window]

View larger version (12K):
[in this window]
[in a new window]
| Fig 1.
RT-PCR amplification of IgH VDJ using consensus primers
from single BM plasma cells of a myeloma patient. (A) Individual BM
plasma cells from patient 2 were purified, stained, and sorted into PCR
tubes containing lysis buffer, followed by reverse transcription and
seminested amplification of IgH VDJ mRNA using consensus primers to FR2
and Jh as indicated in methods. Product was amplified from 10 of 14 plasma cells (lines 1-14) (M: molecular weight marker 100 bp
ladder). (B) Individual BM plasma cells from patient 2 were purified,
stained, and sorted into PCR tubes containing lysis buffer, followed by
reverse transcription and nested amplification of IgH VDJ mRNA first
using consensus primers to FR2 and Jh and next using specific primers
to CDR2 and CDR3 regions of clonotypic IgH for patient 2. Product was
amplified from 12 of 14 plasma cells (lines 1-14) (M: molecular weight
marker 100 bp ladder).
|
|
The amplified products from these individual plasma cells were pooled,
subcloned, and sequenced. The predominant sequence thus obtained was
tentatively selected as the clonotypic sequence pending further
testing. In all patients analyzed there were at least two other species
of IgH transcript detected among the amplified sequences, suggestive of
nonmalignant clones. Patient-specific primers were designed and tested
for their ability to amplify IgH mRNA in RT-PCR from individual sorted
plasma cells. For most patients the sequence initially selected was
detectable in nearly all of the sorted autologous plasma cells analyzed
(Fig 1B). However for 3 of 19 patients, the sequence initially
identified was present in only 10% or fewer of BM plasma cells and was
completely different from the actual MM clonal marker sequence. For
these patients, additional cloning and sequencing reactions were
necessary to identify the clonotypic myeloma sequence. For all
patients, the expression of an IgH VDJ sequence defined as clonotypic
was validated using single-cell RT-PCR on sorted BM plasma cells (Fig
1B), analysis of RT-PCR product from 1000 plasma cells, and
amplification of a clonotypic product from purified RNA of BMC for the
appropriate patient. Controls confirmed that the clonotypic MM
sequences were not detected in plasma cells of unrelated patients or
normal donors (see below).
To rigorously confirm the specificity of patient-specific priming and
the unique expression of sequences identified as clonotypic, total RNA
prepared from patient and normal donor BMC was analyzed by RT-PCR using
PSA. For all 19 patients, we detected a clonotypic transcript only when
patient-specific primers were used in combination with RNA
isolated from the appropriate patient. The clonal product was not
detected in total RNA from BMC from unrelated patients or normal donors
(see below). Next, in situ RT-PCR using patient-specific primers was
performed on sorted plasma cells from myeloma patients and from normal
donors. Patient-specific primers were used for further analysis only if
they amplified a product from the majority (>80%) of autologous
plasma cells, but did not amplify a product from BM plasma cells of an
unrelated myeloma patient or of healthy donors
(Fig 2).

View larger version (73K):
[in this window]
[in a new window]
| Fig 2.
In situ RT-PCR on BM plasma cells with patient-specific
primers. (A) Plasma cells sorted from a BM of MM patient 10 and a
healthy donor underwent in situ amplification with patient 10 CDR2/CDR3-IgH-specific primers. (B) Plasma cells sorted from a BM of
MM patient 2 and a healthy donor underwent in situ amplification with
patient 2 CDR2/CDR3-IgH-specific primers. (C) Plasma cells sorted from
a BM of MM patient 11 and a healthy donor underwent in situ
amplification with patient 11 CDR2/CDR3-IgH-specific primers.
|
|
The characteristics of the clonotypic sequences derived from BM plasma
cells of 19 myeloma patients are presented in Tables 1 and 2. The
patients have the Ig isotype distribution typical of myeloma and a
normal Vh and Jh usage. The full sequences of the CDR3 portion of IgH,
and the portion of the CDR2 sequences chosen as primers, are presented
in Table 2.
Clonotypic IgH VDJ sequences are detectable in the blood of patients
with MM.
To determine if clonotypic sequences were detectable in PBMC, total RNA
was purified from PBMC of myeloma patients, as well as from normal
donors, and subjected to PSA. All PBMC and BMC tested expressed mRNA
encoding IgH and histone. Figure 3 presents data for three representative myeloma patients, and shows that patient-specific clonotypic IgH transcripts were present in PBMC and
BMC of the relevant patient, but not in PBMC of unrelated myeloma
patients or normal-donor PBMC. The presence of clonotypic IgH
transcripts in RNA from myeloma PBMC was confirmed for all 19 patients.

View larger version (95K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR with patient-specific primers detects clonotypic
transcripts from both blood and BM of the relevant patient but not from
unrelated patients or healthy donors. One microgram of total RNA
isolated from myeloma and control BM and PBMC was reverse transcribed
and amplified with patient-specific primers. A clonal product was
detected only in BM and PBMC of the patient for whom the primers were
generated. The following primer pairs were used in PCR: (A) consensus
IgH VDJ, (B) histone (housekeeping gene), (C) primers for CDR2/CDR3 of
patient 10, (D) primers for CDR2/CDR3 of patient 11, (E) primers for
CDR2/CDR3 of patient 12. Lanes 1 and 2, unrelated myeloma patient; lane
3 patient 10 BM; lane 4, patient 10 PBMC; lane 5, patient 11 BM; lane
6, patient 11 PBMC; lane 7, patient #12 BM; lane 8, patient 12 PBMC;
lanes 9 and 10 healthy control BM; lane 11 healthy control PBMC; lane
12 water control.
|
|
Clonotypic cells are frequent in freshly isolated myeloma PBMC:
PBMC B cells express clonotypic transcripts, as confirmed
by sequencing of the amplified product.
To determine the frequency of clonotypic cells, a limiting dilution
analysis was performed using defined numbers of PBMC in threefold
dilutions to give from 1000 to 1 cells per tube. PBMC were diluted
immediately after purification. Two representative patients are shown
in Fig 4A and 4B. For freshly
diluted tubes containing 1000, 100, 10, or 3 PBMC per tube, all
replicates were positive indicating that every aliquot of 3 to 1000 cells included at least 1 clonotypic cell. At 1 cell per tube, 1/3 (Fig
4A and 4B) or 24 of 96 tubes (Fig 4C) were positive. The frequency of clonal cells was in the range of 25% to 33% of PBMC for these two
patients, comparable with that obtained for the same samples using in
situ RT-PCR (see below). A clonotypic RT-PCR product was not detected
in PBS control tubes. This type of experiment has been done for PBMC
samples from six other myeloma patients, and the frequency of
clonotypic PBMC was within the range of that calculated from analysis
by in situ RT-PCR.

View larger version (27K):
[in this window]
[in a new window]

View larger version (61K):
[in this window]
[in a new window]

View larger version (58K):
[in this window]
[in a new window]
| Fig 4.
Limiting dilution analysis of freshly isolated PBMC from
patient 1 and 19 using PSA. (A) Limiting dilution assay of PBMC from
patient 1. The number of cells indicated in the figure were added to
PCR tubes, reverse transcribed, and amplified in PSA with
patient-specific primers. The transcripts in each tube were amplified
in nested PCR using consensus primers to FR2 and Jh1 followed by a
second amplification using patient-specific CDR2 and CDR3 primers. Of
three tubes containing one cell, one was positive and two were negative
suggesting an approximate concentration of the clonotypic cells in the
blood of about 33%. The number of B cells as measured by flow
cytometry for an aliquot of the same PBMC sample was 35%. This PBMC
sample is the same as that described in Table 3, line 2, where
clonotypic cells represented 18% of PBMC as measured by in situ RT-PCR
on sorted B cells. (B) Limiting dilution of fresh PBMC from patient 19. IgH transcripts were amplified using VH3 family specific,40
and Jh consensus primers, followed by patient-specific CDR2 and CDR3
primers in nested PCR. For this patient, 2 of 3 tubes were positive at
the concentration of three cells per well (with 37% negative tubes at
this concentration, the approximate frequency of clonotypic cells is
one in every three PBMC, based on Poisson statistics), and 2 of 3 positive at one cell per well. By flow cytometry, patient 19 had 34% B
cells in the PBMC samples used for the limiting dilution assay.
(C) Clonotypic IgH transcripts at one cell per
tube from patient 19. To more accurately determine the number of
clonotypic cells, 96 tubes of one cell/tube were analyzed and 24 were
positive (25%), as shown in the figure. With 75% negative tubes at
this concentration, the chances of a given tube receiving more than one
clonotypic cell are very low.
|
|
At the time of the limiting dilution analysis, patient 19 had stable
disease with only 5% to 6% BM plasma cells, mIg of 5 gm/L, and no
detectable circulating plasma cells in blood smears. Clonotypic PBMC
are unlikely to be circulating plasma cells based on the low frequency
of such cells in blood of patients throughout most of their
disease.38,39 To confirm the relative absence of plasma
cells from myeloma PBMC, cytospins of PBMC from patient 19 were Giemsa
stained and analyzed by an experienced hematologist. Less than 1% of
PBMC (14/1576 or 0.89%) were morphologically identifiable as plasma
cells. However, at one cell per tube, 25% of tubes were positive for
this patient, indicating that, at most, one tube might contain a plasma
cell. This analysis shows that circulating plasma cells cannot possibly
account for all the clonotypic cells detected in myeloma PBMC. Thus,
clonotypic PBMC are B cells, as previously shown.24,25
To confirm that patient-specific RT-PCR was in fact detecting
clonotypic sequences, we sequenced the amplified product from 18 of the
positive PBMC B cells of patient 19 shown in Fig 4C. The first-stage
reaction mixtures were reamplified using a patient-specific CDR2 primer
and the Jh consensus primer. For each positive tube, the amplified
product was subcloned and sequenced, after randomly picking several
colonies with an Ig insert from each transformation (three to five
transformants for each individual B cell, for a total of 74 inserts).
All IgH subclones analyzed had CDR3 sequences completely identical to
those of autologous plasma cells (Table 2).
This confirms the specificity of the patient-specific RT-PCR, and
indicates the population of circulating B cells lacks intraclonal heterogeneity. Because VH3 is the most frequently used VH gene family,40-42 residual polyclonal B cells likely
exist,1A,36 but they were excluded from analysis by our use
of the patient-specific CDR2 primer in the second stage of the nested
PCR reaction. The analysis of Fig 4 shows that in fresh PBMC,
clonotypic B cells are frequent.
Clonotypic PBMC are CD19+ B cells.
To confirm that B cells expressed the clonotypic sequence, single
CD19+ B cells were sorted into PCR tubes for direct lysis
followed by amplification of IgH transcripts using liquid phase
patient-specific RT-PCR. Results for two representative patients are
shown in Fig 5A. Clonotypic IgH transcripts
were amplified from three of eight B cells from patient 1, and for two
of eight B cells from patient 4.

View larger version (33K):
[in this window]
[in a new window]

View larger version (64K):
[in this window]
[in a new window]
| Fig 5.
Detection of circulating clonotypic cells among sorted
PBMC B cells using single-cell in situ RT-PCR with patient-specific
primers. (A) Single-cell RT-PCR using sorted B cells. Individual
FMC63+ B cells were sorted directly into PCR
tubes. Nested PCR first with consensus, and second with
patient-specific primers was performed. The products had the expected
size of 111 bp (Patient 1) or 160 bp (patient 4). M = molecular
weight markers; Lanes 1 to 8 = sorted B cells; lanes 9,10 water
controls. (B) In situ RT-PCR using sorted B cells. Row 1, CD19+ cells sorted from a peripheral blood of MM patient
11 and from a healthy donor underwent in situ RT-PCR amplification with
patient 11 CDR2/CDR3-IgH-specific primers. Row 2, CD19+
cells sorted from a peripheral blood of MM patient 12 and from a
healthy donor underwent in situ amplification with
CDR2/CDR3-IgH-specific primers for patient #12. Row 3, CD19+ cells sorted from a peripheral blood of MM patient
1 and from a healthy donor underwent in situ amplification with
CDR2/CDR3-IgH-specific primers for patient 1. Row 4, CD19+ cells sorted from a peripheral blood of MM patient
5 and from a healthy donor underwent in situ amplification with
CDR2/CDR3-IgH-specific primers for patient 5.
|
|
To further confirm identification and more precisely quantify the
clonotypic B cells in myeloma PBMC, we used in situ RT-PCR to analyze
sorted CD19+ B cells for clonotypic sequences.
CD19+ B cells were rapidly stained and fixed, followed by
sorting onto slides for in situ RT-PCR using patient-specific primers.
For all patient-specific primer pairs, in situ RT-PCR PSA was performed on sorted B cells from PBMC of at least two normal donors and sorted
plasma cells from BMC of at least one normal donor, with consistently
negative results. Representative PSA in situ RT-PCR of sorted B cells
from four myeloma patients and four normal donors is shown in Fig 5B.
On average, 66% of B cells in myeloma PBMC are clonotypic as
detected by in situ RT-PCR.
Table 3 records the frequency of clonotypic
B cells for each myeloma patient, as measured by in situ RT-PCR, for
one or more blood samples taken at regular clinical visits. In blood,
the proportion of sorted B cells expressing clonotypic IgH mRNA ranged from 9% to 95% with a mean of 66% ± 4% standard error (SE).
These values were used to calculate that 14% ± 2% of PBMC were
clonotypic cells (range, 0.9% to 50% of PBMC). The proportion of
clonotypic cells among total white blood cells was calculated as 3.5% ± 1% (range, 1% to 9%) (not shown). The absolute number of
circulating clonotypic B cells was 0.15 ± 0.02 × 109/L of blood (range, 0.01 to 0.61 × 109/L).
The number of clonotypic B cells in blood is reduced after
chemotherapy but most are drug-resistant survivors.
Figure 6A plots the absolute
numbers of circulating clonotypic B cells in individual myeloma
patients as a function of time and exposure to chemotherapy. Although
the absolute numbers decreased slightly in most of the patients who had
been evaluated at multiple time points, clonotypic cells persist in
blood during and after therapy. For one patient (#12) analyzed before
and after autologous stem-cell transplantation, a similar frequency of
clonotypic B cells was detectable before and after the transplantation,
and a high frequency was detected in the G-CSF-mobilized blood used for transplant (Fig 6B). For this patient, circulating clonotypic cells
appear to be mobilized by G-CSF and escape cytoreduction. A sequential
time course was performed for a second patient who subsequently
underwent allogeneic stem-cell transplantation. Figure 6C shows that
for patient 4, whose clonotypic B cells were only mildly depleted by
vincristine/adriamycin/dexamethasone (VAD) therapy, the
number of circulating clonotypic B cells was reduced 28-fold at 7 months, and became undetectable at 14 months after transplant.

View larger version (21K):
[in this window]
[in a new window]

View larger version (16K):
[in this window]
[in a new window]

View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
The frequency of clonotypic B cells is slightly
reduced by conventional chemotherapy in most patients, and is
maintained after autologous transplantation (auto-tnsp), but clonotypic
B cells are depleted after cytoreduction therapy and allogeneic
transplantion. (A) The number of circulating clonotypic B cells was
monitored at the time points after diagnosis as indicated. Data points
are from Table 3. Patient ID numbers are given in the figure. For
patients 1, 2, 7, 15, and 18 chemotherapy was initiated immediately
after diagnosis and continued at monthly intervals until month 7. With
the exception of the 10- and 13-month time points, patients 3, 5, and 6 were on chemotherapy for the time points recorded here. Patient 11 remained untreated for both samples shown here. (B) This patient was
analyzed for clonotypic B cells a few days before stem-cell
mobilization with G-CSF (mIg = 16 gm/L and 11% plasma cells in BM, a
75% decrement in response to treatment). The frequency of clonotypic B
cells was analyzed in the G-CSF-mobilized blood cells, and in a blood
sample taken at 1 month after cytoreduction and autologous
transplantation, at which time the patient had a further 20% reduction
in mIg for a total decrement of 95%. This patient has since remained
in partial remission. (C) This patient was treated with VAD for 6 cycles followed by high-dose cytoxan and radiation, followed by
allogeneic hematopoietic transplantation (Allo Tsnp) and
immunosuppression with cyclosporin A. This patient remains in complete
remission.
|
|
 |
DISCUSSION |
The work presented here shows that 66% ± 4% of total circulating
blood B cells in 18 myeloma patients, or on average 14% of PBMC, have
an IgH rearrangement identical to that of autologous BM plasma cells.
The absolute number ranges from 0.01 to 0.61 × 109
clonotypic B cells/L of blood (mean, 0.15 ± .02 × 109/L). Using single-cell patient-specific RT-PCR of
freshly isolated myeloma PBMC, the amplified CDR3 transcripts were
sequenced and found to be identical for 18 individual B cells,
confirming the high frequency of clonotypic B cells, the specificity of
the patient-specific RT-PCR, and indicating that circulating myeloma B
cells exhibit intraclonal homogeneity. This implies that expansion of B
cells within the myeloma clone is independent of antigen-mediated
selective pressure, a characteristic of malignant lymphocytes.
Confirming the identity of clontypic PBMC, clonal IgH transcripts were
identified among 3 of 8 and 2 of 8 sorted B cells, from 2 different
patients, in single-cell RT-PCR. The clonotypic cells in the blood
express CD19, as well as CD34 and CD11b as shown
previously.24,25 The clonotypic PBMC detected cannot be
accounted for by circulating plasma cells, which are
infrequent38,39 and lack CD3.24,43,44 Thus,
based on their high frequency in blood of myeloma patients, their
phenotypic profile,4,24 and their
morphology,27,29 these clonotypic cells are B cells.
Consistent with our identification of the clonotypic B cell set as
adherent cells,6 Berenson et al14 have shown by
Southern blotting that rearranged myeloma IgH in blood derives from
adherent cells. To accurately quantify the number of clonotypic B
cells, patient-specific in situ RT-PCR was performed on sorted B cells.
The number of clonotypic B cells as measured by in situ RT-PCR
correlated with the number of clonotypic PBMC as measured by an RT-PCR
limiting dilution analysis of PBMC having patient-specific IgH
transcripts.
Only an IgH CDR3 sequence that identifies most BM plasma cells would be
expected to have a high frequency in the blood. Thus, it was essential
to confirm that the IgH sequence identified as clonotypic was expressed
by the majority of individual BM plasma cells in a patient. Most
studies do not control for the possible presence of frequent but
nonmalignant plasma cell clones in the BM. The number of residual
polyclonal B cells in myeloma patients is low,45,46 with an
abnormally restricted specificity repertoire,47-50 further
supporting the idea that expanded but nonmalignant B-cell clones,
unrelated to the myeloma clone, might be detected among BMC of some
myeloma patients. To address this problem, clonotypic transcripts were
measured using single-cell and in situ RT-PCR. For all patients,
greater than 80% of BM plasma cells expressed the sequence identified
as clonotypic. Although fully expected, this work represents the first
formal proof that nearly all individual plasma cells from myeloma BM
express the same IgH VDJ sequence.
Based on previous work analyzing nearly 500 patients, the absolute
numbers of circulating B cells represent about 3% to 10% of total
white blood cells, or about 0.4 × 109 B cells/L of
blood.4 On average for the smaller patient cohort analyzed
here, the absolute number of clonotypic B cells was 0.15 × 109/L. Based on mean values from this previous
group,4 clonotypic B cells are expected to represent about
38% of the total circulating B cells in blood. This is within the
actual range (mean, 66%) reported here for the 18 individual myeloma
patients for whom clonotypic sequences are available. Our evidence
shows that for myeloma patients assayed at more than one time point,
the absolute number of circulating clonotypic B cells decreased only
partially after chemotherapy. For one patient who had a 75% decrement
in mIg at the time of transplant, a high frequency of clonotypic B
cells was found in the G-CSF-mobilized blood used for autologous transplant. At 1 month after transplant the patient had a 95% total
decrement in mIg, although clonotypic B cells persisted in blood. For a
second patient, clonotypic B cells became undetectable after allogeneic
transplantation, when the patient was clinically in complete remission.
The high proportion of monoclonal B cells in myeloma patients contrasts
with the extensive diversity of the B-cell population from normal
donors. Little or no overlap was detected among randomly picked VDJ
rearrangements from normal PBMC51 or from IgH sequences of
70 individual B cells from a normal donor.41 Thus at a
molecular level, this work confirms the restricted
diversity/specificity repertoire among the B cells from each myeloma
patient.24,27,49,52 The lack of diversity is also indicated
by the monotypic expression of light-chain Ig4 and of light
chain mRNA.53 In situ RT-PCR confirms that circulating B
cells have monotypic expression of light-chain mRNA (data not shown).
The relative absence of polyclonal B cells in many of the myeloma
patients analyzed here confirms our previous reports that the number of
normal polyclonal B cells is reduced in myeloma
patients.45,46
The number of clonotypic B cells detected here range from 0.9% to 50%
of total PBMC, within the range of values obtained by Billadeau et
al,16,17 although we found much higher mean values. Billadeau et al16,17 report 7 of 39 patients who had 1% or more clonal PBMC. These values did not correlate with the number of
circulating plasma cells measured at the same time points in the
patients.17 This implies that the clonal cells detected by
Billadeau et al16,17 were B cells. The differences between the analysis done here and the Billadeau study may reflect their use of
cryopreserved cells. We find that clonotypic B and plasma cells are
often lost on thawing of cryopreserved PBMC or BMC (unpublished data).
Brown et al54 have also found frequent clonal cells, with
1% to 4% clonal PBMC in two myeloma patients. However, our results
are in contrast to those reported by Chen and Epstein23 who
detected infrequent clonotypic cells and low numbers of total circulating B cells as compared to ourselves and
others,4,55 suggesting that their sort strategy may have
inadvertently selected a polyclonal subset of B cells.
Expression of clonotypic sequences by B cells in myeloma indicates a
direct relationship with the malignant clone of plasma cells, but not
necessarily the same malignant status.5 The extent to which
these clonotypic B cells have undergone the progressive steps required
for full fledged malignancy is unknown. Broadly speaking, there are
three possible stages en route to malignancy and myeloma in which
clonotypic B cells might be expected. Firstly, B cells having the
clonotypic IgH rearrangement may have progressed through all stages
required for malignant growth. Secondly, they may have undergone only
some of the steps necessary for full malignancy. Third, they may be
nonmalignant remnants of the original B cell clone that gave rise to
the myeloma. This third possibility assumes that the monoclonal
gammopathy of uncertain significance from which myeloma may originate,
persists after evolution of frank myeloma. The population of clonotypic
B cells described here is heterogeneous by many measures and may
include representatives of all these stages, as a mixture of coexisting
malignant, partially malignant, and nonmalignant clonal relatives of
the BM plasma cells. However, a variety of evidence including oncogene
expression,29,56 DNA aneuploidy,27,28
functional multidrug resistance,25,28,32 stem-cell-like
characteristic5,24,27 and the clonal homogeneity shown
here, support options one or two, suggesting that the majority of these
B cells are malignant and have escaped the need for antigen-driven clonal expansion.
In summary, this work was designed to resolve the controversy
surrounding the frequency of clonotypic cells in blood. We find that
substantial numbers of clonotypic B cells (0.01 to 0.61 × 109/L of blood) colonize the blood of myeloma patients.
Clonotypic B cells are found in indolent myeloma, during stable phases
of disease, and after autologous stem-cell transplantation in one patient. For a second transplant patient, clonotypic B cells became undetectable after allogeneic transplantation. The frequent relapse rate for myeloma indicates that treatment does not eliminate the generative compartment of myeloma and that the malignant clone may
include less differentiated B lineage cells that are drug resistant.
Circulating clonotypic B cells, as measured using in situ RT-PCR with
patient-specific primers, provide a marker of blood involvement in
myeloma that complements measures of plasma cell kill. It seems likely
that at least some of these clonotypic B cells are
malignant.5 If so, treatments to eradicate or reduce their
numbers might confer enhanced survival. The relatively large numbers of
circulating clonotypic B cells, shown here and
elsewhere24,25 to survive chemotherapy, suggest that
targeting clonotypic B cells should be a therapeutic priority.
 |
FOOTNOTES |
Submitted January 21, 1998;
accepted June 8, 1998.
Funded by a grant from the National Cancer Institute of Canada with
funds from the Canadian Cancer Society, and by the Alberta Cancer Board
Research Initiatives Program. A.J.S. was supported by a 75th
Anniversary Award from the Faculty of Medicine and currently holds an
AHFMR studentship award. The Faculty of Medicine Flow Cytometry
Facility was supported by grants from the Medical Research Council of
Canada and the Alberta Cancer Board Research Initiatives Program.
Address correspondence to Linda M. Pilarski, Department of Oncology,
University of Alberta, Edmonton, Alberta, T6G1Z2, Canada; e-mail:
lpilarsk{at}gpu.srv.ualberta.ca.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
Dr Tony Fields, Director of the Cross Cancer Institute, has been and
continues to be a supportive facilitator for this work. The Edmonton
Blood Transfusion Service provided blood samples from healthy normal
individuals. The Department of Surgery and the Hematology laboratory of
the University of Alberta Hospitals provided normal bone marrow. We
thank the myeloma patients at the Cross Cancer Institute for their
generous donations of tissues and their willingness to participate in
this study.
 |
REFERENCES |
1.
Barlogie B,
Epstein J,
Selvanayagam P,
Alexanian R:
Plasma cell myeloma New biological insights and advances in therapy.
Blood
73:865,
1989[Abstract/Free Full Text]
1A. Szczepek AJ, Belch AR, Pilarski LM: Differential expression of
CD19 epitopes distinguishes circulating clonotypic B cells from
residual polyclonal B cells in multiple myeloma. (in
preparation)
2.
Greipp PR:
Advances in the diagnosis and management of myeloma.
Semin Hematol
29:24,
1992[Medline]
[Order article via Infotrieve]
3.
Pilarski LM,
Jensen GS:
Monoclonal circulating B cells in multiple myeloma: A continuously differentiating possibly invasive population as defined by expression of CD45 isoforms and adhesion molecules.
Hematol Oncol Clin North Am
6:297,
1992[Medline]
[Order article via Infotrieve]
4.
Bergsagel PL,
Masellis S,
Szczepek A,
Mant MJ,
Belch AR,
Pilarski LM:
In multiple myeloma, clonotypic B lymphocytes are detectable among CD19+ peripheral blood cells expressing CD38, CD56 and monotypic immunoglobulin light chain.
Blood
85:436,
1995[Abstract/Free Full Text]
5.
Pilarski LM,
Masellis S,
Szczepek A,
Mant MJ,
Belch AR:
Circulating clonotypic B cells in the biology of myeloma. Speculations on the origin of multiple myeloma.
Leuk Lymphoma
22:375,
1996[Medline]
[Order article via Infotrieve]
6.
Jensen GS,
Mant MJ,
Belch AR,
Berensen JR,
Ruether BA,
Pilarski LM:
Selective expression of CD45 isoforms defines CALLA+ monoclonal B lineage cells in peripheral blood from myeloma patients as late stage B cells.
Blood
78:711,
1991[Abstract/Free Full Text]
7.
Billadeau D,
Ahmann G,
Greipp P,
Van Ness B:
The bone marrow of multiple myeloma patients contains B cell populations at different stages of differentiation that are clonally related to the malignant plasma cell.
J Exp Med
178:1023,
1993[Abstract/Free Full Text]
8.
Takashita M,
Kosaka M,
Goto T,
Saito S:
Cellular origin and extent of clonal involvement in multiple myeloma: Genetic and phenotypic studies.
Br J Haematol
87:735,
1994[Medline]
[Order article via Infotrieve]
9.
Bakkus MHC,
Van Riet I,
Van Camp B,
Thielemann K:
Evidence that the clonogenic cell in multiple myeloma originates from a pre-switched but somatically mutated B cell.
Br J Haematol
87:68,
1994[Medline]
[Order article via Infotrieve]
10.
Omedè P,
Tarella C,
Palumbo A,
Argentino C,
Caracciolo D,
Corradini P,
Dominietto A,
Giaretta F,
Ravaglia R,
Triolo R,
Triolo S,
Pileri A,
Boccadoro M:
Multiple myeloma: Reduced plasma cell contamination in peripheral blood progenitor cell collections performed after repeated high-dose chemotherapy courses.
Br J Haematol
99:685,
1997[Medline]
[Order article via Infotrieve]
11.
Boccadoro M,
Gavarotti P,
Fossati G,
Massaia M,
Pilieri A,
Durie BGM:
Kinetics of circulating B lymphocytes in human myeloma.
Blood
61:812,
1983[Abstract/Free Full Text]
12.
Hulin N,
Conte PF,
Pileri A:
Biology of the human myeloma cell population. II. Cytokinetic characteristics.
Ric Clin Lab
8:49,
1978[Medline]
[Order article via Infotrieve]
13.
Caligaris-Cappio F,
Bergui L,
Gregoretti MG,
Gaidano G,
Gaboli M,
Schena M,
Zallone AZ,
Marchisio PC:
Role of bone marrow stromal cells in the growth of human multiple myeloma.
Blood
77:2688,
1991[Abstract/Free Full Text]
14.
Berenson JR,
Lichtenstein AK:
Clonal rearrangement of immunoglobulin genes in the peripheral blood of multiple myeloma patients.
Br J Haematol
73:425,
1989[Medline]
[Order article via Infotrieve]
15.
Berenson J,
Wong R,
Kim K,
Brown N,
Lichtenstein A:
Evidence for peripheral blood B lymphocyte but not T lymphocyte involvement in multiple myeloma.
Blood
70:1550,
1987[Abstract/Free Full Text]
16.
Billadeau D,
Quam L,
Thomas W,
Kay NE,
Greipp P,
Kyle R,
Oken MM,
Van Ness B:
Detection and quantitation of malignant cells in the peripheral blood of multiple myeloma patients.
Blood
80:1818,
1992[Abstract/Free Full Text]
17.
Billadeau D,
Van Ness B,
Kimlinger T,
Kyle RA,
Therneau TM,
Greipp PR,
Witzig TE:
Clonal circulating cells are common in plasma cell proliferative disorders: A comparison of monoclonal gammopathy of undetermined significance, smoldering multiple myeloma, and active myeloma.
Blood
88:289,
1996[Abstract/Free Full Text]
18.
Corradini P,
Voena C,
Omede P,
Astolfi M,
Boccadoro M,
Dalla-Favera R,
Pilieri A:
Detection of circulating tumor cells in multiple myeloma by a PCR based method.
Leukemia
7:1879,
1993[Medline]
[Order article via Infotrieve]
19.
Gazitt Y,
Reading CC,
Hoffman R,
Wickrema A,
Vesole D,
Jagannath S,
Condino J,
Lee B,
Barlogie B,
Tricot G:
Purified CD34+Lin-Thy+ stem cells do not contain clonal myeloma cells.
Blood
86:381,
1995[Abstract/Free Full Text]
20.
Cassel A,
Leibovitz N,
Hornstein L,
Quitt M,
Aghai E:
Evidence for the existence of circulating monoclonal B-lymphocytes in multiple myeloma patients.
Exp Hematol
18:1171,
1990[Medline]
[Order article via Infotrieve]
21.
Dreyfus F,
Melle J,
Quarre C,
Pillier C:
Contamination of peripheral blood by monoclonal B cells following treatment of multiple myeloma by high dose chemotherapy.
Br J Hematol
85:411,
1993[Medline]
[Order article via Infotrieve]
22.
Corradini P,
Voena C,
Astolfi M,
Ladetto M,
Tarella C,
Boccadoro M,
Pilieri A:
High dose sequential chemotherapy in multiple myeloma: Residual tumor cells are detectable in bone marrow and peripheral blood cell harvests and after autografting.
Blood
85:1596,
1995[Abstract/Free Full Text]
23.
Chen BJ,
Epstein J:
Circulating clonal lymphocytes in myeloma constitute a minor population of B cells.
Blood
87:1972,
1996[Abstract/Free Full Text]
24.
Szczepek AJ,
Bergsagel PL,
Axelsson L,
Brown CB,
Belch AR,
Pilarski LM:
CD34+ cells in the blood of patients with multiple myeloma express CD19 and IgH mRNA and have patient-specific IgH VDJ rearrangements.
Blood
89:1824,
1997[Abstract/Free Full Text]
25.
Pilarski LM,
Szczepek AJ,
Belch AR:
Deficient drug transporter function of bone marrow-localized and leukemic plasma cells in multiple myeloma.
Blood
90:3751,
1997[Abstract/Free Full Text]
26.
Pilarski LM,
Szczepek A,
MacDonald H,
Mant MJ,
Belch AR:
Single cell IgH CDR3 and in situ RT-PCR for IgH CDR3 and Ig light chain unequivocally confirm that circulating CD19+ cells in multiple myeloma are B cells.
Blood
86:58a,
1995(abstr)
27. Pilarski LM, Mant MJ, Belch AR: Circulating, monoclonal,
multi-drug resistant B cells may comprise the malignant stem cells
population in multiple myeloma, Ares Serono Symposia, Rome, Italy, in
Dammaco F, Barlogie B (eds): Challenges in Modern Medicine, vol 4, 1994, p 31
28.
Pilarski LM,
Belch AR:
Circulating monoclonal B cells expressing p-glycoprotein may be a reservoir of multidrug resistant disease in multiple myeloma.
Blood
83:724,
1994[Abstract/Free Full Text]
29.
Pilarski LM,
Masellis Smith A,
Belch AR,
Yang B,
Savani RC,
Turley EA:
RHAMM, a receptor for hyaluronan-mediated motility, on normal lymphocytes, thymocytes and in B cell malignancy: A mediator in B cell malignancy?
Leuk Lymphoma
14:363,
1994[Medline]
[Order article via Infotrieve]
30.
Masellis-Smith A,
Belch AR,
Mant MJ,
Turley EA,
Pilarski LM:
Hyaluronan-dependent motility of B cells and leukemic plasma cells but not of bone marrow plasma cells in multiple myeloma: Alternate usage of RHAMM and CD44.
Blood
87:1891,
1996[Abstract/Free Full Text]
31.
Masellis S,
Belch AR,
Mant MJ,
Pilarski LM:
Adhesion of multiple myeloma peripheral blood B cells to bone marrow fibroblasts: a requirement for CD44 and a 4 7.
Cancer Res
57:930,
1997[Abstract/Free Full Text]
32.
Pilarski LM,
Belch AR:
Intrinsic expression of the multidrug transporter, P-glycoprotein 170, in multiple myeloma: Implications for treatment.
Leuk Lymphoma
17:367,
1995[Medline]
[Order article via Infotrieve]
33.
Frickhoven N,
Muller E,
Sandherr M,
Binder T,
Baumgartner M,
Wiest C,
Enz M,
Heimpel H:
Rearranged Ig heavy chain is detectable in cell-free blood samples of patients with B cell neoplasia.
Blood
90:4953,
1998[Abstract/Free Full Text]
34.
Pietersz GA,
Li WJ,
Sutton VR,
Burgess J,
McKenzie IFC,
Zola H,
Trapani JA:
In vitro and in vivo antitumor-activity of a chimeric anti-CD19 antibody.
Cancer Immunol Immunother
41:53,
1995[Medline]
[Order article via Infotrieve]
35.
Zola H,
McCardle PJ,
Bradford T,
Weedon H,
Yasui H,
Kurosawa Y:
Preparation and characterization of a chimeric CD19 monoclonal antibody.
Immunol Cell Biol
69:411,
1991
36.
Pilarski LM,
Szczepek AJ,
Mant MJ,
Belch AR:
Cryptic expression of the CD19 epitope detected by MoAb Leu12 distinguishes malignant from residual polyclonal B cells in the blood of myeloma patients.
Blood
90:349a,
1997(abstr)
37.
Aubin J,
Davi F,
Nuguyen-Salomon F,
Leboeuf D,
Debert C,
Taher M,
Valensi F,
Canioni D,
Brousse N,
Varet B,
Fladrin G,
Macintyre EA:
Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies for the detection of clonality in B cell malignancies.
Leukemia
9:471,
1995[Medline]
[Order article via Infotrieve]
38.
Witzig TE,
Dhodapkar MV,
Kyle RA,
Greipp PR:
Quantitation of circulating peripheral blood plasma cells and their relationship to disease activity in patients with multiple myeloma.
Cancer
72:108,
1993[Medline]
[Order article via Infotrieve]
39.
Witzig TE,
Kimlinger TK,
Ahmann GJ,
Katzmann JA,
Greipp PR:
Detection of myeloma cells in the peripheral blood by flow cytometry.
Cytometry
26:113,
1996[Medline]
[Order article via Infotrieve]
40.
Demaison C,
David D,
Letourneur F,
Theze J,
Saragosti S,
Zouali M:
Analysis of human VH gene repertoire expression in peripheral CD19+ B cells.
Immunogenetics
42:342,
1995[Medline]
[Order article via Infotrieve]
41.
Brezinschek HP,
Brezinschek RI,
Lipsky PE:
Analysis of the heavy chain repertoire of human peripheral B cells using single cell polymerase chain reaction.
J Immunol
155:190,
1995[Abstract]
42.
Davidkova G,
Petterson S,
Holmberg D,
Lundkvist I:
Selective use of VH genes in adult human B lymphocyte repertoires.
Scand J Immunol
45:62,
1997[Medline]
[Order article via Infotrieve]
43.
Vescio RA,
Hong CH,
Cao J,
Kim A,
Schiller GJ,
Lichtenstein AK,
Berenson RJ,
Berenson JR:
The hematopoietic stem cell antigen CD34 is not expressed on the malignant cells in multiple myeloma.
Blood
84:3283,
1994[Abstract/Free Full Text]
44.
Kimlinger T,
Witzig TE:
Expression of the hematopoietic stem cell antigen CD34 on blood and bone marrow monoclonal plasma cells from patients with multiple myeloma.
Bone Marrow Transplant
19:553,
1997[Medline]
[Order article via Infotrieve]
45.
Pilarski LM,
Mant MJ,
Ruether BA,
Belch AR:
Severe deficiency of B lymphocytes in peripheral blood from multiple myeloma patients.
J Clin Invest
74:1301,
1984
46.
Pilarski LM,
Ruether BA,
Mant MJ:
Abnormal function of B lymphocytes from peripheral blood of multiple myeloma patients. I. Lack of correlation between the number of cells potentially able to secrete IgM and serum IgM levels.
J Clin Invest
75:2024,
1985
47.
Pilarski LM,
Andrews EJ,
Mant MJ,
Ruether BA:
Humoral immune deficiency in multiple myeloma patients due to compromised B cell function.
J Clin Immunol
6:491,
1986[Medline]
[Order article via Infotrieve]
48.
Pilarski LM,
Andrews EJ,
Serra HM,
Ledbetter JA,
Ruether BA,
Mant MJ:
Abnormalities in lymphocyte profile and specificity repertoire of patients with Waldenstroms macroglobulinemia, multiple myeloma and I IgM monoclonal gammopathy of undetermined significance.
Am J Hematol
30:53,
1989[Medline]
[Order article via Infotrieve]
49.
Pilarski LM,
Andrews EJ,
Serra HM,
Ruether BA,
Mant MJ:
Comparative analysis of immunodeficiency between patients with gammopathy of undetermined significance and patients with untrested myeloma.
Scand J Immunol
29:217,
1989[Medline]
[Order article via Infotrieve]
50.
Pilarski LM,
Mant MJ,
Ruether BA:
Review: Analysis of immunodeficiency in multiple myeloma: Observations and hypothesis.
J Clin Lab Anal
1:214,
1987
51.
Yamada M,
Wasserman R,
Reichard BA,
Shane S,
Caton AJ,
Rovera G:
Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood B lymphocytes.
J Exp Med
173:395,
1991[Abstract/Free Full Text]
52.
Pilarski LM,
Piotrowska-Krezolek M,
Gibney DJ,
Winger L,
Winger C,
Mant MJ,
Ruether BA:
Specificity repertoire of lymphocytes from multiple myeloma patients. I. High frequency of B cells specific for idiotypic and F(ab')2 region determinants on immunoglobulin.
J Clin Immunol
5:275,
1985[Medline]
[Order article via Infotrieve]
53.
Jensen GS,
Belch AR,
Kherani F,
Mant MJ,
Ruether BA,
Pilarski LM:
Restricted expression of immunoglobulin light chain mRNA and of the adhesion molecule CD11b on circulating monoclonal B lineage cells in peripheral blood of myeloma patients.
Scand J Immunol
36:843,
1992[Medline]
[Order article via Infotrieve]
54.
Brown R,
Luo XF,
Gibson J,
Morley A,
Sykes P,
Brisco M,
Joshua D:
Idiotypic oligonucleotide probes to detect myeloma cells by mRNA in situ hybridization.
Br J Haematol
90:113,
1998
55.
Kay NE,
Oken MM,
Bone N,
Kyle RA,
Greipp P,
Van Ness B,
Leong T:
Circulating CD19+ blood cells in myeloma.
Blood
86:4000,
1995[Free Full Text]
56.
Bergsagel PL,
Belch AR,
Pilarski LM:
The blood B cells and bone marrow plasma cells in a patient with multiple myeloma include cells with the same N-ras mutation.
Blood
84:524a,
1994(abstr)

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Adamia, A. A. Reichert, H. Kuppusamy, J. Kriangkum, A. Ghosh, J. J. Hodges, P. M. Pilarski, S. P. Treon, M. J. Mant, T. Reiman, et al.
Inherited and acquired variations in the hyaluronan synthase 1 (HAS1) gene may contribute to disease progression in multiple myeloma and Waldenstrom macroglobulinemia
Blood,
December 15, 2008;
112(13):
5111 - 5121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kirshner, K. J. Thulien, L. D. Martin, C. Debes Marun, T. Reiman, A. R. Belch, and L. M. Pilarski
A unique three-dimensional model for evaluating the impact of therapy on multiple myeloma
Blood,
October 1, 2008;
112(7):
2935 - 2945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Taylor, J. Kriangkum, J. A. Pittman, M. J. Mant, T. Reiman, A. R. Belch, and L. M. Pilarski
Analysis of clonotypic switch junctions reveals multiple myeloma originates from a single class switch event with ongoing mutation in the isotype-switched progeny
Blood,
September 1, 2008;
112(5):
1894 - 1903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Huff and W. Matsui
Multiple Myeloma Cancer Stem Cells
J. Clin. Oncol.,
June 10, 2008;
26(17):
2895 - 2900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Matsui, Q. Wang, J. P. Barber, S. Brennan, B. D. Smith, I. Borrello, I. McNiece, L. Lin, R. F. Ambinder, C. Peacock, et al.
Clonogenic Multiple Myeloma Progenitors, Stem Cell Properties, and Drug Resistance
Cancer Res.,
January 1, 2008;
68(1):
190 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. VanDijken, G. V. Kaigala, J. Lauzon, A. Atrazhev, S. Adamia, B. J. Taylor, T. Reiman, A. R. Belch, C. J. Backhouse, and L. M. Pilarski
Microfluidic Chips for Detecting the t(4;14) Translocation and Monitoring Disease during Treatment Using Reverse Transcriptase-Polymerase Chain Reaction Analysis of IgH-MMSET Hybrid Transcripts
J. Mol. Diagn.,
July 1, 2007;
9(3):
358 - 367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-T. Tai, X. Li, X. Tong, D. Santos, T. Otsuki, L. Catley, O. Tournilhac, K. Podar, T. Hideshima, R. Schlossman, et al.
Human Anti-CD40 Antagonist Antibody Triggers Significant Antitumor Activity against Human Multiple Myeloma
Cancer Res.,
July 1, 2005;
65(13):
5898 - 5906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Adamia, T. Reiman, M. Crainie, M. J. Mant, A. R. Belch, and L. M. Pilarski
Intronic splicing of hyaluronan synthase 1 (HAS1): a biologically relevant indicator of poor outcome in multiple myeloma
Blood,
June 15, 2005;
105(12):
4836 - 4844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kriangkum, B. J. Taylor, S. P. Treon, M. J. Mant, A. R. Belch, and L. M. Pilarski
Clonotypic IgM V/D/J sequence analysis in Waldenstrom macroglobulinemia suggests an unusual B-cell origin and an expansion of polyclonal B cells in peripheral blood
Blood,
October 1, 2004;
104(7):
2134 - 2142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Maxwell, E. Rasmussen, F. Zhan, J. J. Keats, S. Adamia, E. Strachan, M. Crainie, R. Walker, A. R. Belch, L. M. Pilarski, et al.
RHAMM expression and isoform balance predict aggressive disease and poor survival in multiple myeloma
Blood,
August 15, 2004;
104(4):
1151 - 1158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Matsui, C. A. Huff, Q. Wang, M. T. Malehorn, J. Barber, Y. Tanhehco, B. D. Smith, C. I. Civin, and R. J. Jones
Characterization of clonogenic multiple myeloma cells
Blood,
March 15, 2004;
103(6):
2332 - 2336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-Y. Huang, H.-F. Tien, F.-H. Su, and S.-M. Hsu
Nonirradiated NOD/SCID-Human Chimeric Animal Model for Primary Human Multiple Myeloma: A Potential in Vivo Culture System
Am. J. Pathol.,
February 1, 2004;
164(2):
747 - 756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-L. Harousseau, J. Shaughnessy Jr., and P. Richardson
Multiple Myeloma
Hematology,
January 1, 2004;
2004(1):
237 - 256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski
In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression
Blood,
February 15, 2003;
101(4):
1520 - 1529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Zhan, E. Tian, K. Bumm, R. Smith, B. Barlogie, and J. Shaughnessy Jr
Gene expression profiling of human plasma cell differentiation and classification of multiple myeloma based on similarities to distinct stages of late-stage B-cell development
Blood,
February 1, 2003;
101(3):
1128 - 1140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ohno, M. Yoshimoto, S. Honda, S. Miyachi, T. Ishida, F. Itoh, T. Endo, S. Chiba, and K. Imai
The Antisense Approach in Amyloid Light Chain Amyloidosis: Identification of Monoclonal Ig and Inhibition of Its Production by Antisense Oligonucleotides in In Vitro and In Vivo Models
J. Immunol.,
October 1, 2002;
169(7):
4039 - 4045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Pilarski and A. R. Belch
Clonotypic Myeloma Cells Able to Xenograft Myeloma to Nonobese Diabetic Severe Combined Immunodeficient Mice Copurify with CD34+ Hematopoietic Progenitors
Clin. Cancer Res.,
October 1, 2002;
8(10):
3198 - 3204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Taylor, J. A. Pittman, K. Seeberger, M. J. Mant, T. Reiman, A. R. Belch, and L. M. Pilarski
Intraclonal Homogeneity of Clonotypic Immunoglobulin M and Diversity of Nonclinical Post-Switch Isotypes in Multiple Myeloma: Insights into the Evolution of the Myeloma Clone
Clin. Cancer Res.,
February 1, 2002;
8(2):
502 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Reiman, K. Seeberger, B. J. Taylor, A. J. Szczepek, J. Hanson, M. J. Mant, R. W. Coupland, A. R. Belch, and L. M. Pilarski
Persistent preswitch clonotypic myeloma cells correlate with decreased survival: evidence for isotype switching within the myeloma clone
Blood,
November 1, 2001;
98(9):
2791 - 2799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. W. Cremer, H. Goldschmidt, M. Moos, T. Rasmussen, and H. E. Johnsen
Clonotypic B cells in the peripheral blood of patients with multiple myeloma
Blood,
May 1, 2001;
97(9):
2913 - 2914.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Rasmussen, L. Jensen, L. Honore, and H. E. Johnsen
Frequency and kinetics of polyclonal and clonal B cells in the peripheral blood of patients being treated for multiple myeloma
Blood,
December 15, 2000;
96(13):
4357 - 4359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Treon, P. Maimonis, D. Bua, G. Young, N. Raje, J. Mollick, D. Chauhan, Y.-T. Tai, T. Hideshima, Y. Shima, et al.
Elevated soluble MUC1 levels and decreased anti-MUC1 antibody levels in patients with multiple myeloma
Blood,
November 1, 2000;
96(9):
3147 - 3153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Szczepanski, M. B. van 't Veer, I. L. M. Wolvers-Tettero, A. W. Langerak, and J. J. M. van Dongen
Molecular features responsible for the absence of immunoglobulin heavy chain protein synthesis in an IgH- subgroup of multiple myeloma
Blood,
August 1, 2000;
96(3):
1087 - 1093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Rasmussen, L. Jensen, and H. E. Johnsen
Levels of circulating CD19+ cells in patients with multiple myeloma
Blood,
June 15, 2000;
95(12):
4020 - 4020.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Pilarski, N. V. Giannakopoulos, A. J. Szczepek, A. M. Masellis, M. J. Mant, and A. R. Belch
In Multiple Myeloma, Circulating Hyperdiploid B Cells Have Clonotypic Immunoglobulin Heavy Chain Rearrangements and May Mediate Spread of Disease
Clin. Cancer Res.,
February 1, 2000;
6(2):
585 - 596.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. M. Pilarski, G. Hipperson, K. Seeberger, E. Pruski, R. W. Coupland, and A. R. Belch
Myeloma progenitors in the blood of patients with aggressive or minimal disease: engraftment and self-renewal of primary human myeloma in the bone marrow of NOD SCID mice
Blood,
February 1, 2000;
95(3):
1056 - 1065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.C. LaCasse, M.R. Bray, B. Patterson, W.-M. Lim, S. Perampalam, L. G. Radvanyi, A. Keating, A.K. Stewart, R. Buckstein, J.S. Sandhu, et al.
Shiga-Like Toxin-1 Receptor on Human Breast Cancer, Lymphoma, and Myeloma and Absence From CD34+ Hematopoietic Stem Cells: Implications for Ex Vivo Tumor Purging and Autologous Stem Cell Transplantation
Blood,
October 15, 1999;
94(8):
2901 - 2910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Crainie, A. R. Belch, M. J. Mant, and L. M. Pilarski
Overexpression of the Receptor for Hyaluronan-Mediated Motility (RHAMM) Characterizes the Malignant Clone in Multiple Myeloma: Identification of Three Distinct RHAMM Variants
Blood,
March 1, 1999;
93(5):
1684 - 1696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Treon, J. A. Mollick, M. Urashima, G. Teoh, D. Chauhan, A. Ogata, N. Raje, J. H.M. Hilgers, L. Nadler, A. R. Belch, et al.
Muc-1 Core Protein Is Expressed on Multiple Myeloma Cells and Is Induced by Dexamethasone
Blood,
February 15, 1999;
93(4):
1287 - 1298.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|