|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 92 No. 8 (October 15), 1998:
pp. 2844-2855
By
From the Departments of Oncology and Medicine, University of Alberta
and the Cross Cancer Institute, Edmonton, Alberta T6G1Z2 Canada.
In multiple myeloma (MM), the VDJ rearrangement of the
immunoglobulin heavy chain expressed by MM plasma cells provides a unique clonotypic marker. Although clonotypic MM cells have been found
in the circulation, their number has been controversial. Our objective
was to provide direct evidence, using single-cell assays, for the
frequency of clonotypic cells in blood of 18 MM patients, and to
confirm their identity as B cells. The clonotypic Ig heavy-chain
(IgH) VDJ was determined from single plasma cells using
consensus reverse transcriptase-polymerase chain reaction (RT-PCR),
subcloning, and sequencing. For all patients, using patient-specific
primers, clonotypic transcripts were amplified from 10 or more
individual plasma cells. Using in situ RT-PCR, for all patients greater
than 80% of plasma cells were found to be clonotypic. Three separate
methods, RT-PCR, single-cell RT-PCR, and in situ RT-PCR, were used to
analyze clonotypic cells in peripheral blood mononuclear cells (PBMC)
from MM patients. Sequencing of the IgH transcripts expressed by
individual cells obtained by limiting dilution of freshly isolated PBMC
from a MM patient showed that all B cells expressed an identical CDR3.
This intraclonal homogeneity indicates an escape from
antigenic-selection, characteristic of malignant B cells. For this
patient, the frequency of clonotypic PBMC, about 25%, was comparable
to the number of PBMC B cells (34%). Because the PBMC included less
than 1% plasma cells, virtually all clonotypic PBMC must be B cells.
Using single-cell RT-PCR, clonotypic IgH transcripts were identified in
individual sorted B cells from blood. To accurately quantify the number
of clonotypic B cells, sorted B cells derived from 18 MM patients (36 samples) and 18 healthy donors (53 samples) were analyzed using in situ RT-PCR with patient-specific primers. Clonotypic transcripts were not
detectable among normal B cells. For the 18 MM patients, a mean of 66% ± 4% (SE) of blood B cells were clonotypic (range, 9% to 95%),
with mean absolute number of 0.15 ± .02 × 109/L blood.
Over time in individual patients, conventional chemotherapy transiently
decreased circulating clonotypic B cells. Their numbers were increased
in granulocyte colony-stimulating factor (G-CSF)- mobilized
blood of one patient. However, clonotypic B cells of a one patient
became undetectable after allogeneic transplant, correlating with
complete remission. Although contributions to MM spread and progression
is likely, their malignant status and impact has yet to be clarified.
Their high frequency in the blood, and their resistence to conventional
chemotherapy suggests that the number of circulating clonotypic cells
should be clinically monitored, and that therapeutic targeting of these
B cells may benefit myeloma patients.
© 1998 by The American Society of Hematology.
MULTIPLE MYELOMA (MM), a B-cell
neoplasia, is characterized by the presence of monoclonal
immunoglobulin in the blood, lytic bone lesions, and often large
numbers of monoclonal plasma cells in the bone marrow (BM). Although
many patients respond initially, nearly all relapse and become
refractory to treatment.1,2 While it is clear that
monoclonal plasma cells located in the BM directly or indirectly
mediate most symptoms of myeloma, these cells do not appear to have the
qualities of growth and spread required of a malignant progenitor cell.
A number of observations have led to the view that the generative
compartment in myeloma includes B-lineage cells found in the BM, the
blood, or both, at a stage of differentiation preceding that of plasma
cells.3-15
For B-lineage malignancies, unique sequences within the Ig genes,
termed complementarity determining regions (CDR1, CDR2, CDR3), provide
a consistent molecular marker for unequivocal identification of clonal
B-lineage cells. Many studies have shown cells in the blood of myeloma
patients with an Ig heavy-chain (IgH) rearrangement identical to that
of autologous BM plasma cells.4,8,9,16-23 Although the
differentiation stage of these blood cells and their number is
controversial, the sharing of IgH rearrangements with the malignant
plasma cells is widely accepted as indicative of a clonal relationship,
termed clonotypic. A first step towards evaluating the extent to which
peripheral blood mononuclear cells (PBMC) include myeloma-associated or
precursor cells is to quantitate the number of clonotypic B cells in
the circulation. Previous work showing the presence in PBMC of cells
with clonotypic rearrangements have provided a wide range of
numbers.4,16,17,23,24 Most of these numbers are estimates
based on the frequency of a given sequence in nucleic acids purified
from heterogeneous cell populations. Circulating plasma cells cannot
account for the sometimes large numbers of clonotypic blood cells in
myeloma.17 To assess the number of individual cells with
clonotypic transcripts in myeloma PBMC and BM cells (BMC), single-cell
assays are required. Analysis of myeloma PBMC, using marker sequences
confirmed as clonal, indicate a large subset of circulating clonotypic
CD19+ cells.24,25 These B cells are
morphologically and functionally distinct from plasma
cells.4,5,24,25,27 They are CD19+,
CD11b+ CD34+ cells4,24,25 that
express messenger RNA (mRNA) encoding IgH, CD19, and
CD34.24,26 This clonotypic B cell subset has properties
consistent with malignant status.24,25,28-31
CD34+ CD11b+ B cells are the predominant clonotypic subset
in blood, with an average of 81% to 87% clonotypic
cells.24,25 The drug resistance of these
cells,25,28,32 and their persistence after chemotherapy4,28 implicates them in the events underlying relapse. The frequency of myeloma B cells is most accurately determined using methods that analyze individual B-lineage cells. In this report,
using single-cell reverse transcriptase-polymerase chain reaction
(RT-PCR) assays and in situ RT-PCR with patient-specific primers, we show that a large proportion of individual myeloma B cells
are clonotypic.
Patients and samples.
Blood and BM were obtained after informed consent from 19 patients with
MM, at diagnosis, during intermittent chemotherapy and after treatment
(Table 1). Blood was also obtained from 18 healthy donors, and BM from 5 healthy donors. BM aspirates used for
deriving the clonotypic IgH VDJ sequence had 11% to 80% plasma cells
as identified morphologically and phenotypically. BMC were purified
using Ficoll Paque (Pharmacia, Dorval, Quebec, Canada). Peripheral
blood was drawn into heparinized tubes and purified over Ficoll Paque
(Pharmacia) to give PBMC. Because no EDTA was added, cell-free DNA or
RNA from serum would be immediately degraded33 and thus
could not be a source of contamination in the analysis described below.
All samples were purified immediately after being drawn. For RT-PCR,
PBMC were lysed in Trizol (GIBCO-BRL, Burlington, Ontario,
Canada) immediately after purification. For in situ RT-PCR, cells were
antibody labeled and stored for 18 hours in fixative before sorting.
For single-cell RT-PCR, cells were either used immediately in the
limiting dilution assay or were antibody labeled, sorted, and processed
within 3 to 4 hours after collection of the sample. For limiting
dilution analysis, PBMC were diluted to an appropriate concentration as
indicated in Results, and immediately deposited into PCR tubes
containing lysis buffer (see below). This study analyzed all myeloma
patients presenting at our institution for whom a BM sample had been
obtained during the course of the study.
Antibodies and reagents.
FMC63 (CD19)34,35 was conjugated to fluorescein
isothiocyanate (FITC). Leu17-phycoerythrin (PE) (CD38) was from Becton Dickinson (San Jose, CA). Ig2aPE, antihuman Ig F(ab)2
fragments coupled to FITC and F(ab)2 fragments of
goat-antimouse PE were purchased from Southern Biotech (Birmingham,
AL).
Immunofluorescence (IF) and sorting.
Staining for surface phenotype used one- or two-color IF with CD19-FITC
or CD38-PE/antihuman Ig-FITC, as well as all relevant isotype controls,
as described previously.4,24,28 BMC were stained with
CD38-PE and antihuman Ig-FITC followed by sorting of CD38hi
Ig+ BMC with high forward and side scatter. PBMC were
sorted for CD19+ cells with no gates set on scatter beyond
those used to exclude red and dead cells. The CD19+ B cells
sorted here were detected by their staining with either FMC63 or B4
(Coulter, Oakville, Ontario, Canada) but were not detected by Leu12
(Becton Dickinson)1A,5,36 (International Myeloma Workshop,
Boston, 1997), or by monoclonal antibody (MoAb) to CD19 from Sigma
(Oakville, Ontario, Canada), Dako (Detroit,
MI), or Immunotech/Coulter (Burlington, Ontario, Canada).
Neuraminidase treatment shows Leu12 epitopes indicating they are
present but cryptic on these B cells.36 For single-cell experiments, individual CD19+ PBMC or
CD38hiIg+ large BMC were sorted directly into
0.2 mL thin-walled PCR tubes or onto slides. On reanalysis, sorted
populations had a purity of 96% or greater for the defining phenotype.
Less than 1% of morphologically identifiable plasma cells were
observed in cytospins of sorted B cells (performed for six patients),
in cytospins of PBMC (for four patients), or in smears of patient blood
(all patients).
Identification of patient-specific (clonotypic) IgH sequences and
primer selection.
The clonotypic sequence was determined from mRNA of 1 to 1000 BM plasma
cells using consensus RT-PCR, followed by sequencing of the amplified
product from at least 3 individual plasma cells or from 6 subclones of
the consensus product. Primers to histone, a housekeeping mRNA, were
used as a positive control to ensure mRNA integrity. IgH VDJ region
primers to FR2, J region, or to Vh3 family4,37 were as
previously described. CDR2 and CDR3 patient-specific primers are given
in Results. Histone primers were as follows: 5' CCACTGAACTTCTGATTCGC,
3' GCGTGCTAGCTGGATGTCTT. The V, D, and J families of clonotypic IgH
sequences were analyzed, and patient-specific primers annealing to the
CDR2 and CDR3 portions of the identified IgH sequence were chosen using
the V-base sequence directory
(http://www.mrc-cpe.cam.ac.uk/imt-doc/vbase-home-page.html), DNAPLOT (http://www.mrc-cpe.cam.ac. uk/imt-doc/DNAsearch.html), and
Primer3 (Picks PCR primers from nucleotide sequence)
(http://www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi). Primers were
synthesized on ABI PCR mate 391 (Perkin Elmer, Applied Biosystems,
Mississauga, Ontario, Canada). To confirm the specificity of the chosen primers, they were used in PCR to identify a product of
the expected size from complementary DNA (cDNA) of individual autologous BM plasma cells, but not from cDNA of plasma cells or PBMC
of unrelated myeloma patients.
Patient-specific amplification (PSA).
For amplification of PS sequences, primers to the CDR2 and the CDR3
regions of the rearranged IgH VDJ from individual BM plasma cells were
designed and used for in situ RT-PCR. The size of PCR product varied in
individual patients within the range of 120 to 180 bp, and gave a
discrete single band when mRNA was analyzed. For all patients, the
specificity of the PSA was confirmed by testing the primers using RNA
isolated from PBMC B cells of healthy donors,
CD38hicIg+ BM plasma cells of healthy donors,
and unrelated myeloma B and plasma cells as negative controls.
RT-PCR: (consensus and specific).
Using Trizol according to manufacturers directions (GIBCO-BRL,
Burlington, Ontario, Canada), RNA was prepared from 0.1 to 10 × 106 unfractionated BMC, PBMC or sorted
populations of B cells from myeloma patients and normal donors. After
purification, 1 µg of RNA was reverse transcribed using SuperScript
reverse transcriptase (GIBCO-BRL) and universal primer oligo
dT15, according to the manufacturers instructions. PCR was
performed under standard conditions. Briefly, 2 µL of cDNA was added
to 48 µL of PCR buffer (GIBCO-BRL), 2 mmol/L MgCl2, mixed
with 0.2 µmol/L consensus primers FR2 and Jh, and 1 U/reaction tube
of TAQ polymerase: 25 cycles of 30 seconds at 94°C, 30 seconds at
50°C, and 45 seconds at 72°C were performed on the PCR Thermal
Cycler Perkin Elmer 9600 (Perkin Elmer). For consensus RT-PCR, a second
round of amplification used FR2 and a nested Jh consensus primer. For
PSA, as described above, the second round of amplification used
patient-specific primers (CDR2 and CDR3) for 25 cycles at an annealing
temperature of 60°C. The PCR product was analyzed on a 2% agarose
gel in tris-borate/EDTA (TBE) buffer, soaked in ethidium
bromide, and visualized under ultraviolet light.
Single-cell RT-PCR.
Using the ELITE flow cytometer with an Autoclone Cell Deposition Unit
(Coulter, Hiale, FL), single cells were sorted into 0.2 mL PCR tubes
containing 8 µL of RT-Lysis solution (SuperScript first-strand
buffer, 0.5% NP-40 (vol/vol), 0.01 mol/L dithiothreitol (DTT), 0.25 mmol/L dNTPs, 0.006 mmol/L dT16, 200 U of RNAse inhibitor (GIBCO-BRL).
Immediately after the sort, tubes were centrifuged for 1 minute and
then frozen at In situ RT-PCR.
In situ RT-PCR was performed as previously described.24,25
Generation of patient-specific IgH VDJ sequences using single plasma
cell RT-PCR.
To identify clonotypic IgH VDJ sequences for individual myeloma
patients, single BM plasma cells were sorted directly into PCR tubes
containing RT-lysis buffer, followed by reverse transcription and
amplification of cDNA with consensus primers to FR2 and Jh of
IgH.4,24,25 For all patients analyzed, a PCR product was obtained from the majority of these sorted plasma cells
(Fig 1A).
Clonotypic IgH VDJ sequences are detectable in the blood of patients
with MM.
To determine if clonotypic sequences were detectable in PBMC, total RNA
was purified from PBMC of myeloma patients, as well as from normal
donors, and subjected to PSA. All PBMC and BMC tested expressed mRNA
encoding IgH and histone. Figure 3 presents data for three representative myeloma patients, and shows that patient-specific clonotypic IgH transcripts were present in PBMC and
BMC of the relevant patient, but not in PBMC of unrelated myeloma
patients or normal-donor PBMC. The presence of clonotypic IgH
transcripts in RNA from myeloma PBMC was confirmed for all 19 patients.
Clonotypic cells are frequent in freshly isolated myeloma PBMC:
PBMC B cells express clonotypic transcripts, as confirmed
by sequencing of the amplified product.
To determine the frequency of clonotypic cells, a limiting dilution
analysis was performed using defined numbers of PBMC in threefold
dilutions to give from 1000 to 1 cells per tube. PBMC were diluted
immediately after purification. Two representative patients are shown
in Fig 4A and 4B. For freshly
diluted tubes containing 1000, 100, 10, or 3 PBMC per tube, all
replicates were positive indicating that every aliquot of 3 to 1000 cells included at least 1 clonotypic cell. At 1 cell per tube, 1/3 (Fig
4A and 4B) or 24 of 96 tubes (Fig 4C) were positive. The frequency of clonal cells was in the range of 25% to 33% of PBMC for these two
patients, comparable with that obtained for the same samples using in
situ RT-PCR (see below). A clonotypic RT-PCR product was not detected
in PBS control tubes. This type of experiment has been done for PBMC
samples from six other myeloma patients, and the frequency of
clonotypic PBMC was within the range of that calculated from analysis
by in situ RT-PCR.
Clonotypic PBMC are CD19+ B cells.
To confirm that B cells expressed the clonotypic sequence, single
CD19+ B cells were sorted into PCR tubes for direct lysis
followed by amplification of IgH transcripts using liquid phase
patient-specific RT-PCR. Results for two representative patients are
shown in Fig 5A. Clonotypic IgH transcripts
were amplified from three of eight B cells from patient 1, and for two
of eight B cells from patient 4.
On average, 66% of B cells in myeloma PBMC are clonotypic as
detected by in situ RT-PCR.
Table 3 records the frequency of clonotypic
B cells for each myeloma patient, as measured by in situ RT-PCR, for
one or more blood samples taken at regular clinical visits. In blood,
the proportion of sorted B cells expressing clonotypic IgH mRNA ranged from 9% to 95% with a mean of 66% ± 4% standard error (SE).
These values were used to calculate that 14% ± 2% of PBMC were
clonotypic cells (range, 0.9% to 50% of PBMC). The proportion of
clonotypic cells among total white blood cells was calculated as 3.5% ± 1% (range, 1% to 9%) (not shown). The absolute number of
circulating clonotypic B cells was 0.15 ± 0.02 × 109/L of blood (range, 0.01 to 0.61 × 109/L).
The number of clonotypic B cells in blood is reduced after
chemotherapy but most are drug-resistant survivors.
Figure 6A plots the absolute
numbers of circulating clonotypic B cells in individual myeloma
patients as a function of time and exposure to chemotherapy. Although
the absolute numbers decreased slightly in most of the patients who had
been evaluated at multiple time points, clonotypic cells persist in
blood during and after therapy. For one patient (#12) analyzed before
and after autologous stem-cell transplantation, a similar frequency of
clonotypic B cells was detectable before and after the transplantation,
and a high frequency was detected in the G-CSF-mobilized blood used for transplant (Fig 6B). For this patient, circulating clonotypic cells
appear to be mobilized by G-CSF and escape cytoreduction. A sequential
time course was performed for a second patient who subsequently
underwent allogeneic stem-cell transplantation. Figure 6C shows that
for patient 4, whose clonotypic B cells were only mildly depleted by
vincristine/adriamycin/dexamethasone (VAD) therapy, the
number of circulating clonotypic B cells was reduced 28-fold at 7 months, and became undetectable at 14 months after transplant.
The work presented here shows that 66% ± 4% of total circulating
blood B cells in 18 myeloma patients, or on average 14% of PBMC, have
an IgH rearrangement identical to that of autologous BM plasma cells.
The absolute number ranges from 0.01 to 0.61 × 109
clonotypic B cells/L of blood (mean, 0.15 ± .02 × 109/L). Using single-cell patient-specific RT-PCR of
freshly isolated myeloma PBMC, the amplified CDR3 transcripts were
sequenced and found to be identical for 18 individual B cells,
confirming the high frequency of clonotypic B cells, the specificity of
the patient-specific RT-PCR, and indicating that circulating myeloma B
cells exhibit intraclonal homogeneity. This implies that expansion of B
cells within the myeloma clone is independent of antigen-mediated
selective pressure, a characteristic of malignant lymphocytes.
Confirming the identity of clontypic PBMC, clonal IgH transcripts were
identified among 3 of 8 and 2 of 8 sorted B cells, from 2 different
patients, in single-cell RT-PCR. The clonotypic cells in the blood
express CD19, as well as CD34 and CD11b as shown
previously.24,25 The clonotypic PBMC detected cannot be
accounted for by circulating plasma cells, which are
infrequent38,39 and lack CD3.24,43,44 Thus,
based on their high frequency in blood of myeloma patients, their
phenotypic profile,4,24 and their
morphology,27,29 these clonotypic cells are B cells.
Consistent with our identification of the clonotypic B cell set as
adherent cells,6 Berenson et al14 have shown by
Southern blotting that rearranged myeloma IgH in blood derives from
adherent cells. To accurately quantify the number of clonotypic B
cells, patient-specific in situ RT-PCR was performed on sorted B cells.
The number of clonotypic B cells as measured by in situ RT-PCR
correlated with the number of clonotypic PBMC as measured by an RT-PCR
limiting dilution analysis of PBMC having patient-specific IgH
transcripts.
Submitted January 21, 1998;
accepted June 8, 1998.
Dr Tony Fields, Director of the Cross Cancer Institute, has been and
continues to be a supportive facilitator for this work. The Edmonton
Blood Transfusion Service provided blood samples from healthy normal
individuals. The Department of Surgery and the Hematology laboratory of
the University of Alberta Hospitals provided normal bone marrow. We
thank the myeloma patients at the Cross Cancer Institute for their
generous donations of tissues and their willingness to participate in
this study.
1.
Barlogie B,
Epstein J,
Selvanayagam P,
Alexanian R:
Plasma cell myeloma
1A. Szczepek AJ, Belch AR, Pilarski LM: Differential expression of
CD19 epitopes distinguishes circulating clonotypic B cells from
residual polyclonal B cells in multiple myeloma. (in
preparation)
2.
Greipp PR:
Advances in the diagnosis and management of myeloma.
Semin Hematol
29:24,
1992[Medline]
[Order article via Infotrieve]
3.
Pilarski LM,
Jensen GS:
Monoclonal circulating B cells in multiple myeloma: A continuously differentiating possibly invasive population as defined by expression of CD45 isoforms and adhesion molecules.
Hematol Oncol Clin North Am
6:297,
1992[Medline]
[Order article via Infotrieve]
4.
Bergsagel PL,
Masellis S,
Szczepek A,
Mant MJ,
Belch AR,
Pilarski LM:
In multiple myeloma, clonotypic B lymphocytes are detectable among CD19+ peripheral blood cells expressing CD38, CD56 and monotypic immunoglobulin light chain.
Blood
85:436,
1995
5.
Pilarski LM,
Masellis S,
Szczepek A,
Mant MJ,
Belch AR:
Circulating clonotypic B cells in the biology of myeloma. Speculations on the origin of multiple myeloma.
Leuk Lymphoma
22:375,
1996[Medline]
[Order article via Infotrieve]
6.
Jensen GS,
Mant MJ,
Belch AR,
Berensen JR,
Ruether BA,
Pilarski LM:
Selective expression of CD45 isoforms defines CALLA+ monoclonal B lineage cells in peripheral blood from myeloma patients as late stage B cells.
Blood
78:711,
1991
7.
Billadeau D,
Ahmann G,
Greipp P,
Van Ness B:
The bone marrow of multiple myeloma patients contains B cell populations at different stages of differentiation that are clonally related to the malignant plasma cell.
J Exp Med
178:1023,
1993 |
Abstract
Introduction
Abstract
80°C. After thawing, samples were heated to
70°C for 10 minutes, placed on ice, and 2 µL (100 U) of reverse
transcriptase SuperScript (GIBCO-BRL) was added into each tube and
incubated at 42°C for 60 minutes. The reaction was stopped by
heating at 99°C for 3 minutes. Alternatively, immediately after
purification, within 1 to 2 hours after the sample was drawn, PBMC were
diluted to an appropriate concentration as indicated in results and 1 µL of this suspension was deposited into 9 µL of lysis buffer
containing the reverse transcriptase, in PCR tubes. This step was
followed by an immediate incubation at 42°C for 60 minutes and next
at 99°C for 3 minutes. For either method, all of the obtained
single-cell cDNA was then used in a two-step nested PCR. Briefly, PCR
mix (0.2 mmol/L dNTPs, 10 mmol/L Tris-HCL pH 8.3, 0.2 µmol/L each of
sense and antisense primers, 2 mmol/L MgCl2, and 2 U of TAQ
polymerase) in a final volume of 50 µL was added to tubes, followed
by 30 cycles of 30 seconds at 94°C, 30 seconds at 52°C and 1 minute at 72°C. Four percent (vol/vol) of this PCR amplified
mixture was transferred into a secondary PCR mix with 2 mmol
MgCl2, FR2, and JH2 primers and cycled as previously for 35 cycles. Finally, 20% of the product was analyzed on 2% agarose gels
(GIBCO/BRL). For all samples, amplified products were subcloned into a
TA cloning vector (Invitrogen, Mississauga, Ontario, Canada) and cycle
sequenced with universal M13 forward and reverse primers. For
the PSA, 25 cycles were performed using CDR2 and CDR3 primers and an
annealing temperature of 60°C. The final product was analyzed on
2% agarose gel in 0.5 × TBE buffer.
New biological insights and advances in therapy.
Blood
73:865,
1989