|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 9 (November 1), 1998:
pp. 3057-3063
RAPID COMMUNICATION
Reversal of Lethal - and -Thalassemias in Mice by Expression of
Human Embryonic Globins
By
J. Eric Russell and
Stephen A. Liebhaber
From the Departments of Medicine (Hematology/Oncology), Pediatrics
(Hematology), and Genetics, and the Howard Hughes Medical Institute,
University of Pennsylvania School of Medicine, Philadelphia.
 |
ABSTRACT |
Genetic mutations that block - or -globin gene expression in
humans can result in severe and frequently lethal thalassemic phenotypes. Homozygous inactivation of the endogenous - or
-globin genes in mice results in corresponding thalassemic syndromes
that are uniformly fatal in utero. In the current study, we show that the viability of these mice can be rescued by expression of human embryonic - and -globins, respectively. The capacity of embryonic globins to fully substitute for their adult globin homologues is
further demonstrated by showing that - and -globins reverse the
hemolytic anemia and abnormal erythrocyte morphology of mice with
nonlethal forms of - and -thalassemia. These results illustrate the potential therapeutic utility of embryonic globins as substitutes for deficient adult globins in thalassemic individuals. Moreover, the
capacity of embryonic globins to functionally replace their adult
homologues brings into question the physiologic basis for globin gene
switching.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
MOLECULAR DEFECTS that affect the level
of - or -globin expression result in a collection of clinically
heterogeneous disorders known as - and -thalassemias,
respectively.1-3 As a group, thalassemias comprise the most
common genetic defects in humans, with a particularly high prevalence
in certain Mediterranean, central African, and south Asian
populations.2-4 Clinically significant thalassemias are
also increasingly recognized in members of many North American
immigrant communities.5 The phenotypes of specific thalassemic mutations are directly proportional to the quantitative deficits in globin gene expression and the resulting imbalance in
: -chain synthesis. Severe forms of thalassemia are characterized by retarded growth and development resulting from a marked hemolytic anemia, with a compensatory expansion of hematopoietic tissues and a
consequent hypermetabolic state.1-3 Complete loss of
-globin gene expression results in mid-gestational fetal demise
( -thalassemia hydrops fetalis),5 while complete loss of
-globin expression ( -thalassemia major) is lethal in untreated
children.2,3 Therapeutic options for severely affected
individuals are limited to allogeneic bone marrow transplantation (BMT)
or lifelong transfusions, neither of which is universally available and
both of which are attended by significant cost and risk.6-8
Two -like and two -like globin chains assemble into functional
hemoglobin (Hb) heterotetramers that reversibly and cooperatively bind
four O2 molecules under physiologic conditions. The
expression profile of the constituent globin monomers is
developmentally regulated. There are three functional -like globin
genes in both mouse and humans: , 2, and 1. Expression of
human -globin is specific to the primitive, nucleated erythroblasts
in the blood islands of the extraembryonic yolk sac.9,10 As
the site of active erythropoiesis migrates to the fetal liver, there is
silencing of the -globin gene and reciprocal induction of the two
-globin genes, which continue to express at high levels into
adulthood. The human -like globins are encoded by an embryonic
-globin gene, expressed in yolk sac erythroblasts, two fetal
-globin genes, and a -globin gene that is maximally induced at
birth and encodes almost 98% of the -like globin chains in normal
adult erythrocytes.1,9,11 Coordinate switching of genes
within the - and -globin clusters results in the sequential
assembly of characteristic Hbs during embryonic
( 2 2), fetal
( 2 2), and adult
( 2 2) developmental stages. The major
evolutionary factor driving wide phylogenic conservation of this system
is unknown, although developmental stage-specific Hbs may optimize
O2 delivery to embryonic, fetal, and adult tissues.
The presence of developmentally silenced, yet structurally intact,
globin genes in the - and -globin clusters suggests a potential
therapeutic approach to severe forms of thalassemia based on
reactivation of these "back-up" loci. Hypothetically, globin
chains expressed from these embryonic and fetal loci could substitute
for their deficient adult globin homologues in individuals with severe
thalassemias. This approach would be useful only if the Hbs assembling
from existing adult and reactivated embryonic globin subunits (eg, Hbs
2 2 and 2 2)
were functional in adult (definitive) erythrocytes. The feasibility of
this approach is demonstrated by the phenotypic reversion in
individuals with -thalassemia who overexpress fetal -globin,
assembling functional Hb
2 2.2,12 The capacity of
embryonic -globin to substitute for its adult -globin homologue
in definitive erythrocytes has not previously been explored. Likewise,
the possibility that embryonic -globin might substitute for adult
-globin, which has no fetal homologue, has never been investigated.
A major concern about stage-discordant globin substitution is the
likelihood that Hbs incorporating embryonic subunits would be
physiologically irrelevant in definitive erythrocytes. The widely held
model in which developmental globin switching reflects some crucial
difference between the functions of embryonic and adult globins
predicts that Hbs assembled from embryonic subunits should perform
poorly in adult erythrocytes. Recent studies demonstrating that these
Hbs exhibit substantially elevated O2 affinities in vitro
appear to support this model.13,14 However, these
predictions do not account for adaptive mechanisms that permit adults
expressing mutant Hbs with a wide spectrum of O2-binding
affinities to grow and develop normally, and to sustain normal
pregnancies.15,16 For these reasons, in vivo assessments
may prove to be more valuable predictors of embryonic globin
function.17 In the current work, we demonstrate the
capacity of human embryonic - and -globins to reverse the
phenotypes of adult - and -thalassemic mice, by substituting for
deficient -and -globin chains, respectively. Moreover, we show
that - and -globins maintain viability in mice with homozygous
lethal inactivation of their endogenous adult globin genes,
respectively. The data indicate that embryonic globins can function
efficiently in vivo in definitive erythrocytes, providing a rational
basis for the design of novel therapies aimed at their reactivation in
individuals with clinically-severe thalassemias.
 |
MATERIALS AND METHODS |
Transgene construction.
A 2.4-kb human (h) transgene, comprising a 0.6-kb human -globin
promoter fragment linked to the 1.8-kb -globin transcribed region
and proximal 3 flanking region, was constructed as previously described.18 A 4.1-kb h transgene was constructed using
a two-step splice-overlap-extension/polymerase chain reaction
synthesis,19 in which the 1.5-kb h transcribed region
was inserted between 0.8-kb and 1.7-kb fragments containing the h
promoter and enhancer elements, respectively.20 The h
and h transgenes were inserted into polylinker EcoRI and
Cla I/EcoRV sites of plasmid pSP72/ LCR, respectively, immediately adjacent to a 6.5-kb DNA fragment containing core elements of the human -globin LCR DNase I hypersensitive sites
1-4.18,21 All polymerase chain reaction (PCR)-amplified fragments were subsequently verified by dideoxy
sequencing.22 Linked 8.9-kb µ LCR/h and 10.6 kb
µ LCR/h fragments were released by Sal I/EcoRV
or EcoRI digestion, respectively, and purified over an Elutip
filtration column (Schleicher & Schuell, Keene, NH) before
microinjection.18
Transgenic mice.
Transgenic founders were generated according to a standard protocol by
the University of Pennsylvania Transgenic and Chimeric Mouse
Facility.18 Founder mice identified by Southern transfer analysis of tail DNA were mated with CD-1 females or C57BL6 males to
generate F1 progeny with germline transgene integration. Generation and
characterization of mice with targeted deletions of the endogenous -
and -globin genes are reported elsewhere.23-26 The
genotypes of progeny with combinations of human transgenes and gene
deletions were determined by Southern analysis and/or PCR
analysis of tail DNA, and/or deduced from their globin
phenotypes (detailed below).
Southern analysis.
Southern transfers were performed as previously described on 5 µg DNA
purified from the tails of candidate mice.18
[32P]-random-primer labeled probes were generated from
agarose gel-purified DNA templates. The h transgene was identified
as a 1.2-kb Pst I fragment using a 610-bp Nco I
template encompassing the h -globin promoter region.18
The h transgene was identified as a 5.1-kb BamHI DNA
fragment using a 572-bp BamHI/DraIII template
encompassing the junction of the constituent -globin promoter and
-globin transcribed regions. When necessary, a 1.3-kb
BamHI fragment of intergenic DNA from the mouse (m) -globin
cluster (the `X' region) was identified using itself as
template.18 Endogenous wild-type and -globin knockout
loci were identified as 13.0-kb and 9.0-kb HindIII DNA
fragments, respectively, using a 1.3-kb BamHI fragment originating 5 to the tandem m -globin genes.23
h transgene copy numbers were estimated as described,18
based on two copies of -globin gene/human genome and two copies of
`X' region/mouse genome.
PCR amplification.
Wild-type m -globin genes were identified as a 250-bp PCR product by
amplification of mouse tail DNA using an oligomer pair specific to
exons I and II of the mouse Major-,
Minor-, and Single-globin genes
(5 CAACCCCAGAAACAGACATC3 and
5 CCAAGGGTAGACAACCAGC3 ). The -globin knockout allele
(containing an HPRT mini-gene)24 was identified as a 179-bp
product with a sequence-specific oligomer pair
(5 GACTGAACGTCTTGCTCGAG3 and
5 AGCTCTTCAGTCTGATAAAATC3 ). Primers (100 pmol each) were
added to 0.25 µg DNA in a 50-µL reaction assembled according to the
manufacturer's recommendations (Perkin Elmer Cetus, Norwalk,
CT) with MgCl2 adjusted to 2 mmol/L.
Amplifications were performed for one cycle at 95°C × 3 minutes, 60°C × 15 seconds, and 72°C × 15 seconds,
and for an additional 29 cycles using a modified (92°C × 1 minute) denaturation step. PCR products were analyzed on
an EtBr-stained 5% polyacrylamide gel.
Globin analysis.
Five to 10 µL of phosphate-buffered saline (PBS)-washed transgenic
erythrocytes were lysed in 4 vol 1 mmol/L MgCl2, and
membranes pelleted at 4°C in a desktop centrifuge after addition of
1 vol 1.5 mol/L KCl. Globins were resolved by Triton-acid-urea gel
electrophoresis in 5% acetic acid and visualized by Coomassie blue
staining.27
Blood counts and peripheral blood smears.
Complete blood counts were performed on EDTA-anticoagulated blood from
duplicate age- and sex-matched mice using a Cell-Dyne 3500 analyzer
(Abbott Laboratories, Chicago, IL). Manually prepared peripheral blood smears were stained with Wright-Giemsa reagent and
photographed under oil at 100× magnification through an Optifoto microscope (Nikon, New York, NY) using Ektachrome 160T film (Eastman Kodak, Rochester, NY).
 |
RESULTS |
Generation of adult mice that express human embryonic globins.
Transgenes capable of expressing embryonic globins in adult
erythrocytes were constructed by linking the transcribed regions of the
human - and -globin genes to transcriptional control elements
from the human adult - and -globin genes, respectively (Fig 1A and B). The -globin transcribed
region was linked to the -globin promoter to generate the human (h ) transgene,18 while the human (h ) transgene
was constructed by inserting the -globin transcribed region between
the -globin promoter and 3 enhancer elements.20
Each chimeric gene was linked to core elements of hypersensitive sites
1-4 from the -globin locus control region (µ LCR) to promote
integration site-independent expression.18,21 Multiple
independent mouse lines containing the h and h transgenes were
generated using standard methods,18 and the transgene copy
number for each line was established in F1 mice.18 The
5 cap and 3 poly(A) addition sites of the transcribed h - and h -globin mRNAs were shown to be normally positioned using RNase protection analysis of RNA from adult reticulocytes (not shown).
The expression of human embryonic globins was demonstrated by gel
electrophoresis of clarified erythrocyte lysates (Fig
1C).27,28 Based on their high-level expression of h - or
h -globin, one h -and one h -globin line, with transgene copy
numbers of 14 and 7, respectively, were identified for use in all
subsequent studies.

View larger version (22K):
[in this window]
[in a new window]
| Fig 1.
Generation of adult mice expressing human embryonic -
and -globins. (A) Construction of the h transgene. The full human
-globin transcribed region (black) was linked to the human
-globin gene promoter and 5 untranslated region
(light).18 This chimeric h transgene was subsequently
linked to a µ LCR cassette containing core elements of DNase I
hypersensitive sites 1-4.21 Exons are indicated as filled
boxes, and translation initiation and termination codons by tick marks.
(B) Construction of the h transgene. The full-length -globin
transcribed region (black) is bracketed by the -globin promoter and
3 flanking region (light), including the 3 -globin
enhancer element (E). Exons and translation initiation and termination
sites are indicated as in (A). (C) Expression of embryonic globins in
definitive erythrocytes from mice carrying the h and h
transgenes. Clarified erythrocyte lysates from a wild type control
( ), and h and h adult transgenic mice were resolved by
Triton-acid-urea gel electrophoresis and visualized by Coomassie blue
staining.27,28 Globin bands are identified to the right.
The third lane (h ) was overloaded to demonstrate the h -globin
product.
|
|
Expression of embryonic h -globin reverses an -thalassemic
phenotype.
Embryonic -globin function in adult erythrocytes was initially
assessed by determining its capacity to reverse an -thalassemia phenotype. Transgenic mice expressing h -globin were mated with mice
heterozygous for combined deletion of the closely linked mouse 2-
and 1-globin genes (m +/ ; kind gift of
J. Chang and Y.W. Kan, University of California, San
Francisco).23 Globin genotypes of the offspring were
determined by Southern analysis of tail DNA
(Fig 2A), and phenotypes of compound hemizygous m +/ /h mice were subsequently
compared with those of sex-matched sibling m +/
controls. The size and shape of m +/ erythrocytes
varied widely (Fig 2C), modeling the changes typically observed in
human -thalassemic erythrocytes.1-3 In contrast, erythrocytes from sex-matched m +/ littermates
that coexpressed h -globin were morphologically normal. The
hypochromic, microcytic anemia of m +/ mice (low
Hb [Hb], elevated erythrocyte number [RBC], small erythrocyte size
[mean corpuscular volume or MCV], and depressed intracellular Hb
[mean corpuscular Hb or MCH]) reverted to normal in
m +/ mice that coexpressed h -globin. (Fig 2E).
The correction of the -thalassemia phenotype in
m +/ mice coexpressing h -globin suggests that
the embryonic globin assembles into Hb 2 2
heterotetramers that are functional in adult erythrocytes.

View larger version (38K):
[in this window]
[in a new window]
| Fig 2.
Function of human embryonic - and -globins in
adult murine erythrocytes. (A) Determination of mouse -globin
genotypes by Southern analysis. Duplicate Southern transfers of
Pst I-digested DNA from wild-type mice
( +/+), mice carrying the h transgene
( +/+/h ), mice heterozygous for deletion of the
m -globin genes ( +/ ), and mice heterozygous for
deletion of the m -globin genes that carried the h transgene
( +/ /h ). Blots were probed with a 1.3-kb fragment
originating 5 to the deleted m -globin sequences (upper
autoradiograph)23 or the h -globin promoter (lower
autoradiograph).18 The sizes and identities of the
wild-type (m +) and deleted m -globin loci
(m ), and the h transgene (h ) are indicated to
the left and right of each autoradiograph, respectively. (B)
Determination of mouse -globin genotypes by combined Southern and
PCR analyses. Tail DNA from mice was coamplified using paired oligomers
recognizing wild-type m -globin genes (250-bp product) or a fragment
of the HPRT cDNA comprising the knockout `socket' (179-bp
product).24 Reaction products were resolved and visualized
on an ethidium bromide-stained 5% polyacrylamide gel. Genotypes are
indicated at top. Southern analysis of the same DNA (bottom) using the
572-bp h probe indicates the presence/absence of the h transgene.
The sizes and identities of the wild-type (m +) and
deleted m -globin loci (m ), and the h transgene
(h ) are indicated to the left and right of each autoradiograph,
respectively. (C) Thalassemic erythrocyte morphology in
m +/ mice is corrected by coexpression of embryonic
-globin. Wright-Giemsa-stained peripheral blood smears from
wild-type, m +/ , and m +/ /h
mice, viewed under oil at 100 × magnification. A typical `target
cell' is indicated (arrow). (D) Thalassemic erythrocyte morphology in
m +/ mice is corrected by coexpression of embryonic
-globin. Wright-Giemsa-stained peripheral blood smears from
wild-type, m +/ , and m +/ /h
mice viewed under oil at 100 × magnification. (E) Resolution of
anemia and normalization of erythrocyte indices in
m +/ mice coexpressing embryonic -globin.
Erythrocyte analyses were performed on anticoagulated whole blood
collected from duplicate sex-matched 13-week adult siblings. The Hb
( ), RBC number ( ), MCV ( ), and MCH ( ) are plotted for mice
with the globin genotypes and sexes indicated at bottom. (F) Resolution
of anemia and normalization of erythrocyte indices in
m +/ mice expressing embryonic -globin. Analyses
were performed on anticoagulated whole blood collected from duplicate
sex-matched 9-week adult siblings as described in (E). The globin
genotypes and sexes are indicated at bottom.
|
|
Expression of embryonic h -globin reverses a -thalassemic
phenotype.
To assess the function of embryonic -globin in adult erythrocytes,
transgenic h mice were mated with mice heterozygous for deletion of
the two tandem endogenous adult -globin genes
(m +/ mice, kind gift of O. Smithies,
University of North Carolina, Chapel Hill).24 The genotypes
of offspring were determined by Southern and PCR analysis of tail DNA
(Fig 2B). Both male and female m +/ mice were
growth retarded and displayed marked splenomegaly, characteristics
shared by humans with severe forms of -thalassemia.1-3 Both of these phenotypic abnormalities resolved in
m +/ littermates coexpressing h -globin (data
not shown). Moreover, m +/ mice displayed severe
erythrocyte morphologic changes comprising marked variation in
erythrocyte size and shape, while erythrocytes from sex-matched
m +/ littermates coexpressing embryonic
h -globin appeared normal (Fig 2D). Coexpression of the h -globin
transgene also normalized Hb levels, RBC, MCV, and MCH in erythrocytes
from m +/ littermates (Fig 2F). The underlying
functional abnormalities in m +/ erythrocytes that
result in their abnormal morphologies are thus corrected by expression
of h -globin. These data imply that h -globin acts as a -like
globin in adult erythrocytes by assembling into functional Hb
2 2 heterotetramers.
Embryonic h -globin rescues the viability of mice with homozygous
lethal -globin gene deletion.
The function of h -globin in adult erythrocytes was more rigorously
tested by inbreeding m +/ /h mice to generate
embryos that were homozygous for the m deletion
(m / ). Although the expression of
endogenous m -globin permits normal embryonic development, mice with
the m / genotype die in utero at the time
of the embryonic - to adult -globin switch.25
Remarkably, however, these matings generated a number of
m / mice whose viability was rescued by
expression of embryonic h -globin. These
m / /h mice, which do not synthesize any
m -globin chains, appear identical to wild-type controls, are
fertile, and bear normal litters (Fig 3A and C, and data not shown).
The rescue of m / mice directly shows that
embryonic h -globin is a fully sufficient substitute for adult
-globin in definitive erythrocytes.
Embryonic h -globin rescues the viability of mice with homozygous
lethal -globin gene deletion.
A similar strategy was used to determine whether human embryonic
-globin could substitute for adult -globin in definitive erythrocytes. m +/ /h mice were inbred, and
genotypes of the weaned pups determined by analysis of genomic DNA (not
shown). We failed to identify any m / pups,
consistent with previous reports that mice with homozygous deletion of
the endogenous -globin genes (m / ) die
in utero.26 Remarkably, though, the matings generated liveborn m / /h mice that survived into
adulthood, despite the complete absence of adult -globin in their
erythrocytes (Fig 3B). Although viable m / /h mice are smaller than
nontransgenic controls (Fig 3D; see Discussion), their survival
demonstrates the functional overlap between embryonic and adult
-like globins.

View larger version (40K):
[in this window]
[in a new window]
| Fig 3.
Rescue of viability in mice homozygous for deletion of
adult - and -globin genes by expression of human embryonic -
and -globin. (A) Globin profile of m / /h
mice. Clarified erythrocyte lysates prepared from mice with the
indicated genotypes were resolved by Triton-acid-urea gel
electrophoresis and visualized by Coomassie Blue staining. The identity
of each globin band is indicated to the left of the gel. (B) Globin
profile of m / /h mice. Clarified erythrocyte
lysates were analyzed as described in (A). Genotypes are shown at the
top, and globins identified to the left. (C) Physical appearance of
m / /h mice. Female m / /h
and control CD-1 mice are shown. (D) Physical appearance of
m / /h mice. Male m / /h
and control C57BL6 mice are shown.
|
|
 |
DISCUSSION |
This report demonstrates that embryonic - and -globins can
functionally substitute for their adult - and -globin homologues in adult erythroid cells. These findings suggest that individuals with
- or -thalassemia would likely benefit from reactivation of their
endogenous embryonic - or -globin genes, respectively. Moreover,
the results bring into question the basis for the phylogenic conservation of globin gene switching.15,16,29
Transgenic mice are a valuable model system in which to study human
embryonic globin function. The organization of the globin genes,1,30-32 molecular controls of their
expression,1,33 and functions of their encoded globin
proteins25,26 are closely conserved between mice and
humans. Although mice do not exhibit a clearly defined fetal stage of
-globin gene expression, they parallel human development by
expressing different -like and -like globins during intrauterine
(embryonic/fetal) and extrauterine (adult) stages. The physiologic
characteristics of Hb function and O2 transport in mice and
humans are also quite similar. Previous reports have shown that
deficiencies of - or -globin chains in the mouse result in
disorders that closely model human - or -thalassemia,
respectively (Fig 2), and that human - and -globins can fully
substitute for their mouse counterparts.25,26 These data
indicate that the mouse model is an appropriate one in which to study
human globin function.
To test the thesis that embryonic globins could sustain adult life, it
was first necessary to overcome their tight developmental stage-specific regulation.1,9-11 Silencing of both - and
-globin genes at the embryonic-to-fetal transition appears to be
mediated primarily through their transcriptional
regulation,34-38 although recent evidence suggests that
posttranscriptional events contribute to this process.18,39
Elements mapping to the 5 flanking region regulate
transcriptional silencing of the -globin gene,34-36
while transcriptional silencing of the -globin gene requires
interaction of elements within both the 5 and 3 flanking
regions.18,37,38 To maximize - and -globin expression
in adults, these regulatory elements were replaced by promoter and
enhancer elements from the corresponding human adult globin genes (Fig
1A and B). By using this approach, and by linking each construct to a
µ LCR before microinjection,18,21 it was possible to
generate transgenes expressing high levels of embryonic globins in
definitive mouse erythrocytes (Fig 1C).
The phenotypic severity of a thalassemic phenotype parallels the
imbalance in - and -globin chain expression in terminally differentiating erythroid cells. The excess globin chains particularly free -globin chains exhibit cytotoxic effects that manifest
clinically as inefficient erythropoiesis and chronic hemolytic
anemia.1-3,5 Hence, the initial evidence that the embryonic
h - and h -globins could effectively substitute for deficient adult
- and -globins, respectively, was inferred from their ability to
reverse the thalassemic phenotypes of m +/ and
m +/ mice. As in humans who are heterozygous for
loss of both -globin loci ( -thalassemia trait),
m +/ mice grow normally despite a morphologically
distinct hypochromic, microcytic anemia (Fig 2C and E).25
Heterozygosity for loss of -globin gene expression
(m +/ ) in mice results in a slightly more severe
phenotype, comprising growth retardation, splenomegaly, and marked
erythrocyte abnormalities (Fig 2D and F, and data not
shown),26 as also occurs in humans.1-3 Remarkably, the expression of embryonic h -and h -globins reverses the growth retardation, anemia, and abnormal erythrocyte morphologies that characterize the thalassemic phenotypes in
m +/ and m +/ mice (Fig 2C
through F, and data not shown). These results suggest that embryonic
globins can substitute for their deficient adult counterparts, bringing
the : ratio back into balance.
The functional properties of embryonic - and -globins were
further tested by asking whether they were fully sufficient to replace
their corresponding adult - and -globins, respectively. As in
humans,5 the  / genotype in
mice is lethal in utero.25 Coexpression of embryonic h -globin in m / mice results in viable
adults which appear identical to age- and sex-matched wild-type
controls (Fig 3A and C). The m / genotype,
which is also lethal to mice in utero,26 differs from its
corresponding genetic disorder in humans, because human -globin
supports fetal growth and development through birth.1-3 Mice with homozygous lethal deletion of both -globin loci
(m / ) were rescued by expression of
embryonic h -globin (Fig 3B and D). Although these
m / /h mice were viable and fertile, they
appear to be small relative to wild-type controls. This modest growth
retardation may reflect a residual deficit in h -globin levels,
although functional deficiencies cannot be excluded. Nonetheless, the
data demonstrate that embryonic - and -globins are remarkably
effective substitutes for their adult - and -globin counterparts.
This implies assembly of functional Hb 2 2
and 2 2 heterotetramers that bind and
discharge O2 in a manner that is physiologically valuable
in adult erythrocytes.
The demonstration that expression of - and -globins reverses the
phenotypes in adult mice with deficient levels of - and -globins
indicates that clinically significant - and -thalassemias in
humans might be mitigated by reactivation of endogenous embryonic -
or -globin genes, respectively. The feasibility of this approach is
demonstrated by the phenotypic reversion resulting from high-level -globin expression in -thalassemics with concomitant HPFH
mutations.12 Embryonic globin genes are structurally and
functionally unaffected by the vast majority of - and
-thalassemic mutations, making them theoretically available for
reactivation in most fetuses or adults with thalassemia. The current
work shows that -globin, encoded by the single extant nonadult
-like globin gene, has potential value to individuals with severe
forms of -thalassemia (Hb H disease), as well as to developing
fetuses with otherwise lethal -thalassemia hydrops
fetalis.5 The parallel recognition that -globin can
substitute for -globin in adults provides an alternate to the
-globin genes as a target for developing molecular therapies. The
-globin gene may be particularly valuable in this regard, as its
transcriptional control is gene-autonomous,40 in contrast
with the fetal -globin genes, whose expression may be affected by
the structural integrity of the adjacent -globin gene.41-43 Theoretically, this functional linkage of -
and -globin gene expression might complicate attempts to fully
reactivate -globin gene expression in individuals with thalassemias
resulting from nondeletional mutations of the -globin gene. In
addition to its O2-transporting capacity, -globin may
possess other properties, such as antipolymerization activity, which
might benefit individuals with sickle cell disease or related
hemoglobinopathies. These functional characteristics of human embryonic
globins remain to be explored.
The current data bring into question the widely held model that the
highly conserved process of globin gene switching in higher vertebrates
reflects some crucial difference between the functions of embryonic and
adult globins. The viability of m / /h
mice indicates that -globin can subserve the spectrum of functions
required of -like globins in both embryonic and fetal/adult erythroid environments. The lack of a strong physiologic requirement for globin gene switching is further suggested by the recent
demonstration that -globin can also subserve both embryonic and
adult/fetal functions in mice with homozygous inactivation of
endogenous m -globin expression.44 These observations
would support previous claims that maintenance of a
trans-placental O2 gradient may not be the major
force underlying the evolutionary conservation of the -to- -globin switch.5,16 The phylogenic conservation of globin switching may instead reflect a marginal survival advantage due to mechanisms that have not yet been established. However, from the present data it
is clear that reactivation of the embryonic genes in erythroid progenitors from - or -thalassemic adults would result in a striking survival advantage.
 |
FOOTNOTES |
Submitted July 29, 1998;
accepted August 20, 1998.
Supported in part by Grants No. HL-K11-02623 (J.E.R.) and HL-38632
(S.A.L.). J.E.R. is the recipient of a research fellowship from the
Cooley's Anemia Foundation; S.A.L. is an Investigator of the Howard
Hughes Medical Institute.
Address reprint requests to J. Eric Russell, MD, Abramson
Research Bldg, Room 316F, Children's Hospital of Philadelphia, 34th St
and Civic Center Blvd, Philadelphia, PA 19104; e-mail:
jeruss{at}mail.med.upenn.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Y.W. Kan and J. Chang, and O. Smithies for generously
providing m +/ and m +/ mice,
respectively; K. Horiuchi for photomicroscopic assistance; A. Lee for
technical assistance; and S. Surrey and N. Cooke for critical reading
of the manuscript.
 |
REFERENCES |
1.
Liebhaber SA:
Molecular genetics of thalassemia
, in Verma RS
(ed):
Advances in Genome Biology, vol 2.
Greenwich, CT, JAI
, 1993
, p 283
2.
Bunn HF,
Forget BG:
Hemoglobin: Molecular, Genetic, and Clinical Aspects.
Philadelphia, PA, Saunders
, 1986
3.
Weatherall DJ,
Clegg JB:
The Thalassemia Syndromes.
Oxford, UK, Blackwell Scientific
, 1981
4.
Modell B,
Bulyzhenkov:
Distribution and control of some genetic disorders.
World Health Stat Quart
41:209,
1988[Medline]
[Order article via Infotrieve]
5.
Chui DHK,
Waye JS:
Hydrops fetalis caused by alpha thalassemia: An emerging health care problem.
Blood
91:2213,
1998[Free Full Text]
6.
Giardini C,
Galimberti M,
Lucarelli G:
Bone marrow transplantation in thalassemia.
Annu Rev Med
46:319,
1995[Medline]
[Order article via Infotrieve]
7.
Giardina PJ,
Grady RW:
Chelation therapy in beta thalassemia: The benefits and limitations of desferrioxamine.
Semin Hematol
32:310,
1995
8.
Feitelson M,
Lega L,
Guo J,
Resti M,
Rossi ME,
Azzari C,
Blubberg BS,
Vierucci A:
Pathogenesis of posttransfusion viral hepatitis in children with beta thalassemia.
Hepatology
19:558,
1994[Medline]
[Order article via Infotrieve]
9.
Peschle C,
Mavilio F,
Care F,
Migliaccio G,
Migliaccio AR,
Salvo G,
Samoggia P,
Petti S,
Guerriero R,
Marinucci M,
Lazzaro D,
Russo G,
Mastroberardino G:
Haemoglobin switching in human embryos: asynchrony of zeta alpha and epsilon gamma globin switches in primitive and definitive erythropoietic lineage.
Nature
313:235,
1985[Medline]
[Order article via Infotrieve]
10.
Albitar M,
Care A,
Peschle C,
Liebhaber SA:
Developmental switching of messenger RNA expression from the human alpha-globin cluster: Fetal/adult pattern of theta globin gene expression.
Blood
80:1586,
1992[Abstract/Free Full Text]
11.
Ley TJ,
Maloney KA,
Gordon JI,
Schwartz AL:
Globin gene expression in erythroid human fetal liver cells.
J Clin Invest
83:1032,
1989
12.
Wood WG:
Increased Hb F in adult life
, in Higgs DR,
Weatherall DJ
(eds):
The Hemoglobinopathies.
London, UK, Balliere Tindall
, 1993
13.
Mould RM,
Hofmann OM,
Brittain T:
Production of human embryonic hemoglobin (Gower-II) in a yeast expression system.
Biochem J
298:619,
1994
14.
Hofmann OM,
Mould R,
Brittain T:
Allosteric modulation of oxygen binding to the three human embryonic hemoglobins.
Biochem J
306:367,
1995
15.
Adamson JW,
Parer JT,
Stamatoyannopoulous G:
Erythrocytosis associated with hemoglobin Ranier: Oxygen equilibria and marrow regulation.
J Clin Invest
48:1376,
1969
16.
Charache S,
Catalano P,
Burns S,
Jones RT,
Koler RD,
Rutstein R,
Williams RR:
Pregnancy in carriers of high-affinity hemoglobins.
Blood
65:713,
1985[Abstract/Free Full Text]
17.
Adachi K,
Konitzer P,
Lai CH,
Kim J,
Surrey S:
Oxygen-binding properties and mechanical stability of human hemoglobin made in yeast.
Protein Eng
5:807,
1992[Abstract/Free Full Text]
18.
Liebhaber SA,
Wang Z,
Cash F,
Monks B,
Russell JE:
Developmental silencing of the embryonic zeta-globin gene: Concerted action of the promoter and the 3 flanking region combined with stage-specific silencing of the transcribed region.
Mol Cell Biol
16:2637,
1996[Abstract]
19.
Russell JE,
Liebhaber SA:
The stability of human beta-globin mRNA is dependent on structural determinants positioned within its 3 untranslated region.
Blood
87:5314,
1996[Abstract/Free Full Text]
20.
Trudel M,
Constantini F:
A 3 enhancer contributes to the stage-specific expression of the human beta-globin gene.
Genes Dev
1:954,
1987[Abstract/Free Full Text]
21.
Talbot D,
Collis P,
Antoniou M,
Vidal M,
Grosveld F,
Greaves DR:
A dominant control region from human beta-globin locus conferring integration site-independent gene expression.
Nature
33:352,
1989
22.
Sanger F,
Nicklen S,
Coulson AR:
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463,
1977[Abstract/Free Full Text]
23.
Chang J,
Lu RH,
Xu SM,
Meneses J,
Chan K,
Pederson R,
Kan YW:
Inactivation of mouse alpha-globin gene by homologous recombination: Mouse model of hemoglobin H disease.
Blood
88:1846,
1996[Abstract/Free Full Text]
24.
Detloff PJ,
Lewis J,
John SWM,
Shehee WR,
Langenbach R,
Maeda N,
Smithies O:
Deletion and replacement of the mouse adult beta-globin genes by a "plug and socket" repeated targeting strategy.
Mol Cell Biol
14:6936,
1994[Abstract/Free Full Text]
25.
Pastzy C,
Mohandis N,
Stevens ME,
Loring JF,
Liebhaber SA,
Brion CM,
Rubin EM:
Lethal alpha-thalassemia created by gene targeting in mice and its genetic rescue.
Nat Genet
11:33,
1995[Medline]
[Order article via Infotrieve]
26.
Ciavatta DJ,
Ryan TM,
Farmer SC,
Townes TM:
Mouse model of human beta(o) thalassemia: Targeted deletion of the mouse beta maj- and beta min-globin genes in embryonic stem cells.
Proc Natl Acad Sci USA
92:9259,
1995[Abstract/Free Full Text]
27.
Rovera G,
Magarian C,
Borun TW:
Resolution of hemoglobin subunits by electrophoresis in acid urea polyacrylamide gels containing Triton X-100.
Anal Biochem
85:506,
1978[Medline]
[Order article via Infotrieve]
28.
Alter BP:
Gel electrophoretic separation of globin chains.
Prog Clin Biol Res
60:157,
1981[Medline]
[Order article via Infotrieve]
29.
Stryer L:
Biochemistry.
New York, NY, Freeman
, 1993
, p 157
30.
Jimenez G,
Gale KB,
Enver T:
The mouse beta-globin locus control region: hypersensitive sites 3 and 4.
Nucleic Acids Res
20:5797,
1992[Abstract/Free Full Text]
31.
Hug B,
Moon AM,
Ley TJ:
Structure and function of the murine beta-globin locus control region 5 HS-3.
Nucleic Acids Res
20:5771,
1992[Abstract/Free Full Text]
32.
Kielman MF,
Smits R,
Bernini LF:
Localization and characterization of the mouse alpha-globin locus control region.
Genomics
21:431,
1994[Medline]
[Order article via Infotrieve]
33.
Enver T,
Li Q,
Gale KB,
Hu M,
May GE,
Karlinsey JE,
Jiminez G,
Papayannopoulou T,
Constantini F:
Analysis of the developmental and transcriptional potentiation functions of 5 HS-2 of the murine beta-globin locus control region in transgenic mice.
Dev Biol
165:574,
1994[Medline]
[Order article via Infotrieve]
34.
Raich N,
Papayannopoulou T,
Stamatoyannopoulous G,
Enver T:
Demonstration of a human epsilon-globin gene silencer with studies in transgenic mice.
Blood
79:861,
1992[Abstract/Free Full Text]
35.
Trepicchio WL,
Dyer MA,
Baron MH:
Developmental regulation of the human embryonic beta-like globin gene is mediated by synergistic interactions among multiple tissue- and stage-specific elements.
Mol Cell Biol
13:7457,
1993[Abstract/Free Full Text]
36.
Peters B,
Merezhinskaya N,
Diffley JFX,
Noguchi CT:
Protein-DNA interactions in the epsilon-globin gene silencer.
J Biol Chem
268:3430,
1993[Abstract/Free Full Text]
37.
Sabeth DE,
Koehler KM,
Yang WQ,
Patton K,
Stamatoyannopoulous G:
Identification of a major positive regulatory element located 5 to the human zeta-globin gene.
Blood
82:2899,
1995[Abstract/Free Full Text]
38.
Sabath DE,
Koehler KM,
Yang WQ:
Structure and function of the zeta-globin upstream regulatory element.
Nucleic Acids Res
24:4978,
1996[Abstract/Free Full Text]
39.
Russell JE,
Morales J,
Makeyev A,
Liebhaber SA:
Sequence divergence in the 3 UTRs of human zeta- and alpha-globin mRNA mediates a difference in their stabilities and contributes to efficient zeta-to-alpha gene developmental switching.
Mol Cell Biol
18:2173,
1998[Abstract/Free Full Text]
40.
Raich N,
Enver T,
Nakamoto B,
Josephson B,
Papayannopoulou T,
Stamatoyannopoulous G:
Autonomous developmental control of human embryonic globin gene switching in transgenic mice.
Science
23:1147,
1990
41.
Behringer RR,
Ryan TM,
Palmiter RD,
Brinster RL,
Townes TM:
Human gamma- to beta-globin gene switching in transgenic mice.
Genes Develop
4:380,
1990[Abstract/Free Full Text]
42.
Enver T,
Raich N,
Ebens AJ,
Papayannopoulou T,
Constantini F,
Stamatoyannopoulous G:
Developmental regulation of human fetal-to-adult globin gene switching in transgenic mice.
Nature
344:309,
1990[Medline]
[Order article via Infotrieve]
43.
Shih DM,
Wall RJ,
Shapiro SG:
Developmentally regulated and erythroid-specific expression of the human beta-globin gene in transgenic mice.
Nucleic Acids Res
18:5465,
1991[Abstract/Free Full Text]
44.
Leder A,
Daugherty C,
Whitney B,
Leder P:
Mouse zeta- and alpha-globin genes: embryonic survival, alpha thalassemia, and genetic background effects.
Blood
90:1275,
1997[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Beauchemin and M. Trudel
Evidence for a Bigenic Chromatin Subdomain in Regulation of the Fetal-to-Adult Hemoglobin Switch
Mol. Cell. Biol.,
March 15, 2009;
29(6):
1635 - 1648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. Fu, T.-T. Du, M. Dong, K.-Y. Zhu, C.-B. Jing, Y. Zhang, L. Wang, H.-B. Fan, Y. Chen, Y. Jin, et al.
Mir-144 selectively regulates embryonic {alpha}-hemoglobin synthesis during primitive erythropoiesis
Blood,
February 5, 2009;
113(6):
1340 - 1349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. He and J. E. Russell
Dynamic posttranscriptional regulation of {epsilon}-globin gene expression in vivo
Blood,
January 15, 2007;
109(2):
795 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Suwanmanee, H. Sierakowska, G. Lacerra, S. Svasti, S. Kirby, C. E. Walsh, S. Fucharoen, and R. Kole
Restoration of Human beta -Globin Gene Expression in Murine and Human IVS2-654 Thalassemic Erythroid Cells by Free Uptake of Antisense Oligonucleotides
Mol. Pharmacol.,
September 1, 2002;
62(3):
545 - 553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. He and J. E. Russell
A human embryonic hemoglobin inhibits Hb S polymerization in vitro and restores a normal phenotype to mouse models of sickle cell disease
PNAS,
August 6, 2002;
99(16):
10635 - 10640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Yu and J. E. Russell
Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human {beta}-Globin mRNA
Mol. Cell. Biol.,
September 1, 2001;
21(17):
5879 - 5888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. He and J. E. Russell
Expression, purification, and characterization of human hemoglobins Gower-1 ({zeta}2{epsilon}2), Gower-2 ({alpha}2{epsilon}2), and Portland-2 ({zeta}2{beta}2) assembled in complex transgenic-knockout mice
Blood,
February 15, 2001;
97(4):
1099 - 1105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lacerra, H. Sierakowska, C. Carestia, S. Fucharoen, J. Summerton, D. Weller, and R. Kole
Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients
PNAS,
August 15, 2000;
97(17):
9591 - 9596.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|