|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 9 (November 1), 1998:
pp. 3318-3327
Expansion of Philadelphia Chromosome-Negative
CD3+CD56+ Cytotoxic Cells From Chronic
Myeloid Leukemia Patients: In Vitro and In Vivo Efficacy in Severe
Combined Immunodeficiency Disease Mice
By
Christine Hoyle,
Charles D. Bangs,
Pearl Chang,
Onsi Kamel,
Bela Mehta, and
Robert S. Negrin
From the Division of Bone Marrow Transplantation, Department of
Medicine; the Department of Pathology, Stanford University Medical
School, Stanford; and Becton Dickinson Immunocytometry
Systems, San Jose, CA.
 |
ABSTRACT |
We have developed culture conditions for the efficient expansion of
cytotoxic effector cells from peripheral blood mononuclear cells
(PBMNCs) by the timed addition of interferon- (IFN- ), interleukin-2 (IL-2), and the monoclonal antibody (MoAb) OKT3. These
cells, termed cytokine-induced killer (CIK) cells, are composed primarily of T cells, and the population of cells with the greatest cytotoxic activity is an otherwise rare population of
CD3+CD56+ cells that expand dramatically
under these culture conditions. CIK cells were expanded from PBMNCs
from 13 patients with chronic myeloid leukemia (CML). These cultures
contained a variable number of T cells at the start of the culture
(median 44%, range 1% to 64%), yet after 21 to 28 days of culture,
virtually all of the cells were CD3+ T cells (median
97%, range 90% to 99%). The CD3+CD56+
subset of cells expanded significantly (median 25-fold, range 2.2- to
525-fold). CIK cells from all patients showed cytotoxicity against the
tumor cell lines OCI-LY8 and K562. In four patients the expanded CIK
cells suppressed colony growth of autologous CML blast cells and
myeloid progenitor cells. Allogeneic CIK cells from normal donors also
suppressed CML colony growth but did not inhibit growth of normal
hematopoietic colonies. Twelve of the 13 cultures were exclusively
composed of Philadelphia (Ph)-negative cells and one culture had 1 out
of 20 Ph-positive metaphases after 4 weeks in culture. Intracellular
cytokine production was assayed by fluorescence-activated cell sorter
(FACS), and the expanded T-cell cultures produced IL-2, IFN- , and
tumor necrosis factor- (TNF- ), but not IL-4. Both the
CD4+ and CD8+ subsets secreted this
cytokine profile. To test the in vivo activity of the expanded CIK
cells, CML was engrafted into severe combined immunodeficiency disease
(SCID) mice using matrigel. After 4 weeks, 4 × 107
autologous CIK cells were injected intravenously by tail vein injection
into groups of mice, and the animals were sacrificed after a total of
18 weeks. Bcr-abl was detected in the bone marrow or spleen of 5 out of
6 control mice and only 2 out of 13 mice who received the autologous
CIK cells (P = .02). In an additional series of animals, the
mice did not engraft with CML but instead developed large human
Epstein-Barr virus-associated lymphomas by 12 weeks. The mice who
received autologous CIK cells at 4 weeks had either no tumor (5) or
small tumors (5), whereas all 10 mice that received CIK cells at week 8 developed lymphomas; however, these were not as large as in the 10 control mice who did not receive CIK cells (P = .03). This
study shows that CIK cells, which are Ph chromosome-negative, can be
expanded from patients with CML and have potent in vitro and in vivo
efficacy against autologous tumor cells.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
CHRONIC MYELOID leukemia (CML) is a fatal
myeloproliferative disorder that is characterized by the presence of
the Philadelphia (Ph) chromosome leading to the transcription of an
abnormal fusion gene termed bcr-abl. At present CML is only curable by
allogeneic bone marrow transplantation (BMT),1,2 although
autologous BMT (ABMT)3,4 and treatment with interferon-
(IFN- ) may prolong survival.5 Allogeneic BMT is a highly
effective treatment for CML due to the high dose chemoradiation
conditioning regimen and immune effects known as graft-versus-leukemia
(GVL). The importance of immune effects in CML is shown by the high
rate of relapse of CML following T-cell-depleted BMT6 and
identical twin transplants.7 A GVL reaction has been
directly shown by the success of donor buffy coat infusions to treat
patients who have relapsed following allogeneic BMT.8,9
Despite the use of unrelated donors, the majority of patients with CML
will not have an allogeneic bone marrow donor or will be too old to pursue aggressive therapy. Alternative strategies are, therefore, needed.
In recent years, a number of centers have reported studies of
autologous BMT for chronic-phase CML, using a variety of conditioning regimens and purged and unpurged stem cells.3,4,10-12 Many patients became Ph negative shortly after ABMT, and a few have remained
Ph negative for long periods of time. In some studies, survival was
prolonged compared with historical conventionally treated patients.
Survival and possibly cure may be further improved if immunotherapy
could be developed that is effective in the autologous setting. Toward
this end, HLA-restricted T-cell clones have been generated that
recognize bcr-abl-specific peptides and autologous leukemic cells but
not normal cells.13,14 The generation of T-cell clones from
individual patients is difficult, time consuming, and probably not a
viable option for routine therapeutic use. Natural killer (NK) cells
and lymphokine-activated killer (LAK) cells have been shown to have in
vitro cytotoxicity against autologous and allogeneic CML
cells,15,16 which has been corelated with an improved
clinical outcome.17 However, NK cells do not expand well in
vitro and need exogenous interleukin-2 (IL-2) for maximum activity in
vivo.
We have defined culture conditions, using IFN- , IL-2, and a
monoclonal antibody directed against CD3 (OKT3), where a subset of T
cells with the phenotypes of
CD3+CD16 CD56+ and
CD3+CD16 CD56 can be
expanded ex vivo. These expanded cells, which have been termed
cytokine-induced killer (CIK) cells, have non-major histocompatibility complex (MHC) restricted cytotoxicity against a variety of tumor cell
targets.18,19 The cells with the greatest cytotoxic
activity in these cultures are the otherwise rare population of
CD3+CD56+ cells, which expand up to 1,000-fold
after 3 to 4 weeks in culture. This population of
CD3+CD56+ cells was initially described in 1986 by Ritz20 and Lanier21 and further
characterized by Ortaldo,22 who showed that
CD3+CD56+ cells are capable of lysing a broad
array of tumor cell targets in a non-MHC-restricted manner. In CIK
cell cultures, the expanded CD3+CD56+ cells are
derived from CD3+CD56 T cells and not
CD3 CD56+ NK cells.19 CIK
cells have been shown to protect animals from a lethal challenge of a
non-Hodgkin's lymphoma cell line in vivo using mice with severe
combined immunodeficiency (SCID). Approximately 30% to 40% of animals
treated with CIK cells survived long term as compared with none of the
control animals injected with the human non-Hodgkin's lymphoma cell
line SU-DHL-4.19,23 In addition, the expanded CIK cells
have been shown to be superior to IL-2-activated NK cells in this SCID
mouse model and do not require exogenous administration of IL-2 for in
vivo activity.19 In vitro, the cytotoxicity of
CD3+CD56+ cells is inhibited by antibodies to
ICAM-1, LFA-1, and CD18 but not by antibodies to TCR, CD3, CD4, CD8,
CD56, MHC class I, or MHC class II.18
In this study we show that CIK cells can be generated from CML
patients. The expanded CIK cells are Ph chromosome negative and have
both in vitro and in vivo cytotoxicity against tumor cell lines and
autologous leukemic cells. CIK cells may be a useful therapeutic
option, for example, following an autologous transplant procedure.
 |
MATERIALS AND METHODS |
Patients.
Peripheral blood progenitor cells (PBPCs) or bone marrow (BM) cells
were obtained after informed consent from 11 chronic-phase CML patients
and 2 blast crisis patients before allogeneic or autologous BMT. For
autografting, PBPCs were mobilized with idarubicin, cytarabine, and
etoposide chemotherapy.11 Details on individual patients
from whom CIK cells were generated are presented in
Table 1. For the in vivo CIK experiments in
mice, fresh BM was obtained from patient K.D. at the time of a back-up
BM harvest; patient M.R. underwent leukopheresis; and blast cells from
patient R.G. were collected after 6 cGy of radiation when the
white blood cell count rose suddenly to 165 × 109/L. All cells injected into the animals were 100%
Ph+, as assessed by cytogenetics.
Generation of CIK cells.
BM or peripheral blood mononuclear cells (PBMNCs) were isolated by
ficoll density gradient centrifugation, washed, and resuspended at 2 to
5 × 106 cells/mL in complete RPMI (cRPMI) containing
10% fetal calf serum (FCS; Hyclone labs, Logan, UT), penicillin 100 U/mL, streptomycin 100 mg/mL, 2 mmol/L l-glutamine, and 50 µmol/L
2-mercaptoethanol. On day 1, IFN- (Genentech, South San Francisco,
CA) was added to a final concentration of 1,000 U/mL. On day 2, IL-2
(Chiron, Inc, Emeryville, CA) at a final concentration of 300 U/mL and a monoclonal antibody to CD3 (OKT3; Ortho Biotech,
Raritan, NJ) at 25 ng/mL were added. Cultures were fed every 5 to 7 days with cRPMI and IL-2. Expansion was assessed between days 21 and
30.
Cytogenetic studies.
An aliquot of cells in cRPMI and IL-2 was removed from the cultures at
various time points from 7 to 30 days, and colchicine 50 ng/mL was
added for 1 hour (termed lymphoid cytogenetics). Cells were stained
with Giemsa, G banded, and 20 cells on average were analyzed for the
presence of the Ph chromosome. In some patients an aliquot of cells was
removed, washed 3 times to remove any IL-2, and resuspended in
Myelocult (Terry Fox Labs, Vancouver, Canada). Cytogenetics was
performed after 2 to 4 days in culture (termed myeloid cytogenetics).
Hematopoietic colony assays of CIK cells.
A total of 2 × 105 cells was washed 3 times in
phosphate-buffered saline (PBS) to remove any IL-2 and plated in
triplicate in 1mL of methocult (Terry Fox Labs). Colonies were counted
after 14 days of culture in 5% CO2. Clusters of more than
50 cells were scored as colonies.
Fluorescence-activated cell sorter (FACS) analysis.
A total of 1 × 106 ficolled MNC or CIK cells was
washed once in PBS containing 1% bovine serum albumin (BSA) and
resuspended in 100 µL PBS/BSA. The cells were incubated with various
conjugated monoclonal antibodies for 60 minutes at 4°C, washed
twice in PBS, and resuspended in 200 µL of PBS. Ten milliliters of
propridium iodide (PI) was added to each tube shortly before analysis.
Flow cytometric analysis was performed on the FACScanner (Becton
Dickinson, San Jose, CA), and data on 10,000 cells were acquired. Dead
cells were excluded by PI after acquisition, and results reported are for live cells only. The monoclonal antibodies (Becton Dickinson) used
were CD3, CD4, CD16 (FITC conjugated); CD8, CD34, CD56 (phycoerythrin [PE] conjugated); and CD4, CD8 (PerCP conjugated).
Intracellular cytokine production.
Day-21 to -28 CIK cells known to be greater than 98% CD3+
were analyzed for intracellular expression of IL-2, TNF, IFN- , and IL-4. Ten micrograms brefeldin A was added to two tubes containing 5 × 106 CIK. The cells in one tube were stimulated for
4 hours at 37°C with 25 ng Phorbol 12-Myristate
13-Acetate (PMA) and 1 µg ionomycin (activated), and then both tubes
were stained with CD8 PCP and CD56 FITC (as above) and washed once in
PBS. A total of 1 × 106 cells was permeabilized in
separate tubes using 500 µL of 1× FACS permeabilizing solution
(Becton Dickinson) for 10 minutes at room temperature and washed once
in PBS/1% BSA. Cells were then incubated with 20 µL of PE-conjugated
antibodies to IL-2, TNF, IFN- , or IL-4 for 30 minutes at room
temperature. Cells were then washed and fixed in 1% paraformaldehyde.
Data were acquired on 50,000 cells using a FACS vantage analyzer and
analyzed using LYSYS II software (Becton Dickinson).
Cr51 cytotoxicity assay.
Two tumor cell lines, OCI-Ly8, a human lymphoma cell line, and K562, a
Ph+ erythroleukemia cell line, were selected as targets. A
total of 1 × 106 target cells was labeled with 100 µCi of Cr51 (Dupont-NEN, Boston, MA) for 1 to 2 hours at
37°C. The labeled cells were washed three times in PBS and
resuspended in 10 mL of cRPMI. A total of 1 × 104
targets in 100 µL cRPMI was plated in triplicate into U-bottomed 96-well plates and incubated for 4 hours with 100 µL of effector cells at various effector-to-target ratios. Cells were then collected by centrifugation and an aliquot of supernatant counted in a gamma counter. The percentage of specific lysis was calculated according to
the equation:
Spontaneous
release was obtained by incubating cells in medium alone and maximal
release after treatment with 2% Nonidet P-40 (Sigma, St
Louis, MO).
Preparation of mice.
CB17 SCID mice 8 to 12 weeks old were obtained from the colony at
Stanford University. From birth, mice were housed in a clean isolated
environment with autoclaved food and water containing trimethoprim
sulfamethoxazole (Biocraft, Elmwood Park, NJ). To eradicate NK
cells,24 the mice received 20 µL of antiasialo GM1 rabbit
antiserum (Wako Chemicals, Dallas, TX) by intraperitoneal injection
(IP) on the day of injection of the CML cells. Antiasialo GM1 antiserum
was not given at the time of injection of the CIK cells.
Preparation and injection of CP-CML cells.
Fresh BM cells from CML patients were layered over percoll (Pharmacia,
Uppsala, Sweden) of density of 1.068 g/L to remove red cells and mature
myeloid cells. Cells were washed twice in PBS and resuspended in 100 to
200 µL of cRPMI. The cells (in 200 µL) were then added to 1 mL of
cold matrigel (Becton Dickinson) on ice, vortexed, and aspirated into a
1-mL syringe using a 21-gauge needle for injection into the mice. For
each patient sample, colony-forming unit-granulocyte-macrophage
(CFU-GM) and burst-forming unit-erythroid (BFU-E) assays were
performed and the CD34 content assayed by FACS using the PE-conjugated
antibody HPCA (Becton Dickinson).
In vivo assessment of cytotoxicity of CIK cells.
To test the in vivo activity of expanded CIK cells, 20 mice were
injected with 9 × 106 low-density BM cells,
containing 1.5 × 106 CD34+ cells from
patient K.D., in matrigel subcutaneously. The human cytokines
stem cell factor (SCF) 100 ng/mL (Amgen, Thousand Oaks, CA), IL-3 100 ng/mL (Sandoz, E Hanover, NJ), and granulocyte-macrophage colony-stimulating factor (GM-CSF) 50 ng/mL (Immunex, Seattle, WA) were
added to the matrigel, and the mice did not receive any additional
cytokines. After 4 weeks, seven mice received 4 × 107
autologous CIK cells grown from the PB, and seven mice received 4 × 107 CIK cells grown from the BM, by tail vein
injection. Exogenous IL-2 was not given.
An additional 30 mice were injected with 1 mL of matrigel containing 1 × 107 MNC cells (2 × 106
CD34+ cells) from patient M.R. and 1 × 106 irradiated M210B4 cells that were genetically
engineered to secrete human IL-3 (gift from Dr D. Hogge, Vancouver,
Canada). Cytokines were added to the matrigel as described previously.
After 4 and 8 weeks, 10 mice in each group were injected with 2 × 107 autologous CIK cells derived from the PB by tail vein
injection.
A total of 2 × 106 blast cells from patient R.G. was
injected subcutaneously (SC) in matrigel into 30 mice. After 4 weeks, 12 mice were injected intravenously (IV) with 2 × 107
fresh PB from the allogeneic donor (K.S.) and 7 mice with 2 × 107 CIK cells grown from the allogeneic donor.
Detection of CML in SCID mice.
To detect engraftment of primitive hematopoietic stem cells rather than
a committed progenitor, individual mice were sacrificed after 12 weeks
unless they became ill. The spleen (SP) was removed, half of which was
made into a single-cell suspension. BM was extracted from the femurs.
Excess red blood cells (RBCs) were lysed with NH4Cl, and
the cells were washed twice in PBS. A total of 2 × 105 BM or SP cells was plated separately in 1 mL of methyl
cellulose containing SCF (100 ng/mL), IL-3 (100 ng/mL), GM-CSF (50 ng/mL), and erythropoietin (3 U/mL) and incubated at 37°C in 5%
CO2 for 14 to 21 days. An aliquot of cells from the BM and
SP was used for reverse transcription polymerase chain reaction
(RT-PCR), and cytospins were prepared.
RT-PCR.
RNA was extracted using either the RNeasy kit (Qiagen Inc, Santa
Clarita, CA), Trizol (GIBCO, Grand Island, NY), or RNAzol B (TM Cinna
Scientific Inc, Friendswood, TX). The extracted RNA was dissolved in 30 µL DEPC-treated water. Amplification of the mouse housekeeping gene
hypoxanthine phosphoribosyltransferase (HPRT) was used for ensuring the
integrity of the RNA.25 To perform RT-PCR, the RNA was
incubated with 1 µL of 5 RNAse inhibitor (5 Prime 3 Prime Inc, Boulder, CO) and 3 µL of random hexamers 200 ng/mL
(Pharmacia, Piscataway, NJ) for 5 minutes at 70°C and then rapidly
chilled. Sixteen microliters of the reaction mixture containing 5 U of
MLV reverse transcriptase (GIBCO) was added followed by an incubation
at 37°C for 2 hours and 90°C for 5 minutes. One fifth (10 µL)
of the reaction product was added to 20 µL of PCR reaction mixture
containing 1U of TAQ polymerase (GIBCO) and appropriate primers
(BCR-1A, ABL-2C, or HPRT-S, HPRT-AS). After overlayering with oil, 33 cycles of PCR was performed using a Perkin Elmer thermocycler (Chiron,
Emeryville, CA). To increase the sensitivity of detection of bcr-abl, a
second round of PCR was performed using the nested primers BCR-1B and
ABL-2D.26 The sequence of the primers used is as follows.
For amplification of bcr-abl, ABL2C 5 TTATCTCCACTGGCCACAAA
3 , BCR1A 5 AGTTACACGTTCCTGATCTC 3 , ABL2D 5
AGTGCAACGAAAAGGTTGGG 3 , BCR1B 5 TCTGACTATGTGCGTGCAGA 3 . The expected product size is either 363 bp (b3a2 transcript) or 288 bp (b2a2 transcript). For detection of the mouse HPRT gene the
primers HPRT-S 5 GTAATGATCAGTCAACGGGGGAC 3 and HPRT-AS
5 CCAGCAAGCTTGCAACCTTAACCA 3 were used.25 The
expected product size is 214 bp. For detection of normal human cells,
-actin was amplified using the primers ACTIN-F 5
CCGCAAAGACCTGTACGCCA 3 and ACTIN-I 5 TGGACTTGGGAGAGGACTGG
3 .27
To confirm that appropriate sequences had been amplified, some gels
were blotted with Zetaprobe membranes and hybridized overnight with
appropriate P32-labeled internal oligonucleotides. The
sequences of the internal oligonucleotides used are as follows: for
detection of bcr-abl 5 AGCCTCAGGGTCTGAGTGAAGCCGCTCGTT 3 ,
for HPRT-5 GCTTTCCCTGGTTAAGGACAGTACAGCCCC 3 ,25
and for -actin 5 GCCATCCTAAAAGCCACCCCACTTCTCTCTA 3 . The
hybridization blot was washed in 2× SSC and subjected to
autoradiography.
VDJ analysis of IgH gene by PCR.
DNA was extracted from 5 µ thick paraffin-embedded tissue sections
using proteinase K as described previously28 and 35 cycles of PCR performed using the primers VH-FR3:
5 GACACGGCCGTGTATTACTG and
JH:5 -ACCTGAGGAGACGGTGACCAGGGT. Three control samples
were included in each experiment: (1) B-lineage non-Hodgkin's
lymphoma, (2) tonsil showing reactive hyperplasia, and (3) "no
DNA" control sample. Epstein-Barr virus (EBV)-negative samples were
also amplified for the mouse TCR gene under similar conditions to show
integrity of the DNA preparations. The primers for the mouse TCR
introns between JB2.6 and CB2, termed J2CII (5
TCCTAGCTTGCGAGAGAGCGA) and J2CIV (5 AACAGTACTTCGGTCCCGGCA) were
kindly provided by Dr S. Strober (Stanford University, Stanford, CA).
Detection of EBV in mouse tissues.
DNA was extracted from mouse tumor, BM, or spleen using the Instangene
matrix (Biorad, Hercules, CA) or precipitated from the Trizol/RNAsol
using ethanol. EBV latent membrane protein (LMP) was amplified using
the primers LMP 9 5 AGCGACTCTGCTGGAAATGAT and LMP 11 5 TGATTAGCTAAGGCATTCCCA.29 PCR products were run on a
1.5% agarose gel, blotted, and subjected to autoradiography using the
probe LMP 10 5 CATGTCATAGGCTTGCTGAC-3 .
Histological examination.
The spleen, BM, and remnants of the matrigel and surrounding tissues
were examined histologically along with any organs thought to be
infiltrated with leukemic cells. Immunohistochemistry was performed on
both fresh cytospins and paraffin sections. For each cytospin a
tris-buffered saline (TBS) control was performed in parallel. Slides
were fixed in acetone, then blocked with human AB serum, washed in TBS
and CD15 (Becton Dickinson), CD43 (Pharmingen, San Diego, CA), or CD45
(Dako Chemicals, Carpinteria, CA) applied for 45 minutes at room
temperature. Positive cells were detected using biotinylated goat
anti-mouse (Caltag, San Francisco, CA) followed by
streptavidin-conjugated to alkaline phosphatase or peroxidase (GIBCO).
Statistical analysis.
The Fisher's exact test was used to compare the incidence of bcr/abl
positivity in treated versus untreated groups of mice. The statistical
analysis of the colony killing data was performed on the logarithm of
the number of colonies, comparing the geometric means between groups
using the unpaired t-test.
 |
RESULTS |
Expansion and phenotype of CIK cells from CML patients.
The starting population of PBMNCs contained a variable number of
CD3+ T cells with a median of 44% (range 1% to 64%) and
a median of 1% CD3+CD56+ cells (range 0% to
4%). After 21 to 28 days in culture, the median content of
CD3+ cells was 97% (range 90% to 99%) and for
CD3+CD56+ was 12% (range 3% to 45%). This
represents an expansion of CD3+ cells of 20.2-fold (range
2.5- to 74-fold) and of CD3+CD56+ 26.5-fold
(range 2- to 525-fold). Individual patient expansions are presented in
Table 2. The two cultures grown from frozen cells of patients M.R. and R.D. showed much poorer expansion.
The expanded cultures contained both CD4+ and
CD8+ T cells. The median percentage of CD4+
cells was 51% (range 17% to 88%) and of CD8+ cells was
59% (range 12% to 82%). In some cultures there were large numbers of
CD4+CD8+ T cells, median 6% (range 1% to
41%). In the majority of the cultures
CD16+CD56+ NK cells were not present except for
one patient (A.Z.), who had CML with a myeloid blast crisis and had
significant numbers of NK cells (7%).
Ph chromosome status of CIK cells.
All of the CIK cultures were evaluated by cytogenetic analysis for the
presence of the Ph chromosome at different time points in culture and
after 21 to 28 days. At least 20 metaphases were analyzed for each
patient. Cells from all patients were Ph chromosome-positive at the
beginning of the culture period. After 21 to 28 days of culture, cells
from 12 of the 13 patients were Ph-negative (Table 2). One patient
(S.T.) had 1 of 25 metaphases that were Ph positive. At day 7, 4 out of
6 cultures tested were Ph negative, and at day 14, 6 out of 8 cultures
were Ph negative. To test whether dormant myeloid cells may still be
present in these expanded cell cultures, aliquots of cells were
evaluated from two CP-CML patients who were Ph negative on day 7, by
culturing the cells in myelocult (Stem Cell Technology, Vancouver,
Canada), which favors the growth of myeloid cells. Indeed, myeloid
cells that were Ph positive could be grown early on in these cultures.
Similar aliquots of cells taken from the culture of patient S.T. on
days 14, 21, and 35 and recultured with myelocult showed 20 out of 20 Ph-positive metaphases on day 14, revealed no analyzable metaphases on
day 21 and 0 out of 5 Ph-positive cells on day 35 of culture. In 14- to
21-day CIK cultures derived from an additional five patients (two
myeloid blast crisis and three chronic-phase patients), no metaphases
were observed after switching to conditions that favored the growth of
myeloid cells. At day 28 all CIK cultures remained bcr-abl positive by
RT-PCR using nested primers.
Hematopoietic colony growth.
Two patients had CFU-GM assays performed on day 1 of culture, which
showed greater than 800 and greater than 1,000 colonies per 1 × 105 cells. In 9 out of the 13 patients, no myeloid colonies
could be grown from the CIK cultures at days 21 to 28. In four patients a small number of colonies (2 to 6 per 105 cells) were
detected. The colonies from three of these patients were small, with
less than 100 cells per colony. The 4th patient (L.C., with untreated
CP-CML with a white blood cell count of 90 × 109/L)
grew large multilineage colonies that were Ph negative by cytogenetics.
Cytotoxicity assays.
Cytotoxicity of the expanded CIK cells was evaluated in all patients by
Cr51-release assays against the tumor cell lines OCI-Ly8
and K562. Specific lysis of tumor cell lines could be shown in all
patients. In general the killing of OCI-Ly8 by CIK cells was superior
to that of K562 (Fig 1). Although there was
no direct correlation between the percentage of
CD3+CD56+ cells in the cultures from different
patients and the degree of specific lysis, repeated analysis of
individual patients showed superior killing with an increasing
percentage of CD3+CD56+ cells in that culture
(data not shown). The percentage of CD4+ or
CD8+ cells did not correlate with the degree of specific
lysis, although there was a trend toward better killing with a
predominance of CD4+ cells or the presence of
CD4+CD8+ double-positive cells in the culture.
The patient A.Z. with 7% NK cells showed superior killing of K562, an
NK-sensitive target.

View larger version (21K):
[in this window]
[in a new window]
| Fig 1.
Cytotoxicity of expanded CIK cells from CML patients. The
tumor cell lines OCI-Ly8 and K562 were labeled with Cr51
and incubated for 4 hours with CIK cells at an effector-to-target ratio
of 40:1. The percentage specific lysis for each patient's CIK cells at
day 21 to 28 is shown.
|
|
In a standard 4-hour Cr51 release assay, no consistent
lysis of patient CML cells could be shown using both allogeneic and
autologous CIK cells. However, these target cell populations were a
heterogenous mixture of different populations of cells and were not
preselected for progenitor cells. Therefore, the effect of CIK cells on
the growth of hematopoietic colonies was evaluated.
Colony inhibition assays.
To further evaluate the in vitro cytotoxicity of autologous CIK cells,
colony assays were performed. A total of 1 × 105
cryopreserved blast cells from patients R.G. and A.Z. was incubated for
4 hours at 37°C in 5% CO2 with autologous CIK cells at
effector:target ratios ranging from 1:1 to 5:1. The cells were then
washed once and plated in 1mL of methocult in triplicate. Similarly,
low-density cells from two chronic-phase patients (M.R. and M.B.A.)
were incubated with autologous CIK cells at effector:target ratios
ranging from 1:1 to 10:1. In patient M.R., the experiment was
complicated by the fact that the CIK cells alone grew approximately 17 colonies /105 cells. There was reduction in the number
of colonies in all patients, which was statistically significant
(P < .01) in patients A.Z., R.G., and M.R. Colony growth,
after incubation with autologous CIK cells at various effector:target
ratios, is shown compared to targets alone in
Fig 2. Colonies grown from patient M.R.
after incubation with autologous CIK cells at a ratio of 5:1 were
picked and RT-PCR performed, all colonies were bcr-abl positive.

View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Inhibition of autologous hematopoietic colony growth by
CML CIK cells. 1 × 105 myeloid progenitor cells were
incubated for 4 hours with autologous CIK cells at ratios of 1:1, 2:1,
and 5:1; washed once; and then replated in 1mL of methyl cellulose.
Each incubation was performed in triplicate, and colonies were scored
after 14 days' incubation in 5% CO2. Results are
expressed as the percentage growth compared with control target cells
incubated in medium alone. The mean number of colonies
for 1 × 105 targets alone were MR-325, MBA-21, RG-35, and
AZ-73. Patient M.R. grew 17 colonies/105 CIK cells, but
this was not adjusted for in calculating the percentage growth compared
to targets alone.
|
|
To evaluate the effect of CIK cells on normal hematopoietic colony
growth as compared to CML cells, CIK cells were generated from buffy
coats obtained from normal donors and incubated with 1 × 105 targets at an effector target ratio of 5:1 for 4 hours
then replated in methyl cellulose. Targets used were PBSCs obtained
from a normal donor (M.B.), lymphoma (P.S.), and CML (M.R.). Colonies
were counted 14 days later. All experiments were performed in
triplicate and controls included both CIK cells and targets incubated
in medium alone. Results are expressed as the percentage growth
relative to that of targets alone (Table
3). As can be seen the allogeneic CIK cells from normal donors did not
effect overall colony growth of hematopoietic stem cells from these
individuals. These same cultures of CIK cells derived from normal
donors also showed significant inhibition of CFU-GM colonies from CML
patient M.R. (33% to 50% inhibition, P < .05). This level
of inhibition of colony growth was comparable to that observed with CIK
cells against autologous hematopoietic targets.
Cytokine production by expanded cells in CIK cultures.
CIK cells generated from six patients and the allogeneic donor (K.S.)
for patient R.G. were assessed by intracellular staining and FACS
analysis for production of the cytokines IFN- , TNF- , IL-2, and
IL-4. Cytokine expression was examined in
CD3+56+ cells and
CD3+56 cells. None of the CIK cells
produced IL-4, whereas IL-2, IFN- , and TNF- was detected in a
variable percentage of both CD3+56+ and
CD3+56 cells
(Fig 3). Two cultures (one from a CML
patient and from the normal donor K.S.) on repeated testing at
different time points showed a consistent cytokine profile.

View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
Intracellular cytokine production of expanded CIK cells
from CML patients. CIK cells from different patients on various days of
culture were stimulated with PMA and ionomycin for 4 hours then stained
with surface antibodies against CD3 (PCP) and CD56 (PE), followed by
permeabilization and intracellular staining with FITC-labeled
antibodies against TNF- , IFN- , IL-2, and IL-4. The percentage of
CD3+56+ cells (light shaded bars) and
CD3+56 cells (dark bars) expressing
TNF- , IFN- , IL-2, and IL-4 is shown.
|
|
In vivo activity of autologous CIK cells in SCID mice engrafted with
CML.
To test the in vivo efficacy of the expanded CIK cells from patients
with CML, we established an animal model of this disease in SCID
mice.30 To do this chronic-phase CML cells were obtained from the PB and enriched for immature progenitor cells by percoll gradient centrifugation. These CD34+-enriched cells were
admixed with matrigel. Matrigel is a soluble extract of basement
membranes material containing laminin, collagen type IV, proteoglycans,
and a variety of growth factors that is liquid below 22°C and gels
rapidly at 37°C. In these experiments, SCID mice were first
injected with CML cells in matrigel and CIK cells were expanded in
vitro from the same patient material. After 4 weeks the autologous CIK
cells were injected IV into groups of mice. No exogenous IL-2 was
administered to any of the animals because in our prior experiments
expanded CIK cells did not require the administration of IL-2 to the
animals for in vivo activity.19
In the first experiment cells from patient K.D. were used and injected
into 20 animals to establish disease. Autologous CIK cells were
expanded from either the BM or PBMNCs and 4 × 107 CIK
cells were injected IV into groups of mice 4 weeks later. At week 7, one control mouse became ill (cause unknown) and was killed; in this
animal bcr-abl was detected in the BM by RT-PCR, but this mouse was not
included in the overall analysis. A second mouse (given BM CIK cells)
died unexpectedly at week 11, and no RNA could be recovered. The
remaining mice were sacrificed after 18 to 20 weeks. Bcr-abl was
detected in the BM or spleen of 4 out of 5 of the remaining control
mice. In marked contrast, only 1 out of 6 mice who received CIK cells
derived from the PB and 1 out of 7 mice who received CIK cells expanded
from the BM were PCR positive for bcr-abl
(Table 4; P = .02). Detection of
bcr-abl in the spleens of a representative 12 mice is shown in
Fig 4.

View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
In vivo activity of autologous CIK cells. Southern
hybridization of bcr-abl RT-PCR products from the spleens of 12 mice
injected with CML cells in matrigel followed by autologous CIK cells.
Lanes 1 through 4, control mice not receiving CIK cells; lanes 5 through 8, mice treated with autologous BM-derived CIK cells; lanes 9 through 12, mice treated with autologous CIK cells derived from the
peripheral blood; lane 13, buffer control; lane 14, 1 in
105 dilution of chronic-phase CML cells in murine cells.
|
|
In a second in vivo experiment 30 mice were injected with CML cells
admixed with matrigel from patient M.R. After 4 and 8 weeks, 10 mice
per group were injected with 2 × 107 autologous CIK
cells expanded from PB. In one mouse the matrigel ulcerated the skin at
day 5, and this mouse was killed and excluded from further analysis. By
10 weeks all of the control mice had developed subcutaneous tumors at
the site of injection of the matrigel. In seven animals these tumors
were large (>1.5 cm diameter). At week 11 one mouse died, and the
remainder of the mice were sacrificed at week 12 to 13. Histological
examination showed that the tumors were an intermediate grade
CD20+ lymphoma. The lymphoma was confirmed to be of human
origin by cytogenetics and PCR of human immunoglobulin JH
region and to be EBV derived by PCR detection of the latent membrane
protein of EBV. The tumors were Ph negative, but the tumor from one
mouse had a t(4:10) chromosomal translocation. PCR of the human
immunoglobulin JH region showed that the lymphomas were
both clonal and oligoclonal as is typical of EBV-transformed lymphomas
in SCID mice.31 Figure 5 shows
the macroscopic appearance of two mice who received CIK cells at week 4 compared with two mice who received no CIK cells. Clear evidence of
macroscopic disease is evident in the control animals, which was not
observed in the mice that received the autologous CIK cells. In 5 of 10 mice who had received CIK cells at week 4, there was no macroscopic
evidence of tumor (P = .03 compared to control animals). Three
of these mice showed no rearrangement of the JH region and
were negative for EBV by DNA PCR. Of the five mice who did develop
tumors, these tended to be smaller (<1.5 cm). By 8 weeks, when some
of the mice already had macroscopic evidence of disease, treatment with
CIK cells was not effective. In this group of mice, 7 had large tumors
and 3 of the 10 mice had small tumors, similar to control mice.

View larger version (135K):
[in this window]
[in a new window]
| Fig 5.
EBV-associated lymphoma in control versus CIK
cell-treated mice. SCID mice were injected with low-density CML cells
from patient M.R. in matrigel. Groups of mice were treated with
autologous CIK cells at 4 and 8 weeks following the injection of the
CML cells. At 12 weeks the majority of the mice developed lymphomas
that were found to be EBV associated. Two control mice that did not
receive CIK cells are shown in the left hand panels. The large arrows
indicate the lymphomas. On the right hand panel two mice who received
CIK cells at week 4 are shown. No tumors are visible, but the remains
of the matrigel can be seen (small arrows).
|
|
In a third group of mice injected with blast crisis cells, all mice
developed subcutaneous tumors of varying sizes, and the percentage of
human CD43+ cells in the BM or spleen ranged from 1% to
95%. Cohorts of mice were treated with HLA-matched PBL or expanded CIK
cells; however, all animals had subcutaneous tumors and detectable
disease in the BM and spleen, using CML blast crisis cells from this
patient with aggressive disease.
 |
DISCUSSION |
Enhanced understanding of the phenotype and biological activity of
effector cell populations with antitumor cell activity as well as the
cytokines that activate these cells has led to novel treatment
strategies. One such population of expanded effector T cells, termed
CIK cells, containing substantial numbers of
CD3+CD56+ cells have been shown to have both in
vitro and in vivo activity against human lymphoma cell lines in SCID
models of human disease.19 In this study we have expanded
CIK cells from patients with CML and tested their in vitro and in vivo
activity in an autologous CML disease model using SCID mice.
Ph-negative CIK cells containing substantial numbers of
CD3+CD56+ cells could be generated from most
CML patients. The fold expansion of CD3+CD56+
cells was variable between patients, ranging from 2- to 525-fold but
was reproducible in individual patients (data not shown). The expansion
of CIK cells from CML patients was less than in our previous work using
normal donors19 but similar to the expansion seen in CIK
cultures from lymphoma patients (CD3+expansion 17- to
90-fold, CD3+CD56+ expansion 23- to 241-fold).
The two cultures started from frozen cells showed exceptionally poor
expansion. Similar variability in expansion of NK cells on M210B4
feeder layers has been documented between patients but with
reproducibility in individual patients, suggesting the variability in
expansion is inherent to the patient cells and not due to variations in
the culture conditions.17 The fold expansion of
CD3+CD56+ cells did not appear to correlate
with the starting numbers of CD3+ or
CD3+CD56+ cells, the time from diagnosis, or
previous treatment. Remarkably we were able to generate Ph-negative CIK
cells from patients with high white blood cell counts or blast crisis.
The starting population for the CIK cultures was PB that contained a
variable number of T cells; however, after approximately 14 days in
culture virtually all of the cells present were CD3+ T
cells. Under these culture conditions, which favor T-cell expansion, the non-T-cell populations likely die off. Importantly, these T cells
are not derived from the malignant clone and are Ph chromosome negative.
CIK cells are Ph negative by cytogenetic analysis; however, care should
be taken in interpreting cytogenetics of cultured cells as culture
conditions dictate which cells are likely to be dividing. Several of
the cultures were Ph negative at day 7 under CIK conditions but were Ph
positive when recultured under myeloid conditions at this early time
point. However, after 21 days in culture, myeloid cells were no longer
detectable in all but one individual. Scheffeld32 reported
that CD3+CD56+ cells were bcr-abl negative at
day 56 of culture but the CD56 cells were bcr-abl
positive. All of our bulk cultures were bcr-abl positive assayed by
RT-PCR using nested primers at an earlier time point (day 28). The
significance of this finding is unclear because the CIK cultures do not
sustain significant numbers of clonogenic Ph-positive cells. At day 21 to 28 of culture, only a minority of patients grew a few small colonies
(<100 cells). Only one patient, who was newly diagnosed and most
likely to have circulating normal progenitors, grew large multilineage
(including erythroid) colonies that were found to be Ph negative by
cytogenetics. These results suggest that Ph-positive malignant cells
likely die off under CIK conditions. It has been shown that Ph-positive progenitors are selectively purged under optimal myeloid
conditions,10 and others have cultured BM from patients
with AML in first remission with IL-2 to purge leukemic
progenitors.33 Thus, under CIK culture conditions the
Ph-positive cells are effectively purged, whereas the cytolytic
CD3+CD56+ and
CD3+CD56 T cells expand significantly.
CIK cells derived from all patients had shown cytotoxicity against the
tumor cell lines K562 and OCI-Ly8, whereas fresh ficolled PBMNCs showed
no cytotoxicity. Cytotoxicity was observed from day 14 on and generally
peaked around day 28 as did the percentage of
CD3+CD56+ cells in the culture, which increased
to a plateau (data not shown). The degree of cytotoxicity between
patient cell cultures was not absolutely related to the percentage of
CD3+CD56+ cells. However, there was a trend
toward better killing with an increasing percentage of
CD3+CD56+ cells. Outgrowth of NK cells did not
account for the cytotoxicity as only one culture had significant
numbers (7%) of
CD3 CD16+CD56+ cells. This
was associated with superior cytotoxicity against K562, an NK-sensitive
cell line. Removal of CD3+CD56+ cells from the
bulk cultures significantly reduced cytotoxicity (data not shown),
which is similar to expanded cells from normal individuals.19
Cytotoxicity using both autologous and allogeneic CIK cells against CML
targets labeled with Cr51 was inconsistent, but the targets
were a heterogenous population of cells. Four patients (including two
blast crisis patients) were further analyzed by colony growth assays,
and significant inhibition of colony growth was observed following
incubation of the CML cells with autologous expanded CIK cells. In
contrast CIK cells showed little inhibition of normal myeloid colony
growth but some inhibition of erythroid colony growth, which was not blocked by antibodies to HLA class 1, CD2, CD18 or reproduced by
incubation targets with supernatant alone. Inhibition of BFU-E colony
growth may be due to production of IFN- , which has recently been
reported to induce apoptosis of erythroid progenitors via the Fas
receptor.34 Allogeneic CIK cells were able to suppress the
colony growth of CML but not normal progenitor cells. This observation
is consistent with the hypothesis that the CML cells have lost the
ability to inhibit NK and NK-like populations of cells possibly due to
downregulation of HLA class I or an alteration in the peptides that
normally bind to killer inhibitory receptors (KIRs) or other inhibitory
molecules and suppress NK cell activity.35 CD3+CD56+ effector cells in CIK cultures do
express killer inhibitory receptors (data not shown), which may be
important in regulating killing and is being further investigated. An
alternative hypothesis is that the CML progenitor cells are more
sensitive to cytokines such as IFN- . The fact that Ph-negative
colonies could be grown after 28 days in CIK culture conditions from
patient L.C., with untreated CML, suggests that CIK cells do not
inhibit normal long-term culture initiating cells (LTCICs).
To test the in vivo efficacy of CIK cells, we engrafted CML into SCID
mice using matrigel. CP-CML has been difficult to engraft in SCID and
NOD/SCID mice despite the use of large numbers of cells36,37; however, recently reliable engraftment of CML
in NOD/SCID mice has been achieved.38 The reason for this
is unclear, but we postulated it may be related to the requirement for
human cytokines or an appropriate microenvironment for the cells to
proliferate. Matrigel is a soluble extract of basement membranes that
is liquid below 22°C and gels rapidly at 37°C, which may allow
the human cells to grow in a localized more favorable environment
before migrating to the mouse BM and spleen. Matrigel contains laminin, collagen type IV, proteoglycans, a variety of growth factors, and is
used in many types of tumor invasion assays. Following subcutaneous
injection of CP-CML cells suspended in matrigel into SCID mice, we have
detected bcr-abl sequences for up to 35 weeks in the BM or
SP.30 This long-term engraftment indicates that an immature
hematopoietic cell engrafted in the mice. Bcr-abl positive colonies
could also be detected from cultured murine BM, indicating that the
hematopoietic progenitor cells were able to migrate from the matrigel
to the murine bone marrow.
Using this system we tested the in vivo activity of expanded CIK cells
against autologous tumor cell targets. In these experiments, CP-CML
cells were admixed with matrigel and injected subcutaneously into SCID
mice. After 4 weeks expanded autologous CIK cells were injected
intravenously into some mice. Mice that received the CIK cells derived
from either peripheral blood or bone marrow were significantly less
likely to be bcr-abl positive as assayed by RT-PCR of RNA from the bone
marrow or spleen than control mice that did not receive the effector
CIK cells. In one experiment the mice developed large tumors following
the injection of the CML cells, which were found to be an
EBV-transformed human B-cell lymphoma that is occasionally observed in
SCID mice that receive human cell grafts that are replete with B cells.
In those mice that received autologous CIK cells 4 weeks after the
injection of the CML cells, half of the mice had no macroscopic
evidence of disease, and in the remainder of the mice the size of the
tumors were significantly smaller than either the control mice or mice that received CIK cells after 8 weeks. In addition, some of the mice
without macroscopic disease were also PCR-negative for EBV sequences.
This animal model shows the effectiveness of autologous T cells as
opposed to allogeneic effector cells against EBV lymphoma. In other
studies, allogeneic EBV-specific CTLs were required to achieve
significant tumor regression in SCID models of EBV
lymphomas.39
The exact mechanism of the in vivo effect is not known. The expanded
CIK cells clearly have cytotoxic activity against target cell lines and
also suppress autologous CML myeloid progenitor cell growth. In
addition, CIK cells may function through the production of cytokines,
such as IFN- or TNF. Current studies in our laboratory have shown
that CIK cells express fas ligand (data not shown), and this may also
be an important mechanism of killing by CIK cells that would not be
demonstrable using a standard 4-hour Cr51 release assay.
These studies further document the in vitro and in vivo efficacy of CIK
cells against these autologous tumors, especially when present in a
minimal disease state. It is important to recognize that these in vivo
studies were performed with a single injection of autologous CIK cells
without the exogenous administration of IL-2, which is similar to our
previous studies with lymphoma targets using allogeneic CIK cells and
tumor cell lines.19 The enhanced in vivo activity observed
in the absence of exogenous IL-2 may prove to be a distinct advantage
of this population of cells as compared to IL-2-activated NK cells,
which require exogenous IL-2 for in vivo activity. Clinically, IL-2
administration has been associated with significant toxicity.
In summary, we have shown that CIK cells can be expanded from PBMNCs
from most patients with CML. These cells are derived from
CD3+ T cells, and the cultures contain primarily
CD3+CD56 and
CD3+CD56+ T cells that expand dramatically
under these culture conditions. The CD3+CD56+ T
cells have been shown to have significant cytolytic activity against a
broad array of tumor cell targets. The CIK cells derived from CML
patients are Ph chromosome negative; produce cytokines such as IL-2,
IFN, and TNF; and have in vitro and in vivo cytotoxicity. These cells
may prove to be an effective form of immunotherapy, for example,
following a bone marrow or peripheral blood transplant.
 |
FOOTNOTES |
Submitted February 24, 1998;
accepted June 12, 1998.
Supported in part by a grant from The Jose Carreras para la Lucha
contra la Leucemia (FIJC-92/INT-2) and by USA Public Health Service
Grant (CA-49605).
Address reprint requests to Robert S. Negrin, MD, Room H1353, Bone
Marrow Transplant Division, Stanford University Hospital, Stanford, CA
94305; e-mail: Negrs{at}leland.Stanford.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
Statistical analysis was performed by Ruby Wong PhD. The helpful advice
of Dr Karl Blume was greatly appreciated.
 |
REFERENCES |
1.
Snyder DS,
Negrin RS,
O'Donnell MR,
Chao NJ,
Amylon MD,
Long GD,
Nademanee AP,
Stein AS,
Parker PM,
Smith EP,
Somlo G,
Margolin K,
Molina A,
Stepan DE,
Lipsett JA,
Hoppe RT,
Slovak ML,
Niland JC,
Dagis AC,
Wong RW,
Forman SJ,
Blume KG:
Fractionated total-body irradiation and high-dose etoposide as a preparatory regimen for bone marrow transplantation for 94 patients with chronic myelogenous leukemia in chronic phase.
Blood
84:1672,
1994[Abstract/Free Full Text]
2.
Thomas ED,
Clift RA,
Fefer A,
Appelbaum FR,
Beatty P,
Bensinger WI,
Buckner CD,
Cheever MA,
Deeg HJ,
Doney K,
Flournoy N,
Greenberg P,
Hansen JA,
Martin P,
McGuffin R,
Ramberg R,
Sanders JE,
Singer J,
Stewart P,
Storb R,
Sullivan K,
Weiden PL,
Witherspoon R:
Marrow transplantation for the treatment of chronic myelogenous leukemia.
Ann Intern Med
104:155,
1986
3.
Hoyle C,
Gray R,
Goldman JM:
Autografting for CML in chronic phase: An update.
Br J Haematol
86:76,
1994[Medline]
[Order article via Infotrieve]
4.
McGlave PB,
De Fabritis P,
Deisseroth A,
Goldman J,
Barnett M,
Reiffers J,
Simonsson B,
Carella A,
Aeppli D:
Autologous transplants for chronic myelogenous leukemia: Results from eight transplant groups.
Lancet
343:1486,
1994[Medline]
[Order article via Infotrieve]
5.
The Italian Cooperative Study Group on Chronic Myeloid Leukemia:
Interferon Alfa-2a as compared with conventional chemotherapy for the treatment of chronic myeloid leukemia.
N Engl J Med
330:820,
1994[Abstract/Free Full Text]
6.
Goldman JM,
Gale RP,
Horowitz MM,
Biggs JC,
Champlin RE,
Gluckman E,
Hoffmann RG,
Jacobsed SJ,
Marmont AM,
McGlave PB,
Messner HA,
Rimm AA,
Rozman C,
Speck B,
Tura S,
Weiner RS,
Bortin MM:
Bone marrow transplantation for chronic myelogenous leukemia in chronic phase. Increased risk for relapse associated with T-cell depletion.
Ann Intern Med
108:806,
1988
7.
Horowitz MM,
Gale RP,
Sondel PM,
Goldman JM,
Kersay J,
Kolb HJ,
Rimm AA,
Ringden O,
Rozman C,
Speck B,
Truitt RL,
Zwaan FE,
Bortin MM:
Graft vs leukemia reactions after bone marrow transplantation.
Blood
75:555,
1990[Abstract/Free Full Text]
8.
Kolb H,
Mittermuller J,
Clemm CL,
Holler E,
Ledderose G,
Brehm G,
Heim H,
Wilmanns W:
Donor leukocyte infusions for treatment of recurrent chronic myeloid leukemia in bone marrow transplant patients.
Blood
76:2462,
1990[Abstract/Free Full Text]
9.
Kolb H,
Schattenburg A,
Goldman JM,
Hertenstein B,
Jacobsen NJ,
Arcese W,
Ljungman P,
Ferrant A,
Verdonck L,
Niederwieser D,
van Rhee F,
Mittermueller J,
de Witte T,
Holler E,
Ansari H:
Graft-versus-leukemia effect of donor lymphocyte transfusions in marrow grafted patients. European Group for Blood and Marrow Transplantation Working Party Chronic Leukemia.
Blood
86:2041,
1995[Abstract/Free Full Text]
10.
Barnett MJ,
Eaves CJ,
Phillips GL,
Gascoyne RD,
Hogge DE,
Horsman DE,
Humphries RK,
Klingermann HG,
Lansdorp PM,
Nantel SH,
Reece DE,
Shepherd JD,
Spinelli JJ,
Sutherland HJ,
Eaves AC:
Autografting with cultured marrow in chronic myeloid leukemia: Results of a pilot study.
Blood
84:724,
1994[Abstract/Free Full Text]
11.
Carella AM,
Podesta M,
Frassoni F,
Raffo MR,
Pollicardo N,
Pungolino E,
Vimercati R,
Sessarego M,
Parodi C,
Rabitti C,
Ferrero R,
Benvenuto F,
Figari O,
Carlier P,
Levcasic G,
Valbonesi M,
Vitale V,
Giordano D,
Pierluigi D,
Nati S,
Guerraçio A,
Rosso C,
Sagho G:
Collection of `normal' blood repopulating cells during early hematopoietic recovery after intensive conventional chemotherapy in chronic myelogenous leukemia.
Bone Marrow Transplant
12:267,
1993[Medline]
[Order article via Infotrieve]
12.
Rowe JM,
Ryan DH,
DiPersio JF,
Gaspari A,
Nilsson B,
Larsson L,
Liesveld JL,
Kouides P,
Simonsson B:
Autografting in chronic myelogenous leukemia followed by immunotherapy.
Stem Cells
11:34,
1993(suppl 3)
13.
Faber LM,
van Luxemburg-Heijs SA,
Rijnbeek M,
Willemze R,
Falkenburg JH:
Minor histocompatibility antigen specific, leukemia-reactive cytotoxic T cell clones can be generated in vitro without in vivo priming using chronic myeloid leukemia cells as stimulators in the presence of alpha-interferon.
Biol Blood Marrow Transplant
2:31,
1996[Medline]
[Order article via Infotrieve]
14.
Serody JS,
Brecher ME,
Dent G,
Bently SA,
Frelinger JA,
Shea TC:
A method for the production of CD4+ chronic myelogenous leukemia-specific allogeneic T lymphocytes.
Cancer Res
57:1547,
1997[Abstract/Free Full Text]
15.
Cervantes F,
Pierson BA,
McGlave PB,
Verfaillie CM,
Miller JS:
Autologous activated natural killer cells suppress primitive chronic myelogenous leukemia progenitors in long-term culture.
Blood
87:2476,
1996[Abstract/Free Full Text]
16.
Mackinnon S,
Hows JM,
Goldman JM:
Induction of in vitro graft-versus-leukemia activity following bone marrow transplant for chronic myeloid leukemia.
Blood
76:2037,
1990[Abstract/Free Full Text]
17.
Hauch M,
Gazzola MV,
Small T,
Bordignon C,
Barnett L,
Cunningham I,
Castro-Malaspinia H,
O'Reilly RJ,
Keever CA:
Anti-leukemia potential of interleukin-2 activated natural killer cells after bone marrow transplantation for chronic myelogenous leukemia.
Blood
75:2250,
1990[Abstract/Free Full Text]
18.
Schmidt-Wolf IGH,
Lefterova P,
Mehta BA,
Fernandez LP,
Huhn D,
Blume KG,
Weissman IL,
Negrin RS:
Phenotypic characterization and identification of effector cells involved in tumor cell recognition of cytokine induced killer cells.
Exp Hematol
21:1673,
1993[Medline]
[Order article via Infotrieve]
19.
Lu PH,
Negrin RS:
A novel population of expanded human CD3+CD56+ cells derived from T cells with potent in vivo anti-tumor activity in SCID mice.
J Immunol
153:1687,
1994[Abstract]
20.
Schmidt RE,
Murray C,
Daley JF,
Schlossman SF,
Ritz J:
A subset of natural killer cells in peripheral blood displays a mature T cell phenotype.
J Exp Med
164:351,
1986[Abstract/Free Full Text]
21.
Lanier LL,
Le AM,
Clvin CI,
Loken MR,
Phillips JH:
The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes.
J Immunol
136:4480,
1986[Abstract]
22.
Ortaldo JR,
Winkler-Pickett RT,
Yagita H,
Young HA:
Comparative studies of CD3- and CD3+CD56+ cells: Examination of morphology, functions, T cell receptor rearrangement, and pore-forming protein expression.
Cell Immunol
136:486,
1991[Medline]
[Order article via Infotrieve]
23.
Schmidt-Wolf IGH,
Negrin RS,
Kiem H,
Blume KG,
Weissman IL:
Use of a SCID mouse/human lymphoma model to evaluate cytokine-induced killer cells with potent anti-tumor cell activity.
J Exp Med
174:139,
1991[Abstract/Free Full Text]
24.
Shpitz B,
Chambers CA,
Singhal AB,
Hozumi N,
Fernandes BJ,
Roifman CM,
Weiner LM,
Roder JC,
Gallinger S:
High level functional engraftment of SCID mice with human peripheral blood lymphocytes following pretreatment with radiation and anti-asialo GM1.
J Immunol Methods
169:1,
1994[Medline]
[Order article via Infotrieve]
25.
Murphy E,
Hieny S,
Sher A,
O'Garra A:
Detection of in vivo expression of interleukin 10 using a semi-quantitative polymerase chain reaction method in Schistosoma mansoni infected mice.
J Immunol Methods
162:211,
1993[Medline]
[Order article via Infotrieve]
26.
Thompson J,
Brodsky I,
Yunis JJ:
Molecular quantification of residual disease in chronic myelogenous leukemia after bone marrow transplant.
Blood
79:1629,
1992[Abstract/Free Full Text]
27.
Imada K,
Takaori-Kondo A,
Akagi T,
Shimotohno K,
Sugamura K,
Hattori T,
Yamabe H,
Okuma M,
Uchiyama T:
Tumorigenicity of human T-cell leukemia virus type-1 infected cell lines in severe combined immunodeficient mice and characterization of the cells proliferating in vivo.
Blood
86:2350,
1995[Abstract/Free Full Text]
28.
Kamel OW,
Chang PP,
Hsu FJ,
Dolezal MV,
Warnke RA,
van de Rijn M:
Clonal VDJ recombination of the immunoglobulin heavy chain gene by PCR in classical Hodgkin's disease.
Am J Clin Pathol
104:419,
1995[Medline]
[Order article via Infotrieve]
29.
Knecht H,
Bachmann E,
Joske DJL,
Sahli R,
Emery-Goodman A,
Casanova JL,
Zilic M,
Bachmann F,
Odermatt BF:
Molecular analysis of the LMP (latent membrane protein) oncogene in Hodgkin's disease.
Leukemia
7:580,
1993[Medline]
[Order article via Infotrieve]
30.
Hoyle C,
Negrin R:
A minimal residual disease model of CML in SCID mice.
Blood
86:572a,
1995(abstr)
31.
Veronese ML,
Veronesi A,
Bruni L,
Coppola V,
D'Andrea E,
Del Mistro A,
Mezzalira S,
Montagna M,
Ruffatto G,
Amadori A,
Chieco-Bianchi L:
Properties of tumors arising in SCID mice injected with PBMC from EBV-positive donors.
Leukemia
8:S214,
1994
32.
Scheffold C,
Brandt K,
Johnston V,
Lefterova P,
Degen B,
Schontube M,
Huhn D,
Neubauer A,
Schmidt-Wolf IGH:
Potential of autologous immunologic effector cells for bone marrow purging in patients with chronic myeloid leukemia.
Bone Marrow Transplant
15:33,
1995[Medline]
[Order article via Infotrieve]
33.
Klingemann HG,
Eaves CJ,
Barnett MJ,
Eaves AC,
Hogge DE,
Nantel SH,
Reece E,
Shepherd JD,
Sutherland HJ,
Phillips GL:
Transplantation of patients with high risk acute myeloid leukemia in first remission with autologous marrow cultured in interleukin-2 followed by interleukin-2 administration.
Bone Marrow Transplant
14:389,
1994[Medline]
[Order article via Infotrieve]
34.
Dai CH,
Price JO,
Brunner T,
Krantz SB:
Fas ligand is present in human erythroid colony-forming cells and interacts with Fas produced by interferon gamma to produce erythroid cell apoptosis.
Blood
91:1235,
1998[Abstract/Free Full Text]
35.
Gumperz JE,
Parham P:
The enigma of the natural killer cell.
Nature
378:245,
1995[Medline]
[Order article via Infotrieve]
36.
Sawyers CL,
Gishizky ML,
Quan S,
Golde DW,
Witte ON:
Propagation of human blastic myeloid leukemias in SCID mice.
Blood
79:2089,
1992[Abstract/Free Full Text]
37.
Sirard C,
Lapidot T,
Vormoor J,
Cashman JD,
Doedens M,
Murdoch B,
Jamal N,
Messner H,
Addey L,
Minden M,
Paraya P,
Keating A,
Eaves A,
Lansdorp PM,
Eaves CJ,
Dick JE:
Normal and leukemia SCID-repopulating cells (SRC) coexist in the bone marrow and peripheral blood from CML patients in chronic phase, whereas leukemic SRC are detected in blast crisis.
Blood
87:1539,
1996[Abstract/Free Full Text]
38.
Wang JC,
Lapidot T,
Cashman JD,
Doedens M,
Addy L,
Sutherland DR,
Nayar R,
Laraya P,
Minden M,
Keating A,
Eaves AC,
Eaves CJ,
Dick JE:
High level engraftment of NOD/SCID mice by primitive normal and leukemic hematopoietic cells from patients with chronic myeloid leukemia in chronic phase.
Blood
91:2406,
1998[Abstract/Free Full Text]
39.
Lacerda JF,
Ladanyi M,
Louie DC,
Fernandez JM,
Papdopoulos EB,
O'Reilly RJ:
Human Epstein-Barr virus (EBV)-specific cytotoxic T lymphocytes home preferentially to and induce selective regressions of autologous EBV-induced B cell lymphoproliferations in xenografted C.B-17 scid/scid mice.
J Exp Med
183:1215,
1996[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Sangiolo, E. Martinuzzi, M. Todorovic, K. Vitaggio, A. Vallario, N. Jordaney, F. Carnevale-Schianca, A. Capaldi, M. Geuna, L. Casorzo, et al.
Alloreactivity and anti-tumor activity segregate within two distinct subsets of cytokine-induced killer (CIK) cells: implications for their infusion across major HLA barriers
Int. Immunol.,
July 1, 2008;
20(7):
841 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Joshi, J.-Q. Liu, Y. Wang, X. Chang, J. Richards, E. Assarsson, F.-D. Shi, H.-G. Ljunggren, and X.-F. Bai
Cytokine-induced killer T cells kill immature dendritic cells by TCR-independent and perforin-dependent mechanisms
J. Leukoc. Biol.,
December 1, 2006;
80(6):
1345 - 1353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Chan, C. A. Hamilton, M. K. Cheung, M. Karimi, J. Baker, J. M. Gall, S. Schulz, S. H. Thorne, N. N. Teng, C. H. Contag, et al.
Enhanced killing of primary ovarian cancer by retargeting autologous cytokine-induced killer cells with bispecific antibodies: a preclinical study.
Clin. Cancer Res.,
March 15, 2006;
12(6):
1859 - 1867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Karimi, T. M. Cao, J. A. Baker, M. R. Verneris, L. Soares, and R. S. Negrin
Silencing Human NKG2D, DAP10, and DAP12 Reduces Cytotoxicity of Activated CD8+ T Cells and NK Cells
J. Immunol.,
December 15, 2005;
175(12):
7819 - 7828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sconocchia, M. Lau, M. Provenzano, K. Rezvani, W. Wongsena, H. Fujiwara, N. Hensel, J. Melenhorst, J. Li, S. Ferrone, et al.
The antileukemia effect of HLA-matched NK and NK-T cells in chronic myelogenous leukemia involves NKG2D-target-cell interactions
Blood,
November 15, 2005;
106(10):
3666 - 3672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Verneris, M. Karami, J. Baker, A. Jayaswal, and R. S. Negrin
Role of NKG2D signaling in the cytotoxicity of activated and expanded CD8+ T cells
Blood,
April 15, 2004;
103(8):
3065 - 3072.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
CD56+ Lymphoma With Skin Involvement: Clinicopathologic Features and Classification
Arch Dermatol,
April 1, 2004;
140(4):
427 - 436.
|
 |
|

|
 |

|
 |
 
C. Scheffold, M. Kornacker, Y. C. Scheffold, C. H. Contag, and R. S. Negrin
Visualization of Effective Tumor Targeting by CD8+ Natural Killer T Cells Redirected with Bispecific Antibody F(ab')2HER2xCD3
Cancer Res.,
October 15, 2002;
62(20):
5785 - 5791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Nijmeijer, R. Willemze, and J. H. F. Falkenburg
An animal model for human cellular immunotherapy: specific eradication of human acute lymphoblastic leukemia by cytotoxic T lymphocytes in NOD/scid mice
Blood,
June 28, 2002;
100(2):
654 - 660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Baker, M. R. Verneris, M. Ito, J. A. Shizuru, and R. S. Negrin
Expansion of cytolytic CD8+ natural killer T cells with limited capacity for graft-versus-host disease induction due to interferon {gamma} production
Blood,
May 15, 2001;
97(10):
2923 - 2931.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Sweeney, V. Mailander, A. A. Tucker, A. B. Olomu, W. Zhang, Y.-a. Cao, R. S. Negrin, and C. H. Contag
Visualizing the kinetics of tumor-cell clearance in living animals
PNAS,
October 12, 1999;
96(21):
12044 - 12049.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|