|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 9 (November 1), 1998:
pp. 3328-3337
Hepatitis C Virus Infection Involves CD34+
Hematopoietic Progenitor Cells in Hepatitis C Virus Chronic Carriers
By
Domenico Sansonno,
Claudio Lotesoriere,
Vito Cornacchiulo,
Massimo Fanelli,
Pietro Gatti,
Giuseppe Iodice,
Vito Racanelli, and
Franco Dammacco
From the Department of Biomedical Sciences and Human Oncology,
Section of Internal Medicine and Clinical Oncology, University of Bari
Medical School, Bari, Italy.
 |
ABSTRACT |
Although hepatitis C virus (HCV) mainly affects hepatocytes,
infection is widespread and involves immunologically privileged sites.
Whether lymphoid cells represent further targets of early HCV
infection, or whether other cells in the hematopoietic microenvironment may serve as a potential virus reservoir, is still unclear. We studied
whether pluripotent hematopoietic CD34+ cells support
productive HCV infection and can be used to establish an in vitro
infection system for HCV. Six patients were selected as part of a
cohort of HCV chronic carriers who developed a neoplastic disease.
Reverse transcriptase-polymerase chain reaction (RT-PCR) and branched
DNA signal amplification assays were used to detect and quantitate HCV
RNA in extracted nucleic acids from purified bone marrow and peripheral
blood CD34+ cells. Direct in situ RT-PCR, flow cytometry
analysis, and immunocytochemistry were applied to demonstrate specific
viral genomic sequences and structural and nonstructural virus-related
proteins in intact cells. Results indicated that both positive and
negative HCV RNA strands and viral proteins were present in
CD34+ cells from all HCV-positive patients and in none of
the controls. Additional experiments showed that a complete viral cycle
took place in CD34+ cells in vitro. Spontaneous increases
in viral titers indicated that virions were produced by infected
hematopoietic progenitor cells. To further define the cellular tropism,
we attempted to infect CD34+ cells in vitro. We were
unable to demonstrate viral uptake by cells. These findings suggest
that HCV replication can occur in the early differentiation stages of
hematopoietic progenitor cells, and that they may be an important
source of virus production.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE CLINICAL COURSE of a viral infection
reflects the fluctuating balance between the capacity of the virus to
replicate and spread and the ability of the host to eliminate it.
Persistence of a virus is evidence of its ability to escape the host's
immune surveillance through the exploitation of several strategies,
including integration into the host genome,1 silencing of
viral gene expression,2 inhibition of antigen processing
and presentation,3,4 synthesis of proteins homologous to
known immune regulatory molecules,5 mutations that either
inhibit viral responsiveness to antiviral cytokines or preclude
recognition by neutralizing antibodies3 or else modify
residues that are critical for recognition by the major
histocompatibility complex (MHC),6 or the
T-cell receptor.7 A further defense mechanism is direct
infection of immunologically priviliged sites that cannot be reached by
virus-specific T cells or that do not express class I or costimulatory
molecules.8
Hepatitis C virus (HCV) infection is characterized by its striking
tendency to become chronic in a high proportion of patients. A 70% to
80% range of persistent infection has been documented by detection of
HCV RNA.9 This persistence seems attributable to HCV's
ability to mutate rapidly and exist simultaneously as a series of
related but immunologically distinct variants (quasi-species nature).10,11 Several studies have provided convincing
evidence for the occurrence of HCV productive infection in both bone
marrow (BM) and peripheral blood mononuclear cells (PBMC)12
and in lymphoid organs,13 which may thus serve as major HCV
reservoirs.
The susceptibility of B-, T-, and monocyte/macrophage cell lines to HCV
infection has been demonstrated by the observation of polymerase chain
reaction (PCR)-driven HCV specific sequences.12 These
findings have been corroborated by in situ hybridization techniques
showing both positive- and negative-polarity HCV genomic strands in
circulating and/or BM-recruited mononuclear
cells.14-16 However, it remains unclear whether PBMC are
the principal targets of early HCV infection in hematologic tissue, or
whether other cells within the hematopoietic microenvironment may also
serve as potential virus sites. In particular, it would be of interest to determine whether early hematopoietic CD34+ progenitor
cells17 are also susceptible to infection.
Data from the present study indicate that hematopoietic progenitor
cells may indeed be an additional HCV infection site and provide a
better understanding of the cellular tropism of HCV.
| |
MATERIALS AND METHODS |
Patients.
Six patients were recruited from a cohort of consecutive human
immunodeficiency virus (HIV)-negative patients referred to the
Department of Biomedical Sciences and Clinical Oncology of the
University of Bari because of chronic HCV infection and a neoplastic
disease. In four of them, non-Hodgkin's lymphoma (NHL) was diagnosed
from routinely stained sections prepared from formalin-fixed paraffin-embedded surgical biopsy samples and classified according to
the International Working Formulation.18 Immunophenotypic analyses using routine procedures, including the study of antigens associated with B cells, T cells, plasma cells, natural killer cells,
monocytes/macrophages, and granulocytes, were performed on snap-frozen
tissues. Light chain restriction of surface IgG, IgA, IgM, and DNA and
RNA extraction studies were performed by standard procedures. DNA
analyses included Southern blotting and molecular hybridization to
detect Ig gene rearrangement; assessment of B-cell clonality by VDJ
PCR19; sensitive analysis for Epstein-Barr virus and human
herpes virus-6 genomes by PCR.20 NHL patients underwent
liver biopsy and iliac crest BM needle biopsy. In the remaining two
patients, colon carcinoma and gastric carcinoma were diagnosed
respectively, and liver biopsies were performed during laparotomy.
All were hepatitis B surface antigen (HBsAg) and hepatitis
B virus (HBV)-DNA negative, although four patients had
antibodies to hepatitis B surface (HBs) and hepatitis B core
(HBc) and one had antibodies to HBc alone. Organ- and
nonorgan-specific autoantibodies were not detected. Two patients had
received a blood transfusion many years earlier.
In all patients, clinical evaluation and biochemical and hematologic
testing was performed at 3-month intervals during the follow-up for
liver disease (mean, 9.1 ± 1.86 years). The presence of anti-HCV
antibodies was confirmed by recombinant immunoblot assay (RIBA-2; Ortho
Diagnostic Systems, Raritan, NJ). At the time of diagnosis of NHL, two
patients were receiving interferon treatment (9 MU/wk). The controls
were four patients with NHL and negative serology for anti-HCV
antibodies and HCV RNA. The main clinical, histologic, and virologic
features of patients and controls are summarized in
Table 1.
The study was approved by the ethical committee of the University of
Bari Medical School and informed consent was obtained from all patients
and controls.
CD34+ cell mobilization, isolation, and
purification.
CD34+ cell mobilization was achieved by injecting patients
with granulocyte colony-stimulating factor (G-CSF), given at a daily dose of 10 µg/kg. Injections were repeated for 6 to 7 days before the
apheresis and BM aspiration. Leukocyte subsets were monitored frequently (every 1 to 3 days) until the end of the apheresis procedure. In all of the cases, leukapheresis was started when the
absolute number of circulating CD34+ cells exceeded
10/µL. After volume reduction by centrifugation, each
leukapheresis product was frozen in 1-3 DF 700 freezing bags (Gambro,
Leuven, Belgium). The freezing medium consisted of 4% (wt/vol) human
serum albumin and 7.5% (vol/vol) dimethylsulfoxide in 0.9% NaCl. All
bags were frozen in a controlled rate freezer and stored in liquid
nitrogen ( 196°C).
For collection of peripheral blood CD34+ cells, an
automated dual chamber computer-assisted continuous flow blood cell
separator (Baxter CS 3000; Baxter Healthcare Co,
Deerfield, IL) was used, using a preattached solution in a closed
system kit. Common parameters included blood flow (60 mL/min),
anticoagulation (ACD-A 500 to 700 mL), volume of processed blood (7.5 L), and rotating speed (1,400 rpm).
BM mononuclear cells and aliquots of the leukapheresis products were
washed with RPMI 1640, separated by density gradient centrifugation
over Ficoll-Hypaque (Pharmacia, Uppsala, Sweden), washed twice,
suspended in Iscove's modified Dulbecco's medium (IMDM)/20% fetal calf serum (FCS), and cultured overnight
to remove adherent cells.
The CD34+ mononuclear cell fraction was isolated by
sequential immunomagnetic bead selection using the Dynal CD34
progenitor cell selection system (code 113.01/113.02 from Dynal A.S.,
Oslo, Norway). This reagent contains paramagnetic-polystyrene beads coated with monoclonal antibody (MoAb) 561 specifically directed against class III epitope on the CD34 antigen.21 Flow
cytometry analysis showed that CD34 selection in the final product
ranged from 81% to 96% with a mean of 92.3%.
CD34+ cell cultures and lymphocyte subpopulations.
Adherent BM stromal cells were recovered after enzymatic digestion,
washed twice with RPMI 1640/10% FCS in medium, and seeded into flasks.
They were then expanded by several passages. The medium was changed
every week. CD34+ cells (0.5 × 106 per
well) were added to the washed, stromal feeder layer and cultured for a
further 2 to 4 weeks in IMDM/20% FCS. Control cultures included no
stroma or stroma alone. Cultures were half-refed with complete medium
twice weekly.
Positive selection of CD20+, CD4+, and
CD8+ cell fractions was performed using the same type of
magnetic beads (Dynal) already described, coated with the corresponding
MoAbs.
Flow cytometry analysis.
CD34+ cell cultures were obtained by gentle aspiration,
washed twice in phosphate-buffered saline (PBS), and stained with the following murine MoAbs against HCV: (1) anti-c22-3 antibody (clone 4,6 E7-F6), recognizing amino acids (AA) 29-43 of the core protein at a
concentration of 0.9 µg/mL; (2) antienvelope glycoprotein 2 (E2)/nonstructural protein 1 (NS1) antibody (clone 15-B4-C7), recognizing a conformational antigen of E2/NS1-encoded protein of HCV-1
strain at a concentration of 1.5 µg/mL; (3) anti-c33c antibody (clone
1,4 G11-B4G10), recognizing a structural determinant in the NS3-encoded
protein at a concentration of 1.0 µg/mL; (4) a mixture of three
anti-c100-3 antibodies, namely clone 2C4G3 recognizing AA 1690-1696;
clone 22A5B12 recognizing AA 1694-1711, and clone 20A6F3 recognizing a
linker sequence at the junction of superoxide dismutase (SOD)
and HCV sequences in the NS4-encoded protein. Protein concentration in
the working mixture of each MoAb was 1.0 µg/mL; (5) anti-NS5 antibody
(clone 1A6B7), recognizing AA 2278-2310 of NS5-encoded protein was used
at a protein concentration of 1.2 µg/mL. Immunochemical
characteristics and fine specificities of these reagents have been
reported elsewhere.13,22
After a 1-hour incubation at 37°C, the cells were pelleted, washed
with PBS, and reincubated with fluorescein isothiocyanate (FITC)-conjugated antimouse immunoglobulin F(ab )2
fragment (Boehringer Mannheim, Mannheim, Germany; code 1.214.616). A
parallel number of cells fixed with 4% paraformaldehyde were analyzed
for each unfixed sample.
CD34+ immunophenotype was detected by a pool of
phycoerythrin (PE)-labeled anti-CD34 MoAbs (Immunotech, Marseille,
France; code 1459), which contained optimized proportions of the
following three MoAbs: QBend-10 directed to CD34 class II epitopes and
Immu-33 and Immu-409 specific for different CD34 class I epitopes.
Omission of the first antibody in indirect assay or PE-conjugated
isotype-matched nonspecific mouse immunoglobulins were used as controls
in each culture sample. CD34+ mononuclear cells recovered
from HCV patients acted as a further control. Flow
cytometric analysis was performed with a FACScan cytometer (Becton
Dickinson, Sunnyvale, CA).
For double-staining, cell suspensions were stained with the following
antibody combinations: anti-CD34 conjugated with PE (Immunotech) and
anti-HCV (E2/NS1 protein, clone 15-B4-C7) conjugated with FITC.
Immunocytochemical staining.
After harvesting, CD34+ cells were washed twice in PBS,
resuspended at 1 × 105/mL, dried onto glass
coverslips, and fixed for 15 minutes at 20°C with 100%
acetone followed by 100% methanol. After extensive washings, adherent
stromal cells were similarly fixed. After rehydration, cells were
incubated with anti-HCV MoAbs (see above) and then with
affinity-purified sheep IgG, F(ab)2 fragment to
mouse Ig conjugated to alkaline phosphatase (APh) (Boehringer, code
1.198.661). Unbound antibody was washed off by immersing the slides in
0.1 mol/L Tris-HCl buffer pH 7.4 containing 0.15 mol/L NaCl, followed by 0.1 mol/L Tris-HCl pH 9.5 containing 0.1 mol/L NaCl and 0.05 mol/L
MgCl2. Levamisole (0.15 mg/mL) was added to the APh
substrate (4-chloro-2-methylbenzenediazonium/3-hydroxy-2-naphthoic acid 2,4-dimethyl-anilide phosphate) at 1 mg/mL to block endogenous APh.
Specificity of HCV staining patterns was assessed on selected positive
samples before and after absorption of the probe with recombinant
proteins (1 mg/mL) derived from the equivalent structural and
nonstructural regions of HCV genome. Recombinant SOD and HBV-associated antigens (HBsAg, HBcAg) and hepatitis A virus (HAV)
antigen were included in these experiments as controls. Efficiencyof
absorption was shown by testing the probes before and after absorption
for antigen reactivities with commercially available RIBA. Replacement of primary antibody with an irrelevant antibody (mouse antihuman chorionic gonadotropin [HCG] MoAb) was also performed.
CD34 antigen was detected both directly by incubating the section with
polystyrene beads coated with anti-CD34 MoAb (Dynal A.S.), and
indirectly with an anti-CD34 MoAb (clone QBend-10, Immunotech) followed
by antimouse Ig/APh (Boehringer Mannheim). Omission of the first
antibody and mouse isotypic antibody recognizing an irrelevant epitope
(IgG1 anti-HCG antibody) acted as the controls.
RT-PCR assay for HCV RNA and HCV genotyping.
RNA was extracted according to Chomczynsky and Sacchi.23
The RNA pellet was washed in 75% ethanol and resuspended in 20 µL of
diethyl-pyrocarbonate-treated autoclaved H2O. The total RNA yield was determined by spectrophotometry and processed for HCV RNA
detection by RT-PCR assay, as described elsewhere.24 Primers were selected from the 5-noncoding (NC) region of the HCV genome.
To characterize the HCV genotypes, biotinylated universal primers
referred to the 5-NC region were used to amplify and hybridize to genotype-specific probes (Line Probe assay, LiPA HCV II;
Innogenetics, Brussels, Belgium). Each sample was tested in triplicate,
and appropriate positive and negative controls were always included.
Negative strand-specific RT-PCR.
Negative-polarity strand HCV RNA sequences, presumably representing
replicative intermediates, were detected by RT-PCR with two sets of
primers aimed at specifically priming and amplifying HCV negative
strand RNA.25 One of them contained at the 5 end a
tag sequence unrelated to HCV genome (TAG-based assay). The second was located in the nucleocapsid of viral genome outside the
highly structured 5-NC region (CAP-based assay). Conditions for
the amplification of negative strand templates, their specificity, and
sensitivity were those described for the "TAG-based" assay by
Lanford et al26 and for the CAP-based assay
by Lerat et al.27
HCV strands were analyzed in CD34+ cells
obtained from patients 5 and 6. Following the above-described Dynal
protocol, CD34+ cell fractions were further purified with a
microbeads system (MACS; Miltenyi Biotec Inc, Auburn, CA). After
removal of magnetic beads from CD34+ cells using the
detachment system (Detach-a-Bead CD34 No. 113.01/02; Dynal), cells were
relabeled specifically with supermagnetic MACS microbeads coated with
anti-CD34 MoAb (clone QBend-10) and passed through a separation column
placed in a strong permanent magnet. Thus, only the magnetically
labeled CD34+ cells were retained in the column and then
recovered after removal of the column from the magnetic field. By
sequentially applying these two methodologies, which combine the use of
anti-CD34 antibodies directed against different epitopes on CD34
antigen, almost 100% pure CD34+ cells were obtained.
HCV RNA quantitation.
HCV RNA was quantitated by signal amplification using branched DNA
(bDNA) in a sandwich hybridization assay,28 according to
the manufacturer's instructions (Quantiplex HCV RNA, Version 2.0;
Chiron Corp, Emeryville, CA). Duplicate 50-µL samples were added to
the wells in which lysis, hybridization, capture, and signal
amplification occurred. Synthetic oligonucleotides, in a mixture which
included probes that mediated capture and probes that bound to the bDNA
amplifier molecule, hybridized equally well to the highly conserved
5-NC and core regions of the HCV RNA of all known genotypes,
thereby capturing the RNA molecules onto the surface of a microwell
plate and linking to synthetic bDNA molecules added to the well.
Multiple copies of an APh-linked synthetic probe hybridized to the
immobilized complex, thereby amplifying the target signal. Detection
was achieved by incubating the complex with a chemiluminescent
substrate (dioxetane) and measuring light emission, which was
proportional to the concentration of target nucleic acid in the
specimen. The standard curve was based on a diluted sample from a
patient with HCV infection whose serum had been quantitated by
comparison with synthetic HCV RNA. Because the values assigned to the
HCV RNA standards were based on comparison with highly purified RNA
transcript covering the first 3,200 nucleotides from the 5 end
of the HCV genome, the results were expressed as genomic equivalents
per mL (Eq/mL) rather than genomic copies. The lower limit of
sensitivity of this assay was 0.2 million Eq/mL (MEq/mL). HCV genomic
equivalents were divided by the number of the cells and results
expressed as HCV Eq/cell when considering HCV RNA extracted from
cultured cells.
Direct in situ RT-PCR (IS-RT-PCR).
CD34+ cells, washed with PBS to remove all traces of
culture medium, were centrifuged onto silane-coated microscope slides (Perkin-Elmer, Foster City, CA; code: 804-0502). A mild acid hydrolysis was performed by incubating the slides in 0.02 mol/L HCl for 10 minutes. After repeated washings in PBS, cells were immersed in 0.01%
Triton-X 100 in PBS for 2 minutes, transferred to a Coplin jar
containing proteinase K (Boehringer Mannheim) in 0.1 mol/L Tris-HCl pH
7.5, 5 mmol/L EDTA, and placed in a microwave oven for 10 minutes.
Microwaves were pulsed through the jar until boiling for 5 minutes. To
further reduce the levels of endogenous APh, the slides were dipped in
acetic acid at 4°C for 1 minute. They were then transferred to PBS
and digested with RNase-free DNase (Boehringer Mannheim) at 37°C at
1 U/mL overnight. After washings in PBS and nuclease-free water, the
slides were dehydrated through graded ethanols to 100%. RT-PCR was
performed with one enzyme under a single set of buffer conditions using
DNA polymerase from Thermus thermophilus (Tth) (Perkin-Elmer;
code N808-0097), which possesses RT activity in the presence of
manganese. RT-PCR mixture contained 200 mmol/L (each)
deoxyribonucleoside triphosphates (deoxyadenosine triphosphate
[dATP], deoxycytidine triphosphate [dCTP], deoxyguanosine
triphosphate [dGTP], and deoxythymidine triphosphate
[dTTP]), 2.5 mmol/L digoxigenin (DIG)-linked
11-deoxyuridine 5-triphosphate (dUTP) (Boehringer Mannheim), 2.5 mmol/L manganese acetate [Mn(OAc)2], 5 U recombinant Tth
DNA polymerase, 2.5 U RNasin (Promega, Madison, WI), 150 mmol/L of each
primer (JHC 51, antisense: CCCAACACTACTCGGCTA; JHC93 B, sense:
ACCATGAATCACTCCCCT) from the highly conserved 5-NC of HCV
genome,29 and 1× RT-PCR buffer (5× RT-PCR
buffer consists of 250 mmol/L Bicine, 575 mmol/L potassium acetate,
40% glycerol, pH 8.2; Perkin-Elmer, code 808-0177). The reactions were
performed in an Omnislide Thermal Cycler (Hybaid Limited, Middlesex,
UK), and slides were assembled with amplicover clips (Perkin-Elmer;
code N804-0501).
RT was allowed to proceed for 60 minutes at 70°C, followed by
1-minute incubation at 95°C to facilitate denaturation. PCR amplification was performed with two cycles at 95°C for 2 minutes followed by 38 cycles at 95°C for 1 minute, and a combined
annealing and extension step for 1 minute at 60°C and 72°C. A
final extension step of 7 minutes at 72°C followed the last PCR
cycle. At the end of the cycling, the slides were washed in 2×
SSC (1× SSC: 0.15 mol/L sodium chloride and 0.015 mol/L sodium
citrate) at 60°C for 5 minutes and then in PBS for 2 minutes.
Slides were dipped in 0.1 mol/L Tris-HCl, pH 7.5, 0.1 mol/L NaCl, 2 mmol/L MgCl2, 0.05% Triton-X 100 for 30 minutes.
DIG-labeled PCR product was detected by incubating the slides with
anti-DIG antibody conjugated with APh (Boehringer Mannheim) and the
signal detected by nitroblue tetrazolium (NTB; 340 µg/mL) and
5-bromo-4-chloro-3-indolyl phosphate (BCIP; 170 µg/mL) (Boehringer
Mannheim) substrate.
IS-RT-PCR procedure included the following controls: (1)
CD34+cells from HCV RNA-negative patients; (2) RT-PCR
solution phase on nucleic acids extracted from CD34+ cells
from each patient; (3) RT-PCR on cell suspensions containing a known
number of CD34+ cells from HCV RNA-positive patients mixed
with CD34+ cells from HCV RNA-negative patients; (4)
addition of RNase to remove target RNA; (5) omission of specific
primers, enzyme, nucleotides, Mn(OAc)2, or anti-DIG
antibody; (6) reference control gene-specific primers to amplify 308-bp
sequence complementary to interleukin-1 (IL-1) site insert from
pAW109-derived cDNA (Perkin-Elmer; code N0808-0037); (7) IS-RT-PCR
efficiency, analyzed by targeting  -actin mRNA; sense:
5ACACTGTGCCCATCTACCTAGGGG3; antisense:
5ATGATGGAGTTGAAGGTAGTTTCGTGGAT3.
In vitro HCV infection.
Primary CD34+ hematopoietic precursors from either BM or
peripheral blood were seeded at 1 × 105 cells per
well and inoculated with undiluted serum #0715 containing 2 × 10 HCV MEq/mL (genotype 1b). This inoculum was selected because it
contained a high genomic titer and was capable of establishing a
productive HCV infection in MOLT-4 cells, a human T-cell line (American
Type Culture Collection, Rockville, MD). A total of 1 mL
of #0715 inoculum together with 3 mL of fresh culture medium was
incubated for 24 hours at 37°C. Cells were then washed and fresh
medium was added, followed by continued incubation with medium changes
at 4-day intervals. At various times during the culture period, culture
medium (0.25 mL) and cells (105 cells) were collected for
HCV RNA detection and titration.
| |
RESULTS |
Experiments were designed to detect the presence of HCV RNA in
CD34+ cells. Suspensions containing positively-selected
CD34+ cells from BM and/or peripheral blood were
collected during a single apheresis procedure, and extracted RNA was
processed to demonstrate sequences of HCV genome.
Data reported in Table 2 provide evidence
that all patients showed HCV genomic sequences in CD34+
cells. Specifically, confirmation of negative-polarity strand HCV RNA
likely representing viral replicative intermediates was examined in two
highly purified CD34+ cell products obtained from patients
5 and 6, which were found to be 99.7% and 99.1% phenotypically pure,
respectively. Nested PCR using capsid-derived primers detected a
specific product at 1 × 103 HCV RNA Eq. Its
sensitivity appeared slightly reduced at 5 × 103 HCV
RNA Eq in the presence of 1 × 106 Eq of positive
strand templates, whereas it was not significantly influenced by the
addition of cellular RNA to the system. By the CAP-based assay,
negative strand intermediates were demonstrated in CD34+
cells of both patients (Fig 1).
Strand-specific RT-PCR analysis was also performed with TAG-based
derived primers. Negative strand HCV RNA was shown in one (patient 6)
of the two CD34+ samples. As indicated in Table 1, products
of PCR-driven amplification of 5-NC region were obtained in the
serum of all anti-HCV positive patients. Moreover, detection and
distribution of HCV RNA in purified lymphocyte subsets of these
patients did not show a consistent picture, in that CD20+
and/or CD8+ or CD4+ subsets tested
positive for HCV RNA (data not shown).
View larger version (59K):
[in this window]
[in a new window]
| Fig 1.
Negative-polarity strand HCV RNA and specificity of
CAP-based RT-PCR assay. Products were fractionated on a 3% agarose gel
and stained with ethidium bromide. Lane B: detection of synthetic HCV
negative strand RNA generated from the vector pRTI HCV cDNA containing
HCV capsid sequences cloned into pBluescript (Stratagene, San Diego,
CA).24 Lanes A, E, and G: negative control reactions in
which RNA templates were amplified in the absence of RT, omitting
specific primers, or in nucleic acids extracted from
CD34+ cells of a HCV-negative control, respectively.
Lanes C and D: RT-PCR products for negative strand HCV RNA amplified
from highly purified samples of CD34+ cells from patients
no. 5 and 6, respectively. Results were confirmed after Southern
blotting (inserted panel). A total of 1 µg of RNA extracts prepared
from CD34+ cells was used along with 250 ng outer sense
primer (5CCAAAACCCCAAAGAAA3, position: 750) for cDNA
synthesis. Resulting cDNA was amplified after addition of 250 ng of the
outer antisense primer (5GTACCCCATGAGGTCGGCG3, position:
355). A second PCR reaction was performed using a set of internal
primers (sense-5CAGATCGTTGGTGGAGTT3, position: 427;
antisense-5CAAGCCCTCATTGCCAT3, position: 616). The
resulting product of 189 bp was probed after Southern blotting using a
P32-labeled oligomer
(5GGTCGCAACCTCGAGGTAGACGTCAGCCT3, position: 506).
Lane F: molecular markers (HaeIII-digested  X174). Predicted size of
amplified fragment is indicated in base pair (bp).
|
|
To gain insight as to whether HCV might sustain a productive infection
in CD34+ cells, the latter were incubated and seeded in
liquid culture at a concentration of 0.5 × 106 in the
absence of growth factors. HCV RNA levels were titrated daily by the
bDNA technique in cells and the corresponding supernatants. Results
from separate experiments after 5 days of culture showed that
increments of HCV genomic equivalents in the cells paralleled those
found in the supernatants at corresponding intervals.
Figure 2, which summarizes culture
experiments, shows that 0.63 ± 0.24 (mean ± standard deviation
[SD]) genomic HCV equivalents per cell could be
detected on the starting day, whereas no viral RNA could be
demonstrated in the supernatant. Significant progressive increases of
viral RNA concentrations were shown during the culture period, and 5 days later, the number of viral Eq/cell was more than duplicated (2.11 ± 0.74). Remarkable changes were also shown in the supernatants, in
that 0.84 ± 0.42 HCV RNA MEq/mL were found on day 5.
View larger version (17K):
[in this window]
[in a new window]
| Fig 2.
HCV RNA titration by branched DNA signal amplification
assay of nucleic acids extracted from CD34+ cells and
their corresponding supernatants. Peripheral CD34+ cells
obtained from HCV-infected patients were cultured in RPMI 1640 medium
supplemented with 10% FCS. Supernatants and cells were harvested daily
for a period of 5 days.
|
|
Data from cells and supernatants suggested that CD34+ cells
contained viral particles and expressed a complete viral cycle. The
time-dependent increase in viral titers strongly indicated that the
virions present in the culture fluid were actually produced by infected
cells. After 5 days, infected cultures compared with noninfected
cultures differed neither in terms of number of CD34+ cells
nor of viable cells. To assess whether cells in which HCV was suspected
to replicate still expressed the CD34 antigen, cells were restained
with anti-CD34 MoAbs and separated into CD34+ and
CD34 cells. Molecular analysis showed that
CD34+ and CD34 cells both expressed
viral RNA in five of six patients. No difference in cell morphology and
viability was found between the two fractions.
The presence of HCV RNA genomic sequences within CD34+
cells was demonstrated morphologically by using a PCR-driven in situ hybridization technique. Intracellular RNA sequences were preserved in
situ while the cell membrane was permeabilized with proteinase K. Specific intracellular viral RNA was amplified by a PCR protocol in
which DIG-11-dUTP was used to obtain a DNA product that remained in
situ. DIG-labeled dUTP incorporated into the PCR product was detected
by antidigoxigenin-APh-labeled antibody and chromogenic substrate.
Controls were carefully evaluated. Positive cells were mixed with
uninfected CD34+ cells at different dilutions. Each
experiment was performed in triplicate.
Amplified HCV RNA product was identified in a mixture containing at
least 1 × 104 negative cells in excess.
Cytocentrifuged samples showed that the cellular morphology was
preserved, cellular debris was minimal, and intracellular localization
of PCR product was maintained. Efficiency of the RT-PCR process was
monitored by reverse transcription of cRNA transcribed from the plasmid
pAW109 containing an insert of a synthetic linear array of primer
sequences for the IL-1 site. Sensitivity was further evaluated by
targeting in situ -actin mRNA constitutively present in PBMC and
showing that more than 95% of them were positive. Analysis of viral
accumulation in the cell compartments showed that the signal
corresponding to HCV-specific 240-bp amplicon was detected in the
cytoplasm of CD34+ cells from all patients
(Fig 3A) and in none of the controls. Albeit with different intensity, a large proportion of
CD34+ cells were positive ranging from 36% to 65% (mean,
53.8 ± 25.1) of purified fractions.
View larger version (88K):
[in this window]
[in a new window]
| Fig 3.
(A) Direct in situ RT-PCR to amplify 5-NC region
of HCV genome in CD34+ cells. Note the complete absence
of reaction in an adjoining cell. Immunocytochemistry to detect core
(B) and E2/NS1 (C) antigens in CD34+ cells. In both cases
a cytoplasmic appearance of immune reactants was found. Note adhesion
of the core antigen to the nuclear membrane and accumulation of E2/NS1
antigen in cytoplasmic submembrane spaces. In (D) core reactivity was
blocked by preadsorption of antibody with recombinant HCV core antigen.
(E) Staining of CD34+ cells with FITC-conjugated
anti-E2/NS1 protein. Specific signal outlining nonfluorescent nuclei is
demonstrated. (F) The same cell as described in (E) was shown to
coexpress CD34 antigen, stained with PE-labeled antibody.
|
|
Morphologic evidence for the cellular accumulation of HCV proteins was
provided by immunocytochemistry on cultured CD34+ cells.
Cells were tested with a large panel of MoAbs covering structural
(core, E2/NS1 proteins) and nonstructural (NS3, NS4, NS5 proteins)
encoding regions of the HCV genome. Results showed that antigens were
detected as diffuse and homogeneous immune reactants within cytoplasmic
compartments of CD34+ cells (Fig 3B and C). Immunoreactive
cells rarely displayed granular submembrane deposits. Cell nuclei were
persistently negative. Immunostaining was considered specific, as there
was no reaction with CD34+ cells from HCV-unrelated
controls, or with HCV-related samples after substitution of the primary
antibody mixture. Preabsorption of the reagents with specific
recombinant antigens abolished the signal (Fig 3D), with a parallel
loss of reactivity in immunoblotting. The proportion of HCV-infected
CD34+ cells ranged from 9% to 33% (mean, 19.2 ± 14.7)
in the different purified preparations.
Morphologic studies on the coexpression of CD34 antigen and HCV
structural protein (E2/NS1) using two different fluorochromes demonstrated a cytoplasmic colocalization of both reactivities (Fig 3E
and F). With this methodology, however, the frequency of HCV-positivity
in CD34+ cells was somewhat lower (9.2% ± 4.7%).
To determine whether viral protein translation was a regular and
effective process following transcription of viral genes in
CD34+ cells, core and E2/NS1 protein-related epitopes were
analyzed by flow cytometry (Fig 4).
CD34+ cells were enumerated by flow cytometry in the
apheresis products with and without Ficoll-Hypaque centrifugation. The
percentage of double-stained cells approximately reflected that found
with immunohistochemistry in cytocentrifuged samples, in that almost one fourth of CD34+ cells (25.12% ± 17.88%)
coexpressed HCV proteins. For cytoplasmic staining, CD34+
cells were previously fixed in 4% formaldehyde solution and
resuspended in acetone. The presence of intracytoplasmic core and
E2/NS1 epitopes occurred less frequently than that found for surface
staining (16.8 ± 15.2 v 48.6 ± 31.9), respectively.
View larger version (34K):
[in this window]
[in a new window]
| Fig 4.
Analysis by flow cytometry of Ficoll-Hypaque-purified
leukapheresis products. Enumeration of CD34+ cells in
light density cell suspension of peripheral blood labeled with
anti-E2/NS1 whose labeling to the cells was defined by goat antimouse
Ig conjugated with FITC. Surface (A) and cytoplasmic (B) stainings were
performed. In (C), FITC-labeled isotypic control is shown.
Double-staining analysis with PE-conjugated anti-CD34 antibody followed
by FITC-labeled anti-E2/NS1 antibody is reported in (D). Isotypic
controls are indicated in (E and F).
|
|
These results led us to investigate whether CD34+ cells
could be infected in vitro. CD34+ cells from anti-HCV, HCV
RNA-negative patients were inoculated with undiluted serum #0750, which
was known to contain a high titer HCV and to be extremely efficient in
infecting the MOLT-4 cell line. Results were negative in all
experiments, performed under different conditions, including the
addition of feeder layers obtained from BM stromal cells and growth
factors (IL-2, G-CSF,  -interferon) (data not shown). Samples from
cells and supernatants failed to show viral RNA genomic sequences after
4 weeks of culture.
| |
DISCUSSION |
Our results demonstrate that HCV-harboring CD34+ cells are
a consistent biological feature in chronic HCV carriers. The following evidence points to productive infection of CD34+ cells by
HCV: (1) detection of negative-polarity strand of viral RNA by RT-PCR amplification on nucleic acids extracted from highly purified CD34+ cell populations; (2) in situ demonstration
of HCV RNA on intact cells; (3) detection of HCV-related structural and
nonstructural proteins by flow cytometry analysis, immunocytochemistry,
and immunofluorescence; and (4) an apparently complete extent of the viral cycle in cultured CD34+ cells.
Separation of CD34 from the CD34+ cell
fraction showed that HCV infection occurs in both cells that do and do
not express CD34 antigen, suggesting that HCV infection is not
restricted to a CD34+ subset. In addition, it was
demonstrated that other hematopoietic lineages including B- and T-cell
subsets may be infected with HCV, as already
reported.12,14-16
The presence or absence of HCV RNA within PBMC did not correlate with
any specific profile of serum or histologic markers. During the
purification of CD34+ cells and lymphocyte subsets, the
last washing was tested for HCV RNA. In every instance, no PCR product
was detected, suggesting that the HCV RNA signal detected in the cells
was not due to plasma contamination. The presence of both positive- and
negative-polarity HCV RNA strands in CD34+ cells and only
the positive HCV RNA strand detected in the corresponding serum
reflects the specificity of the RT-PCR products. Furthermore, the
uneven distribution of HCV RNA in the blood mononuclear cell subsets in
the same patient is consistent with the specific nature of the signal.
In vitro experiments indicated that HCV-infected BM and peripheral
blood hematopoietic progenitors did not show obvious morphologic abnormalities when compared with noninfected CD34+ cells.
Furthermore, the percentages of viable cells after many days of liquid
culture were not significantly different between infected and
noninfected CD34+ cells. These data support the contention
that HCV infection has little or no effect on the proliferation and
differentiation of CD34+ cells. They also suggest that,
although HCV infection occurs in the early steps of blood progenitor
differentiation, it does not result in viral-induced myelosuppression.
These considerations are in good accordance with clinical studies
showing that HCV is not directly responsible for hepatitis-associated
aplastic anemia.30 However, the biological significance of
these findings is still uncertain, and their impact on the clonogenic
differentiation of infected CD34+ cells should be directly
investigated.
Our experiments showed that CD34+ cells are not susceptible
to HCV infection in vitro. None of the variations in the culture conditions tested, including different concentrations of the virus and
the presence of a variety of growth factors or different accessory cells, resulted in susceptibility to HCV infection. These observations raise the possibility that several mechanisms, acting alone or in
combination, could mediate HCV infection of CD34+ cells in
vivo, namely infection of accessory cells necessary for maintenance and
regulation of normal hematopoiesis through the production of growth
factors and infection of stromal cells in the microenvironment
interfering with cytokine(s) production or disrupting normal stromal
cell-hematopoietic cell interactions.
As compared with HCV RNA-containing CD34+ cells, those
expressing HCV-related antigens were significantly fewer. It is clear from our experiments that differing sensitivities in the detection of
CD34+ cells infected with HCV are related to the techniques
used. Immunofluorescence on cytocentrifuged samples appears to be less
sensitive as compared with immunocytochemistry and flow cytometry
analysis, which gave roughly the same frequency. These differences were
particularly striking with in situ RT-PCR, in that mispriming and
incorrect priming were carefully excluded. Indeed, a pattern of viral
latency with silencing of viral genes expression can be suggested, as already described in hepatitis B virus (HBV) infection in which not all
cells that contain HBV DNA display HBV-related proteins.31 Because CD34+ cells include self-renewing stem cells, they
can be an initial site of infection, a continuous source of virus, and
possibly a mode of dissemination.
Previous studies on liver characterization and distribution of CD34
reactivity have indicated that anti-CD34 antibodies are more specific
and sensitive than anti-von Willebrand factor or Ulex europeus
agglutinin 1 for labeling endothelial cells.32 Moreover, it
has been shown that CD34 antigen is expressed by endothelial cells in
the sinusoid-like vessels of primary liver tumor and not by the
endothelial cells in the normal sinusoids. CD34 staining, as detected
by QBend-10 clone product, in normal liver was confined to vessels of
the portal tracts and in a few sinusoids of the periportal areas in
patients with chronic hepatitis and cirrhosis.33
Experimental studies have indeed shown that expression of CD34
transcripts fluctuate and decrease after the birth, but increase during
processes such as wound healing or tumor growth.34 In any
case, the demonstration of CD34 reactivity in the liver suggests that
this organ may retain CD34+ cells and perhaps act as a
hematopoietic microenvironment from the fetal period, or as a reservoir
of circulating CD34+ cells still remaining in the adult
organ, as already suggested.35 Further studies are needed
to recognize and characterize the distribution of CD34+
reactivity in various tissues, in view of the evidence which indicate
that it may be involved in leukocyte adhesion and "homing" during
inflammatory processes, as well as in the localization of progenitor
cells in the BM.17 Although the precise function of CD34
protein remains unknown, its widespread detection is consistent with
the multiple sites of demonstration of HCV infection, namely BM,12,16 liver,36 and
endothelium.22
Whether HCV infection of CD34+ cells is also related to
lymphomagenesis is an intriguing possibility37 suggested by
the fact that HCV infection in our patients preceded the appearance of lymphoma by many years and by the demonstration of HCV proteins in the
pathologic lymph nodes.13 Indeed, HCV might sustain
indolent stages of B-cell lymphoproliferation (putatively
antigen-dependent), as recently demonstrated by PCR analysis of Ig-VH
gene rearrangements using genomic DNA derived from intrahepatic B cells
of chronically HCV-infected patients with type II mixed
cryoglobulinemia.38 A common origin from B cells selected
by the triggering antigen may be inferred in both low-grade and
high-grade NHLs.39
| |
FOOTNOTES |
Submitted August 27, 1997;
accepted June 21, 1998.
Supported in part by the Finalized Project "Clinical Applications of
Oncologic Research," National Research Council, Rome (Contract No.
92.02269.PF39), by "Associazione Italiana per la Ricerca sul
Cancro" (AIRC), and by a grant from Italian Ministry of University
and Scientific and Technological Research, group "Liver Cirrhosis
and Viral Hepatitis." V.C. is the recipient of a fellowship from
AIRC.
Address reprint requests to Franco Dammacco, MD, Department of
Biomedical Sciences and Human Oncology, University of Bari Medical
School, Policlinico, P.zza G. Cesare, 11, 70124 Bari, Italy.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
REFERENCES |
1.
Whitcomb JM,
Hughes SH:
Retroviral reverse transcription and integration: Progress and problems.
Ann Rev Cell Biol
8:275,
1992
2.
Butera ST,
Roberts BD,
Lam L,
Hodge T,
Folks TM:
Human immunodeficiency virus type 1 RNA expression by four chronically infected cell lines indicates multiple mechanism of latency.
J Virol
68:2726,
1994[Abstract/Free Full Text]
3.
Miyashita E,
Yang B,
Lam KMC,
Crawford DH,
Thorley-Lawson DA:
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593,
1995[Medline]
[Order article via Infotrieve]
4.
McFadden G,
Kane K:
How DNA viruses perturb functional MHC expression to alter immune recognition.
Adv Cancer Res
63:117,
1994[Medline]
[Order article via Infotrieve]
5.
Spriggs MK:
Cytokine and cytokine receptors genes captured by viruses.
Curr Opin Immunol
6:526,
1994[Medline]
[Order article via Infotrieve]
6.
De Campos Lima PO,
Gavioli R,
Zhang QJ,
Wallace LE,
Dolcetti R,
Rowe M,
Rickinson AB,
Masucci MG:
HLA-A11 epitope loss in isolates of Epstein-Barr virus from a highly A11+ population.
Science
260:98,
1993[Abstract/Free Full Text]
7.
Phillips RE,
Rowland-Jones S,
Nixon FD,
Gotch FM,
Edwards JP,
Ogunlesi AO,
Elvin JG,
Rothbard JA,
Bangham CRM,
Rizza CR,
McMichael AJ:
Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition.
Nature
354:453,
1991[Medline]
[Order article via Infotrieve]
8.
Franco A,
Ferrari C,
Sette A,
Chisari FV:
Viral mutations, TCR antagonism and escape from the immune response.
Curr Opin Immunol
7:524,
1995[Medline]
[Order article via Infotrieve]
9.
Alter HJ:
To C or not to C: These are the questions.
Blood
85:1681,
1995[Free Full Text]
10.
Weiner AJ,
Brauer MJ,
Rosenblatt J,
Richman KH,
Tung J,
Crawford K,
Bonino F,
Saracco G,
Choo Q-L,
Houghton M,
Han JH:
Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins.
Virology
180:842,
1991[Medline]
[Order article via Infotrieve]
11.
Ogata NR,
Alter HJ,
Miller RH,
Purcell RH:
Nucleotide sequence and mutation rate of the H strain of hepatitis C virus.
Proc Natl Acad Sci USA
88:3392,
1991[Abstract/Free Full Text]
12.
Gabrielli A,
Manzin A,
Candela M,
Caniglia ML,
Paolucci S,
Danieli G,
Clementi M:
Active hepatitis C virus infection in bone marrow and peripheral blood mononuclear cells from patients with mixed cryoglobulinemia.
Clin Exp Immunol
97:87,
1994[Medline]
[Order article via Infotrieve]
13.
Sansonno D,
De Vita S,
Cornacchiulo V,
Carbone A,
Boiocchi M,
Dammacco F:
Detection and distribution of hepatitis C virus-related proteins in lymph nodes of patients with type II mixed cryoglobulinemia and neoplastic or non-neoplastic lymphoproliferation.
Blood
88:4638,
1996[Abstract/Free Full Text]
14.
Moldvay J,
Deny P,
Pol S,
Brechot C,
Lamas E:
Detection of hepatitis C virus RNA in peripheral blood mononuclear cells of infected patients by in situ hybridization.
Blood
83:269,
1994[Abstract/Free Full Text]
15.
Muratori L,
Gibellini D,
Lenzi M,
Cataleta M,
Muratori P,
Morelli MC,
Bianchi F:
Quantification of hepatitis C virus-infected peripheral blood mononuclear cells by in situ reverse transcriptase-polymerase chain reaction.
Blood
88:2768,
1996[Abstract/Free Full Text]
16.
Sansonno D,
Iacobelli AR,
Cornacchiulo V,
Iodice G,
Dammacco F:
Detection of hepatitis C virus (HCV) proteins by immunofluorescence and HCV RNA genomic sequences by non-isotopic in situ hybridization in bone marrow and peripheral blood mononuclear cells of chronically HCV-infected patients.
Clin Exp Immunol
103:414,
1996[Medline]
[Order article via Infotrieve]
17.
Krause DS,
Fackler MJ,
Civin CI,
Stratford May W:
CD34: Structure, biology, and clinical utility.
Blood
87:1,
1996[Free Full Text]
18.
Non-Hodgkin's Lymphoma Pathologic Classification Project:
National Cancer Institute sponsored study of classifications of non-Hodgkin's lymphomas. Summary and description of a working formulation for clinical usage.
Cancer
49:223,
1989
19.
De Vita S,
Ferraccioli GF,
De Re V,
Dolcetti R,
Carbone A,
Bartoli E,
Boiocchi M:
Polymerase chain reaction detects B-cell clonalities in patients with Sjögren syndrome and suspected malignant lymphoma.
J Rheumatol
21:1497,
1994[Medline]
[Order article via Infotrieve]
20.
Di Luca D,
Dolcetti R,
Mirandola P,
De Re V,
Secchiero P,
Carbone A,
Boiocchi M,
Cassai E:
Human herpesvirus 6: A survey of presence and variant distribution in normal peripheral lymphocytes and lymphoproliferative disorders.
J Infect Dis
170:211,
1994[Medline]
[Order article via Infotrieve]
21.
Sutherland DR,
Keating A:
The CD34 antigen: Structure, biology and potential clinical application.
J Haematother
1:115,
1992[Medline]
[Order article via Infotrieve]
22.
Sansonno D,
Cornacchiulo V,
Iacobelli AR,
Di Stefano R,
Lospalluti M,
Dammacco F:
Localization of hepatitis C virus (HCV) antigens in liver and skin tissues of chronically HCV-infected patients with mixed cryoglobulinemia.
Hepatology
21:305,
1995[Medline]
[Order article via Infotrieve]
23.
Chomczynsky P,
Sacchi N:
Single-step method of RNA isolation by guanidium thiocyanate phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
24.
Dammacco F,
Sansonno D,
Han JH,
Shyamala V,
Cornacchiulo V,
Iacobelli AR,
Lauletta G,
Rizzi R:
Natural interferon- versus its combination with 6-methylprednisolone in the therapy of type II mixed cryoglobulinemia: A long-term, randomized, controlled study.
Blood
84:3336,
1994[Abstract/Free Full Text]
25.
Dash S,
Halim A-B,
Tsuji H,
Hiramatsu N,
Gerber MA:
Transfection of HepG2 cells with infectious hepatitis C virus genome.
Am J Pathol
151:363,
1997[Abstract]
26.
Lanford RE,
Sureau C,
Jacob JR,
White R,
Fuerst T:
Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR.
Virology
202:606,
1994[Medline]
[Order article via Infotrieve]
27.
Lerat H,
Berby F,
Trabaud M-A,
Vidalin O,
Major M,
Trépo C,
Inchauspé G:
Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells.
J Clin Invest
97:845,
1996[Medline]
[Order article via Infotrieve]
28.
Davis GL,
Lau JYN,
Urdea MS,
Neuwald PD,
Wilber JC,
Lindsay K,
Perrillo RP,
Albrecht J:
Quantitative detection of hepatitis C virus RNA with a solid-phase signal amplification method: Definition of optical conditions for specimen collection and clinical application in interferon-treated patients.
Hepatology
19:1337,
1994[Medline]
[Order article via Infotrieve]
29.
Han JH,
Shyamala V,
Richman KH,
Brauer MJ,
Irvine B,
Urdea MS,
Tekamp-Olson,
Kuo G,
Choo Q-L,
Houghton M:
Characterization of the terminal regions of hepatitis C viral RNA: Identification of conserved sequences in the 5 untranslated region and poly(A) tails at the 3 end.
Proc Natl Acad Sci USA
88:1711,
1991[Abstract/Free Full Text]
30.
Brown KE,
Tisdale J,
Dunbar CE,
Young NS:
Hepatitis-associated aplastic anemia.
N Engl J Med
336:1059,
1997[Abstract/Free Full Text]
31.
Farmer JL,
Irace HE,
Maaba M,
Heine K:
Analysis of cell-associated recombinant hepatitis B surface antigen by flow cytometry.
Arch Virol
109:223,
1989[Medline]
[Order article via Infotrieve]
32.
Anthony PP,
Ramani P:
Endothelial markers in malignant vascular tumors of the liver: Superiority of QB-END/10 over Von Willebrand factor and ulex europaeus agglutinin 1.
J Clin Pathol
44:29,
1991[Abstract/Free Full Text]
33.
Tanigawa N,
Lu C,
Mitsui T,
Miura S:
Quantitation of sinusoid-like vessels in hepatocellular carcinoma: Its clinical and prognostic significance.
Hepatology
26:1216,
1997[Medline]
[Order article via Infotrieve]
34.
Ito A,
Nomura S,
Hirota S,
Suda J,
Suda T,
Kitamura Y:
Enhanced expression of CD34 messenger RNA by developing endothelial cells of mice.
Lab Invest
72:532,
1995[Medline]
[Order article via Infotrieve]
35.
Fina L,
Molgaard HV,
Robertson D,
Bradley MJ,
Monaghan P,
Delia D,
Sutherland DR,
Baker MA,
Greaves MF:
Expression of the CD34 gene in vascular endothelial cells.
Blood
75:2417,
1990[Abstract/Free Full Text]
36.
Selby MJ,
Choo QL,
Berger K,
Kuo G,
Glazer E,
Eckart M,
Lee C,
Chien D,
Kuo C,
Houghton M:
Expression, identification and subcellular localization of the proteins encoded by the hepatitis C viral genome.
J Gen Virol
74:1103,
1993[Abstract/Free Full Text]
37.
De Vita S,
Sacco C,
Sansonno D,
Gloghini A,
Dammacco F,
Crovatto M,
Santini G,
Dolcetti R,
Boiocchi M,
Carbone A,
Zagonel V:
Characterization of overt B-cell lymphomas in patients with hepatitis C virus infection.
Blood
90:776,
1997[Abstract/Free Full Text]
38.
Sansonno D,
De Vita S,
Iacobelli AR,
Cornacchiulo V,
Boiocchi M,
Dammacco F:
Clonal analysis of intrahepatic B cells from HCV-infected patients with and without mixed cryoglobulinemia.
J Immunol
160:3594,
1998[Abstract/Free Full Text]
39.
Hsu FJ,
Levy R:
Preferential use of the VH4 Ig gene family by diffuse large-cell lymphoma.
Blood
86:3072,
1995[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
B. Liu, A. M. Woltman, H. L. A. Janssen, and A. Boonstra
Modulation of dendritic cell function by persistent viruses
J. Leukoc. Biol.,
February 1, 2009;
85(2):
205 - 214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Anderson, R. Pfeiffer, J. L. Warren, O. Landgren, S. Gadalla, S. I. Berndt, W. Ricker, R. Parsons, W. Wheeler, and E. A. Engels
Hematopoietic Malignancies Associated with Viral and Alcoholic Hepatitis
Cancer Epidemiol. Biomarkers Prev.,
November 1, 2008;
17(11):
3069 - 3075.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Sansonno, A. Carbone, V. De Re, and F. Dammacco
Hepatitis C virus infection, cryoglobulinaemia, and beyond
Rheumatology,
April 1, 2007;
46(4):
572 - 578.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Feldmann, H. D. Nischalke, J. Nattermann, B. Banas, T. Berg, C. Teschendorf, W. Schmiegel, U. Duhrsen, J. Halangk, A. Iwan, et al.
Induction of Interleukin-6 by Hepatitis C Virus Core Protein in Hepatitis C-Associated Mixed Cryoglobulinemia and B-Cell Non-Hodgkin's Lymphoma
Clin. Cancer Res.,
August 1, 2006;
12(15):
4491 - 4498.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Wu, J. Vieira, N. Fiore, P. Banerjee, M. Sieburg, R. Rochford, W. Harrington Jr, and G. Feuer
KSHV/HHV-8 infection of human hematopoietic progenitor (CD34+) cells: persistence of infection during hematopoiesis in vitro and in vivo
Blood,
July 1, 2006;
108(1):
141 - 151.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Wolk, C. Gremion, N. Ivashkina, O. B. Engler, B. Grabscheid, E. Bieck, H. E. Blum, A. Cerny, and D. Moradpour
Stable human lymphoblastoid cell lines constitutively expressing hepatitis C virus proteins
J. Gen. Virol.,
June 1, 2005;
86(6):
1737 - 1746.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. D. Aljurf, T. W. Owaidah, A. Ezzat, E. Ibrahim, and A. Tbakhi
Antigen- and/or immune-driven lymphoproliferative disorders
Ann. Onc.,
November 1, 2003;
14(11):
1595 - 1606.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Laporte, C. Bain, P. Maurel, G. Inchauspe, H. Agut, and A. Cahour
Differential distribution and internal translation efficiency of hepatitis C virus quasispecies present in dendritic and liver cells
Blood,
January 1, 2003;
101(1):
52 - 57.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. De Luca, R. Bugarini, A. C. Lepri, M. Puoti, E. Girardi, A. Antinori, A. Poggio, G. Pagano, G. Tositti, G. Cadeo, et al.
Coinfection With Hepatitis Viruses and Outcome of Initial Antiretroviral Regimens in Previously Naive HIV-Infected Subjects
Arch Intern Med,
October 14, 2002;
162(18):
2125 - 2132.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Radkowski, J. Wilkinson, M. Nowicki, D. Adair, H. Vargas, C. Ingui, J. Rakela, and T. Laskus
Search for Hepatitis C Virus Negative-Strand RNA Sequences and Analysis of Viral Sequences in the Central Nervous System: Evidence of Replication
J. Virol.,
January 15, 2002;
76(2):
600 - 608.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Azzari, M. Resti, M. Moriondo, R. Ferrari, P. Lionetti, and A. Vierucci
Vertical transmission of HCV is related to maternal peripheral blood mononuclear cell infection
Blood,
September 15, 2000;
96(6):
2045 - 2048.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Radkowski, J. Kubicka, E. Kisiel, J. Cianciara, M. Nowicki, J. Rakela, and T. Laskus
Detection of active hepatitis C virus and hepatitis G virus/GB virus C replication in bone marrow in human subjects
Blood,
June 15, 2000;
95(12):
3986 - 3989.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract