SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Brooks, E. G. Articles by Goldblum, R. M. Search for Related Content PubMed PubMed Citation Articles by Brooks, E. G. Articles by Goldblum, R. M. Related Collections Immunobiology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 93 No. 1 (January 1), 1999: pp. 242-250 T-Cell Receptor Analysis in Omenn's Syndrome: Evidence for Defects in Gene Rearrangement and Assembly By Edward G. Brooks, Alexandra H. Filipovich, John W. Padgett, Robert Mamlock, and Randall M. Goldblum From the University of Texas Medical Branch, Department of Pediatrics, Child Health Research Center, Galveston, TX; Pediatric Immunology, University of Minnesota, Minneapolis, MN; and Texas Tech Health Sciences Center School of Medicine, Department of Pediatrics, Lubbock, TX.     ABSTRACT Top Abstract Introduction Materials and methods Results and discussion References Patients with Omenn's syndrome have a form of severe immune deficiency that is associated with pathological features of graft-versus-host disease, except for the lack of foreign engraftment. It has been hypothesized that the disease's unique clinical features are mediated by an expanded population of autologous self-reactive T cells of limited clonality. In the current study, an investigation of the T-cell receptor (TCR) repertoire was undertaken to identify defects in T-cell rearrangement and development. The TCR repertoire in this group of patients was exquisitely restricted in the number of different TCR clonotypes, and some of these clonotypes seemed to have similar recognition motifs in the antigen-binding region, indicating antigen-driven proliferation of T lymphocytes. The TCRs from some patients lacked N- or P-nucleotide insertions and used proximal variable and joining gene segments, suggesting abnormal intrathymic T-cell development. Finally, abnormal assembly of gene segments and truncated rearrangements within nonproductive alleles suggested abnormalities in TCR rearrangement mechanisms. Overall, the findings suggest that inefficient and/or abnormal generation of TCRs may be a consistent feature of this disease. © 1999 by The American Society of Hematology.     INTRODUCTION Top Abstract Introduction Materials and methods Results and discussion References OMENN'S SYNDROME was initially described in 1968 by Gilbert Omenn as an immunodeficiency disease with autoimmune features resembling graft-versus-host disease (GvHD).1 The origin of this disease seems to result from a variety of genetic and, perhaps, primary immunologic mechanisms that converge to result in a homogenous pathological picture of autologous GvHD in the context of an oligoclonal expansion of activated T cells. The original reports described the members of a single extended family, in which the inheritance pattern and consanguinity suggested an autosomal recessive inheritance of the disease.1-3 Since that time, cases with similar manifestations but different patterns of inheritance have been described.4-7 For example, a sibling of a patient with severe combined immune deficiency (SCID) developed Omenn's syndrome, prompting the hypothesis that some patients with Omenn's syndrome may represent a "leaky" form of SCID.5,8 Arguments that Omenn's syndrome represents true GvHD in patients with SCID have been discounted by the lack of evidence for engrafted lymphocytes.9,10 Partial recombinase activating gene (RAG) defects have been recently described in many of these patients.11 Here we report, for the first time, an infant with the DiGeorge anomaly and chromosome 22q11 deletion who developed Omenn's syndrome. Thus, both intrinsic defects in VDJ (variable, diversity, joining) recombination as well as defects in thymic development may lead to SCID with GvHD-like autoimmunity (Omenn's syndrome). The primary goal in our investigation was to seek evidence for common abnormalities in T-cell development, T-cell receptor (TCR) repertoire, and assembly of TCRs within these patients by examining the productive and nonproductive TCR transcripts in the circulating T-cell populations. The results showed that the TCR repertoires were not only exquisitely restricted in the number of different TCR clonotypes, but some of these clonotypes seemed to have similar recognition motifs in the antigen-binding region, indicating antigen-driven proliferation of T lymphocytes. Decreased N- and P-nucleotide insertions and usage of proximal gene segments found in some patients may be consistent with abnormal T-cell development. Abnormal assembly of gene elements and truncated rearrangements were found within nonproductive alleles indicative of abnormalities in TCR rearrangement mechanisms.     MATERIALS AND METHODS Top Abstract Introduction Materials and methods Results and discussion References Case Reports A summary of clinical features and peripheral blood T-cell phenotypes is shown in Tables 1 and 2. Cases 3 through 7 have been previously described.7,12,13                                View this table: [in this window] [in a new window]   Table 1. Clinical Characteristics                                View this table: [in this window] [in a new window]   Table 2. Peripheral Blood T-Cell Subsets (%) Case 1.   A female infant was born with facial features consistent with the DiGeorge syndrome. She had hypocalcemia, absence of a thymic shadow on chest roentgenogram, severe lymphopenia, and absent responses to mitogens. She had no cardiac abnormalities. Fluorescent in situ hybridization analysis showed a deletion within the region of chromosome 22q11. At 2 months of age her lymphocyte numbers increased dramatically, and she developed erythroderma, hepatosplenomegaly, lymphadenopathy, chronic diarrhea, and respiratory distress. Maternal engraftment could not be detected by serological techniques in peripheral blood lymphocytes (PBLs) or by polymerase chain reaction (PCR) analysis of class II HLA alleles in B- and T-cell lines derived from the patient. Case 2.   A female infant developed exfoliative dermatitis, failure to thrive, and chronic diarrhea at 1 month of age. She subsequently developed progressive lymphadenopathy and splenomegaly. Her laboratory evaluation at 6 weeks of age showed mild lymphopenia (absolute lymphocyte count, 1,100 to 1,500/µL), hypogammaglobulinemia (IgG 236 mg/dL, IgM 27 mg/dL, and IgA <7 mg/dL), and elevated IgE (2,617 U/mL). The phenotype of her peripheral blood T cells was normal and HLA typing showed no engraftment with maternal lymphocytes. Case 3.   A female infant developed chronic diarrhea soon after birth and dermatitis at 1 month of age.7 A skin biopsy was believed to be consistent with GvHD and the patient was treated with prednisone and CsA with subsequent control of the dermatitis. She subsequently developed recurrent infections (otitis media, conjunctivitis, and bacterial and Candida sepsis), hepatomegaly, lymphadenopathy, eosinophilia, and hemolytic anemia. The family history was significant in that a female first cousin with SCID died after haploidentical T-cell-depleted bone marrow transplantation. Her laboratory evaluation showed normal serum IgG, absent IgA and IgE, and low IgM concentrations. Her PBLs ranged from 1,200 to 4,200/µL and did not respond to T- and B-cell mitogens. The patient's T-cell phenotype was dominated by TCR+ CD4 CD8 T cells at the time specimens for this study were obtained. Restriction fragment length polymorphism analysis did not detect maternal engraftment. Case 4.   This previously reported white male was characterized by severe craniofacial anomalies distinct from those described in the DiGeorge anomaly and consisted of malformed ears and external auditory canals, a fish-shaped mouth, and cleft palate.12,13 He had a massive expansion of TCR CD4 CD8 T cells in the peripheral blood, skin, and lymph nodes. He developed chronic sino-pulmonary infections, oral thrush, severe exfoliative dermatitis, pulmonary edema, chronic diarrhea, and massive lymphadenopathy and lymphocytosis. When the patient was placed on CsA, there was a dramatic improvement in the dermatitis, eosinophilia, and lymphocytosis. Karyotyping and lymphocyte typing failed to show engraftment of maternal lymphocytes. Case 5.   The parents of this male infant were second cousins.7 He was born full term and remained healthy until 4 months of age when he first developed severe oral and perineal candidiasis followed by severe seborrheic dermatitis unresponsive to medical therapy. At 7 months of age he developed Pneumocystis carinii pneumonia (PCP). Laboratory testing showed absent IgG and IgA, depressed IgM, and an elevated IgE, which ranged from 482 to 6,140 IU/mL. Absolute numbers of lymphocytes ranged from 500 to 2,400/µL and eosinophils from 1,160 to 9,100/µL. Isohemagglutinins and titres to diphtheria and tetanus were negative; mitogens were profoundly depressed. Over the next several months the dermatitis progressed to alopecia, and the patient developed massive lymphadenopathy and hepatomegaly. When he was treated with CsA at 15 months of age there was remarkable improvement in skin manifestations, hair regrowth, and a significant reduction in lymph node and liver size. Case 6.   A male infant experienced failure to thrive since birth and intermittent diarrhea.7 Dermatitis appeared at 2 months of age. Severe PCP and Candida pneumonia were treated during the first 6 months of life. Lymphadenopathy was prominent. IgG, A, and M were decreased, and IgE was elevated. Proliferation to standard mitogens was 5% to 15% of normal. Lymphocyte counts ranged from 1,580 to 6,200/µL. No maternal engraftment was detected. An older brother, who died of opportunistic infections, also had a clinical history consistent with Omenn's syndrome. Case 7.   This male infant developed jaundice at 1 week of age followed by chronic diarrhea.7 By 1 month of age he exhibited severe dermatitis and had failure to thrive. At 9 months of age chronic PCP was diagnosed. Absolute lymphocyte counts ranged from 1,500 to 5,000/µL, and eosinophilia was noted. IgG, A, and M were in the normal range, but IgE levels ranged as high as 10,000 IU/mL. Proliferation to mitogens was minimal, and isohemagglutinins and specific antibody titres were negative. The patient subsequently experienced multiple episodes of bacterial (gram negative and positive) sepsis. Inverse PCR To estimate the frequency of T-cell clones in the peripheral blood and determine the TCR sequences, inverse PCR was used as described.14 Briefly, total RNA was extracted from PBL using oligo dT-Sepharose chromatography (Pharmacia, Gaithersburg, MD) and cDNA synthesized using reverse transcriptase (GIBCO-BRL, Gaithersburg, MD) and oligo dT priming. Double-stranded cDNA was generated using RNase H, Escherichia coli. DNA polymerase I and DNA ligase were followed by T4 DNA polymerase for blunt ending. The cDNAs were then circularized with T4 DNA ligase and used as a template in the PCR using primers for either the - or -chain constant (C) region genes. In most cases, nested primers were used to reamplify products to increase quantity and specificity. The PCR primers used were as follows: C inverse, 5 CCCTGCTATGCTGTGTGTCT 3; C inverse nested primer, 5 TCCTGCTGCCGATGCCTTCATT 3; C forward, 5 AGACCTCATGTCTAGCACAGT 3; C forward nested primer, 5 GCAGACAGACTTGTCACTGGATT 3; C inverse, 5 TGCCACCATCCTCTATGAGATC 3; C inverse nested primer, 5 GCCATGGTCAAGAGAAAGGAT 3; C forward, 5 GCCTTTTCCCTGTGGGAGAT 3; C forward nested primer, 5 AACACAGCGACCTCGGGTG 3. DNA Sequencing and Analysis The amplified DNA was then inserted into a bacterial plasmid vector (PCr II; Invitrogen, San Diego, CA), cloned into E coli, and plated onto selective medium. Individual colonies were selected and sequenced using the dideoxy chain-termination method (Amersham, Arlington, Heights, IL). Sequences obtained were compared with a TCR database derived from the GenBank database (National Library of Medicine, Bethesda, MD). Sequence similarities and junctions were identified using a computer search program developed in this laboratory (TCR IDENTIFY program; Steven Jowers, Michael Kulvicki and Edward Brooks, unpublished observation, 1996), which uses algorithms available from Genetics Computer Group (Madison, WI) software package. Nomenclature for the TCR genomic sequences were according to Rowen et al,15 Slightom et al,16 Koop et al,17 and Arden et al.18 Analyses of complementarity determining region-3 (CDR3) lengths were calculated as the number of amino acids between the terminal V-region cysteine and the J-region motif, GXG, minus four. Statistical analyses were performed on Quatro Pro software, version 6.0, (Corel Corp, Ottawa, Ontario, Canada). T-Cell Clones T-cells were obtained from peripheral blood and cultured in the presence of interleukin-2 (IL-2) and phytohemaglutinin (PHA) as described.19,20 Cultures were stimulated every 2 to 3 weeks with irradiated B-lymphoblastoid cells and PHA in IL-2 containing culture medium. After several months in culture, flow cytometry was performed using fluorescein and phycoerythrin-labeled monoclonal antibodies (Becton Dickinson, San Jose, CA) directed against the TCR (WT31) CD4 (Leu3) and CD8 (Leu2a). Without subcloning, the dominant cells within the cultures were >98% TCR CD4 CD8. To isolate mRNA as described above, 2 to 5 × 106 cells were used. Only one productive TCR was identified from the T-cell lines obtained from patients 1 and 4. In patient 4, two subclones were isolated that bore identical TCRs. The fact that only one T cell dominated each of the T-cell cultures was consistent with the oligoclonality in these patients.     RESULTS AND DISCUSSION Top Abstract Introduction Materials and methods Results and discussion References TCR and  sequences were obtained from peripheral blood samples from each of the patients described. The results of those analyses are shown in Tables 3 through 8. Because of the ability of this technique to amplify any mRNA transcript containing the target C region sequences, both productively and nonproductively rearranged TCR alleles were identified and analyzed. All germline VDJ genes were identical to previously described genes, although previously unrecognized polymorphisms could not be excluded. Abnormal recombinations within homologous regions of different V and J genes, previously reported in certain PCR techniques, were not observed.21,22                                View this table: [in this window] [in a new window]   Table 3. Productive Sequences: TCR                                View this table: [in this window] [in a new window]   Table 4. Productive Sequences: TCR                                View this table: [in this window] [in a new window]   Table 5. Shared CDR3 Motifs                                View this table: [in this window] [in a new window]   Table 6. Nonproductive Sequences                                View this table: [in this window] [in a new window]   Table 7. Abnormal TCR Sequences                                View this table: [in this window] [in a new window]   Table 8. Abnormal TCR Sequences Analysis of Productive TCR Transcripts All patients displayed an oligoclonal repertoire of productively rearranged TCRs. Both the - and -chain repertoires were limited to a few unique clones. This was indicated by the inability to clone large numbers of unique TCRs within the same patient, and the high frequency with which different cDNAs representing the same clonotype were sequenced. To ensure that repeated sequences were indeed derived from unique mRNA transcripts and not from the amplified products of the same mRNA transcript, the most 5 end of the cloned VDJC template was sequenced. Because second-strand synthesis by DNA polymerase was primed on RNase-generated fragments of RNA, each amplified cDNA bore a novel 5 start site caused by random nicking by RNase and subsequent digestion (blunt-ending) of the 5 end by T4 DNA polymerase. Thus, it could be determined whether each sequence represented a unique mRNA species or simply the amplified products of the same mRNA. In some cases few or no unique mRNA transcripts were amplified (TCR: case 1 [2 transcripts]; TCR: case 5 [1 transcript], case 6 [1 transcript], and case 7 [none]; and TCR: case 1 [2 transcripts]) (Tables 3 and 4). However, in all patients, an adequate analysis of the complexity of the repertoire was obtained from the amplified sequences of either the - or -chains. Reproducibility of the technique was shown in one patient (case 4), in which two different aliquots of the same blood sample were analyzed in separate experiments that yielded nearly identical frequencies of the same TCR transcripts. In all cases, it can be concluded that there was an expansion of one or several T-cell clones (Tables 3 and 4). This finding is consistent with previous analyses of the TCR repertoire in Omenn's syndrome by Southern blotting.6,13 Also of note was the preferential usage of certain V genes among the few TCRs expressed in given individuals. For example, in case 1, TCRBV5S1 was used in 3 clones and TCRBV14S1 in 2 of 6 clones. The only other receptor identified in case 1 used TCRBV3S1, which bears extensive sequence homology with TCRBV14. In case 2, TCRBV13 was used in 3 of 10 clones, and in case 4, TCRBV3S1 was used in 2 of 4 clones. The TCR V gene usage was less preferential, but some skewing was evident. TCRAV3S1 was used in 2 of 6 clones in case 4, and TCRAV14S1 was used in 2 of 5 clones in case 8 and in 2 of 5 clones in case 6. It was important to examine the structure of the CDR3 of these TCRs, because this region possesses the highest degree of diversity, and, according to most models, encodes the TCR segment involved in antigen recognition.23-26 The length of the CDR3 may also provide information about the nature of the ligands or the rearrangement process.27,28 This analysis was undertaken for both the  and  CDR3s in this group of Omenn's patients (Tables 3 and 4), and compared with previous analyses of large pools of TCRs from antigen-specific T cells or a randomly selected pool from normal humans.29,30 In the TCR chains, the CDR3 lengths were slightly shorter than previous studies (mean, 8.4 v 9.2 [or 10.5]), had a slightly larger range (5 to 13 v 6 to 12), and had similar variance (2.7 v 2.8; skewing, 0.13 v 0.1; and kurtosis, 0.21 v 0.9). Within the TCR chains, one CDR3 (case 1, clone 2), which was only two amino acids in length, was excluded from the statistical analysis. The range of lengths was similar to previous reports (7 to 13 v 6 to 12), but the mean lengths were shorter (8.6 v 9.5), with slightly less variance (2.5 v 4), and similar kurtosis (0.55 v 0.2).29,30 Based on the findings of a previous study, which found that the length of the CDR3s from thymic T cells, both selected and unselected, differed little from the mature, antigen-specific pool of TCRs, the shorter CDR3 lengths that we detected in the Omenn's group were probably not the result of selection events.29 Rather, as discussed in more detail below, it is likely that the shorter CDR3 lengths resulted from fewer N or P nucleotide insertions or increased deletion of germline encoded segments within recombinatorial joints. A few common amino acid motifs within the CDR3s were identified both within individual patients and among different patients (Table 5). For one motif (1), identical amino acid sequences were observed in two clones. The common sequences encoded by this motif (1) may have been attributable to identical germline J regions and the lack of N nucleotide insertions. In three patients, TCRs were identified that predominantly used V and J gene segments that map to genomic regions in close proximity to each other. In cases 1, 3, and 4, TCRBV3S1, 14S1, 11S1, and 15S1, which are the second, third, four, and fifth, respectively, most 3 V genes in the human TCRB locus on chromosome 7, accounted for the majority (8 of 13) of V genes used (Table 2).15 Some of these same receptors also rearranged to the most 5 J-region locus (TCRBJ1). Finally, as indicated above, within some of those same TCR clones, no N or P nucleotides were detected so that the junctional regions were encoded solely by germline V-, D-, and J-region nucleotides (case 1, clones 1 and 3; case 3, clones 1 and 3; and case 4, clone 2). This is most pronounced in case 3, where a total of only three nongermline-encoded nucleotides were identified in the three TCRs. Those nucleotides, identified in clone 2, coded for an isoleucine. The apparent nongermline-encoded aspartic acid (D) within that joint was encoded by one germline D-region and two germline J-region nucleotides. Preferential usage of proximal TCR J genes could be observed in case 1, within both the productive and the nonproductive transcripts (TCRAJ56, 53, and 49), but it could not be determined for the TCRAV locus because that locus has yet to be fully mapped.17 However, these TCRs also had decreased numbers of junctional nucleotides in some clones. Although the enzyme responsible for N nucleotide insertion, terminal deoxynucleotidyl transferase (TdT), seemed to be functional in all patients studied, as indicated by the presence of N nucleotides, it may not have been fully active. Alternatively, the atypical TCRs may have arisen before the full expression of TdT, reminiscent of "immature" TCRs detected in human fetal thymus.28,31 Interestingly, the peripheral blood T cells in all three of these patients (cases 1, 3, and 4) with limited N nucleotide insertion were dominated by TCR/ populations lacking CD4 and CD8. These TCR/ "double negative" T cells normally comprise a minuscule population in the blood of healthy individuals (0.1% to 2%), but are increased in some autoimmune diseases.13,32-35 In normal humans, TCR/ double-negative T cells represent populations with oligoclonal TCRs, some of which use similar proximal rearrangements and lack N nucleotides.20,36 Several reports have suggested that these cells may be extrathymically derived.37-42 T-cell clones were generated from two patients and their TCR chains were identified (Table 3). The clones derived from the peripheral blood of patient 1 was TCR/ double negative and used TCRBV17S1 and BJ2s1. TCRBV17S1 is highly homologous to BV14S1 and 3S1 and is also a somewhat proximal gene (seventh nonpseudo gene from the 3 end of the TCRBV locus). A second TCR/ double-negative clone was derived from patient 4, which bore TCRBV3s1 rearranged to J1s1, and a short germline-encoded junctional region. These features were in keeping with the abnormalites already described for the other circulating T cells in the patients. The functional activity of this clone has been previously examined and showed proinflammatory and cytotoxic activities that implicated the TCR/ double-negative T cells in the disease pathogenesis.12,13,19 Analysis of Nonproductive TCR Transcripts The vast majority of nonproductive transcripts identified seemed to be the result of either normally occurring out-of-frame VDJ/C -chain and VJ/C -chain or truncated DJ/C or J/C transcripts (Table 6). However, several observations can be made with regard to the relative proportions of the different types of nonproductive transcripts. First, there seemed to be an abundance of TCR J/C as compared with DJ/C nonproductive transcripts. Normally, virtually all truncated  transcripts contain a D to J rearrangement, and thus the TCR J/C transcripts may represent unrearranged alleles.43 Also, most (13 of 18) truncated J/C transcripts lacked 5 signal sequences and the most 5 germline nucleotides. The altered 5 ends, appearing as "broken" transcripts (designated as // in Table 6), could be caused by aborted rearrangements, or alternatively, could be attributable to technical loss during second-strand synthesis (see Materials and Methods). The former possibility is supported by the fact that in virtually all cases, only the most proximal 5 nucleotides of the germline J segment exon were missing, which could represent exonucleolytic loss observed in normal rearrangement processing. Also supporting defective rearrangement mechanisms was an approximately twofold higher number of "broken" nonproductive transcripts within the TCR (13 of 32; 0.41 ratio) than in the TCR (9 of 38; 0.24 ratio) sequences. The increased frequency of broken transcripts in TCR may be a result of twice the number of rearrangement events required at the TCRB locus (D to J plus V to D rearrangements in TCRB v only V to J during TCRA rearrangements). The abundance of TCR J/C transcripts could thus represent unrearranged alleles or aborted rearrangements. Either of these possibilities is consistent with disordered rearrangement mechanisms. A second observation was that few out-of-frame rearrangements were detected at the TCRB locus. Because mechanisms of allelic exclusion normally operate to inhibit V to D rearrangements after a productive TCR chain is translated, this should result in a consistent ratio of out-of-frame to truncated alleles in the surviving T-cell pool. Mathematically, 2 of 3 of nonproductive transcripts should be out-of-frame and 1 of 3 truncated (DJC).43 However, in the presence of disordered or impaired rearrangement mechanisms, the out-of-frame rearrangements would become progressively diminished in proportion (E.G.B., unpublished observation, 1998). The TCR transcripts would be affected much less because of lack of strict allelic exclusion. Thus, the decreased ratio of out-of-frame to truncated rearrangements within the TCR sequences, with relative preservation within the TCR sequences, would also be consistent with disordered rearrangement mechanisms. One of the more interesting findings in several of the patients was the demonstration of abnormal nonproductive transcripts (Tables 6, 7, and 8). These included abnormal insertions of J genes into intronic sequences, inclusion of several contiguous J-region introns and exons within otherwise normally rearranged genes, and disordered splicing of C-region exons and introns. In some cases alternative mRNA splicing mechanisms may have created abnormalities, although none of the atypical transcripts identified were similar to those previously reported.44-46 The inability to detect more illegitimate or abnormally rearranged transcripts may be caused by the targeting of those cells for apoptosis because of persistent double-strand breaks or nonviable translocations. In summary, Omenn's syndrome may arise from different primary defects, the common endpoint being SCID with clinical and pathological features of GvHD caused by an autologous source of T lymphocytes. The immunologic hallmark of this disease is the expansion of an oligoclonal population of T cells. The identification of two patients with congenital malformations consistent with embryological defects of the pharyngeal pouches, one with classic DiGeorge anomaly and Chromosome 22q11 deletion, suggests that primary thymic defects may be the underlying cause in some patients. Other patients with Omenn's syndrome have also been reported to have dysplastic thymi, but whether this is primary or secondary to the disease is unknown.12,47,48 The disordered TCRs identified in the patients described here highlight the possibility that defects previously thought to affect only the development of sufficient numbers of T cells, such as the DiGeorge anomaly, may also produce a qualitative defect in the generation of normal TCRs. Previously, defects in antigen receptor rearrangement were thought to result solely from primary defects in those rearrangement mechanisms, such as those identified in murine SCID. The identification of partial RAG defects in Omenn's patients confirms that primary defects in VDJ recombination causes the thymic dysplasia and abnormal T-cell development in many patients. One of the more intriguing findings in this study was that there were similar abnormalities in the TCRs from the patient with the DiGeorge anomaly. This may imply that intrinsic defects in thymic epithelium may induce abnormalities in TCR rearrangement. Thus, different etiologies may cause Omenn's syndrome, and common endpoints seem to be the oligoclonal expansion of antigen-driven T cells that bear TCRs, which reflect abnormal development and abnormal TCR rearrangement and assembly. The pathological induction of a GvHD-like illness may require defective T-cell development coupled with other unknown environmental and/or host factors to produce Omenn's syndrome.     ACKNOWLEDGMENT We thank Smita Vaidya, PhD for HLA typing; Armond S. Goldman, MD for referral of Case 1; and Harout Dersimonian, PhD and Yasushi Uematsu, MD, PhD for their assistance and protocols in the inverse PCR technique.     FOOTNOTES    Submitted December 17, 1997; accepted September 7, 1998.    Supported by a Clinical Investigator Award, National Institutes of Health K08 AI01064 to E.G.B.    The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact. Address reprint requests to Edward G. Brooks, MD, Child Health Research Center, University of Texas Medical Branch, 301 University Blvd, Galveston TX 77555-0366; e-mail: ebrooks{at}utmb.edu.     REFERENCES Top Abstract Introduction Materials and methods Results and discussion References 1. Omenn GS: Familial reticuloendotheliosis with eosinophilia. N Engl J Med 273:427, 1965 2. Omenn GS: Familial reticuloendotheliosis with eosinophilia: A follow-up. Birth Defects: Original Article Series 7:196, 1971[Medline] [Order article via Infotrieve] 3. Karol RA, Eng J, Cooper JB, Dennison DK, Sawyer MK, Lawrence EC, Marcus DM, Shearer WT: Imbalances in subsets of T lymphocytes in an inbred pedigree with Omenn's syndrome. Clin Immunol Immunopathol 27:412, 1983[Medline] [Order article via Infotrieve] 4. Schofer O, Blaha I, Mannhardt W, Zepp F, Stallmach T, Spranger J: Omenn phenotype with short-limbed dwarfism. J Pediatr 118:86, 1991[Medline] [Order article via Infotrieve] 5. Cavazzana-Calvo M, Le Deist F, De Saint Basile G, Papadopoulo D, De Villartay JP, Fischer A: Increased radiosensitivity of granulocyte macrophage colony-forming units and skin fibroblasts in human autosomal recessive severe combined immunodeficiency. J Clin Invest 91:1214, 1993 6. de Saint-Basile G, Le Deist F, De Villartay JP, Cerf-Bensussan N, Journet O, Brousse N, Griscelli C, Fischer A: Restricted heterogeneity of T lymphocytes in combined immunodeficiency with hypereosinophilia (Omenn's syndrome). J Clin Invest 87:1352, 1991 7. Loechelt BJ, Shapiro RS, Jyonouchi H, Filipovich AH: Mismatched bone marrow transplantation for Omenn syndrome: A variant of severe combined immunodeficiency. Bone Marrow Transplant 16:381, 1995[Medline] [Order article via Infotrieve] 8. Bosma GC, Fried M, Custer RP, Carroll A, Gibson DM, Bosma MJ: Evidence of functional lymphocytes in some (Leaky) scid mice. J Exp Med 167:1016, 1988[Abstract/Free Full Text] 9. Appleton AL, Curtis A, Wilkes J, Cant AJ: Differentiation of materno-fetal GVHD from Omenn's syndrome in pre-BMT patients with severe combined immunodeficiency. Bone Marrow Transplant 14:157, 1994[Medline] [Order article via Infotrieve] 10. Tachinami T, Koizumi S, Yachie A, Yamagami M, Yokoi T, Ohno I, Taniguchi N, Takada I, Kawashima A, Okada Y: Immune status in two brothers with Omenn's syndrome: No discernible chimerism on FACS analysis using a monoclonal antibody specific for a maternally restricted HLA antigen. Am J Pediatr Hematol-Oncol 12:343, 1990[Medline] [Order article via Infotrieve] 11. Villa A, Santagata S, Bozzi F, Giliani S, Frattini A, Imberti L, Gatta L, Ochs H, Schwartz K, Notarangelo L, Vezzoni P, Spanopoulou E: Partial V(D)J recombination activity leads to Omenn Syndrome. Cell 93:885, 1998[Medline] [Order article via Infotrieve] 12. Brooks EG, Wirt DP, Klimpel GR, Vaidya S, Goldblum RM: In vivo and in vitro suppression of T-cell receptor alpha/beta CD4-CD8- T lymphocytes by cyclosporine A. Clin Immunol Immunopathol 67:224, 1993[Medline] [Order article via Infotrieve] 13. Wirt DP, Brooks EG, Vaidya S, Klimpel GR, Waldmann TA, Goldblum RM: Novel T-lymphocyte population in combined immunodeficiency with features of graft-versus-host disease. N Engl J Med 321:370, 1989[Medline] [Order article via Infotrieve] 14. Uematsu Y: A novel and rapid cloning method for the T-cell receptor variable region sequences. Immunogenetics 34:174, 1991[Medline] [Order article via Infotrieve] 15. Rowen L, Koop BF, Hood L: The complete 685-kilobase DNA sequence of the human beta T cell receptor locus. Science 272:1755, 1996[Abstract] 16. Slightom JL, Siemieniak DR, Sieu LC, Koop BF, Hood L: Nucleotide sequence analysis of 77.7 kb of the human V beta T-cell receptor gene locus: Direct primer-walking using cosmid template DNAs. Genomics 20:149, 1994[Medline] [Order article via Infotrieve] 17. Koop BF, Rowen L, Wang K, Kuo CL, Seto D, Lenstra JA, Howard S, Shan W, Deshpande P, Hood L: The human T-cell receptor TCRAC/TCRDC (C alpha/C delta) region: Organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478, 1994[Medline] [Order article via Infotrieve] 18. Arden B, Clark SP, Kabelitz D, Mak TW: Human T-cell receptor variable gene segment families. Immunogenetics 42:455, 1995[Medline] [Order article via Infotrieve] 19. Brooks EG, Wirt DP, Goldblum RM, Vaidya S, Asuncion MT, Patterson JC, Ware CF, Klimpel GR: Double-negative (CD4- CD8-) T cells with an alpha/beta T cell receptor. Non-MHC-restricted cytolytic activity and lymphokine production. J Immunol 144:4507, 1990[Abstract] 20. Brooks EG, Balk SP, Aupeix K, Colonna M, Strominger JL, Groh Spies V: Human T-cell receptor (TCR) alpha/beta + CD4-CD8- T cells express oligoclonal TCRs, share junctional motifs across TCR V beta-gene families, and phenotypically resemble memory T cells. Proc Natl Acad Sci USA 90:11787, 1993[Abstract/Free Full Text] 21. Meyerhans A, Vartanian JP, Wain Hobson S: DNA recombination during PCR. Nucleic Acids Res 18:1687, 1990[Abstract/Free Full Text] 22. Shuldiner AR, Nirula A, Roth J: Hybrid DNA artifact from PCR of closely related target sequences. Nucleic Acids Res 17:4409, 1989[Free Full Text] 23. Jorgensen JL, Esser U, de St Groth BF, Reay PA, Davis MM: Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature 355:224, 1992[Medline] [Order article via Infotrieve] 24. Bjorkman PJ, Davis MM: Model for the interaction of T-cell receptors with peptide/MHC complexes. Cold Spring Harbor Symposia on Quantitative Biology 54:1365, 1989 25. Garcia KC, Degano M, Stanfield RL, Brunmark A, Jackson MR, Peterson PA, Teyton L, Wilson IA: An alpha beta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209, 1996[Abstract/Free Full Text] 26. Garboczi DN, Ghosh P, Utz U, Fan QR, Biddison WE, Wiley DC: Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134, 1997 27. Kayser C, Waase I, Weyand CM, Goronzy JJ: T cell receptor germline gene segments and HLA haplotypes control the length of the CDR3 of human T cell receptor beta chains. Cell Immunol 168:235, 1996[Medline] [Order article via Infotrieve] 28. George JF Jr, Schroeder HW Jr: Developmental regulation of D beta reading frame and junctional diversity in T cell receptor-beta transcripts from human thymus. J Immunol 148:1230, 1992[Abstract] 29. Rock EP, Sibbald PR, Davis MM, Chien YH: CDR3 length in antigen-specific immune receptors. J Exp Med 179:323, 1994[Abstract/Free Full Text] 30. Moss PA, Bell JI: Sequence analysis of the human alpha beta T-cell receptor CDR3 region. Immunogenetics 42:10, 1995[Medline] [Order article via Infotrieve] 31. Gilfillan S, Dierich A, Lemeur M, Benoist C, Mathis D: Mice lacking TdT: Mature animals with an immature lymphocyte repertoire. Science 261:1175, 1993[Abstract/Free Full Text] 32. Melamed I, Cohen A, Roifman CM: Expansion of CD3+CD4-CD8- T cell population expressing high levels of IL-5 in Omenn's syndrome. Clin Exp Immunol 95:14, 1994[Medline] [Order article via Infotrieve] 33. Sneller MC, Straus SE, Jaffe ES, Jaffe JS, Fleisher TA, Stetler Stevenson M, Strober W: A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. J Clin Invest 90:334, 1992 34. Shivakumar S, Tsokos GC, Datta SK: T cell receptor alpha/beta expressing double-negative (CD4-/CD8-) and CD4+ T helper cells in humans augment the production of pathogenic anti-DNA autoantibodies associated with lupus nephritis. J Immunol 143:103, 1989[Abstract] 35. Kahaleh B: Immunologic aspects of scleroderma. Curr Opin Rheumatol 5:760, 1993[Medline] [Order article via Infotrieve] 36. Porcelli S, Yockey CE, Brenner MB, Balk SP: Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- alpha/beta T cells demonstrates preferential use of several V beta genes and an invariant TCR alpha chain. J Exp Med 178:1, 1993[Abstract/Free Full Text] 37. Kubota H, Minato N: T cell development and selection in extrathymic environments. Nippon Rinsho 52:2799, 1994[Medline] [Order article via Infotrieve] 38. Kubota H, Okazaki H, Onuma M, Kano S, Hattori M, Minato N: CD3+4-8- alpha beta T cell population with biased T cell receptor V gene usage. Presence in bone marrow and possible involvement of IL-3 for their extrathymic development. J Immunol 149:1143, 1992[Abstract] 39. Dejbakhsh-Jones S, Jerabek L, Weissman IL, Strober S: Extrathymic maturation of alpha beta T cells from hemopoietic stem cells. J Immunol 155:3338, 1995[Abstract] 40. Makino Y, Koseki H, Adachi Y, Akasaka T, Tsuchida K, Taniguchi M: Extrathymic differentiation of a T cell bearing invariant V alpha 14 J alpha 281 TCR. Int Rev Immunol 11:31, 1994[Medline] [Order article via Infotrieve] 41. Adachi Y, Koseki H, Zijlstra M, Taniguchi M: Positive selection of invariant V alpha 14+ T cells by non-major histocompatibility complex-encoded class I-like molecules expressed on bone marrow-derived cells. Proc Natl Acad Sci USA 92:1200, 1995[Abstract/Free Full Text] 42. Makino Y, Yamagata N, Sasho T, Adachi Y, Kanno R, Koseki H, Kanno M, Taniguchi M: Extrathymic development of V alpha 14-positive T cells. J Exp Med 177:1399, 1993[Abstract/Free Full Text] 43. Malissen M, Trucy J, Jouvin Marche E, Cazenave PA, Scollay R, Malissen B: Regulation of TCR alpha and beta gene allelic exclusion during T-cell development. Immunol Today 13:315, 1992[Medline] [Order article via Infotrieve] 44. Roman S, Ferradini L, Azogui O, Faure F, Hercend T, Triebel F: Alternatively spliced T cell receptor transcripts expressed in human T lymphocytes. Mol Immunol 30:423, 1993[Medline] [Order article via Infotrieve] 45. Ferradini L, Roman S, Azogui O, Genevee C, Viel S, Hercend T, Triebel F: The use of anchored polymerase chain reaction for the study of large numbers of human T-cell receptor transcripts. Mol Immunol 30:1143, 1993[Medline] [Order article via Infotrieve] 46. Hue I, Trucy J, McCoy C, Couez D, Malissen B, Malissen M: A novel type of aberrant T cell receptor alpha-chain gene rearrangement. Implications for allelic exclusion and the V-J recombination process. J Immunol 144:4410, 1990[Abstract] 47. Miller DR: Familial reticulendotheliosis: Concurrence of disease in five siblings. Pediatrics 38:986, 1966[Abstract/Free Full Text] 48. Barth RF, Vergara GG, Khurana SK, Lowman JT, Beckwith JB: Rapidly fatal familial histiocytosis associated with eosinophilia and primary immunological deficiency. Lancet 2:503, 1972[Medline] [Order article via Infotrieve] © 1999 by The American Society of Hematology.   0006-4971/99/9301-0030$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: S.-Y. Wong, C. P. Lu, and D. B. Roth A RAG1 Mutation Found in Omenn Syndrome Causes Coding Flank Hypersensitivity: A Novel Mechanism for Antigen Receptor Repertoire Restriction J. Immunol., September 15, 2008; 181(6): 4124 - 4130. [Abstract] [Full Text] [PDF] B. M. Ogle, L. J. West, D. J. Driscoll, S. E. Strome, R. R. Razonable, C. V. Paya, M. Cascalho, and J. L. Platt Effacing of the T Cell Compartment by Cardiac Transplantation in Infancy J. Immunol., February 1, 2006; 176(3): 1962 - 1967. [Abstract] [Full Text] [PDF] M. S. Lim and K. S.J. Elenitoba-Johnson The Molecular Pathology of Primary Immunodeficiencies J. Mol. Diagn., May 1, 2004; 6(2): 59 - 83. [Full Text] [PDF] D. D. Dudley, J. Sekiguchi, C. Zhu, M. J. Sadofsky, S. Whitlow, J. DeVido, R. J. Monroe, C. H. Bassing, and F. W. Alt Impaired V(D)J Recombination and Lymphocyte Development in Core RAG1-expressing Mice J. Exp. Med., November 3, 2003; 198(9): 1439 - 1450. [Abstract] [Full Text] [PDF] E Hodges, M T Krishna, C Pickard, and J L Smith Diagnostic role of tests for T cell receptor (TCR) genes J. Clin. Pathol., January 1, 2003; 56(1): 1 - 11. [Abstract] [Full Text] [PDF] A. Giovannetti, F. Mazzetta, E. Caprini, A. Aiuti, M. Marziali, M. Pierdominici, A. Cossarizza, L. Chessa, E. Scala, I. Quinti, et al. Skewed T-cell receptor repertoire, decreased thymic output, and predominance of terminally differentiated T cells in ataxia telangiectasia Blood, December 1, 2002; 100(12): 4082 - 4089. [Abstract] [Full Text] [PDF] A Meyer-Bahlburg, J-P Haas, R Haase, U Eschrich, A Wawer, L Frank, W C. Marsch, S Burdach, and G Horneff Treatment with cyclosporin A in a patient with Omenn's syndrome Arch. Dis. Child., September 1, 2002; 87(3): 231 - 233. [Abstract] [Full Text] [PDF] B. Corneo, D. Moshous, T. Gungor, N. Wulffraat, P. Philippet, F. L. Deist, A. Fischer, and J.-P. de Villartay Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome Blood, May 1, 2001; 97(9): 2772 - 2776. [Abstract] [Full Text] [PDF] R. H. Buckley Primary Immunodeficiency Diseases Due to Defects in Lymphocytes N. Engl. J. Med., November 2, 2000; 343(18): 1313 - 1324. [Full Text] [PDF] J. G Ocejo-Vinyals, M.-J. Lozano, P. Sanchez-Velasco, J. E. de Diego, J. E Paz-Miguel, and F. Leyva-Cobian An unusual concurrence of graft versus host disease caused by engraftment of maternal lymphocytes with DiGeorge anomaly Arch. Dis. Child., August 1, 2000; 83(2): 165 - 169. [Abstract] [Full Text] [PDF] J. G. Noordzij, N. S. Verkaik, N. G. Hartwig, R. de Groot, D. C. van Gent, and J. J. M. van Dongen N-terminal truncated human RAG1 proteins can direct T-cell receptor but not immunoglobulin gene rearrangements Blood, July 1, 2000; 96(1): 203 - 209. [Abstract] [Full Text] [PDF] T. Midoro-Horiuti, R. M. Goldblum, A. Kurosky, T. G. Wood, and E. G. Brooks Variable Expression of Pathogenesis-Related Protein Allergen in Mountain Cedar (Juniperus ashei) Pollen J. Immunol., February 15, 2000; 164(4): 2188 - 2192. [Abstract] [Full Text] [PDF] S. Signorini, L. Imberti, S. Pirovano, A. Villa, F. Facchetti, M. Ungari, F. Bozzi, A. Albertini, A. G. Ugazio, P. Vezzoni, et al. Intrathymic Restriction and Peripheral Expansion of the T-Cell Repertoire in Omenn Syndrome Blood, November 15, 1999; 94(10): 3468 - 3478. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Brooks, E. G. Articles by Goldblum, R. M. Search for Related Content PubMed PubMed Citation Articles by Brooks, E. G. Articles by Goldblum, R. M. Related Collections Immunobiology Social Bookmarking                   What's this?

	Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020