|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 1 (January 1), 1999:
pp. 293-299
ETV6-AML1 Translocation Breakpoints Cluster Near a Purine/Pyrimidine
Repeat Region in the ETV6 Gene
By
Srinivas P. Thandla,
Jonathan E. Ploski,
Samina Z. Raza-Egilmez,
Pradheepkumar P. Chhalliyil,
AnneMarie W. Block,
Pieter J. de Jong, and
Peter D. Aplan
From the Departments of Cancer Genetics, Pediatrics, Immunology,
Clinical Cytogenetics, Roswell Park Cancer Institute; and the
Department of Pediatric Hematology-Oncology, Children's Hospital of
Buffalo, Buffalo, NY.
 |
ABSTRACT |
The t(12;21)(p13;q22) translocation, fusing the ETV6 and
AML1 genes, is the most frequent chromosomal translocation
associated with pediatric B-cell precursor acute lymphoblastic
leukemia. Although the genomic organization of the ETV6 gene
and a breakpoint cluster region (bcr) in ETV6 intron 5 has been
described, mapping of AML1 breakpoints has been hampered
because of the large, hitherto unknown size of AML1 intron 1. Here, we report the mapping of the AML1 gene between exons 1 and 3, cloning of ETV6-AML1 breakpoints from different
patients, and localization of the AML1 breakpoints within
AML1 intron 1. In contrast to the tightly clustered ETV6 breakpoints, the AML1 breakpoints were found to be
dispersed throughout AML1 intron 1. Although nucleotide
sequence analysis of the breakpoint junctions showed several 5/7
matches for the V(D)J consensus heptamer recognition
sequence, these matches were present only on the ETV6 alleles
and not on the AML1 alleles, making it unlikely that the translocations were mediated by a simple V(D)J recombination mistake. Interestingly, several breakpoints as well as a stable insertion polymorphism mapped close to a polymorphic, alternating
purine-pyrimidine tract in the ETV6 gene, suggesting that this
region may be prone to DNA recombination events such as insertions or
translocations. Finally, the presence of an insertional polymorphism
within the ETV6 bcr must be recognized to avoid incorrect
genotype designation based on Southern blot analysis.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
CHROMOSOMAL TRANSLOCATIONS occur in a
recurrent and nonrandom fashion in many patients with acute leukemia.
The biological relevance of these translocations is underscored by the
fact that a number of known and putative proto-oncogenes have been
identified through the study of genes located at these translocation
breakpoints.1-3 Further characterization of
these translocations on a molecular level has led to insights into the
mechanism(s) which generate these translocations, as well as the
role(s) of the genes involved in producing the malignant
phenotype.1-3 Additionally, clinical studies of patients
with specific nonrandom translocations have aided oncologists in
devising risk-specific therapy, and, in some instances, identifying
molecular markers for tracking minimal residual disease.4-6
The ETV6 gene (also known as TEL) was first identified
in a patient with chronic myelomonocytic leukemia and a
t(5;12)(q33;p13) which involved ETV6 and
PDGFR .7 Since that time, additional translocations involving ETV6, namely
t(3;12)(q26;p13),8,9 t(9;12)(q34;p13),10
t(12;22)(p13;q11),11 and t(12;21)(p13;q22)12-15 translocations which fuse ETV6 with MDS1/EVI1, ABL,
MN1, and AML1/CBFA2, respectively, have been described in
both myeloid and lymphoid malignancies.
Although both an ETV6-AML1 fusion and an AML1-ETV6
fusion may potentially be produced by the t(12;21) translocation,
reverse transcriptase polymerase chain reaction (RT-PCR)
analysis has consistently shown the presence of the ETV6-AML1
transcript, transcribed from the der(21), in all cases with the
t(12;21),16 whereas the reciprocal AML1-ETV6
transcript is not universally found in these patients. The former
protein is therefore thought to play a role in
leukemogenesis.17 The ETV6-AML1 transcript fuses
ETV6 exons 1 through 5 with AML1 exons 2 through 8 and
encodes a protein that contains the amino-terminal portion of the
ETV6 protein, including the putative helix loop helix (HLH)
domain, fused to amino acids 20-480 of the AML1c
protein.17 The ETV6-AML1 fusion transcript is
detected in about 17% to 25% of pediatric B-cell precursor acute
lymphoblastic leukemia (ALL) patients, making it the most common
nonrandom, recurrent translocation associated with childhood
ALL.18,19 Furthermore, a frequent loss of the normal,
untranslocated ETV6 allele has been described by several authors, raising the possibility that ETV6 may function as a
tumor suppressor gene.19
The precise molecular mechanisms leading to chromosomal translocations
remain largely unknown. In some cases there is compelling evidence that
the translocation is caused by mistakes in normal V(D)J recombinase
activity as evidenced by the presence of cryptic heptamer/nonamer
sequences, the addition of nontemplated "N-region" nucleotides at
the breakpoints, and by exonucleolytic deletion of germline nucleotides
at these breakpoint junctions.20,21 In other
translocations, homologous recombination between Alu repeats has been
implicated; this mechanism is almost certainly involved in producing
the partial tandem duplication of MLL.22 In
addition, a number of epidemiological studies have implicated the
therapeutic use of topoisomerase II inhibitors, especially the
epipodophyllotoxins etoposide and teniposide, in the generation of
MLL and AML1 translocations associated with
therapy-related acute myeloid leukemia.23 Finally, a
handful of chromosomal translocations have been found near regions of
DNA containing alternating purine and pyrimidine nucleotides (pu/py
tracts), leading some investigators to speculate that these pu/py
tracts may be regions of the genome that are predisposed to chromosomal rearrangements.24-26
Although a number of investigators have clearly shown that the t(12;21)
is the most frequent chromosomal translocation associated with B-cell
precursor ALL, until very recently,27 none of these translocation breakpoints had been cloned and characterized at the
nucleotide sequence level. Characterization of ETV6-AML1
genomic breakpoints has been hampered because of the large (estimated at >100 kb) first intron of the AML1 gene.17,28
Because most ETV6-AML1 fusion mRNAs join ETV6 exon 5 to
AML1 exon 2, it has been presumed that the AML1
breakpoints occur within AML1 intron 1.17,28
However, it is not known whether the AML1 breakpoints are
clustered within this large intron; indeed, the single
ETV6-AML1 breakpoint reported was not localized with respect to
the AML1 intron-exon structure.27 To gain some
insight into the potential mechanism that generated these
translocations, and to determine if the breakpoints are tightly
clustered, we cloned and sequenced the ETV6-AML1 breakpoints
from several different patients.
| |
MATERIALS AND METHODS |
Preparation and analysis of genomic DNA.
Informed consent to participate in research studies was obtained in
accordance with institutional guidelines. Leukemic blasts from bone
marrow of patients with acute leukemia were isolated by Ficoll-Hypaque
(Sigma, St Louis, MO) density centrifugation. Genomic DNA was isolated
by using a salting out procedure as described.29 Ten
micrograms of genomic DNA was digested with the indicated restriction
enzyme (GIBCO-BRL, Gaithersburg, MD), size fractionated on 0.8%
agarose gels containing 1 µg of ethidium bromide/mL, photographed, denatured, neutralized, and transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH) by the Southern
technique.30,31 DNA was immobilized by ultraviolet
cross-linking.
P1-derived artificial chromosome (PAC) clone isolation
and analysis.
The RPCI 5 human PAC library was screened with a 0.7-kb
EcoRI-SmaI AML1 cDNA probe (nucleotides 1 to 704 of
GenBank accession no. D43969) encompassing AML1 exons 1, 2, and
3.32 Single colonies of the hybridizing PAC clones were
grown in 3 mL Luria-Bertani (LB) broth with 25 µg/mL of
kanamycin and PAC DNA was isolated by a modification of Qiagen
protocol.33 Restriction enzyme digests and Southern blot
transfer were performed as described above for genomic DNA. Field
inversion gel electrophoresis was performed to separate large molecular
weight fragments (25 to 150 kb), using 1% agarose, 0.5× TBE (45 mmol/L Tris, 45 mmol/L Borate, 1.0 mmol/L EDTA, pH 8.3),
with a forward vector of 180 V, a reverse vector of 120 V,
switch time of 0.4 to 3.5 seconds, and linear shape, for 20 hours at
room temperature.
Hybridization and probes.
Probes used to screen patient samples were a 0.9-kb SstI-BamHI ETV6
cDNA (nucleotides 673 to 1580 of GenBank accession no. U11732) encompassing ETV6 exons 5 through 8, a 0.3-kb
MluI-BamHI ETV6 cDNA (nucleotides 813 to 1142 of
GenBank accession no. U11732) encompassing ETV6 exons 5 and 6, several single copy AML1 genomic fragments mapping to AML1
intron 1 (0.3 BR, 0.3 BSca, 0.6 BS, and 0.9 BR), and ETV6-AML1
genomic fusion fragments from each patient. When necessary, reiterated
sequences were suppressed by prehybridization to human placental DNA
(Sigma) at 65°C for 2 to 4 hours. Southern blots were hybridized to
32P probes labeled by the random priming technique, using a
Prime-It II kit (Stratagene, La Jolla, CA) according to
the manufacturer's protocol. Oligonucleotides were labeled using a
terminal deoxynucleotidyl transferase end-labeling
technique,30 and hybridization performed as previously
described30; the blots were washed twice with 0.1×
SSC (1× SSC is 0.15 mol/L sodium chloride and 0.015 mol/L sodium
citrate) and 0.1% sodium dodecyl sulfate (SDS) at
52°C for random primed DNA fragments or with 6× SSC and 0.1%
SDS at 10°C below the melting temperature (Tm) for
oligonucleotide probes. Autoradiography of the blots was performed at
 70°C with an intensifying screen.
Fluorescence in situ hybridization (FISH) analyses.
Bone marrow cells stored at 20°C in 3:1 methanol:glacial
acetic acid were dropped on microscope slides and air-dried. FISH was
performed using the Hybrite hybridization system (Vysis, Downers Grove,
IL), which combines denaturation of the probe solution and specimen. Briefly, a mixture of LSI TEL/AML1 ES probe (Vysis), specimen hybridization buffer, and water were applied to the slide target area, coverslipped, and denatured at 75°C (1 minute), and hybridized overnight at 37°C in a Hybrite unit. After
hybridization, the coverslips were removed and slides were washed in
successive washes of 0.4× SSC/0.3% NP-40 (73°C) and 2×
SSC/0.1% NP-40 (room temperature). Slides were air-dried in darkness.
Cells were counterstained with 4 -6-diamine-2-phenylindole
dihydrochloride (DAPI) and analyzed by fluorescence microscopy using a
triple-band pass filter for DAPI, SpectrumGreen, SpectrumOrange.
Representative cells were photographed with a computer-based imaging
system (Perceptive Scientific Instruments, Inc, League City,
TX).
Genomic library construction.
Genomic DNA (10 µg) was digested to completion with BamHI,
extracted with phenol-chloroform, ethanol precipitated, and used without further size fractionation. In a total volume of 5 µL at
14°C for 16 hours, 0.2 to 0.6 µg of BamHI-digested
genomic DNA was ligated to 1 µg of BamHI-digested  DASH II
(Stratagene) phage arms. Recombinant phage DNA was packaged using
Gigapack III Gold (Stratagene) extracts and protocols. Five to 10 × 105 recombinant phages were plated with XL-1Blue
MRA (Stratagene) cells and incubated at 37°C. Filter lifts,
hybridization, and plaque purification were performed as
described.30
DNA sequence analysis.
Relevant genomic fragments were subcloned into plasmid vectors
(pBluescript II; Stratagene) and sequenced using either an automated
sequencer (ABI PRISM model no. 373A Stretch; Perkin Elmer, Norwalk,
CT) or manual sequencing with Sequenase reagents and
protocols. When necessary, oligonucleotide primers were synthesized on
an oligonucleotide synthesizer (model no. 394; Applied Biosystems, Foster City, CA).
| |
RESULTS |
Screening of patient samples for ETV-6 rearrangements.
Because most of the ETV6-AML1 rearrangements seem to occur
within a 20-kb genomic fragment of the ETV6 gene,14
we screened 92 patients with childhood acute leukemia for ETV6
gene rearrangements using an ETV6 cDNA probe. Southern blots of
genomic DNA extracted from leukemic blasts were screened with a 0.9-kb
SstI-BamH1 ETV-6 cDNA probe containing sequences from
exons 5 to 8 (nucleotides 673 to 1580 of GenBank accession no. U11732).
With the above probe, two germline fragments of 20 kb and 7 kb were
identified on a BamHI digest. As shown in
Fig 1, one or two rearranged fragments can
be detected in lymphoblasts from patients 67, 55, 44, 46, 16, 23, 37, 41, and 45. In patient 41 (as we show later) there were two 20-kb
fragments that represented the germline ETV6 fragment, and a rearranged
fragment that comigrated with the germline fragment. We hybridized
Southern blots from the same patients to a 329-bp MluI-BamHI
ETV6 cDNA fragment that contained exon 5 and 6 sequences (nucleotides 813 to 1142). This probe identified the 20-kb germline ETV6 fragment and the same rearranged fragments identified by the previous probe, indicating that all the ETV6 rearrangements identified with the exon 5 to 8 probe were located within this 20-kb
BamHI fragment. In total, 13 patients with ETV6 gene
rearrangements were identified; all of these patients had B-cell
precursor ALL. Therefore, 13/92 or 14% of the entire sample, and 13/68
or 20% of the patients with B-cell precursor ALL had ETV6 gene
rearrangements. This frequency (20%) is similar to that found in other
series of childhood B-cell precursor ALL.34
View larger version (76K):
[in this window]
[in a new window]
| Fig 1.
ETV6 gene rearrangements in patient samples.
Southern blot of BamHI-digested genomic DNA hybridized to the
0.9-kb ETV6 cDNA probe. Size standards are in kb. The
unique patient numbers are indicated above each lane. Lane 10 contains
DNA from a leukemic patient without an ETV6 gene rearrangement.
Twenty-kb and 7-kb bands represent germline ETV6 fragments;
rearranged fragments representing ETV6 translocations can be
identified in all samples except no. 10.
|
|
FISH analyses of patient samples.
To confirm that the other partner in these translocations was
AML1, we performed FISH analyses on interphase nuclei from
patient samples for which interphase preparations were available. The probes used consisted of a 350-kb ETV6 genomic probe
encompassing exons 1A to 3, labeled with SpectrumGreen, and a 500-kb
AML1 probe encompassing the entire AML1 gene, labeled with
SpectrumOrange. Figure 2 shows
hybridization signals from the germline ETV6 allele (green),
the germline AML1 allele (orange), the derivative 21 containing
the ETV6-AML1 fusion (yellow), and the
derivative 12, also as orange. The derivative 12 does not appear yellow
because the fusion occurs centromeric to the ETV6 region (exons
1A to 3) encompassed by the ETV6 probe.
View larger version (195K):
[in this window]
[in a new window]
| Fig 2.
FISH of interphase nuclei from lymphoblasts of patient
55. The germline ETV6 allele is seen as a green signal,
germline AML1 as orange, derivative 21 (ETV6-AML1
fusion) as yellow, and the derivative 12 (AML1-ETV6 fusion)
also as orange.
|
|
Construction of an AML1 germline map in the region of AML1 exons 1 to
3.
RT-PCR experiments have shown that ETV6-AML1 fusion cDNAs
usually result from ETV6 exon 5 splicing to AML1 exon
2, or, less commonly, to AML1 exon 3.17,18 The
AML1 breakpoints in the t(12;21) translocation are therefore
thought to lie in the 5 end of the AML1 gene, most
likely between exons 1 and 2. Because the genomic organization of the
AML1 gene has not been completely characterized, we developed
an AML1 PAC clone contig of this region. We screened the RPCI 5 human genomic PAC library with an AML1 cDNA probe containing
exon 1, 2, and 3 sequences (nucleotides 1 to 718 of GenBank accession
no. D43969). Using multiple restriction enzyme digests and Southern
blot hybridization to selected probes, a PAC contig of six overlapping
clones was constructed. Of these, four contained exon 1 sequences but
not exon 2 sequences, and two contained exon 2 and 3 sequences but not
exon 1 sequences; no single clone contained both exon 1 and exon 2 sequences. Two of these clones, PAC 1027, containing exon 1 sequences,
and PAC 970, containing exon 2 and 3 sequences, overlapped as shown in Fig 3 and were chosen for construction of
an AML1 germline map. Using multiple restriction enzyme digests
of the above two PAC clones and a combination of pulsed field gel and
conventional agarose gel electrophoresis as well as hybridization to
selected probes, we constructed a map of the AML1 gene as shown
in Fig 3. Exons were localized using an AML1 exon 1 cDNA (0.5-kb EcoRI-NsiI) fragment, an exon 2 oligonucleotide
(5TGCATACTTGGAATGAATCCTTCTAG AGAC 3), and an
exon 3 oligonucleotide (5 TGAGCCCAGGCAAGATGAGC 3) as probes. The large intron between AML1 exon 1 and
exon 2 was determined to be approximately 165 kb.
View larger version (6K):
[in this window]
[in a new window]
| Fig 3.
Restriction map of the AML1 gene. Chromosomal
orientation from telomere to centromere is as indicated. Exons 1, 2, and 3 are shown as solid boxes ( ). The location of the
breakpoints in different patients is indicated by a bracket.
Restriction enzyme sites are C, ClaI; M, MluI ; N,
NotI; and S, SalI. The two overlapping P1 artificial
chromosome clones containing either AML1 exon 1 or exon 2 and 3 are depicted below the AML1 restriction map.
|
|
Cloning and localization of the ETV6-AML1 breakpoints.
We chose to clone and characterize the ETV6-AML1 genomic
breakpoints from 4 of the 13 patients identified with ETV6 gene
rearrangements. Patient-specific genomic DNA libraries were constructed
by cloning BamH1-digested genomic DNA into the DASH II
vector. Five to 10 × 105 recombinant phages were
screened with the 329-bp MluI-BamHI ETV6 cDNA probe.
Independent hybridizing plaques were identified and purified. The phage
inserts were subcloned into plasmids, restriction mapped, and sequenced
from both ends to identify plasmids with either the ETV6
germline allele or rearranged inserts representing either the
derivative 12 or derivative 21 alleles.
To rapidly identify and subclone the germline AML1 fragment
involved in each translocation, we hybridized the cloned, rearranged ETV6-AML1 genomic fragments to Southern blots of
BamHI-digested AML1 PAC clones. Reiterated sequences in
the probes were suppressed by prehybridization with human placental
DNA. Using this technique, a single genomic AML1 BamHI fragment
was identified from each patient. The fragment was gel purified,
subcloned into plasmid vectors, and mapped with restriction enzymes.
The regions that corresponded to the breakpoints were then sequenced.
In this manner, we were able to clone and sequence the derivative 21 breakpoint from all four selected patients. In addition, we were able
to clone and sequence the derivative 12 breakpoint from two patients;
we were not able to recover the derivative 12 allele from the remaining
two patients. Figure 3 shows the location of the AML1
breakpoints in these four patients with respect to AML1 exons
1, 2, and 3. The AML1 breakpoints in patients 23 and 55 were in
a 6-kb BamHI fragment within intron 1 located approximately 40 kb upstream of exon 2 (Fig 3). In patient 44, the AML1
breakpoint occurred within a 7-kb germline BamHI fragment
containing AML1 exon 2 sequences, whereas patient 41 had an
AML1 breakpoint directly downstream of exon 1 as indicated in
Fig 3. Therefore, three out of four patients studied had AML1
breakpoints within a 40-kb region of intron 1.
To determine if the AML1 breakpoints from our 13 patients were
tightly clustered near any of these four breakpoints, we hybridized single-copy AML1 genomic probes (0.3 BSca near breakpoint of
patient 41, 0.6 BS and 0.3 BR near breakpoints of patients 23 and 55, and 0.9 BR near breakpoint of patient 44; Fig 3) derived from these
four breakpoints to Southern blots of BamHI- and
HindIII-digested genomic DNA from our 13 patients. Of the four
probes used, only the 0.3 BR probe was able to identify rearranged
fragments in more than one sample; this AML1 genomic probe
identified rearranged fragments in two patients (patients 23 and 55).
As mentioned above, we were able to clone both germline alleles and
both derivative alleles from two patients (patients 41 and 44). The
four relevant alleles from patient 41 are shown in Fig 4, and show that this translocation was
actually a translocation-deletion with portions of both ETV6
and AML1 being deleted (see below).
View larger version (16K):
[in this window]
[in a new window]
| Fig 4.
Restriction map of germline ETV6 (GL ETV6),
germline AML1 (GL AML), and the derivative 12 (DER 12) and
derivative 21 (DER 21) alleles from patient 41. ETV6 exons are
shown as solid boxes (). ETV6 is depicted as a straight
line; AML1 is crosshatched ( ). The open boxed area ( )
depicted at the breakpoint junction in the two derivative alleles
represents a deletion of 540 bp of the ETV6 gene and 165 bp of
the AML1 gene observed in this patient. Restriction enzyme
sites are B, BamHI; G, BglII; R, EcoRI; S,
SstI; M, MluI; H, HindIII; and Sc, ScaI
.
|
|
ETV6 breakpoints have previously been reported to cluster in a
5.6-kb EcoRI fragment within ETV6 intron
5.8 In two of our four patients, at least one breakpoint
occurred within this fragment. However, in the other two patients, the
ETV6 breakpoint was either 2 kb centromeric (patient 23) or 1.7 kb telomeric (patient 55) to this region.
Sequence characteristics in the vicinity of the breakpoints.
The nucleotide sequences flanking each of the breakpoints was
determined on each derivative and germline allele through sequence analysis of relevant portions of plasmid subclones. In patients 44 and
41, both derivative alleles were cloned and sequenced. Close analysis
of the nucleotide sequence showed that these were not perfectly
reciprocal translocations, and that both patients had a variable number
of nucleotides deleted at the breakpoints from both the ETV6
and the AML1 genes. Patient 41 had 540 nucleotides of
ETV6 deleted and 165 nucleotides of AML1 deleted;
patient 44 had 659 nucleotides of ETV6 deleted and 205 nucleotides of AML1 deleted.
Several unique sequence characteristics found in the ETV6 gene
near the breakpoints are depicted in the map in
Fig 5; sequences flanking the breakpoints
in the four different patients studied are shown in
Fig 6. A nucleotide sequence consisting of
alternating purine and pyridimine nucleotides (a pu/py tract) was found
in ETV6 intron 5 within the breakpoint cluster region. Of six
alleles that were sequenced through this region, the length of this
tract varied from 206 to 233 nucleotides, indicating that this tract undergoes expansions and contractions. The nucleotide sequence of the
pu/py tract was identical in three of these six alleles and single
nucleotide polymorphisms in the nucleotide sequence was observed in the
remaining three. However, in the latter three, the single nucleotide
polymorphisms were all G  A or T C changes that maintained the
integrity of the alternating pu-py tract.
View larger version (10K):
[in this window]
[in a new window]
| Fig 5.
Map of the ETV6 gene between exon 5 and 6 containing the ETV6 breakpoint cluster region (bcr).
Chromosomal orientation from telomere to centromere is as indicated.
Exons 5 and 6 are shown as solid boxes. The breakpoints in the
different patients are shown as downward arrows with the patient
identification numbers marked above. Patients 41 and 44 have two
breakpoints each, designated 41a and 41b, and 44a and 44b,
respectively. The portion of the gene between these breakpoints is
deleted in each patient. Only the derivative 21 was cloned from
patients 23 and 55. The 0.3-kb area in the ETV6 gene, shown as
a speckled box, represents a pu/py repeat region. The 0.7-kb region
depicted by the triangle is a deletion/insertion polymorphism in the
ETV6 gene. Restriction enzyme sites are B,
BamHI; G, BglII; R, EcoRI;
S, SstI; M, MluI; H,
HindIII and X, XbaI. The 1.3-kb
SstI-XbaI probe used to identify the deletion/insertion
polymorphism on Southern blot is indicated .
|
|
View larger version (37K):
[in this window]
[in a new window]
| Fig 6.
Sequences flanking the breakpoints in four patients with
ETV6-AML1 rearrangements. RUPN refers to unique patient number.
Sequences from the ETV6 germline (GL ETV6), AML1
germline (GL AML1), and the two derivatives, derivative 12 (DER 12) and
derivative 21 (DER 21), are shown. Nontemplated nucleotides are shown
in lower case. Nucleotide sequences with at least a 5/7 match to the
consensus V(D)J heptamer recognition sequence (CAC A/T GTG) are shown
with asterisks.
|
|
One of the breakpoints found in lymphoblasts from patient 41 occurred
within this pu/py tract, whereas the other breakpoint from this
patient's lymphoblasts was 316 nucleotides 5 of this tract.
Similarly, the ETV6 breakpoints in patient 44 were 726 nucleotides (44a of Fig 5) and 67 nucleotides (44b of Fig 5) 5 of the pu/py tract. The ETV6 sequence between the corresponding breakpoints was found to be deleted in each patient (540 nucleotides deletion in patient 41, 659 nucleotides deletion in patient 44). Of
interest, a deletion/insertion polymorphism resulting in a deletion of
738 nucleotides with respect to the published ETV6 sequence
(nucleotide 31601 to 32338 of GenBank accession no. U61375 ) was found
in the ETV6 gene 172 nucleotides telomeric to the pu/py tract
(Fig 5). This seems to be a stable polymorphism; of the six germline
and rearranged ETV6 alleles that we characterized, three had
this sequence and three did not.
Analyses of the nucleotide sequences from the germline ETV6 and
AML1 alleles in the vicinity of the breakpoints showed several additional features. There were 5/7 matches for "cryptic" V(D)J heptamer signal sequences in the four patients studied as indicated in
Fig 6. No nonamer-like sequences were found. Additionally, there were
nontemplated nucleotides added at the translocation fusion sites in
these three patients reminiscent of "N-region" nucleotide
addition that is known to occur in physiological V(D)J recombination.
Lastly, in addition to the pu/py tract in the ETV6 gene, an
alternating "TGGA" repeat region of 225 bp was found at one of
the AML1 gene breakpoints from patient 41.
| |
DISCUSSION |
Characterization of chromosomal translocation breakpoints at a
molecular level has resulted not only in identifying known and
potential proto-oncogenes, but has also provided valuable information
regarding the possible mechanisms that cause these chromosomal
rearrangements. Whereas the genomic organization of a large part of the
ETV6 gene, including a t(12;21) breakpoint cluster region, has been
described,35 clustering of the AML1 breakpoints has
not been reported. In fact, until now, the precise size of AML1
intron 1 was not known.17 With the data presented in this
paper we report mapping of the AML1 gene between exons 1 and 3, localization of the t(12;21) breakpoints in this region, and
characterization of the nucleotide sequence flanking breakpoints in
both the ETV6 and AML1 genes.
We identified and characterized overlapping PAC clones spanning the
AML1 gene from exons 1 through 3. AML1 intron 1 is
large and spans approximately 165 kb. Most of the t(12;21) breakpoints have been thought to occur in intron 1, based on the observation that
ETV6-AML1 fusion cDNAs fuse ETV6 exon 5 to AML1
exon 2; a minority of ETV6-AML1 fusion cDNAs fuse ETV6
exon 5 to AML1 exon 3,28 leading to speculation
that these might arise from patients who have AML1 breakpoints
within intron 2. All of the 4 patients who we characterized had
breakpoints within intron 1; 3 out of 4 were in a 40-kb region of
intron 1 immediately 5 of exon 2. When we screened our panel of
13 patients for breakpoint clustering, we were unable to detect tight
clusters near any of the breakpoints we identified.
To gain insight into the mechanism of ETV6-AML1 translocations,
we cloned and sequenced breakpoints from individual patients. Illegitimate V(D)J recombination is a well-known cause for chromosomal translocations resulting in juxtaposition of an immunoglobulin (Ig) or
T-cell receptor (TCR) gene to a proto-oncogene; in many translocations
involving Ig or TCR genes, "cryptic" V(D)J heptamer and nonamer
consensus sequences in the immediate vicinity of the breakpoint can be
found.20,21 Although we found features that suggested that
illegitimate V(D)J recombination might occur in this region, the
evidence for illegitimate V(D)J recombinase activity was not as
convincing as that observed in more compelling cases.20,21 Significant similarity to the V(D)J heptamer consensus sequence (CACA/TGTG) was found near breakpoints of all of our patients, but only
on the ETV6 side of the breakpoints; no heptamer sequences were found
near the AML1 breakpoint regions. Nontemplated nucleotides were added
at the breakpoint junction in the derivative chromosomes; however, this
feature, although regarded as a hallmark of normal V(D)J recombination,
is not an exclusive feature of V(D)J recombinase activity.
One of the AML1 breakpoints from patient 41 occurred within a 225-bp
(TGGA)n repeat region. Tetranucleotide repeats such as (AGGC)n, (TCTG)n, and (TGGA)n have
previously been identified at recombination hotspots within the HLA
class II region, and it has been speculated that this
(TGGA)n repeat may predispose DNA to recombination
events.36
We also identified a pu/py tract in the vicinity of several breakpoints
in the ETV6 gene. Additionally, the single genomic ETV6-AML1 genomic fusion previously reported is also within
this pu/py tract.27 Boehm et al24 have
described the presence of pu/py tracts in proximity to some
translocation breakpoints and have speculated that DNA at these sites
may exist in a Z-DNA conformation which then leads to increased
recombination frequency. This contention was supported by the existence
of DNAse I hypersensitive sites adjacent to pu/py
tracts24 in that study. Interestingly, we found a 738-bp
deletion with respect to the published ETV6 gene sequence in
the ETV6 gene immediately 5 to the pu/py tract; this has
recently been reported as a stable polymorphism in the ETV6 gene.35 Therefore it would seem that this pu/py tract
within the ETV6 gene is a hotspot for recombination events,
including insertions/deletions as well as chromosomal translocations.
Additionally, (CA)n repeat regions are well known to
undergo expansion and contraction both in vivo and in vitro presumably
because of "stuttering" of DNA polymerases.37,38
Intriguingly, triplet repeat regions on plasmid templates have recently
been shown to be site of replication fork pausing in Escherichia
coli,39 raising the possibility that these nucleotide
repeat regions may be more accessible to recombination events caused by
replication fork pausing.
Recently, several investigators have noted that patients with B-cell
precursor ALL and an ETV6-AML1 fusion have an improved prognosis, and have recommended that these patients be treated with
regimens that emphasize antimetabolite chemotherapy.5,6 If
patients are to be stratified for therapeutic purposes based on
ETV6 gene rearrangements, it is important to emphasize the insertional polymorphism that occurs within the ETV6 breakpoint cluster region, to prevent patients from being incorrectly genotyped.
We have shown that the AML1 breakpoints in the t(12;21) occur
in the large intron 1 of this gene; the ones we have characterized are
dispersed throughout intron 1. The breakpoints in the ETV6 gene
most commonly occur in a region of intron 5 close to a pu/py tract.
Although characteristics of DNA sequence in the region of the
breakpoints such as cryptic heptamer signal sequences and nontemplated
nucleotide addition suggest that recombination may be mediated in part
by aberrant V(D)J recombinase activity, the lack of precise clustering
argues against this possibility. Intriguingly, several breakpoints as
well as a stable insertion polymorphism mapped near an extended
polymorphic pu/py repeat region, suggesting that this region may be
predisposed to DNA breakage-religation events, including chromosomal
translocations.
| |
ACKNOWLEDGMENT |
We thank the staff of the RPCI Biopolymer facility, Thomas Isac for
oligonucleotide synthesis, and Michelle Detwiler for sequencing. We
thank Elena Greco for illustrations. We also thank Dr Gary Gilliland
for providing the ETV6 cDNA and Dr Misao Ohki for the AML1
cDNA.
| |
FOOTNOTES |
Submitted June 10, 1998;
accepted September 2, 1998.
Supported in part by grants from the Roswell Park Alliance Foundation,
the National Institutes of Health (CA 73773), and a 1997 Developmental
Fund award from the Roswell Park Cancer Center Support Grant (CA16056)
to P.D.A. and HG01165 to P.J.D. P.D.A. is a scholar of the Leukemia
Society of America.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Peter D. Aplan, MD, Department of
Pediatrics, Roswell Park Cancer Institute, Buffalo, NY 14263; e-mail:
paplan{at}sc3101.med.buffalo.edu.
| |
REFERENCES |
1.
Rabbitts TH:
Chromosomal translocations in human cancer.
Nature
372:143, 1994[Medline]
[Order article via Infotrieve]
2.
Cline MJ:
The molecular basis of leukemia.
N Engl J Med
330:328, 1994[Free Full Text]
3.
Thandla S, Aplan PD:
Molecular biology of acute lymphocytic leukemia.
Semin Oncol
24:45, 1997[Medline]
[Order article via Infotrieve]
4.
Campana D, Pui C-H:
Detection of minimal residual disease in acute leukemia. Methodologic advances and clinical significance.
Blood
85:1416, 1995[Free Full Text]
5.
Rubnitz JE, Downing JR, Pui C, Shurtleff SA, Raimondi SC, Evans WE, Head DR, Crist WM, Rivera GK, Hancock ML, Boyett JM, Buijs A, Grosveld G, Behm FG:
TEL gene rearrangement in acute lymphoblastic leukemia: A new genetic marker with prognostic significance.
J Clin Oncol
15:1150, 1997[Abstract/Free Full Text]
6.
Rubnitz JE, Shuster JJ, Land VJ, Link MP, Pullen DJ, Camitta BM, Pui C, Downing JR, Behm FG:
Case-control study suggests a favorable impact of TEL rearrangement in patients treated with antimetabolite-based therapy: A Pediatric Oncology Group study.
Blood
89:1143, 1997[Abstract/Free Full Text]
7.
Golub TR, Barker GF, Lovett M, Gilliland DG:
Fusion of PDGFR receptor beta to a novel ets-like gene, TEL, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation.
Cell
77:307, 1994[Medline]
[Order article via Infotrieve]
8.
Raynaud SD, Baens M, Grosgeorge J, Rodgers K, Reid CDL, Dainton M, Dyer M, Fuzibet JG, Gratecos N, Taillan B, Ayraud N, Marynen P:
Fluorescence in situ hybridization analysis of t(3;12)(q26;p13): A recurring chromosomal abnormality involving the TEL gene (ETV6) in myelodysplastic syndromes.
Blood
88:682, 1996[Abstract/Free Full Text]
9.
Peeters P, Wlodarska I, Baens M, Criel A, Selleslag D, Hagemeijer A, Van der Berghe H, Marynen P:
Fusion of ETV6 to MDS1/EVI1 as a result of t(3;12)(q26;p13) in myeloproliferative disorders.
Cancer Res
57:564, 1997[Abstract/Free Full Text]
10.
Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM:
The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res
55:34, 1995[Abstract/Free Full Text]
11.
Buijs A, Sherr S, van Baal S, van Bezouw S, van der Plas D, van Kessel AG, Riegman P, Deprez RL, Zwarthoff E, Hagemeijer A, Grosveld G:
Translocation (12;22)(p13;q11) in myeloproliferative disorders results in fusion of the ETS-like TEL gene on 12p13 to the MN1 gene on 22q11.
Oncogene
10:1511, 1995[Medline]
[Order article via Infotrieve]
12.
Golub TR, Barker FG, Bohlander SK, Heibert SW, Ward DC, Bray-Ward P, Morgan E, Raimondi SC, Rowley JD, Gilliland DG:
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92:4917, 1995[Abstract/Free Full Text]
13.
Romana SP, Le Coniat M, Berger R:
t(12;21): A new recurrent translocation in acute lymphoblastic leukemia.
Genes Chromosomes Cancer
9:186, 1994[Medline]
[Order article via Infotrieve]
14.
Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le Paslier D, Berger R, Bernard OA:
The t(12;21) of acute lymphoblastic leukemia results in a TEL-AML1 gene fusion.
Blood
85:3662, 1995[Abstract/Free Full Text]
15.
Raimondi SC, Shurtleff SA, Downing JR, Rubnitz J, Mathew S, Hancock M, Pui C-H, Rivera GK, Grosveld GC, Behm FG:
12 p abnormalities and the TEL gene (ETV6) in childhood acute lymphoblastic leukemia.
Blood
90:4559, 1997[Abstract/Free Full Text]
16.
Kobayashi H, Satake N, Maseki N, Sakashita A, Kaneko Y:
The der(21)t(12;21) chromosome is always formed in a 12;21 translocation associated with childhood acute lymphoblastic leukemia.
Br J Haematol
94:105, 1996[Medline]
[Order article via Infotrieve]
17.
Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, Yokoyama K, Soeda E, Ohki M:
Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia.
Nucleic Acids Res
23:2762, 1995[Abstract/Free Full Text]
18.
Romana SP, Poirel H, Leconiat M, Flexor M-A, Mauchaffe M, Jonveaux P, Macintyre EA, Berger R, Bernard OA:
High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia.
Blood
86:4263, 1995[Abstract/Free Full Text]
19.
Raynaud S, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge J, Guidal-Giroux C, Guo C, Vilmer E, Marynen P, Grandchamp B:
The 12;21 translocation involving TEL and deletion of the other TEL allele: Two frequently associated alterations found in childhood acute lymphoblastic leukemia.
Blood
87:2891, 1996[Abstract/Free Full Text]
20.
Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness VL, Kirsch IR:
Disruption of the human SCL locus by "illegitimate" V(D)J recombinase activity.
Science
250:1426, 1990[Abstract/Free Full Text]
21.
Tycko B, Sklar J:
Chromosomal translocations in lymphoid neoplasia: A reappraisal of the recombinase model.
Cancer Cells
2:1, 1990[Medline]
[Order article via Infotrieve]
22.
Strout MP, Marcucci G, Bloomfield CD, Caligiuri MA:
The partial tandem duplication of ALL1(MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia.
Proc Natl Acad Sci USA
95:2390, 1998[Abstract/Free Full Text]
23.
Maraschin J, Dutrillaux B, Aurias A:
Chromosome aberrations induced by etoposide (VP-16) are not random.
Int J Cancer
46:808, 1990[Medline]
[Order article via Infotrieve]
24.
Boehm T, Mengle-Gaw L, Kees U.R, Spurr N, Lavenir I, Forster A, Rabbitts TH:
Alternating purine-pyrimidine tracts may promote chromosomal translocations seen in a variety of human lymphoid tumors.
EMBO J
8:2621, 1989[Medline]
[Order article via Infotrieve]
25.
Fitzgerald TJ, Neale GAM, Raimondi SC, Goorha RM:
c-tal, a helix-loop-helix protein is juxtaposed to the T cell receptor-b chain gene by a reciprocal chromosomal translocation: t(1;7)(p32;q35).
Blood
78:2686, 1991[Abstract/Free Full Text]
26.
Aplan PD, Raimondi SC, Kirsch IR:
Disruption of the SCL gene by a t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia.
J Exp Med
176:1303, 1992[Abstract/Free Full Text]
27.
Ford AM, Bennett CA, Price CM, Bruin MCA, Van Wering ER, Greaves M:
Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia.
Proc Natl Acad Sci USA
95:4584, 1998[Abstract/Free Full Text]
28.
Bernard OA, Romana SP, Poirel H, Berger R:
Molecular cytogenetics of t(12;21)(p13;q22).
Leuk Lymphoma
23:459, 1996[Medline]
[Order article via Infotrieve]
29.
Miller SA, Dykes DD, Polesky HF:
A simple salting out procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res
16:1215, 1988[Free Full Text]
30.
Davis LG, Dibner MD, Battey JF:
Basic Methods in Molecular Biology. New York, NY, Elsevier, 1986.
31.
Stanulla M, Wang J, Chervinsky DS, Thandla S, Aplan PD:
DNA Cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher order chromatin fragmentation during the initial stages of apoptosis.
Mol Cell Biol
17:4070, 1997[Abstract]
32.
Ioannau PA, de Jong PJ:
Preparation of PAC clones using pCYPAC vector, in
Dracopoli NC,
Haines JL,
Korf BR,
Moir DT,
Morton CC,
Seidman CE,
Seidman JG,
Smith DR,
Boyle AL
(eds):
Current Protocols in Human Genetics, vol 1. New York, NY, Wiley, 1994, p 5.15.2.
33.
Ioannau PA, de Jong PJ:
Modified alkaline lysis miniprep for recovery of DNA from PAC clones, in
Dracopoli NC,
Haines JL,
Korf BR,
Moir DT,
Morton CC,
Seidman CE,
Seidman JG,
Smith DR,
Boyle AL
(eds):
Current Protocols in Human Genetics, vol 1. New York, NY, Wiley, 1994, p 5.15.15.
34.
Borkhardt A, Cazzaniga G, Viehmann S, Valsecchi MG, Ludwig WD, Burci L, Mangioni S, Schrappe M, Riehm H, Lampert F, Basso G, Masera G, Harbott J, Biondi A:
Incidence and clinical relevance of TEL/AML1 fusion genes in children with acute lymphoblastic leukemia enrolled in the German and Italian multicenter therapy trials.
Blood
90:571, 1997[Abstract/Free Full Text]
35.
Baens M, Peeters P, Guo C, Aerssens J, Marynen P:
Genomic organisation of TEL: The human ETS-variant gene 6.
Genome Res
6:404, 1996[Abstract/Free Full Text]
36.
Cullen M, Noble J, Erlich H, Thorpe K, Beck S, Klitz W, Trowsdale J, Carrington M:
Characterization of recombination in the HLA Class II region.
Am J Hum Genet
60:397, 1997[Medline]
[Order article via Infotrieve]
37.
Dutreix M:
(GT)n repetitive tracts affect several stages of Rec A-promoted recombination.
J Mol Biol
273:105, 1997[Medline]
[Order article via Infotrieve]
38.
Hackman P, Gabbani G, Osterholm AM, Hellgren D, Lambert B:
Spontaneous length variation in microsatellite DNA from human T-cell clones.
Genes Chromosomes Cancer
14:215, 1995[Medline]
[Order article via Infotrieve]
39.
Samadashwily GM, Raca G, Mirkin SM:
Trinucleotide repeats affect DNA replication in vivo.
Nat Genet
17:298, 1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. L. Wiemels, J. Hofmann, M. Kang, R. Selzer, R. Green, M. Zhou, S. Zhong, L. Zhang, M. T. Smith, C. Marsit, et al.
Chromosome 12p Deletions in TEL-AML1 Childhood Acute Lymphoblastic Leukemia Are Associated with Retrotransposon Elements and Occur Postnatally
Cancer Res.,
December 1, 2008;
68(23):
9935 - 9944.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. T. Maia, A. M. Ford, G. R. Jalali, C. J. Harrison, G. M. Taylor, O. B. Eden, and M. F. Greaves
Molecular tracking of leukemogenesis in a triplet pregnancy
Blood,
July 15, 2001;
98(2):
478 - 482.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Eguchi-Ishimae, M. Eguchi, E. Ishii, S. Miyazaki, K. Ueda, N. Kamada, and S. Mizutani
Breakage and fusion of the TEL (ETV6) gene in immature B lymphocytes induced by apoptogenic signals
Blood,
February 1, 2001;
97(3):
737 - 743.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-W. Vaandrager, E. Schuuring, K. Philippo, and P. M. Kluin
V(D)J recombinase-mediated transposition of the BCL2 gene to the IGH locus in follicular lymphoma
Blood,
September 1, 2000;
96(5):
1947 - 1952.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Wiemels and M. Greaves
Structure and Possible Mechanisms of TEL-AML1 Gene Fusions in Childhood Acute Lymphoblastic Leukemia
Cancer Res.,
August 1, 1999;
59(16):
4075 - 4082.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction