SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Bux, J. Articles by Santoso, S. Search for Related Content PubMed PubMed Citation Articles by Bux, J. Articles by Santoso, S. Related Collections Phagocytes Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 93 No. 1 (January 1), 1999: pp. 357-362 The Use of Allele-Specific Recombinant Fc Receptor IIIb Antigens for the Detection of Granulocyte Antibodies By Juergen Bux, Karin Kissel, Christine Hofmann, and Sentot Santoso From the Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University, Giessen, Germany.     ABSTRACT Top Abstract Introduction Materials and methods Results Discussion References The Fc receptor IIIb (FcRIIIb) for the Fc domain of IgG is expressed exclusively on neutrophils. The FcRIIIb bears allotypic polymorphisms referred to as NA1, NA2, and SH, which are known for their frequent involvement in alloimmune and autoimmune neutropenias as well as in transfusion reactions. The bactericidal capacity of isolated neutrophils is easily activatable, and activation results in self-desintegration, thus preventing storage of neutrophils. As a result, only freshly isolated granulocytes can be used for antibody screening, often making it impossible to use typed panel cells. To provide a readily available source of typed panel cells, we therefore established stable mammalian cells expressing recombinant NA1, NA2, and SH antigens. We isolated mRNA from typed neutrophils and then transcribed it in cDNA. The cDNA that codes for the different forms of the FcRIIIb was amplified by polymerase chain reaction and was subsequently subcloned into the mammalian expression vector pcDNA3. Chinese hamster ovary (CHO) cells were transfected with allele-specific constructs, and stable cell lines expressing FcRIIIb were selected by flow cytometry. Because human sera show high background fluorescence with transfectants in flow cytometry, the monoclonal antibody-specific isolation of granulocyte antigens (MAIGA) assay was performed. By MAIGA assay, we tested 14 well-characterized human alloantibodies directed against the antigens NA1, NA2, and SH; 5 FcRIIIb-specific isoantibodies; and 12 FcRIIIb-reactive autoantibodies. Except one NA1- and one SH-specific alloantibody, all other antibodies could be identified by the use of CHO transfectants. In contrast to neutrophils, fixed CHO cells can be stored at 4°C for at least 4 weeks or stored frozen for a longer period. This longer shelf life of the transfected CHO cells compared with isolated neutrophils will simplify the detection of the clinically most important FcRIIIb-reactive alloantibodies and autoantibodies. © 1999 by The American Society of Hematology.     INTRODUCTION Top Abstract Introduction Materials and methods Results Discussion References THE Fc RECEPTOR IIIb (FcRIIIb = CD16) is a low-affinity receptor for the Fc region of complexed but not monomeric IgG antibodies and removes preferentially small immune complexes from the circulation.1 Immunological studies have shown that FcRIIIb is rather polymorphic, bearing the important NA1 and NA2 antigens,2 the low-frequency antigen SH,3 and the high-frequency antigens LAN and SAR.4,5 Alloantibodies directed against these antigens cause alloimmune immune neutropenia,6 immune neutropenia after bone marrow transplantation,7 and transfusion-related acute lung injury.8 In addition, neutrophil alloimmunization can result in refractoriness to granulocyte transfusions.9,10 About 0.1% of the European population do not express the FcRIIIb on their neutrophils as a result of FcRIIIB gene deficiency.11 Because these neutrophils do not display the NA1 and NA2 antigens, this phenotype is called NA null.12 Women with the NA null phenotype can form isoantibodies to the FcRIIIb causing severe isoimmune neonatal neutropenia.13 Neutrophil autoantibodies detected in the sera of patients with autoimmune neutropenia are frequently directed against the FcRIIIb with preferential binding to the NA1 isoform.14 In contrast to red blood cells and platelets, granulocytes are not storable without activation and ensuing autolysis as a result of granule enzyme and oxygen radical release. Therefore, cumbersome and time consuming isolation of granulocytes from the donor's blood for each test series is necessary for antibody screening. Because the FcRIIIb is the major immunogenic glycoprotein on the neutrophil membrane, we established stable mammalian cell lines expressing the polymorphic forms of the FcRIIIb and showed their usefulness in detecting FcRIIIb-reactive granulocyte antibodies.     MATERIALS AND METHODS Top Abstract Introduction Materials and methods Results Discussion References Sera.   Human NA-specific typing sera and FRIIIb-specific isoantibodies were obtained from immunized mothers' infants with alloimmune or isoimmune neonatal neutropenia. Sera containing autoantibodies were from infants with primary autoimmune neutropenia. Monoclonal antibodies (MoAbs).   MoAb 3G8 directed against a monomorphic epitope of FcRIIIb (CD16) was purchased from Immunotech (Hamburg, Germany) and a second FcRIIIb-reactive MoAb BW 209/2 was a generous gift of Dr Kurrle (Marburg, Germany). MoAbs CLB gran 11 and GRM1 directed against NA1 and NA2 allelic forms of FcRIIIb were generous gifts of Dr Garrido (Granada, Spain) and Dr von dem Borne (Amsterdam, The Netherlands). Amplification of full-length FcRIIIB cDNA.   Full-length FcRIIIB cDNA was synthesized by polymerase chain reaction (PCR) amplification of granulocyte mRNA from of an NA1-homozygous donor and an NA2-, SH-positive donor as previously described.3 The FcRIII-specific primers were constructed based on the published sequence of Ravetch and Perussia.15 In brief, 3 µL cDNA was mixed with 8 µL PCR buffer, 0.5 µmol/L of sense primer (51-TCTTTGGTGACTTGTCCA-18 3), 0.5 µL antisense primer (5886-AGAGGCCTGAGGATGAT-870 3), 200 µmol/L of each dNTP, and 1.5 U of Taq GOLD polymerase and were amplified on a GenAmp 9600 DNA thermal cycle (Perkin Elmer, Weiterstadt, Germany) for 39 cycles. After heating at 95°C for 5 minutes, PCR was performed under following conditions: denaturation at 95°C for 60 seconds, annealing at 47°C for 90 seconds, and extension at 72°C for 60 seconds. An aliquot of 5 µL PCR product (dilution 1:100) was amplified again using nested primers (5 16-CCACTCCAGTGTGGCATC-33 3) and (5 831-GCCACTGCTCTTATTACT-814 3) for 39 cycles. Each cycle consisted of denaturation at 95°C for 45 seconds, annealing at 49°C for 50 seconds, and extension for 72°C for 60 seconds. In the final cycle, the samples were kept at 72°C for 10 minutes and then chilled to 4°C. Amplified cDNA was analyzed on 1.5% agarose gel electrophoresis and purified by Geneclean (Dianova, Hamburg, Germany). Construction of allele-specific FcRIIIB expression systems.   Purified cDNA was flushed using Klenow DNA polymerase (Biolabs, Bad Schwalbach, Germany) and was subcloned into the EcoRV site of the mammalian expression vector pcDNA3 (Invitrogen, Leek, The Netherlands). To determine the right insert orientation within the vector, NA1-, NA2-, and SH-constructs were digested with KpnI endonuclease (Biolabs). Plasmid from positive clones were then analyzed for NA1-, NA2-, and SH-polymorphic sites by PCR and restriction analysis. In brief, plasmid DNA were amplified by PCR using sense primer no. 5 (5 41-AGCTGCTCCTCCCAACTG-58 3) antisense primer no. 6 (5 393-CTCCTTGAACACCCACCG-376 3) for 35 cycles. Each cycle consisted of denaturation at 95°C for 30 seconds, annealing at 59°C for 50 seconds, and extension at 72°C for 30 seconds. Amplified DNA was analyzed by restriction digestion with TaqI endonuclease (Biolabs). To determine the allele specificity of NA1-, NA2-, and SH-constructs, PCR products were subjected to restriction analysis using TaqI and SfaNI endonucleases (Biolabs). Purified plasmids used for subsequent transfection were validated by nucleotide sequence analysis. Stable expression of allele-specific FcRIIIB recombinant antigens.   Chinese hamster ovary (CHO; American Type Tissue Collection, Rockville, MD) cells were grown in RPMI 1640 medium (GIBCO-BRL, Eggenstein, Germany) containing 10% fetal calf serum (Seromed, Berlin, Germany), 1% sodium pyruvate, 1% glutamine, and 1% penicillin/streptomycine (complete medium) and were transfected with NA1-, NA2-, and SH-constructs by the use of Lipofectin (GIBCO-BRL). In brief, 6 µg of each construct was mixed with 25 µL Lipofectin in 2 mL OptiMEM medium (GIBCO-BRL) and then added to subconfluent 10-cm plate of CHO cells for 12 hours. Nine milliliters complete medium was added and the incubation was continued for 48 hours. After splitting, CHO transfectants were selected with Genicitin (G418; final concentration 1 mg/mL; GIBCO-BRL) for about 2 weeks. Stable transfectants were analyzed for high expression of FcRIIIB recombinant proteins by flow cytometry (see below). After subcloning, stable transfectants were grown in complete medium supplemented with 200 µg/mL G418. Flow cytometry.   Stable transfectants were obtained with Trypsin-EDTA (GIBCO-BRL), washed in phosphate-buffered saline (PBS; GIBCO-BRL), and fixed with 1% paraformaldehyde (PFA). After three times washing 40 µL (5 × 103/L) cells were incubated with 10 µL MoAb 3G8 specific for FcRIIIb for 30 minutes at room temperature. Sensitized cells were then washed twice, stained with 40 µL fluorescein-isothiocyanate-conjugated rabbit anti-mouse IgG (dilution 1:30; Dako, Hamburg, Germany) and analyzed by flow cytometry (Ortho Diagnostics, Neckargemuend, Germany). Antigen capture assay with stable transfectants.   The assay with stable transfectants was performed using the MoAb-specific immobilization of granulocyte antigens (MAIGA) assay as previously described for granulocytes with minor modifications.16 In brief, 100 µL (2 × 103/µL) of transfectants fixed with 1% paraformaldehyde were incubated (30 minutes, 37°C) with human serum and a MoAb. The FcRIII-specific MoAbs 3G8 and BW 209/2 were used in different reaction mixtures. The cells were washed and solubilized by adding 100 µL of lysis buffer (1% Triton-X 100, 5 mmol/L EDTA, 2 mmol/L phenylmethylsulfonylfluoride [PMSF], 0.5 µg/mL Leupeptin, 500 KIE/mL Aprotinin in 20 mmol/L Tris-buffered saline, pH 7.4) for 30 minutes at room temperature. After sonication (2 minutes) and centrifugation at 15,000g for 30 minutes, the supernatant of each reaction mixture was transferred to a separate tube coated with goat anti-mouse antibodies. Unattached antibodies were removed by washing, and goat anti-human IgG (heavy + light chain) antibodies conjugated with peroxidase were added. After washing and subsequent addition of a substrate containing luminol, hydrogen peroxide, and 4-iodophenol, the emitted light (chemiluminescence) was measured over a period of 15 minutes in a luminometer (Lumat LB 9501; Berthold, Wildbad, Germany). Immunoprecipitation.   Immunoprecipitation was performed as recently described.3 In brief, for immunoprecipitation 5 × 107 unfixed CHO cells in PBS were biotinylated (5 mmol/L NHS-LC-Biotin; Pierce, Rockford, IL) for 30 minutes on ice. After washing, 100 µL of cell suspension, 100 µL of serum, or MoAb solution (0.01 mg/mL) was added to each sample and incubated for 30 minutes at 37°C. The cells were washed and solubilized by adding lysis buffer (see MAIGA assay) for 30 minutes at room temperature. After sonication and centrifugation the supernatants were incubated with rabbit anti-human IgG or anti-mouse Ig (Dako) antibodies coupled to Protein A-Sepharose CL-4B (Pharmacia, Freiburg, Germany). The Protein A-Sepharose beads were washed and resuspended in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, boiled, and then subjected to 10% SDS-PAGE. After electrophoresis, proteins were transferred onto nitrocellulose (Hibond C, Amersham, Braunschweig, Germany). For visualization, the nitrocellulose was first blocked with bovine albumin and then incubated with streptavidin conjugated to peroxidase. Unbound streptavidin was washed out, the nitrocellulose was incubated with a chemiluminescent substrate (ECL Western Blotting Detection System; Amersham), and then exposed to x-ray films. NA and SH genotyping by PCR with sequence-specific primers (PCR-SSP).   For genotyping of NA antigens, a slightly modified PCR-SSP technique was used as previously described.17 Briefly, DNA isolated from CHO cells was amplified by PCR using a thermal cycler with 2 U Taq DNA polymerase. The PCR reaction consists of 30 cycles (denaturation, 98°C/30 seconds; annealing, 57°C/1 minute; extension, 71°C/30 seconds; final extension, 71°C/5 minutes). The NA-specific primers were designed as sense primers and were situated at position 208 to 227 for NA1 and at position 130 to 147 for NA2. To enhance the specificity of the NA1 primer, at position 4 from the 3 end, the correct nucleotide A was substituted by a T. The nonspecific antisense primer is situated at position 331 to 348. As internal positive PCR control, two primers (HGH-I and HGH-II, see below) amplifying a 439-bp fragment of the human growth hormone gene (HGH) were used. After electrophoresis in 1.6% agarose gel and staining with ethidium bromide, the PCR products were visualized by ultraviolet illumination and photographed. For genotyping of the SH antigen the recently described PCR-SSP method was used.3 Five microliters of DNA was amplified in a total volume of 50 µL using 0.5 µM SH(+) sequence-specific antisense primer no. 7 (5-285TCTGTCGTTGACTGTGTCAT266-3) or the antithetical SH() sequence-specific antisense primer no. 8 (285TCTGTCGTTGACTGTGTCAG266-3), 0.5 µmol/L sense primer no. 9 (5-95AAGATCTCCCAAAGGCTGTG115-3), 200 µmol/L of each dNTP, 5 µL 10× PCR buffer, 2 U Taq polymerase on a DNA thermal cycler (Perkin Elmer) for 30 cycles. To enhance the specificity of the primers, at position 4 from the 3 end the correct nucleotide, G was substituted by a T. Coamplification of the HGH gene using 0.125 µmol/L HGH I primer (5-CAGTGCCTTCCCAACCATTCCCTTA-3) and 0.125 µmol/L HGH II primer (5-ATCCACTCACGGATTTCTGTTGTGTTTC-3) was run as internal control. Each cycle consisted of denaturation at 95°C for 30 seconds, annealing at 60°C for 1 minute and primer extension at 71°C for 30 seconds.     RESULTS Top Abstract Introduction Materials and methods Results Discussion References Characterization of allele-specific constructs.   Figure 1 shows the results of the restriction analysis of the constructs digested with the NA-specific TaqI and the SH-specific SfaNI endonucleases. View larger version (35K): [in this window] [in a new window]   Fig 1. Restriction analysis of the NA1-, NA2-, and SH-constructs. After PCR amplification of the NA1- (lanes 1), NA-2 (lanes 2), and SH-constructs (lanes 3), FcRIIIb fragments encompassing nucleotides 41-393 were digested with NA-specific TaqI (left panel) or SH-specific SfaNI endonuclease (right panel) and were analyzed on 4% or 1.5% agarose gel, respectively. Expression of allele-specific FcRIIIb on CHO cells.   The FcRIIIb specificity of the transfected CHO cells was tested by the use of human alloantibodies and MoAbs recognizing different isoforms of the FcRIIIb. The NA1, NA2, and SH isoforms of the FcRIIIb expressed by the transfected CHO cells could be clearly identified by flow cytometry (Fig 2). View larger version (31K): [in this window] [in a new window]   Fig 2. Flow cytometry analysis of the stable CHO transfectants expressing FcRIIIb NA1-, NA2-, and SH-isoforms. Paraformaldehyde-fixed CHO cells were stained either with NA1-specific MoAb CLB Gran 11 or with NA2-specific MoAb GRM 1, washed, and labeled with fluorescein-conjugated rabbit anti-mouse IgG. Immunochemical characterization of the FcRIIIb recombinant antigens.   Immunoprecipitation using the MoAb 3G8 showed the expected Mr of ~58 kD for the FcRIIIb-NA1 form and the Mr of ~73 kD for the FcRIIIb-NA2 and ~63 kD for FcRIIIb-SH forms, respectively (Fig 3). The base pair exchange responsible for the SH polymorphism influences glycoslyation of the FcRIIIb, resulting in a slightly lower Mr of the SH isoform. View larger version (24K): [in this window] [in a new window]   Fig 3. Immunoprecipitation of allele-specific FcRIIIb recombinant isoforms from biotin surface-labeled CHO stable transfectants expressing SH (lane 1), NA2 (lane 2), and NA1 (lane 3) granulocyte antigens. After solubilization CHO lysates were immunoprecipitated with MoAb 3G8 specific for FcRIIIb. Immunoprecipitates were separated on 7.5% SDS-PAGE under nonreducing conditions and were transferred by immunoblotting. Biotin-labeled proteins were visualized using streptavidin and chemiluminescence substrate system. Note the different electrophorectic migrations of the various FcRIIIb isoforms. Application of CHO stable transfectants expressing allele-specific recombinant antigens for detection of human granulocytes FcRIIIb-reactive alloantibodies and autoantibodies.   In immunofluorescence, human sera showed a high background staining so that interpretation of the results was often quite difficult. Therefore, we used a CHO cell modification of the antigen-specific MAIGA assay for alloantibody identification in human sera. By the MAIGA assay, false positive results due to antibodies recognizing structures other than the FcRIIIb are excluded. Fourteen human sera containing well-characterized alloantibodies directed against the NA1, NA2, and SH antigens as well as five sera with human isoantibodies to the FcRIIIb were tested in the MAIGA assay for their reactivity with the transfected CHO cells (Table 1) and freshly isolated granulocytes. Whereas all isoantibodies to the FcRIIIb were detected, one NA1 and one SH alloantibody were not detectable by MAIGA assay using CHO cells as well as granulocytes.                                View this table: [in this window] [in a new window]   Table 1. Reactivity of Human Alloantibodies and Autoantibodies in the MAIGA Assay with Transfected CHO Cells and Human Polymorphonuclear (PMN) Leukocytes Expressing Different Isoforms of the FcRIIIb In addition, we tested 12 sera containing autoantibodies to the FcRIIIb as shown by MAIGA assay using human granulocytes (Table 1). The autoantibodies tested showed preferential binding to NA1 homozygous test cells in granulocyte immunofluorescence. Five of the 12 sera showed binding to both NA1- and NA2-transfected cells. However, the binding reactivity to NA2 CHO cells was weaker. Two other sera reacted additionally with the SH transfected CHO cells. CHO cells were stored for 1 month and tested in the MAIGA assay for their reactivity with human alloantibodies as compared to stored granulocytes. In contrast to the human neutrophils, no significant loss of reactivity was observed with the CHO cells (Fig 4). Similar results were achieved when CHO cells and human neutrophils were stored frozen (data not shown). View larger version (39K): [in this window] [in a new window]   Fig 4. Binding of human antisera to NA1-, NA2-, and SH-expressing CHO cells and human granulocytes. Reactivity in the MAIGA assay is shown after 1 day storage and 1 month storage at 4°C. Genotyping analysis of FcRIIIB alleles by sequence (allele)-specific PCR.   Sequence (allele)-specific PCR was performed using DNA isolated from transfected CHO cells (Fig 5). The PCR products were identical to the products obtained by allele-specific PCR using DNA isolated from human leukocytes. The results show that the transfectants can be used as a source of NA1, NA2, and SH reference DNA for genotyping. View larger version (50K): [in this window] [in a new window]   Fig 5. Genotyping analysis of the stable CHO transfectants expressing NA1-, NA2-, and SH-isoforms by allele-specific PCR. DNA were isolated from the transfectants and were amplified using allele-specific NA1- (lanes 2, 5, and 8), NA2-(lanes 3, 6, and 9), and SH- (lanes 4, 7, and 10) primer. PCR products were analyzed on 1.5% agarose gel using MW VI (lane 1; Boehringer Mannheim, Mannheim, Germany) as molecular weight standards.     DISCUSSION Top Abstract Introduction Materials and methods Results Discussion References For granulocyte antibody screening, a combination of the granulocyte immunofluorescence and agglutination has been found to be the best means of detection.18 However, these tests require nonactivated and, for agglutination, also functionally active cells. Therefore, only granulocytes stored up to 4 hours can be used in granulocyte immunofluorescence and agglutination tests.19 This need for freshly isolated granulocytes is a major problem in granulocyte serology, making granulocyte antibody screening often impossible and hampering the detection of antibodies to low-frequency antigens. These problems are avoided by the introduction of stable mammalian cell lines such as CHO cells transfected with cDNA encoding for selected human antigens. CHO transfectants expressing human antigens have been shown to be useful reagents for the detection of alloantibodies that are difficult to identify such as antibodies to Cromer antigens.20 Antibodies binding to the FcRIIIb are of the same clinical importance in granulocyte serology as antibodies to the glycoprotein IIb/IIIa in platelet serology or Rhesus antibodies in red cell serology. Two thirds of all cases of neonatal immune neutropenia are caused by FcRIIIb-reactive allo/isoantibodies,21 and about a third of the autoantibodies in primary autoimmune neutropenia in infancy are directed against the FcRIIIb.14 Therefore, we transfected CHO cells with the NA1, NA2, and SH isoforms of the FcRIIIb. We could show that our NA1, NA2, and SH transfectants exhibit the same antigenic and immunochemical heterogeneity as the isoforms show on human neutrophils. CHO cells also glycosylate FcRIIIb in a similar manner to normal human neutrophils.22 Although MoAbs to FcRIIIb can be easily detected by flow cytometry, human sera caused such a high background in immunofluorescence that interpretation can become very difficult. Therefore, we used a modified MAIGA assay procedure for antibody identification using CHO cells instead of human granulocytes. By this procedure, we could detect most of the FcRIIIb-reactive antibodies. In contrast to neutrophils, the CHO cells could be stored for at least 1 month at 4°C. The alloantibodies that were not detected were also not detectable by MAIGA using human neutrophils. Usually, it is assumed that there is a steric hindrance between the human antibody and the two MoAbs used for antigen immobilization, although the MoAbs are directed against different epitopes because they do not hinder each other in their binding to the FcRIIIb. Another explanation is based on the observation that the glycosylphosphatidylinositol-anchored FcRIIIb cooperates with the transmembrane leukocyte adhesion molecule CD11b/CD18 for signal transduction via the cell membrane.23 Possibly, the epitopes recognized by these alloantibodies are stabilized by the CD11b/CD18 complex and are disrupted during FcRIIIb isolation.     FOOTNOTES    Submitted June 8, 1998; accepted September 1, 1998.    Supported by a grant from the Deutsche Forschungsgemeinschaft DFG Bu 770/3-3.    This work is part of an academic thesis (Phd) of Karin Kissel.    The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact. Address reprint requests to Juergen Bux, MD, Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University, Langhansstrasse 7, D-35385 Giessen, Germany; e-mail: Juergen.Bux{at}immunologie.med.uni-giessen.de.     REFERENCES Top Abstract Introduction Materials and methods Results Discussion References 1. Huizinga TWJ, Dolman KM, van der Linden NJM, Kleijer M, Nuijens JH, von dem Borne AEGKr, Roos D: Phosphatidylinositol-linked FcRIII mediates exocytosis of neutrophil granule proteins but does not mediate initiation of the respiratory burst. J Immunol 144:1432, 1990[Abstract] 2. Huizinga TWA, Kleijer M, Tetteroo PAT, Roos D, von dem Borne AEGKr: Biallelic neutrophil NA antigen system is associated with a polymorphism on the phosphoinositol-linked Fcreceptor III (CD16). Blood 75:213, 1990[Abstract/Free Full Text] 3. Bux J, Stein E-L, Bierling P, Fromont P, Clay M, Stroncek D, Santoso S: Characterisation of a new alloantigen (SH) on the human neutrophil FcReceptor IIIb. Blood 89:1027, 1997[Abstract/Free Full Text] 4. Metcalfe P, Waters AH: Location of the granulocyte-specific antigen LAN on the Fcreceptor III. Transfus Med 2:283, 1992[Medline] [Order article via Infotrieve] 5. Bux J, Hartmann C, Mueller-Eckhardt C: Alloimmune neonatal neutropenia resulting from immunization to a high frequency antigen on the granulocyte Fcreceptor III. Transfusion 34:608, 1994[Medline] [Order article via Infotrieve] 6. Lalezari P, Nussbaum M, Gelman S, Spaet T: Neonatal neutropenia due to maternal isoimmunization. Blood 15:236, 1960[Abstract/Free Full Text] 7. Herzog P, Korinkova P, Stambergova M, Lukasova M: Auto anti-A1 and auto anti-NA1 after bone marrow transplantation. Folia Haematol (Leipz) 114:874, 1987 8. Yomtovian R, Press C, Engman H, Kline W, Clay M, McCullough J: Severe pulmonary hypersensitivity associated with passive transfusion of a neutrophil-specific antibody. Lancet 1:244, 1984[Medline] [Order article via Infotrieve] 9. McCullough J, Weiblen BJ, Clay M, Forstrom L: Effect of leukocyte antibodies and HLA matching on the fate in vivo of indium 111-labeled granulocytes. Blood 58:164, 1981[Abstract/Free Full Text] 10. Stroncek DF, Leonard K, Eiber G, Malech HL, Gallin JI, Leitman SF: Alloimmunization after granulocyte transfusions. Transfusion 36:1009, 1996[Medline] [Order article via Infotrieve] 11. Fromont P, Bettaieb A, Skouri H, Floch C, Poulet E, Duedari N, Bierling P: Frequency of the polymorphonuclear Fc gamma receptor III deficiency in the french population and its involvement in the development of neonatal alloimmune neutropenia. Blood 79:2131, 1992[Abstract/Free Full Text] 12. de Haas M, Kleijer M, van Zwieten R, Roos D, von dem Borne AEGKr: Neutrophil FcRIIIb deficiency, nature and clinical consequences: A study of 21 individuals from 14 families. Blood 86:2403, 1995[Abstract/Free Full Text] 13. Huizinga TWA, Kuijpers RWAM, Kleijer M, Schulpen TWJ, Cuypers TM, Roos D, von dem Borne AEGKr: Maternal genomic neutrophil FcRIII deficiency leading to neonatal isoimmune neutropenia. Blood 76:1927, 1990[Abstract/Free Full Text] 14. Bux J, Behrens G, Jäger G, Welte K: Primary autoimmune neutropenia in infancy: Analysis of 240 cases. Blood 91:181, 1998[Abstract/Free Full Text] 15. Ravetch JV, Perussia B: Alternative membrane forms of FcRIII (CD16) on human natural killer cells and neutrophils. J Exp Med 170:481, 1989[Abstract/Free Full Text] 16. Bux J, Kober B, Kiefel V, Mueller-Eckhardt C: Analysis of granulocyte-reactive antibodies using an immunoassay based upon monoclonal antibody-specific immobilization of granulocyte antigens (MAIGA). Transfus Med 3:157, 1993[Medline] [Order article via Infotrieve] 17. Bux J, Stein EL, Santoso S, Mueller-Eckhardt C: NA gene frequencies in the German population determined by polymerase chain reaction with sequence-specific primers (PCR-SSP). Transfusion 35:54, 1995[Medline] [Order article via Infotrieve] 18. Bux J, Chapman J: Results of the Second International Granulocyte Serology Workshop. Transfusion 37:977, 1997[Medline] [Order article via Infotrieve] 19. Clay ME, Kline WE: Detection of granulocyte antigens and antibodies, in Garratty G (ed): Current Concepts in Transfusion Therapy. Arlington, VA, American Association of Blood Banks, 1985, p 183. 20. Telen MJT, Rao N, Udani M, Thompson ES, Kaufman RM, Lublin DM: Molecular mapping of the Cromer blood group Cra and Tca epitopes of decay accelerating factor: Toward the use of recombinant antigens in immunhematology. Blood 84:3205, 1994[Abstract/Free Full Text] 21. Bux J, Jung KD, Kauth T, Mueller-Eckhardt C: Serological and clinical aspects of granulocyte antibodies leading to alloimmune neonatal neutropenia. Transfus Med 2:143, 1992[Medline] [Order article via Infotrieve] 22. Ory PA, Clark MR, Talhouk AS, Goldstein IM: Transfected NA1 and NA2 forms of human neutrophil Fc Receptor III exhibit antigenic and structural heterogeneity. Blood 77:2682, 1991[Abstract/Free Full Text] 23. Krauss JC, Poo H, Xue W, Mayo-Bond L, Todd RF III, Petty HR: Reconstitution of antibody-dependent phagocytosis in fibroblasts expressing Fcreceptor IIIb and the complement receptor Type 3. J Immunol 153:1769, 1994[Abstract] © 1999 by The American Society of Hematology.   0006-4971/99/9301-0037$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: M. Di Fulvio and J. Gomez-Cambronero Phospholipase D (PLD) gene expression in human neutrophils and HL-60 differentiation J. Leukoc. Biol., June 1, 2005; 77(6): 999 - 1007. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Bux, J. Articles by Santoso, S. Search for Related Content PubMed PubMed Citation Articles by Bux, J. Articles by Santoso, S. Related Collections Phagocytes Social Bookmarking                   What's this?

	Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020