|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 10 (May 15), 1999:
pp. 3216-3224
RAPID COMMUNICATION
Transcriptional Inhibition of p53 by the MLL/MEN Chimeric Protein
Found in Myeloid Leukemia
By
Kazuhiro Maki,
Kinuko Mitani,
Tetsuya Yamagata,
Mineo Kurokawa,
Yoshinobu Kanda,
Yoshio Yazaki, and
Hisamaru Hirai
From the Department of Hematology and Oncology, Faculty of Medicine,
University of Tokyo, Tokyo, Japan.
 |
ABSTRACT |
The t(11;19)(q23;p13.1) translocation is frequently found in adult
myeloid leukemia. In the MLL/MEN fusion protein generated by this
translocation, most of the coding region of the MEN protein, an RNA
polymerase II elongation factor, is fused to the N-terminal third of
the MLL protein, a possible transcriptional regulator. However, the
molecular mechanism of leukemogenesis by the fusion protein remains
unclear. We investigated the effects of the fusion protein on p53
function using luciferase assays. Overexpression of the fusion protein
suppressed the transactivation ability of p53. This negative effect of
the fusion protein on p53 function was dependent on the region derived
from MEN. Moreover, p53 coimmunoprecipitated with MLL/MEN as well as
MEN, suggesting that the fusion protein binds to p53 through the MEN
region. We found that MEN binding to p53 was mediated by its N-terminal
region and repression of p53 transcriptional activity was mediated by
its C-terminal region. We also found that these two functional regions
were essential for the transformation of Rat1 cells mediated by MEN.
Although we could not demonstrate a functional difference between
MLL/MEN and MEN in this study, these data suggest that the MLL/MEN
chimeric transcriptional regulator may exert its oncogenic activity by inhibiting the function of the p53 tumor-suppressor protein by binding
to it. Our findings provide a novel insight into the leukemogenic mechanism exerted by the t(11;19)(q23;p13.1) translocation.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE 11q23 TRANSLOCATIONS, in which the
breakpoints of chromosome 11 are commonly mapped to band q23, are the
most frequently observed chromosomal abnormalities in human
leukemia.1,2 The MLL gene is located at the breakpoint of
11q23 and is rearranged by the translocations. The MLL gene product,
although not yet fully clarified, contains AT-hooks in its N-terminal
portion and two zinc finger domains in its middle3,4 and
appears to encode a putative transcriptional regulator. Upon
chromosomal translocation, the MLL gene is disrupted between the
AT-hooks and the zinc finger domains and fused with various partner
genes. These partner genes encode various kinds of proteins with known
structures,2 including serine/proline rich
sequences,5 zinc finger motifs, leucine zipper
motifs6,7 found in transcriptional factors, and a Src
homology 3 module8 found in signaling molecules. The
resulting fusion proteins appear to differ functionally. Among the 16 genes identified as partners for MLL in the 11q23 translocations, the functions of only six are known. These six genes are MEN/ELL (RNA polymerase II elongation factor) at 19p13.1,9-11 CBP at
16p13.3,12 p300 at 22q13,13 AF6 (Ras-binding
protein) at 6q27,14,15 hCDCrel (cell division cycle
protein) at 22q11.2,16 and ABI-1 (Abl binding protein) at
10p11.2.17 However, the molecular mechanisms underlying
leukemogenesis by these chimeric genes remain unclear.
We have cloned the MLL/MEN chimeric cDNAs generated by the
t(11;19)(q23;p13.1),9 which is specifically found in adult
myeloid leukemia. This fusion protein consists of N-terminal 1406 amino acids (aa) of MLL, followed by the entire coding region of MEN except
for its N-terminal 45 amino acids. MEN is an RNA polymerase II
elongation factor that enhances elongation by suppressing transient pausing by polymerase at many sites along DNA.11 MEN, as
well as ELL2, which shares significant homology with MEN, exhibit the elongation enhancing activity conferred by their N-terminal
regions.18,19 MEN also contains an RNA polymerase II
interaction domain in its most N-terminal area. This region is capable
of negatively regulating the polymerase activity in promoter-specific
transcription initiation.10,20 The MLL/MEN fusion protein,
in which this most N-terminal domain of MEN has been lost, may lead to
overactivation of elongation by failing to inhibit
initiation.18 Therefore, loss of the region for RNA
polymerase II interaction could be a cause for the leukemogenesis induced by the MLL/MEN fusion protein. In addition, overexpression of
the MEN protein in Rat1 cells leads to increased colony
formation.21 MEN also stimulates AP-1 activity by
increasing Fos expression, and these two functions are lost when MEN
lacks the lysine-rich region in its C-terminal portion. Therefore, MEN
may possess an oncogenic function by enhancing AP-1 activity. The
MLL/MEN fusion protein contains most of the coding region of MEN and
therefore may induce strong AP-1 activity. If the AP-1 activity induced by the fusion protein is stronger than that induced by the MEN protein,
it could lead to malignant transformation of myeloid cells.
The p53 tumor-suppressor gene is one of the key genes involved in human
malignancies.22 Mutations and/or allelic losses in the gene
have been found at high frequencies in acute leukemia,23-25 chronic myelocytic leukemia in blastic crisis,26,27 and
myelodysplastic syndrome.28,29 p53 acts not only as a
transcriptional activator of genes containing a p53 binding site in
their regulatory regions,30 but also as a repressor of
genes containing a TATA box but lacking a p53-binding
site.31 p53 regulates cell cycle progression by modulating
the expression of genes such as p21 (WAF-1). p53 is also involved in
apoptotic induction after DNA damage, possibly by transactivating
Bax,32 a proapoptotic member of the bcl-2 family proteins.
To analyze the effects of the MLL/MEN fusion protein on cell cycle
regulation, we investigated the effect of this chimeric protein on p53
function. We found an inhibitory effect of MLL/MEN on the
transactivating ability of p53. This inhibitory effect appears to be
mediated by direct interaction between MLL/MEN and p53. We found that
MEN binds to p53 through its N-terminal p53 binding domain.
In addition, we found that MEN alone represses p53-mediated
transcription almost to the same level as MLL/MEN. This function is
mediated through both its N-terminal p53 binding domain and its
C-terminal repression domain. These two functional domains of MEN are
necessary for the increased colony formation of Rat1 cells by the
induced MEN protein. Our results provide another interesting model for
leukemic transformation of hematopoietic cells by the abnormal
expression of a transcriptional elongation factor.
| |
MATERIALS AND METHODS |
Plasmid construction.
We previously constructed the pME18S-MEN(HA), the pME18S-MLL/MEN(HA),
and the pME18S-tMLL(HA) plasmids, which contain the entire MEN and
MLL/MEN chimeric cDNAs, and the N-terminal MLL part of MLL/MEN chimeric
cDNA (truncated MLL [tMLL]), respectively, followed by the sequence
coding for nine amino acids of the influenza hemagglutinin (HA) epitope
(TACCCATACGACGTCCCAGACTACGCT) in their C-terminals.20 In this study, the
pME18S-MEN(FLAG) and pME18S-MLL/MEN(FLAG) plasmids were generated by
replacing the coding sequence of the HA epitope with that of the FLAG
epitope (GACTACAAGGACGACGATGACAAG). To construct the pME18S-GAL4/VP16,
a DNA fragment containing the coding region of GAL4/VP16, in which the
yeast GAL4 DNA binding domain (1-147 aa) was followed by a part of the
herpesvirus transcriptional activator VP16 (413-490 aa), generated by
polymerase chain reaction (PCR) and inserted into the
EcoRI-Spe I sites of the pME18S expression vector. A
series of MEN deletion mutants named pME18S-dMEN1-7(HA) were
constructed by digesting the pME18S-MEN(HA) plasmid with appropriate
restriction enzymes, blunting with either T4 DNA polymerase or Klenow
fragment, and religating. The EcoRI fragments from these constructs were cloned in the sense orientation into the EcoRI site downstream of the 5' long terminal repeat of the retroviral vector pSRMSVtkneo and named pSRMSVtkneo-MEN and pSRMSVtkneo-dMEN1-7, respectively. The empty pSRMSVtkneo vector (pSRMSVtkneo-Mock) was
used as a negative control.
A reporter plasmid, 2x RGC-Luc, was generated by introducing
double-stranded oligonucleotides containing the sequence of two ribosomal gene cluster (RGC) p53 sites
(5'-GTTGCCTGGACTTGCCTGGCCTTGCCTTTTC-3')33 upstream of the tk promoter of the tk-Luc plasmid. pXP2-HH0.34 was
generated by inserting genomic cyclin G promoter sequence, HH0.34,34 upstream of luciferase coding sequence of the
pXP2 plasmid. HH0.34 was a gift from Dr Koji Okamoto (Columbia
University, New York, NY). GAL4-Luc was generated by
inserting two tandemly repeated GAL4 binding sites into the
BamHI site upstream of the tk promoter of the tk-Luc plasmid.
pRC/CMV-p53 (CMVp53) was generated by introducing the entire coding
region of the human p53 cDNA into the expression vector, pRC/CMV
(Stratagene, La Jolla, CA).
Cell culture.
COS1, COS7, and Rat1 cells were cultured in Dulbecco's modified
Eagle's medium (DMEM), and HeLaS3 cells were cultured in Ham's F12
medium. The media were all supplemented with antibiotics and 10% fetal
calf serum (FCS). HeLaS3 cells, originally developed by Drs T.T. Puck,
P.I. Marcus, and S.J. Cieciura, were given by the Health
Science Research Resources Bank (Osaka, Japan).
Transfection and luciferase assay.
Cells were plated at a density of 3.0 × 105 cells per
6-cm dish 12 hours before transfection. Reporter and expression
plasmids together with 250 ng of pCMV- gal (Stratagene) were
transfected into the cells by the calcium phosphate precipitation
method as described previously.35 To keep the transfection
efficiency as constant as possible among the samples to be compared,
the total amount of DNA in terms of weight was adjusted to be equal by
adding pME18S plasmid DNA. After incubation for 36 hours, cells were
harvested and subjected to the luciferase assay using a Luciferase Assay System (Promega, Madison, WI) and Lumat LB-9501 (BSI Instruments Inc, Aliquoppa, PA). The data were corrected by the -galactosidase activity of each cell lysate assayed using Galacto-Light Plus (Tropix,
Bedford, MA). All transfection experiments were performed three times,
and the representative data are presented.
Immunoprecipitations and Western blotting.
COS1 cells were transfected using the diethyl aminoethyl
(DEAE)-dextran method36 and harvested 48 hours
later in phosphate-buffered saline (PBS). After centrifugation, they
were sonicated by the Sonicator 250 (Branson Ultrasonics, Danbury, CT)
in lysis buffer (25 mmol/L HEPES-KOH [pH 8.0], 150 mmol/L KCl, 2 mmol/L EDTA-2Na, 1 mmol/L dithiothreitol [DTT], 1 mmol/L phenylmethyl
sulfonyl fluoride [PMSF], 0.1% NP-40) and centrifuged
at 15,000 rpm for 5 minutes. The supernatants were incubated with
Protein A-sepharose conjugates (Sigma, St Louis, MO) for 6 hours at
4°C that were pretreated with anti-FLAG antibody (M2; Eastman Kodak
Co, New Haven, CT) or anti-p53 antibody (DO-1; Santa Cruz
Biotechnology, Inc, Santa Cruz, CA). After they were washed 3 times in
lysis buffer, the immunoprecipitates were electrophorased in 10%
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to nylon membranes (Millipore, Bedford, MA). The
membranes were blocked with 10% skim milk treated with anti-HA (HA.11;
BAbCO, Richmond, CA) or anti-p53 antibody, washed, and reacted with
mouse or rabbit anti-IgG antibody coupled to alkaline phosphatase
(Promega, Madison, WI). The blots were visualized by incubation with
nitroblue tetrazolium-bromochloroindolyl phosphate (Promega).
Viral infection.
To prepare the retrovirus stocks, 10 µg of pSRMSVtkneo-Mock,
pSRMSVtkneo-MEN, pSRMSVtkneo-dMEN4, and pSRMSVtkneo-dMEN7 constructs were transfected with 40 µg of  packaging plasmid into 1 × 106 COS7 cells by the DEAE-dextran method. The culture
medium containing viruses was harvested 96 hours after transfection.
Viral titers were determined and normalized. Viral infections were
performed by exposing 5 × 104 Rat1 cells to 1 mL of
virus stocks for 8 hours. G418-resistant populations were selected in
medium containing 800 µg/mL G418 after an additional incubation for
48 hours in medium without G418. The following experiments were
performed with uncloned cell populations.
Assays for transformation.
For the soft agar assay, cells of each transfected derivative were
trypsinized, suspended in DMEM containing 0.3% agar and 20% FCS, and
plated onto a bottom layer containing 0.6% agar. Cells were plated at
a density of 2 × 104 cells/3.5 cm dish in
tetraplicate, and colonies greater than 0.125 mm in diameter were
enumerated after 14 days. The numbers of colonies were presented as a
mean value.
| |
RESULTS |
MLL/MEN chimeric protein suppresses the transcriptional activity of
p53.
We investigated whether the MLL/MEN chimeric protein has an effect on
p53-dependent transcription. Luciferase assays were performed using a
reporter plasmid containing two p53 binding sites upstream of tk basal
promoter region (2x RGC-Luc), which has widely been used in assays of
p53-mediated transcriptional activity.37,38 We used HeLaS3
cells for our assays because both alleles of the p53 gene are deleted
in them.39 The p53 expression vector (CMVp53), alone or in
combination with the MLL/MEN expression vector [pME18S-MLL/MEN(HA)],
was transfected into HeLaS3 cells together with 2x RGC-Luc.
Transfection of CMVp53 led to a marked luciferase activity as
expected37 (Fig 1A, lane 2). Expression of the MLL/MEN chimeric protein alone in HeLaS3 cells had no
effects on the reporter plasmid (lane 3). Surprisingly, the luciferase
activity mediated by CMVp53 significantly decreased when coexpressed
with the MLL/MEN chimeric protein (lane 6). Therefore, the MLL/MEN
chimeric protein repressed the transcriptional activity of p53.
View larger version (37K):
[in this window]
[in a new window]
| Fig 1.
Effect of the MLL/MEN chimeric protein on p53-dependent
transcription. (A) HeLaS3 cells were transfected with 2 µg of 2x
RGC-Luc, 2 µg of CMVp53, and 2 µg of pME18S-MEN(HA),
pME18S-MLL/MEN(HA), or pME18S-tMLL(HA) by using a calcium phosphate
method. The total amounts of the transfected DNAs were equalized in all
samples with the backbone vector, pME18S. Equal amounts of the cell
lysates were assayed for luciferase activities 24 hours after
transfection. The highest value was arbitrarily set as 100 and all
others were consequently normalized. (B) HeLaS3 cells were transfected
with 2 µg of pXP2-HH0.34, 2 µg of CMVp53, and 2 µg of
pME18S-MEN(HA), pME18S-MLL/MEN(HA), or pME18S-tMLL(HA) by using a
calcium phosphate method and were assayed in the same way as (A).
|
|
Next, we determined which portion of the MLL/MEN chimeric protein is
responsible for repression of p53-induced transcriptional activity.
Luciferase assays were performed in the same way using the MEN
expression vector [pME18S-MEN(HA)] and the tMLL expression vector
[pME18S-tMLL(HA)], instead of the pME18S-MLL/MEN(HA). As did the
MLL/MEN chimeric protein, expression of either the MEN protein or the
tMLL protein alone in HeLaS3 cells had no effects on the level of
reporter activation (lanes 4 and 5). In the cotransfection experiments,
the tMLL protein, which does not include the MEN part of the chimeric
protein, could not repress p53-dependent transcription at all (lane 8).
However, the MEN protein was able to repress the activity of p53 to a
the similar level as the MLL/MEN chimeric protein (lane 7). Therefore,
the MEN portion of the MLL/MEN chimeric protein is responsible for
repression of p53-mediated transcriptional activity. This finding was
confirmed by similar results obtained with luciferase assays using a
reporter plasmid containing cyclin G native promoter sequence (Fig 1B).
These repressive effects do not seem to be mediated through the direct
suppression of the promoter, because neither MLL/MEN nor MEN inhibited
the luciferase activity of the reporter (Fig 1A and B, lanes 3 and 4).
To exclude the possibility that MEN or MLL/MEN could be a global
suppressor of transcription, we performed luciferase assays using a
luciferase reporter plasmid with two tandemly repeated GAL4 binding
sites (GAL4-Luc) and pME18S-GAL4/VP16, which is an expression vector
GAL4 DNA containing the binding domain fused to the herpesvirus
transcriptional activator VP16 (GAL4-VP16). In this experiment, neither
MEN nor MLL/MEN repressed luciferase activities exhibited by GAL4-VP16
(Fig 2). Therefore, both MEN and MLL/MEN
seem to be specific suppressors of p53-mediated transcription, but not
global suppressors of transcription. As shown in lane 6, the MEN
protein coexpressed with GAL4-VP16 produced a higher luciferase
activity than GAL4-VP16 alone (lane 2). We speculate that MEN, being an
RNA polymerase II elongation factor, might work as a potential
activator of transcription.
View larger version (43K):
[in this window]
[in a new window]
| Fig 2.
Effect of the MLL/MEN chimeric protein on p53-independent
transcription. HeLaS3 cells were transfected with 2 µg of GAL4-Luc, 2 µg of pME18S-GAL4/VP16, and 2 µg of pME18S-MEN(HA) or
pME18S-MLL/MEN(HA) by using a calcium phosphate method and were assayed
in the same way as in Fig 1.
|
|
MLL/MEN chimeric protein binds to p53 in vivo.
Based on the results shown above, we suspected that the
suppressive effect of the chimeric protein on the activity of p53 was mediated by through interaction between these two proteins. To
examine the possibility that the MLL/MEN chimeric protein binds to p53, immunoprecipitations followed by Western blotting were performed (Fig 3A). COS1 cells were
transfected with the p53 expression vector (CMVp53) alone or in
combination with the MLL/MEN expression vector
[pME18S-MLL/MEN(FLAG)]. Forty-eight hours later, cell extracts were
subjected to immunoprecipitation with the monoclonal anti-FLAG antibody. Western analysis using the anti-p53 antibody showed that p53 was coimmunoprecipitated with the anti-FLAG antibody in
the presence of the chimeric protein (lane 1), but not in its absence
(lane 2) or without the anti-FLAG antibody (lane 3). Lane 4 shows the
total cell lysate from COS1 cells transfected with CMVp53 as a control.
These results indicate that p53 is associated with the MLL/MEN chimeric
protein in vivo. The MLL/MEN chimeric protein could hardly be
detected in the immunoprecipitates with the anti-p53 antibody,
possibly due to the relative difficulty in detecting a large
molecule such as the MLL/MEN protein (data not shown).
View larger version (37K):
[in this window]
[in a new window]
| Fig 3.
The MLL/MEN chimeric protein binds to p53. (A) Cell
extracts derived from COS1 cells transfected with CMVp53, alone or in
combination with pME18S-MLL/MEN(FLAG), were immunoprecipitated with
anti-FLAG monoclonal antibody (lanes 1 and 2) or with the protein
A-Sepharose beads only (lane 3). Western blot was performed using
anti-p53 monoclonal antibody (DO-1). Lane 4 contains the total cell
lysate (TCL) from COS1 cells transfected with CMVp53 as a control. (B)
Cell extracts derived from COS1 cells transfected with CMVp53, alone or
in combination with pME18S-MEN(FLAG), were immunoprecipitated with
anti-FLAG monoclonal antibody (lanes 1 and 2) or with the protein
A-Sepharose beads only (lane 3). Western blot was performed using
anti-p53 monoclonal antibody (DO-1). Lane 4 contains the TCL from COS1
cells transfected with CMVp53 as a control. (C) Cell extracts derived
from COS1 cells transfected with CMVp53, alone or in combination with
pME18S-MEN(HA), were immunoprecipitated with anti-p53 monoclonal
antibody (lanes 1 and 2) or with the protein A-Sepharose beads only
(lane 3). Western blot was performed using anti-HA polyclonal antibody
(HA.11). Cell extracts derived from COS1 cells transfected with
pME18S-MEN(HA) were immunoprecipitated with anti-HA polyclonal antibody
and subjected to Western blot using anti-HA polyclonal antibody (lane
4) as a control.
|
|
Given that the MEN portion of the MLL/MEN chimeric protein is
sufficient for repression of p53-mediated transcriptional activity, we
investigated whether this region is responsible for binding of the
MLL/MEN chimeric protein to p53. COS1 cells were transfected with the
p53 expression vector (CMVp53), alone or in combination with the MEN
expression plasmid, pME18S-MEN(FLAG), or pME18S-MEN(HA), and
immunoprecipitations followed by Western analysis were performed (Fig
3B and C). Western analysis of the immunoprecipitates showed that p53
was coimmunoprecipitated with the anti-FLAG antibody in the presence of
the MEN protein (Fig 3B, lane 1), but not detected in its absence (Fig
3B, lane 2) or without the anti-FLAG antibody (Fig 3B, lane 3). Lane 4 shows the total cell lysate from COS1 cells transfected with CMVp53 as
a control. Conversely, Western blot analysis of the immunoprecipitates
with the anti-p53 antibody showed the presence of the MEN protein of 80 kD associated with p53 (Fig 3C, lane 1). Lane 4 shows the MEN protein
detected in the immunoprecipitates with the anti-HA antibody. These
results showed that the MLL/MEN chimeric protein binds to p53 in vivo, and that the MEN portion of the chimeric protein is sufficient for
binding to p53.
The regions of MEN responsible for repression of p53-mediated
transactivation.
To determine the regions of the MEN protein responsible for repression
of p53-mediated transactivation, we constructed a series of deletion
mutants of MEN, named dMEN1-7 (Fig 4).
Luciferase assays were performed as described above using 2x RGC-Luc as
a reporter plasmid. As expected, tMLL could not inhibit p53-mediated transcription of the 2x RGC promoter. Among the deletion mutants, only dMEN4 and dMEN7, which lack roughly the C-terminal half and the
N-terminal half of the MEN protein, respectively, were unable to
suppress the luciferase activity mediated by p53
(Fig 5, lanes 19 and 22). Because some
mutants such as dMEN2 and dMEN5 could partially suppress p53-mediated
transactivation, the extensive deletions in dMEN4 or dMEN7 appear to be
necessary for complete disruption of the repressive effect on
p53-mediated transactivation.
View larger version (18K):
[in this window]
[in a new window]
| Fig 4.
Deletion mutants of the MEN protein. Structures of
full-length MEN and seven deletion mutants are shown. Restriction
enzyme sites used to construct the mutants are indicated. aa, amino
acids.
|
|
View larger version (61K):
[in this window]
[in a new window]
| Fig 5.
Deletion mutants of MEN that disrupt inhibitory functions
on p53-mediated transactivation. HeLaS3 cells were transfected with 2 µg of 2x RGC-Luc, 2 µg of CMVp53, and 2 µg of
pME18S-MEN(HA), pME18S-MLL/MEN(HA), pME18S-tMLL(HA), or one of
the expression vectors of MEN mutants by using a calcium
phosphate method and were assayed in the same way as in Fig 1.
|
|
The regions of MEN responsible for binding to p53.
Next, to determine the region(s) of MEN required for binding to p53,
immunoprecipitations followed by Western blotting were performed. COS7
cells were transfected with CMVp53, in combination with one
of the expression vectors of MEN [pME18S-MEN(HA)] or its deletion
mutants [pME18SdMEN1-7(HA)]. Forty-eight hours later, cell
extracts were subjected to immunoprecipitation with the monoclonal anti-p53 antibody. The amounts of these proteins used for the immunoprecipitation were comparable, as shown in
Fig 6B. Western analysis using the anti-HA
polyclonal antibody showed that only dMEN7, which could not suppress
the transcriptional activity of p53 in luciferase assays, was not
coimmunoprecipitated with the anti-p53 antibody (Fig 6A, lane 8).
Although all other mutants, including dMEN4, were coimmunoprecipitated
with anti-p53 antibody (Fig 6A, lanes 2 through 7), the binding between
p53 and dMEN1 or dMEN2 seems to be relatively weak. This indicates that
the binding region for p53 is partially deleted in these mutant
proteins. Because the only significant difference between dMEN2 and
dMEN7 is the presence of the N-terminal 40 amino acids, these amino acids must be important for p53 binding. All these results strongly suggest that the region of the MEN protein responsible for binding p53
is located in the N-terminal half of the protein.
View larger version (42K):
[in this window]
[in a new window]
| Fig 6.
Deletion mutants of MEN that disrupt the binding with
p53. (A) Cell extracts derived from COS1 cells transfected with CMVp53
and pME18S-MEN(HA) or pME18S-dMEN1-7(HA) were immunoprecipitated with
anti-p53 monoclonal antibody. Western blot was performed using anti-HA
polyclonal antibody (HA.11). (B) Lanes 1 through 8 contain the equal
amount of the TCLs from the same samples used for the
immunoprecipitation assays in (A). Western blot was performed using
anti-HA polyclonal antibody (HA.11).
|
|
Although dMEN4 was unable to repress p53-mediated
transactivation in the luciferase assays, it
coimmunoprecipitated with anti-p53 antibody. It is possible that
the C-terminal half of MEN, which is deleted in dMEN4, is responsible
for repression of p53-mediated transcription, but not for binding p53.
As is the case with the binding region, it seems that the repression
domain broadly spans the C-terminal half of the MEN protein.
In support of this, dMEN5, which lacks a smaller part of the C-terminal
region than does dMEN4, was able to repress p53-mediated
transactivation in the luciferase assays, although to a lesser extent
than MEN (Fig 5, lane 20).
These results suggest that MEN contains two functional domains, a
binding domain and a repression domain, which can be assigned to the
N-terminal half and the C-terminal half of the protein, respectively.
Correlation of p53 repressive activity and Rat1 transformation.
We have previously shown that overexpression of the MEN protein leads
to Rat1 cell transformation.18 To analyze the transforming ability of dMEN4 and dMEN7, which could not suppress the
transcriptional activity of p53 due to loss of the repression domain
and the binding domain, respectively, we evaluated the capacity for
anchorage-independent growth by the Rat1 transformation assay. Rat1
derivatives expressing the corresponding mutants were seeded in DMEM
containing 0.3% agar and 20% FCS, and colony formation was estimated
as an anchorage-independent growth ability. Mock transfectants barely
made colonies larger than 0.125 mm in diameter. However, as expected
MEN-expressing cells formed many colonies within 14 days. Surprisingly,
like mock transfectants, both dMEN4 and dMEN7 transfectants barely made
colonies (Fig 7). These results show that
both the N-terminal half and the C-terminal half regions of the MEN
protein are essential for transformation of Rat1 cells.
View larger version (21K):
[in this window]
[in a new window]
| Fig 7.
Soft agar assays examining Rat1 transformation ability of
MEN mutants. Soft agar colony counts of Rat1 derivatives expressing
each mutant were shown. Colonies greater than 0.125 mm in diameter were
counted on day 14. MEN-expressing cells formed significantly increased
numbers of macroscopic colonies compared with mock, dMEN4, and dMEN7
transfectants.
|
|
Therefore, p53-repressive activity correlates with the transforming
ability of Rat1 cells, and the oncogenic ability of MEN seems to be
exerted, at least to a certain extent, through repression of p53 activity.
| |
DISCUSSION |
In this study, we have shown that overexpression of the MLL/MEN
chimeric protein suppresses the transactivation ability of p53, using
reporter plasmids containing either the cyclin G native promoter
sequence or a minimal promoter with two p53 binding sites. This
inhibitory effect of the fusion protein on p53 function is shown to be
dependent on the MEN portion, as the MEN protein alone can repress
p53-mediated transcription to almost the same level as MLL/MEN. We have
also demonstrated that p53 physically associates with both MLL/MEN and
MEN, as p53 was coimmunoprecipitated with these two Flag-tagged
proteins by anti-Flag antibody. In addition, the MEN protein itself was
coimmunoprecipitated by anti-p53 antibody. Therefore, the fusion
protein may bind to p53 through its MEN domain. The suppressive effect
of the fusion protein appears to be by this functional interaction with
p53, rather than by a direct effect on the reporter plasmid, as it did
not have a suppressive effect on the reporter in the absence of p53.
This is the first report to describe an interaction between the MLL/MEN
chimeric protein and the tumor-suppressor protein, p53. The inhibitory effect of the chimeric protein on the antioncogene p53, mediated by
this protein-protein interaction, may be critical to the leukemogenesis associated with the t(11;19)(q23;p13.1) translocation.
Through analysis of the deletion mutants of MEN, we have shown that the
MEN protein may contain two functional regions: a binding domain for
p53 located in the N-terminal half, and a repression domain of
p53-mediated transcription located in the C-terminal half. The binding
domain is sufficient for association with p53, but not for inhibition
of its function. Blockade of p53-mediated transactivation also requires
the repression domain. While it is reasonable to consider that this
interaction with p53 is the first step by which the MLL/MEN or MEN
protein exert an inhibitory effect on p53, the exact molecular
mechanism that is involved remains unclarified. It is possible that the
repression domain recruits some kind of histone deacetylase to the
promoters activated by p53. Alternatively, this domain may block the
binding of p53 to promoters or cofactors that are needed for p53
transactivation. It is not clear whether the association between p53
and MLL/MEN or MEN is direct, as we have shown the interaction by
coimmunoprecipitation assays. The protein-protein interactions
demonstrated by this method do not necessarily prove direct
association. Thus, the association of p53 with the MLL/MEN chimeric
protein and the MEN protein may be indirect and mediated by other
intervening molecules that work as a bridge or an adaptor between these
two proteins.
We have also demonstrated that deletion mutants of MEN lacking either
of the N-terminal or C-terminal domains could not transform Rat1 cells.
As we have shown previously, these cells are transformed by the MEN
protein of full length.21 These data suggest that the
binding domain and the repression domain demonstrated by the molecular
experiments are also essential for the transformation ability of MEN
shown in the biological experiments using Rat1 cells.
Whether there are significant functional differences between the
MLL/MEN and the MEN proteins remains to be determined. Although the
MLL/MEN protein possesses an additional MLL portion in its N-terminal
region that does not exist in the MEN protein, these two proteins
suppressed the effect of p53 to almost the same level. In the
coimmunoprecipitation experiments, both proteins were
coimmunoprecipitated with p53. Therefore, the functions of these two
proteins in terms of binding to and suppressing p53 seem to be
identical. Furthermore, we have already examined the subcellular
localization of the MLL/MEN fusion and the MEN proteins in COS7 cells
and showed the same nuclear localization pattern for both
proteins.20 Thus, there appears to be no evidence that the
chimeric protein translocates with p53 from the region where the MEN
protein originally residues to another location, thereby sequestering
p53 away from its normal site. These findings raise the question of why
the generation of the novel fusion protein resulting from chromosomal
translocation leads to leukemic transformation, even in a situation in
which endogenous MEN protein already exists.9 There are
several potential answers to this question. First, the chimeric protein
might be more stable than the MEN protein. The fusion protein has
acquired the N-terminal sequence derived from MLL. This may increase
stability allowing the fusion protein to exert its function for a
longer period than the MEN molecule. Second, the chimeric protein may be expressed more strongly or steadily than the MEN protein in hematopoietic stem cells. As a result of the translocation, the expression of the MLL/MEN fusion protein is driven by the MLL promoter.
The higher expression of the fusion protein could be achieved by two
possible mechanisms. One possibility is that the MLL promoter is
stronger than the MEN promoter. The other possibility is that the MEN
promoter is precisely regulated by other transcription factors. For
example, these factors might be dependent upon the differentiation
stage or the cell cycle, or negatively regulated by excessive
expression of the MEN protein itself. The MLL/MEN chimeric protein
driven by the MLL promoter may escape from the precise control exerted
by the MEN promoter, leading to greater expression of the MLL/MEN
protein relative to the MEN protein. Consequently, the overall
inhibitory influence on p53 function could be increased or dysregulated.
MEN is a multifunctional molecule and acts not only as an RNA
polymerase II elongation factor, but also as a direct suppressor of
p53. We have already shown that the MEN protein stimulates AP-1
activity through its elongation activity and increases the colony
formation of Rat1 cells.19 This function is dependent on
the lysine-rich region in the MEN molecule. The oncogenic activity of
MEN may be observed in various kinds of cells that express Jun and Fos
proteins. It is possible that the MLL/MEN protein exerts a greater
oncogenic effect than the MEN protein itself through stimulation of
AP-1 activity. In this study, we spotlighted the MLL/MEN and the MEN
proteins as inhibitors of p53. This function appears to be unrelated to
the elongation activity. Wild-type p53 functions in normal
hematopoietic cell differentiation in multilineage
cells40-44 and may play pivotal roles in hematopoietic cell
maturation, possibly by inhibiting proliferation during terminal differentiation. It has been reported that the p53 genes are rearranged or mutated in a variety of leukemic cells.23-29 As is the
case with the lack of p53 expression in homozygous deletion, inhibition of the tumor-suppressive effect of p53 by the MLL/MEN protein could
cause leukemias. Therefore, repression of p53 tumor-suppressive transcriptional activity by the MLL/MEN chimeric protein may play an
important role in leukemogenesis by the t(11;19)(q23;p13.1) translocation.
| |
FOOTNOTES |
Submitted June 5, 1998; accepted February 19, 1999.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Hisamaru Hirai, MD, Department of
Hematology and Oncology, Faculty of Medicine, University of Tokyo,
Hongo 7-3-1, Bunkyo-ku, Tokyo 113-8655, Japan.
| |
REFERENCES |
1.
Rowley JD:
Recurring chromosome abnormalities in leukemia and lymphoma.
Semin Hematol
27:122, 1990[Medline]
[Order article via Infotrieve]
2.
Rubnitz JE, Behm FG, Downing JR:
11q23 rearrangements in acute leukemia.
Leukemia
10:74, 1996[Medline]
[Order article via Infotrieve]
3.
Tkachuk DC, Kohler S, Cleary ML:
Involvement of a homolog of Drosophila Trithorax by 11q23 chromosomal translocations in acute leukemias.
Cell
71:691, 1992[Medline]
[Order article via Infotrieve]
4.
Gu Y, Nakamura T, Alder H, Prasad R, Canaani O, Cimino G, Croce CM, Canaani E:
The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene.
Cell
71:701, 1992[Medline]
[Order article via Infotrieve]
5.
Nakamura T, Alder H, Gu Y, Prasad R, Canaani O, Kamada N, Gale RP, Lange B, Crist WM, Nowell PC, Croce CM, Canaani E:
Genes on chromosomes 4, 9, and 19 involved in 11q23 abnormalities in acute leukemia share sequence homology and/or common motifs.
Proc Natl Acad Sci USA
90:4631, 1993[Abstract/Free Full Text]
6.
Prasad R, Leshkowitz D, Gu Y, Alder H, Nakamura T, Saito H, Huebner K, Berger R, Croce CM, Canaani E:
Leucine-zipper dimerization motif encoded by the AF17 gene fused to ALL-1(MLL) in acute leukemia.
Proc Natl Acad Sci USA
90:8107, 1994
7.
Chaplin T, Ayton P, Bernard OA, Saha V, Valle VD, Hilliton J, Gregorini A, Lillington D, Berger R, Young BD:
A novel class of zinc finger/leucine zipper genes identified from the molecular cloning of the t(10;11) translocation in acute leukemia.
Blood
85:1435, 1995[Abstract/Free Full Text]
8.
So CW, Caldas C, Liu MM, Chen SJ, Huang QH, Gu LJ, Sham MH, Wiedemann LM, Chan LC:
EEN encodes for a member of a new family of proteins containing an Src homology 3 domain and is the third gene located on chromosome 19p13 that fuses to MLL in human leukemia.
Proc Natl Acad Sci USA
94:2563, 1997[Abstract/Free Full Text]
9.
Mitani K, Kanda Y, Ogawa S, Tanaka T, Inazawa J, Yazaki Y, Hirai H:
Cloning of several species of MLL/MEN chimeric cDNAs in myeloid leukemia with t(11;19)(q23;p13.1) translocation.
Blood
85:2017, 1995[Abstract/Free Full Text]
10.
Thirman MJ, Levitan DA, Kobayashi H, Simon MC, Rowley JD:
Cloning of ELL, a gene that fuses to MLL in a t(11;19)(q23;p13.1) in acute myeloid leukemia.
Proc Natl Acad Sci USA
91:12110, 1994[Abstract/Free Full Text]
11.
Shilatifard A, Lane WS, Jackson KW, Conaway RC, Conaway JW:
An RNA polymerase II elongation factor encoded by the human ELL gene.
Science
271:1873, 1996[Abstract]
12.
Taki T, Sako M, Tsuchida M, Hayashi Y:
The t(11;16)(q23;p13) translocation in myelodysplastic syndrome fuses the MLL gene to the CBP gene.
Blood
89:3945, 1997[Abstract/Free Full Text]
13.
Ida K, Kitabayashi I, Taki T, Taniwaki M, Noro K, Yamamoto M, Ohki M, Hayashi Y:
Adenoviral E1A-associated protein p300 is involved in acute myeloid leukemia with t(11;22)(q23;q13).
Blood
90:4699, 1997[Abstract/Free Full Text]
14.
Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa K, Yokota J, Morishita K:
Fusion of the MLL gene with two different genes, AF-6 and AF 5alpha, by a complex translocation involving chromosomes 5, 6, 8 and 11 in infant leukemia.
Oncogene
13:2121, 1996[Medline]
[Order article via Infotrieve]
15.
Joh T, Yamamoto K, Kagami Y, Kakuda H, Sato T, Yamamoto T, Takahashi T, Ueda R, Kaibuchi K, Seto M:
Chimeric MLL products with a Ras binding cytoplasmic protein AF6 involving in t(6;11)(q27;q23) leukemia localize in the neucleus.
Oncogene
15:1681, 1997[Medline]
[Order article via Infotrieve]
16.
Megonigal MD, Rappaport EF, Jones DH, Williams TM, Lovett BD, Kelly KM, Lerou PH, Moulton T, Budarf ML, Felix CA:
t(11;22)(q23;q11.2) in acute leukemia of infant twins fuses MLL with hCDCrel, a cell division cycle gene in the genomic region of deletion in DiGeorge and velcardiofacial syndromes.
Proc Natl Acad Sci USA
95:6413, 1998[Abstract/Free Full Text]
17.
Taki T, Shibuya N, Taniwaki M, Hanada R, Morishita K, Bessho F, Yanagisawa M, Hayashi Y:
ABI-1, a human homolog to mouse Abl-interactor 1, fuses the MLL gene in acute myeloid leukemia with t(10;11)(p11.2;q23).
Blood
92:1125, 1998[Abstract/Free Full Text]
18.
Shilatifard A, Haque D, Conaway RC, Conaway JW:
Structure and function of RNA polymerase II elongation factor ELL. Identification of two overlapping ELL functional domains that govern its interaction with polymerase and the ternary elongation complex.
J Biol Chem
272:22355, 1997[Abstract/Free Full Text]
19.
Shilatifard A, Duan DR, Haque D, Florence C, Schubach WH, Conaway JW, Conaway RC:
ELL2, a new member of an ELL family of RNA polymerase II elongation factors.
Proc Natl Acad Sci USA
94:3639, 1997[Abstract/Free Full Text]
20.
Kanda Y, Mitani K, Tanaka T, Tanaka K, Ogawa S, Yazaki Y, Hirai H:
Subcellular localization of the MEN, MLL/MEN and truncated MLL proteins expressed in leukemic cells carrying the t(11;19)(q23;p13.1) translocation.
Int J Hematol
66:189, 1997[Medline]
[Order article via Infotrieve]
21.
Kanda Y, Mitani K, Kurokawa M, Yamagata T, Yazaki Y, Hirai H:
Overexpression of the MEN/ELL protein, an RNA polymerase II elongation factor, results in transformation of Rat1 cells with dependence on the lysine-rich region.
J Biol Chem
273:5248, 1998[Abstract/Free Full Text]
22.
Hollstein M, Sidransky D, Vogelstein B, Harris C:
p53 mutations in human cancers.
Science
253:49, 1991[Abstract/Free Full Text]
23.
Fenaux P, Jonveaux P, Quiqundon I, Lai JL, Pignon JM, Loucheux-Lefebvre MH, Bauters F, Berger R, Kerckaert JP:
p53 gene mutations in acute myeloid leukemia with 17p monosomy.
Blood
78:1652, 1991[Abstract/Free Full Text]
24.
Sugimoto K, Toyoshima H, Sakai R, Miyagawa K, Hagiwara K, Hirai H, Ishikawa F, Takaku F:
Mutations of the p53 gene in lymphoid leukemia.
Blood
77:1153, 1991[Abstract/Free Full Text]
25.
Fenaux P, Jonveaux P, Quiquandon I, Preudhomme C, Lai JL, Vanrumbeke M, Loucheux-Lefebvre MH, Bauters F, Berger R, Kerchaert JP:
Mutations of the p53 gene in B cell acute lymphoblastic leukemia. A report on 60 cases.
Leukemia
6:42, 1992[Medline]
[Order article via Infotrieve]
26.
Ahuja H, Bar-Eli M, Advani SH, Benchimol S, Cline MJ:
Alterations in the p53 gene and the clonal evolution of the blast crisis of chronic myelocytic leukemia.
Proc Natl Acad Sci USA
86:6783, 1989[Abstract/Free Full Text]
27.
Feinstein E, Cimino G, Gale RP, Alimena G, Berthier R, Kishi K, Goldman J, Zaccaria A, Berrebi A, Canaani E:
p53 in chronic myelogenous leukemia in acute phase.
Proc Natl Acad Sci USA
88:6293, 1991[Abstract/Free Full Text]
28.
Sugimoto K, Hirano N, Toyoshima H, Chiba S, Mano H, Takaku F, Yazaki Y, Hirai H:
Mutations of the p53 gene in myelodysplastic syndrome (MDS) and MDS-derived leukemia.
Blood
81:3022, 1993[Abstract/Free Full Text]
29.
Adamson DJA, Dawson AA, Bennett B, King DJ, Haites NE:
p53 mutation in the myelodysplastic syndromes.
Br J Haematol
89:61, 1995[Medline]
[Order article via Infotrieve]
30.
El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B:
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817, 1993[Medline]
[Order article via Infotrieve]
31.
Seto E, Usheva A, Zambetti GP, Momand J, Horikoshi N, Weinmann R, Levine AJ, Shenk T:
Wild-type p53 binds to the TATA-binding protein and represses transcription.
Proc Natl Acad Sci USA
89:12028, 1992[Abstract/Free Full Text]
32.
Miyashita T, Reed JC:
Tumor suppressor p53 is a direct transcriptional activator of the human bax gene.
Cell
80:293, 1995[Medline]
[Order article via Infotrieve]
33.
Kern SE, Kinzler KW, Bruskin A, Jarosz D, Friedman P, Prives C, Vogelstein B:
Identification of p53 as a sequence-specific DNA-binding protein.
Science
252:1708, 1991[Abstract/Free Full Text]
34.
Okamoto K, Beach D:
Cyclin G is a transcriptional target of the p53 tumor suppressor protein.
EMBO J
13:4816, 1994[Medline]
[Order article via Infotrieve]
35.
Chiu R, Angel P, Karin M:
JunB differs in its biological properties from, and is a negative regulator of, c-Jun.
Cell
59:979, 1989[Medline]
[Order article via Infotrieve]
36.
Yamagata T, Nishida J, Sakai R, Tanaka T, Honda H, Hirano N, Mano H, Yazaki Y, Hirai H:
Of the GATA-binding proteins, only GATA-4 selectively regulates the human interleukin-5 gene promoter in interleukin-5-producing cells which express multiple GATA-binding proteins.
Mol Cell Biol
15:3830, 1995[Abstract]
37.
Jost CA, Marin MC, Kaelin WG Jr:
p73 is a human p53-related protein that can induce apoptosis.
Nature
389:191, 1997[Medline]
[Order article via Infotrieve]
38.
Farmer G, Bargonetti J, Zhu H, Friedman P, Prywes R, Prives C:
Wild-type p53 activates transcription in vitro.
Nature
358:83, 1992[Medline]
[Order article via Infotrieve]
39.
Jia LQ, Osada M, Ishioka C, Gamo M, Ikawa S, Suzuki T, Shimodaira H, Niitani T, Kudo T, Akiyama M, Kimura N, Matsuo M, Mizusawa H, Tanaka N, Koyama H, Namba M, Kanamaru R, Kuroki T:
Screening the p53 status of human cell lines using a yeast functional assay.
Mol Carcinog
19:243, 1997[Medline]
[Order article via Infotrieve]
40.
Kastan MB, Radin AI, Kuerbitz SJ, Onyekwere O, Wolkow CA, Civin CI, Stone KD, Woo T, Ravindranath Y, Craig RW:
Levels of p53 protein increase with maturation in human hematopoietic cells.
Cancer Res
51:4279, 1991[Abstract/Free Full Text]
41.
Shaulsky G, Goldfinger N, Paled A, Rotter V:
Involvement of wild-type p53 in pre-B-cell differentiation in vivo.
Proc Natl Acad Sci USA
88:8982, 1991[Abstract/Free Full Text]
42.
Bi S, Lanza F, Goldman JM:
The involvement of "tumor suppressor" p53 in normal and chronic myelogenous leukemia hemopoiesis.
Cancer Res
54:582, 1994[Abstract/Free Full Text]
43.
Banerjee D, Lenz HJ, Schneiders B, Manno DJ, Ju JF, Spears CP, Hochhauser D, Danenberg K, Danenberg P, Bertino JR:
Transfection of wild-type but mutant p53 induces early monocytic differenciation in HL60 cells and increases their sensitivity to stress.
Cell Growth Differ
6:1405, 1995[Abstract]
44.
Shounan Y, Dolnikov A, MacKenzie KL, Miller M, Chan YY, Symonds G:
Retroviral transduction of hematopoietic progenitor cells with mutant p53 promotes survival and proliferation, modifies differentiation potential and inhibits apoptosis.
Leukemia
10:1619, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Zhou, X. Feng, B. Ban, J. Liu, Z. Wang, and W. Xiao
Elongation Factor ELL (Eleven-Nineteen Lysine-rich Leukemia) Acts as a Transcription Factor for Direct Thrombospondin-1 Regulation
J. Biol. Chem.,
July 10, 2009;
284(28):
19142 - 19152.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Wiederschain, H. Kawai, A. Shilatifard, and Z.-M. Yuan
Multiple Mixed Lineage Leukemia (MLL) Fusion Proteins Suppress p53-mediated Response to DNA Damage
J. Biol. Chem.,
July 1, 2005;
280(26):
24315 - 24321.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Maki, H. Arai, K. Waga, K. Sasaki, F. Nakamura, Y. Imai, M. Kurokawa, H. Hirai, and K. Mitani
Leukemia-Related Transcription Factor TEL Is Negatively Regulated through Extracellular Signal-Regulated Kinase-Induced Phosphorylation
Mol. Cell. Biol.,
April 15, 2004;
24(8):
3227 - 3237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Wiederschain, H. Kawai, J. Gu, A. Shilatifard, and Z.-M. Yuan
Molecular Basis of p53 Functional Inactivation by the Leukemic Protein MLL-ELL
Mol. Cell. Biol.,
June 15, 2003;
23(12):
4230 - 4246.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Simone, P. E. Polak, J. J. Kaberlein, R. T. Luo, D. A. Levitan, and M. J. Thirman
EAF1, a novel ELL-associated factor that is delocalized by expression of the MLL-ELL fusion protein
Blood,
July 1, 2001;
98(1):
201 - 209.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. Johnstone, M. Gerber, T. Landewe, A. Tollefson, W. S. Wold, and A. Shilatifard
Functional Analysis of the Leukemia Protein ELL: Evidence for a Role in the Regulation of Cell Growth and Survival
Mol. Cell. Biol.,
March 1, 2001;
21(5):
1672 - 1681.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
T. Taki, H. Kano, M. Taniwaki, M. Sako, M. Yanagisawa, and Y. Hayashi
AF5q31, a newly identified AF4-related gene, is fused to MLL in infant acute lymphoblastic leukemia with ins(5;11)(q31;q13q23)
PNAS,
December 7, 1999;
96(25):
14535 - 14540.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Miller, K. Williams, R. W. Johnstone, and A. Shilatifard
Identification, Cloning, Expression, and Biochemical Characterization of the Testis-specific RNA Polymerase II Elongation Factor ELL3
J. Biol. Chem.,
October 6, 2000;
275(41):
32052 - 32056.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION