SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Verbeek, W. Articles by Koeffler, H. P. Search for Related Content PubMed PubMed Citation Articles by Verbeek, W. Articles by Koeffler, H. P. Related Collections Hematopoiesis and Stem Cells Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 93 No. 10 (May 15), 1999: pp. 3327-3337 C/EBP Directly Interacts With the DNA Binding Domain of c-myb and Cooperatively Activates Transcription of Myeloid Promoters By Walter Verbeek, Adrian F. Gombart, Alexey M. Chumakov, Carsten Müller, Alan D. Friedman, and H. Phillip Koeffler From the Division of Hematology/Oncology, Department of Medicine, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles CA; and the Division of Pediatric Oncology, The Johns-Hopkins University, Baltimore, MD.     ABSTRACT TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES C/EBP is essential for granulocytic differentiation. We investigated the role of C/EBP in the transcriptional activation of various myeloid-specific genes. We found that two C/EBP isoforms, p32 and p30, possessing transcriptional activation domains were coexpressed in myeloid cells. Interestingly, isoform C/EBP p30 but not p32 was differentially upregulated in NB-4 promyelocytic leukemia cells treated with retinoids. Both isoforms bound specifically to C/EBP sites in myeloid promoters. The kd for C/EBP binding to the C/EBP site of the neutrophil elastase promoter was 4.2 nmol/L. In transfection assays using the nonhematopoietic cell line, CV-1, the p32 isoform activated promoters from the myeloid-specific mim-1, neutrophil elastase, and granulocyte colony-stimulating factor (G-CSF) receptor genes by 2.5-, 1.8-, and 1.6-fold, respectively. The p30 isoform lacked significant transcriptional activity, suggesting that other hematopoietic-specific factors were required for its function. Consistent with this prediction, transfections into the hematopoietic cell line Jurkat showed a 9.0- and 2.5-fold activation of the mim-1 promoter by the p32 and p30 isoforms, respectively. The additional 32 NH2-terminal residues made p32 a significantly more potent transcriptional activator than p30. T lymphoblasts (Jurkat cells) and immature myeloid cells (eg, Kcl22 cells) expressed high levels of the c-myb hematopoietic transcription factor. Cotransfection of c-myb with either the p32 or p30 isoform of C/EBP in CV-1 cells cooperatively transactivated the mim-1 promoter by 20- and 16-fold, respectively, and the neutrophil elastase promoter by 10-and 7-fold, respectively. Pulldown assays showed that each C/EBP isoform interacted directly with the DNA binding domain of the c-myb protein. Further studies showed that Kcl22 myeloid cells only contained active C/EBP, but not C/EBP, C/EBP, or C/EBP. A mutation of the C/EBP site in the neutrophil elastase promoter markedly decreased the transactivation of the promoter in Kcl22 myeloblasts. These results demonstrate a role for C/EBP in regulating myeloid promoters, such as neutrophil elastase, probably through a direct interaction with c-myb. © 1999 by The American Society of Hematology.     INTRODUCTION TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES C/EBP1,2 IS A RECENTLY cloned member of the CCAAT enhancer binding protein (C/EBP) family of transcriptional regulators that also includes C/EBP,3 C/EBP,4-9 C/EBP,10 C/EBP,5,11,12 and C/EBP.13 All members share a highly homologous basic DNA binding region and a leucine zipper dimerization domain. Their DNA binding consensus site has been identified as TKNNGYAAK (Y = C or T, K = T or G).14 In contrast to the wide range of expression of the other C/EBP members, the expression of C/EBP is restricted to the granulocytic and T-lymphoid lineages. In the granulocytic lineage, C/EBP is expressed in the later stages of differentiation from the promyelocyte to the mature granulocyte.15,16 Four different C/EBP isoforms p32, p30, p27, and p14 are generated by alternative promoter usage, alternative mRNA splicing, and alternative translation start sites.2,16 As described for other C/EBP proteins, this produces either full-length proteins (C/EBP p32, p30, and p27) having DNA binding and transactivation domains (TAD) or a truncated protein (C/EBP p14) that retains the DNA binding domain but lacks a TAD.17 We recently mapped the essential transactivating element of C/EBP to amino acid residues 33-50 for p32 and 1-18 for p30.18 Interestingly, the domain with maximal transactivating capacity (residues 1-70 of C/EBP p30) is present in both isoforms. Details about the expression of C/EBP isoforms during myeloid differentiation are presently unknown. A number of myeloid-specific genes contain C/EBP binding sites in their promoter regions, including those encoding the receptors for granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and macrophage colony-stimulating factor (M-CSF),19-21 and the primary granule proteins, such as myeloperoxidase (MPO), neutrophil elastase, and proteinase 3.22-24 C/EBP, in concert with the transcription factor PU.1, transactivates a number of these myeloid genes, including those encoding the receptors for G-CSF and GM-CSF. C/EBP transactivates the M-CSF receptor in cooperation with AML-121 and the neutrophil elastase promoter in cooperation with c-myb.25 C/EBP (NF-IL6, LAP) is known to transactivate a number of lipopolysaccharide (LPS)-responsive genes such as interleukin-1 (IL-1)26 and tumor necrosis factor-27 in monocytes. Ectopic expression of C/EBP in murine macrophage cell lines confers LPS-dependent activation of IL-6 and monocyte chemoattractant protein 1. In addition, macrophage inhibitory protein 1 (MIP-1), MIP-1, and the M-CSF receptor have been implicated as targets of C/EBP.28 Transactivation studies show that the mim-1 and MPO promoters can be activated by C/EBP in myeloid cells.2 The C/EBP proteins and myb cooperate in transcriptional activation of myeloid genes. This cooperation was first described for NFM (chicken C/EBP) and myb, which induced the expression of myelomonocytic-related genes (eg, the mim-1 and lysozyme genes) even in nonmyeloid cells, underlining their importance as a myeloid differentiation switch.29,30 Mammalian C/EBP also synergizes with v-myb in the transactivation of mim-1.31 Mink et al32,33 showed that both proteins interact with each other via their DNA binding domains. Recently, the cooperation of the two transcription factors was linked to their interaction with the coactivator protein p300.32,33 The coactivators p300 and the closely related CREB binding protein (CBP) are involved in translocation t(11;22) and t(8;16), respectively, which are associated with acute myeloid leukemia.34,35 Although C/EBP proteins are presently not known to be direcly involved in leukemia-associated translocations, a direct interaction between C/EBP and the leukemia-specific fusion protein AML1-ETO has been shown to interfere with C/EBP-mediated transactivation of myeloid genes.36 Knock-out murine studies showed that C/EBP, C/EBP, and C/EBP are critical for normal myelopoiesis. The C/EBP/ mice developed a complex phenotype reflecting the wide expression pattern of C/EBP. In the hematopoietic system, they exhibit a maturation arrest in myelopoiesis at the stage of the immature myeloblasts.37 The C/EBP/ mice displayed predominantly defects in macrophage function.38 The C/EBP deletional mice have aberrations in late differentiation of both the neutrophilic and eosinophic lineages. Granulocytes of C/EBP/ mice showed dysplastic features and are not completely functional. These animals died between 3 and 5 months after birth due to infectious complications.39 In this study, we addressed several important questions about the structure and function of C/EBP. Are both isoforms (p32 and p30) of C/EBP expressed in myeloid cells? Do they differ in their ability to activate transcription in hematopoietic cells? Do C/EBP p32 and p30 bind to and transactivate myeloid promoters such as mim-1 and neutrophil elastase? Finally, does either the C/EBP p32 or p30 form of C/EBP directly interact and cooperatively activate transcription with c-myb?     MATERIALS AND METHODS TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Eukaryotic expression vectors and promoter-reporter gene constructs.   The construction of the C/EBP (p30) expression vector and the amino-terminal truncation mutants were described previously.2,18 Eukaryotic expression vectors for the C/EBP isoforms p32, p27, p14, and murine C/EBP were a generous gift from Dr K. Xanthopoulos (Aurora Inc, San Diego, CA). The pCMV4 c-myb expression vector was kindly provided by Linda Shapiro (St Jude's Hospital, Memphis, TN), and the HA epitope-tagged CBP expression vector was from R. Goodman (Vollum Institute, Oregon Health Sciences, University of Oregon, Portland, OR).40 Neutrophil elastase promoter-luciferase constructs were described previously.23 The Mim-1 promoter (240 to +150) luciferase construct was a kind gift from Dr A. Leutz (Max Delbrueck Center for Molecular Medicine, Berlin, Germany).30 Preparation of nuclear extracts and Western blotting.   For preparation of nuclear extracts, 5 × 106 COS-1 cells were washed three times with ice-cold phosphate-buffered saline (PBS). After the last wash, adherent cells were scraped off the dish with a rubber policeman and resuspended in 500 µL extraction buffer B (20 mmol/L HEPES, pH 7.9, 20% glycerol, 10 mmol/L NaCl, 0.2 mmol/L EDTA, 1.5 mmol/L MgCl2, 0.1% Triton X, 1 mmol/L dithiothreitol [DTT], 1 mmol/L phenylmethyl sulfonyl fluoride [PMSF], 40 µL/mL Complete [Boehringer, Indianapolis, IN]). After 15 minutes of incubation on ice, the nuclei were pelleted at 250g for 10 minutes. Nuclei were resuspended in extraction buffer B, and NaCl was added dropwise with mixing to a final concentration of 300 mmol/L NaCl. Nuclei were rocked for 60 minutes at 4°C. Samples were microcentrifuged at 12,000 RPM and supernatants were frozen at 80°C. A total of 107 Kcl22, U937, KG-1, and NB4 cells were washed twice in ice-cold PBS and subsequently lysed in RIPA buffer supplemented with protease inhibitors. NB4 cells (5 × 105) were grown in RPMI + 10% fetal bovine serum (FBS) + 106 mol/L all-trans-retinoic acid for 24 hours before protein extracts were prepared in RIPA buffer. Nuclear extracts (15 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gel. The gel was electroblotted on a polyvinylidene difluoride membrane (Immobilon-P; Millipore, Bedford, MA). The membrane was blocked with 1% gelatin and incubated with the primary antibody (rabbit polyclonal antibody, dilution 1:1,000 to 1:2,000) and a secondary horseradish peroxidase-conjugated donkey antirabbit antibody (Amersham, Arlington Heights, IL). Detection was performed using the ECL detection kit (Amersham). The generation of affinity-purified rabbit polyclonal C/EBP antibody against amino acids 1-115 of C/EBP p30 was described previously by us.2 Rabbit polyclonal antibodies to C/EBP, C/EBP, C/EBP, and murine and human c-myb, epitope (aa 98-108) of influenza hemagglutinin protein as well as CBP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). In vitro transcription and translation.   C/EBP and C/EBP genes cloned downstream of the T7 promoter in pCDNA I/III (Invitrogen, Carlsbad, CA) were transcribed with T7 RNA polymerase and in vitro translated in rabbit reticulocyte lysate using the TNT coupled Reticulocyte lysate system (Promega, Madison, WI) with 35S methionine (>1,000 Ci/mmol; Amersham) as a label in the translation reaction. The procedure was performed according to the manufacturer. Pulldown assays.   A fusion of the gene coding for maltose binding protein (MBP) and C/EBP was constructed using the pMalc2 plasmid (New England Biolabs, Beverly, MA) as a backbone. C/EBP cDNA (p30) was cloned in-frame downstream of the MBP sequence. MBP, MBP-C/EBP, GST-C/EBP 1-115 (amino-acids 1-115 of C/EBP p30), and GST were expressed in the bacterial host BL21. GST-c-myb and truncation mutants were kindly provided by Dr Timothy Bender and expressed as previously described.41,42 Soluble protein was prepared by sonication of the bacterial culture 4 hours after induction with 100 mmol/L isoprophyl -D thiogalactopyranoside (IPTG). Amylose resin (New England Biolabs) or glutathione sepharose beads (Pharmacia Biotech, Uppsala, Sweden) were loaded with equal amounts of the different fusion proteins. The loaded amylose resin and the glutathione sepharose beads were washed three times with column buffer (20 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl, 0.5 mmol/L EDTA, 0.1mmol/L DTT) and then incubated 2 hours either with COS-1 cell nuclear extract expressing either the c-myb or C/EBP protein or with in vitro translated 35S-methionine labeled C/EBP protein. The resin (MBP fusion) or the beads (GST fusions) were washed three times with pulldown assay buffer (150 mmol/L NaCl, 20 mmol/L Tris-Cl, pH 7.5, 0.3% NP40, 0.1 mmol/L EDTA, 1 mmol/L DTT, 1 mmol/L PMSF, 10 µg/mL leupeptin and pepstatin) and resuspended in 25 µL 1× SDS-PAGE sample buffer. The samples were boiled for 5 minutes and separated by electrophoresis on a 4% to 15% gradient SDS polyacrylamide minigel (Bio-Rad, Hercules, CA). The gel was electroblotted overnight and probed with antibody against either c-myb or C/EBP. When using 35S-methionine-labeled proteins, the gel was directly fixed in 40% methanol/10% acetic acid; dehydrated in 10% methanol, 2.5% acetic acid, and 2.5% glycerol; dried; and exposed overnight to Kodak Biomax X-ray film (Eastman Kodak, Rochester, NY). Electromobility shift assay (EMSA).   Double-stranded oligonucleotides (30 bp) containing the C/EBP consensus site of a specific promoter and adjacent sequences were end-labeled with 32P ATP. A standard reaction contained 1 ng labeled probe, 10 µg COS-1 nuclear extract expressing either C/EBP or C/EBP, 2 µg pdIdC, and 4.5 µg bovine serum albumin (BSA) in a 20 µL volume. Competing cold oligonucleotides (shown below at 10- and 100-fold molar excess) or antibodies (1 µg/µL) were added where indicated. Electrophoresis was performed on a 4% polyacrylamide gel at 30 mA. Neutrophil elastase: 5' TCGAGGCCAGGATGGGGCAATACAACCC 3'; mutant neutrophil elastase: 5' TCGAGGCCAGGACTCGAGGATACAACCCG 3'; G-CSF receptor: 5' AAGGTGTTGCAATCCCAGC 3'. Transient transfections.   For protein expression, 10 µg of eukaryotic expression vector (C/EBP, C/EBP, c-myb, and CBP-HA) was transfected into COS-1 cells (10-cm dish). Transfection was performed with Superfect reagent (Qiagen, Valencia, CA) over 3 hours according to the manufacturer's protocol. Nuclear extracts were prepared after 48 hours, as described above. For reporter gene assays, CV-1 cells were grown in Dulbecco's modified Eagle's medium (DMEM) + 10% fetal calf serum (FCS). Approximately 5 × 105 cells/dish were plated in 60-mm dishes at 1 day before transfection. Promoter-reporter constucts (5 µg) and expression vectors (100 ng to 1 µg) as well as a control 1 µg pCMV-Gal vector (1 µg) were ethanol precipitated and resuspended in 25 µL sterile TE buffer. Transfection was performed with Superfect reagent (Qiagen) as described above. Cells were washed with PBS and fed with DMEM + 10% FCS. Protein extracts were prepared 40 hours later in reporter lysis buffer (Promega). Luciferase activity was determined according to standard procedures. -Galactosidase activity was used to normalize transfection efficiencies. Approximately 2.5 × 107 Kcl22 or U937 myeloid cells were transfected by electroporation at 340 V with 15 µg of reporter plasmid, 5 µg of expression plasmid, and 3 µg of -galactosidase vector in 500 µL RPMI + 10% FCS. Cells were harvested after 16 hours. Transfection of 2 to 3 × 106 Jurkat cells was performed with 20 µL Lipofectin reagent (GIBCO BRL, Gaithersburg, MD) according to the manufacturer's protocol using 3 µg reporter plasmid, 330 ng expression plasmid (or 75 to 750 ng in dose-response experiments), and 1 µg pCMV-Gal vector and adjusted to 5 µg total DNA with empty expression vector. At 24 hours posttransfection, cells were activated with TPA (5 ng/mL) and calcium ionophore A21387 (125 ng/mL). At 48 hours posttransfection, cells were lysed with reporter lysis buffer (Promega) and micocentrifuged at 12,000 RPM. Supernatants were assayed for luciferase activity. To monitor the levels of the exogenously expressed C/EBP proteins, a pellet from each sample was resuspended in RIPA buffer (50 mmol/L Tris-Cl, pH 8.0, 1% NP40, 0.5% deoxycholicacidsodiumsalt (DOC), 0.1% SDS, 300 mmol/L NaCl, Complete 40 µL/mL), rocked for 1 hour at 4°C, and microcentrifuged at 12,000 RPM. C/EBP was immunoprecipitated with 0.5 µg affinity-purified C/EBP antibody and collected with Protein A sepharose beads. The beads were washed three times in IP buffer (50 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl, 0.5% NP40) and then resuspended in SDS-PAGE sample buffer. Samples were electrophoresed on a 10% to 20% gradient polyacrylamide gel containing SDS, electroblotted, and probed with C/EBP antibody.     RESULTS TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Myeloid leukemia cell lines express two transcriptionally active C/EBP isoforms: p32 and p30.   Two translation start sites were previously described for C/EBP.1,2 The first generates a protein with a predicted molecular weight of 32.2 kD (p32 isoform); the second in-frame ATG generates a protein that is 32 amino acids shorter (p30 isoform). We examined myeloid leukemia cell lines for the expression of these two isoforms by Western blot analysis and found that both isoforms were present in the myeloid cell lines Kcl22, NB4, and U937 at a ratio of approximately 2:1 (p32:p30). Cell line KG-1 did not express C/EBP (Fig 1). We previously reported the upregulation of C/EBP during granulocytic differentiation of cell line NB-4 with retinoid treatment.43 Interestingly, we find that only the p30 isoform of C/EBP was upregulated 24 hours after treatment of NB4 cells with 106 mol/L all-trans retinoic acid. The level of isoform p32 remained unchanged, indicating that both isoforms are differentially regulated (lane 7). For comparison, C/EBP p32 (lane 1) and p30 (lane 2) proteins expressed in transfected COS-1 cells were run alongside the nuclear extracts from myeloid cell lines. View larger version (34K): [in this window] [in a new window]   Fig 1. Western blot demonstrating the expression of p32 and p30 isoforms of C/EBP in myeloid cell lines: Kcl22 myeloblasts (lane 3), NB4 promyelocytes (lane 4), and U937 myelomonoblasts (lane 5). The isoforms p32 and p30 were expressed at a ratio of approximately 2:1. NB4 cells treated with 106 mol/L ATRA for 24 hours selectively upregulate C/EBP p30 (lane 7). The KG-1 early myeloblasts did not express detectable C/EBP levels (lane 6). C/EBP p32 (lane 1) and p30 (lane 2) cDNAs transfected and expressed in COS-1 cells were run alongside as positive controls. C/EBP binds to C/EBP sites in myeloid promoters.   Because the DNA binding domains of C/EBP proteins are highly homologous, we hypothesized that the DNA binding site of C/EBP is either similar or identical to the known sites of other C/EBP proteins. Double-stranded oligonucleotides representing C/EBP sites of the neutrophil elastase and G-CSF receptor promoter were used for EMSA. C/EBP (p32/p30) expressed in COS-1 cells was able to bind to both sites and binding was competed by cold self oligonucleotide and supershifted by antibody to C/EBP. A similar binding was seen with C/EBP expressed in COS-1 cells (Fig 2A). Also, C/EBP present in nuclear extracts of the myeloid cell line Kcl22 bound to the C/EBP site of the neutrophil elastase promoter (Fig 2B). The complex was supershifted by the affinity-purified C/EBP antiserum and its formation was inhibited by the commercially available antibody against CRP1 (rat homolog of C/EBP), demonstrating that the complex contained C/EBP (Fig 2B, lanes 7 and 8). The complex could not be supershifted by antibodies against C/EBP, C/EBP, and C/EBP (Fig 2B, lanes 9 through 11), indicating that these proteins are not present in nuclear extracts of the Kcl22 cell line. View larger version (125K): [in this window] [in a new window]   Fig 2. (A) EMSA study. Both C/EBP and C/EBP bound to the C/EBP site of the promoter of the G-CSF receptor. A 32P -ATP-labeled, double-stranded oligonucleotide containing the C/EBP site of the promoter of the G-CSF receptor was added to lysate from cos-1 cells expressing either C/EBP or C/EBP. Binding was competed by 20-fold excess of cold-self. Retarded bands were supershifted by specific antisera. (B) EMSA study with 32P -ATP-labeled C/EBP consensus site oligonucleotide derived from neutrophil elastase promoter. Oligonucleotides were retarded by C/EBP protein complex present in nuclear extracts of the Kcl22 cell line in characteristic location for C/EBP migration. Antibodies directed against C/EBP (lane 7) and CRP1 (rat C/EBP) (lane 8) either supershifted or blocked binding of the complex, respectively. Antibodies to C/EBP, C/EBP, and C/EBP did not supershift or block formation of the complex (lanes 9 through 11), indicating that C/EBP is the predominant C/EBP protein binding to neutrophil elastase C/EBP consensus site in Kcl22 nuclear extracts. Because the expression of C/EBP and C/EBP partly overlaps during myeloid differentiation and because both proteins can bind to the same DNA motif, we studied their relative DNA binding affinities to the C/EBP binding site of the neutrophil elastase promoter. Decreasing amounts of labeled oligonucleotides representing the C/EBP site were titrated with a constant amount of COS-1 cell extract expressing the respective C/EBP protein, and the bound complexes were separated from the free probe by EMSA (Fig 3A). The amounts of bound and free probe were quantitated with an Ambis imaging system (Ambis Inc, San Diego, CA). The values were plotted as bound/free versus bound, and the results were used to determine the dissociation constant, kd (kd = 1/slope). The kd for C/EBP was 0.65 nmol/L and the kd for C/EBP was 4.2 nmol/L (Fig 3B and C), showing that C/EBP had a 6.5-fold higher affinity than C/EBP to these C/EBP binding sequences. View larger version (83K): [in this window] [in a new window]   Fig 3. (A) Comparison of DNA binding affinity of C/EBP (p32) and C/EBP to neutrophil elastase C/EBP site. EMSA study with 32P -ATP-labeled C/EBP binding site oligonucleotide from the neutrophil elastase promoter and either C/EBP or C/EBP expressed in COS-1 cells. The same amount of protein was incubated with decreasing concentrations of hot oligonucleotides (left to right).  emissions of the retarded bands and the free hot probe were quantitated by an AMBIS imaging system. (B) and (C) show the Scatchard analyses of the data for C/EBP and C/EBP, respectively. The slope of the curves express the affinity of the protein for the DNA motif. kd: 1/slope: C/EBP: 4.2 nmol/L; C/EBP: 0.65 nmol/L. C/EBP p32 is a transcriptional activator in heterologous cells.   The transactivation potential of C/EBP isoforms p32 and p30 were initially examined using the promoters of the neutrophil elastase, G-CSF receptor, and mim-1 genes in heterologous cells. Expression plasmids for either C/EBP p32 or p30 were cotransfected with promoter-luciferase reporter constructs into CV-1 cells, which do not express endogenous C/EBP proteins. Levels of C/EBP isoforms p32 and p30 proteins after transfection with these expression vectors were shown to be similar by Western blotting of protein extracts from transfected cells (Fig 1, lanes 1 and 2). C/EBP isoform p32 activated transcription from the neutrophil elastase promoter by 1.8-fold compared with C/EBP site mutants of the wild-type promoters. The mim-1 promoter was activated by 2.5-fold and the G-CSF receptor promoter by 1.6-fold (Fig 4A). These results are the average of three separate experiments. In all cases, the C/EBP isoform p30 activated the promoters less efficiently than did the p32 isoform. For comparison, the same experiments were performed with C/EBP. In CV-1 cells, C/EBP was more active than C/EBP for each of the promoter-reporter gene constructs (2- to 4-fold activation; Fig 4A). View larger version (59K): [in this window] [in a new window]   Fig 4. (A) Effect of C/EBP isoforms p32 and p30 and C/EBP on transcription of promoter-reporter plasmids for the mim-1, neutrophil elastase, and G-CSF receptor promoters in CV-1 cells. Maximal activation was achieved with 500 ng of the expression vector. C/EBP p32 activated the promoters 2.5-, 1.8-, and 1.6-fold, respectively. C/EBP p30 showed only a small effect on the mim-1 promoter (1.5-fold activation). C/EBP was used as a positive control and activated the reporters approximately twofold to fourfold. For experiments using the mim-1 and neutrophil elastase promoter constructs, transactivation by the empty expression plasmid served as the baseline. (B) Effect of C/EBP isoforms p32 and p30 on transcriptional activation of mim-1 and neutrophil elastase promoter in T-cell leukemia cell line Jurkat. Isoform p32 is 3.5-fold more active than p30 on the mim-1 promoter and 1.5-fold more active on the neutrophil elastase promoter. (C) Western blot demonstrates that transfected Jurkat cells expressed equal amounts of C/EBP p32 and p30. (D) Dose-response curve for transcriptional activation potential of C/EBP p30, p32, and C/EBP on mim-1 promoter in T-cell leukemia cell line Jurkat. Because the overall reporter gene activity for each of the constructs was low in CV-1 cells, we used Jurkat cells, a hematopoietic cell line, to confirm a potential, concentration-independent, in vivo difference in transcriptional activation potential between C/EBP p32 and p30. We cotransfected Jurkat cells with expression plasmids (330 ng) for either C/EBP p32 or p30 with either the mim-1 or neutrophil elastase promoter luciferase construct. After 48 hours, we measured the reporter gene activity in cytoplasmic lysates and determined the C/EBP expression level in the nuclear lysates (Fig 4B). Reproducibly, C/EBP p32 was threefold to fourfold more active than p30 on the mim-1 promoter and 1.5-fold more active than p30 on the neutrophil elastase promoter. In both cases, the expression levels of p32 and p30 were similar in the transfected samples (Fig 4C). Dose-response experiments using between 125 and 1,000 ng of the expression vector and 1 µg mim-1 reporter plasmid showed that the maximal effect on reporter gene activity was reached with expression plasmid concentrations as low as 125 to 250 ng. The rank order of transactivation efficiency was C/EBP > C/EBP p32 > C/EBP p30 (Fig 4D). C/EBP p32 was more potent than C/EBP p30 at each concentration of the expression vector. To determine if C/EBP could activate transcription from these promoters in myeloid cells, the activation of the neutrophil elastase was examined in Kcl22 and U937 cells. As demonstrated (Fig 2B), the only C/EBP family member binding to the neutrophil elastase promoter in Kcl22 cells was C/EBP. The wild-type neutrophil elastase promoter construct was 7.7-fold more active than the empty vector, p19Luc, in Kcl22 cells and 5.5-fold more active in U937 cells. In both cell lines, the NE promoter with a mutation in the C/EBP site was 30% to 50% less active than the wild-type promoter. Taken together, these data demonstrate that C/EBP can contribute to the transactivation of the neutrophil elastase promoter in myeloid cells (Fig 5). View larger version (17K): [in this window] [in a new window]   Fig 5. Relative luciferase activity of neutrophil elastase promoter constructs with and without C/EBP site mutation. Constructs tested in CV-1 cells and the myeloid leukemia cell lines Kcl22 and U937. Luciferase activty of the empty vector construct p19Luc was arbitrarily set as 1. () Wild-type; () C/EBP site mutant. Both C/EBP isoforms (p32 and p30) cooperate with c-myb in the transactivation of the neutrophil elastase and mim-1 promoters.   c-myb is a hematopoietic transcription factor known to cooperate with C/EBP proteins. It is highly expressed in Jurkat and Kcl22 cells (data not shown). A number of myeloid promoters have c-myb binding sites adjacent to C/EBP sites. We used the promoters from the neutrophil elastase and mim-1 genes to investigate the potential cooperation of C/EBP p32 and p30 isoforms with c-myb. c-myb alone activated the neutrophil elastase promoter about twofold. The C/EBP p32 isoform plus c-myb activated the neutrophil elastase promoter 10-fold in comparison to the empty expression vectors (Fig 6A). The C/EBP p30 plus c-myb activated the same promoter sevenfold. These results indicate that both C/EBP isoforms cooperatively activated the NE promoter with c-myb. The combination of both factors was 1.5-fold to twofold higher in activity than an additive effect. Mutation of either the C/EBP or myb sites in the neutrophil elastase promoter resulted in a loss of cooperativity between the factors (Fig 6A). This demonstrated that binding of C/EBP to the promoter was essential for a significant transcriptional activation. The insertion of 5 bp between the C/EBP and the myb sites to rotate the relative position of the binding sites on the double helix did not change the cooperativity. Insertion of 10 bp slightly reduced cooperativity (Fig 6B). View larger version (74K): [in this window] [in a new window]   Fig 6. (A) Cooperative transactivation of the neutrophil elastase promoter by c-myb and either p32 or p30 isoforms of C/EBP. Expression plasmids (500 ng) or empty vectors were cotransfected with 4 µg of either the NELuc reporter or reporter plasmids mutated at either the C/EBP or myb site. Combination of C/EBP and c-myb were 1.5-fold to twofold more active than the additive effect of both factors alone. Binding of both factors to their DNA motif was required for cooperation. () Wild-type; () C/EBP site mutant; () Myb site mutant. (B) Effect of spacing between C/EBP and c-myb binding sites in neutrophil elastase promoter on transcritional activation by C/EBP p30 and c-myb. Two constructs with the insertion of either 5 (NELuc +5) or 10 bp (NELuc +10) between the binding sites were used. (C) Cooperative transactivation of mim-1 promoter (240 to +150) Luc reporter plasmid with c-myb and either the p32 or p30 isoforms of C/EBP or C/EBP. Expression plasmids or empty vectors (500 ng) were cotransfected with reporter plasmid (4 µg) into CV-1 cells. Luciferase activity was assayed after 40 hours. A similar cooperative effect on transactivation of the mim-1 promoter was observed (Fig 6C). The C/EBP isoform p32 plus c-myb activated the promoter 20-fold, C/EBP p30 plus c-myb by 16-fold, and C/EBP plus c-myb by 37-fold. Again, both C/EBP p32 and p30 cooperated with c-myb in transcriptional activation. Together, the combination was twofold to threefold more active than a simple additive effect. C/EBP p32 and p30 isoforms and c-myb can interact in vitro.   To analyze the structural and functional aspects involved in the cooperativity between C/EBP and c-myb, we cotransfected various amino-terminal C/EBP truncation mutants with c-myb and the neutrophil elastase promoter reporter construct (Fig 7). Suprisingly, a truncated C/EBP protein (aa 118-281) that lacked the complete transactivation domain still cooperatively activated transcription from the promoter with c-myb, although at much lower levels than the full-length C/EBP (Fig 7). The truncation mutants alone did not transactivate the neutrophil elastase promoter (data not shown). This result implicates the carboxy-terminal half (DNA binding domain and leucine zipper) of C/EBP in the cooperativity with c-myb. View larger version (20K): [in this window] [in a new window]   Fig 7. C/EBP and c-myb cooperation is mediated by the carboxy-terminal half of C/EBP. Expression plasmids for C/EBP p32 (aa 1-281), C/EBP p30 (aa 33-281), and two amino-terminal truncation mutants of C/EBP (aa 118-281 and aa 218-281) (500 ng) were cotransfected with c-myb and NELuc reporter plasmid (4 µg) into CV-1 cells. Luciferase activity was assayed after 40 hours. The C/EBP 118-281 mutant lacks the transactivation domain but still cooperates with c-myb. The transcriptional cooperativity between C/EBP and c-myb could occur via either indirect or direct interactions. We tested whether both factors could physically interact using pulldown assays. c-myb was pulled down by the MBP-C/EBP fusion, but not by MBP alone (Fig 8A). In the reciprocal experiment, C/EBP was pulled down by GST-c-myb but not by GST alone (Fig 8A). The same result was obtained with C/EBP expressed in COS-1 cells or in vitro synthesized, 35S-methionine labeled C/EBP p32/p30 protein (data not shown). To define further the interacting domains, we used three GST fusion proteins representing different regions of c-myb: (1) the DNA binding domain (aa 1-185), (2) the DNA binding domain and the transactivation domain (aa 1-325), and (3) the negative regulatory domain (aa 326-636). Pulldown assays showed that all 35S-methionine-labeled C/EBP isoforms (p32, p30, p27, and p14) interacted with the GST-c-myb fusions 1-185 and 1-325 containing the DNA binding domain of c-myb. No interaction ocurred with either the GST-c-myb fusion 326-636 or the GST control. Furthermore, interaction of c-myb with all C/EBP isoforms indicated that the carboxy-terminal half of C/EBP, which is common to all isoforms, is sufficient for the interaction (Fig 8B). View larger version (101K): [in this window] [in a new window]   Fig 8. (A) C/EBP physically interacts with c-myb. MBP-C/EBP (p30) and GST-c-myb were used for in vitro pulldown assays. c-Myb was expressed in COS-1 cells; C/EBP (p32) was 35S methionine-labeled by in vitro translation in rabbit reticulocyte lysate. Pulldown of c-myb by MBP-C/EBP (left); pulldown of C/EBP (p32) by GSTc-myb (right). (B) Pulldown assay with three GSTc-myb truncation mutants: (a) DNA binding domain only, amino acids (aa) 1-185; (b) DNA binding domain + transactivation domain of c-myb, aa 1-325; and (c) amino-terminal, negative regulatory domain only, aa 326-636. 35S-methionine-labeled, in vitro-translated C/EBP isoforms p32, p30, p27, and p14 were used as input for separate pulldown experiments. All C/EBP isoforms were pulled down by GSTc-myb fusion proteins containing the DNA binding domain. (C) MBP C/EBP p30 pulldown assay with CBP as input. CBP does not bind to C/EBP p30 in vitro. C/EBP isoform p30 does not directly interact with coactivator protein CBP/p300 in vitro.   Transcriptional cooperativity between v-myb and C/EBP has been attributed to interaction with the coactivator protein, CBP/p300. To investigate a possible interaction between C/EBP p30 and CBP/p300, we performed pulldown assays using MBP-C/EBP as bait and CBP expressed in cos-1 cells as input using the same techniques as those described above. No in vitro interaction between CBP and C/EBP p30 was detected (Fig 8C).     DISCUSSION TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Regulation of eukaryotic transcription is a highly complex process involving chromatin accessibility, basal transcriptional machinery, and the interplay of ubiquitously expressed and lineage-restricted factors. C/EBP has a highly restricted pattern of expression limited predominately to the granulocytic lineage.30 Therefore, it is a good candidate for the regulation of lineage-restricted target genes in granulocytic cells. Because of the high degree of homology of the DNA binding domain between C/EBP and other C/EBP family members and published data for the rat homolog CRP1,10 we reasoned that C/EBP can bind to the same C/EBP consensus sites. Although we demonstrated binding to the C/EBP sites of the neutrophil elastase and G-CSF receptor promoters, the binding affinity was lower for C/EBP than for C/EBP. Further studies are needed to clarify whether homodimers or possibly heterodimers of C/EBP can bind with higher affinity to other DNA motifs. The differential upregulation of C/EBP p30 in NB4 cells treated with retinoids suggests a separate functional role for each isoform in myeloid differentiation. Although both C/EBP p32 and p30 contain the previously mapped transactivation domain,18 our data show that they differ in their potency by which they activate target promoters. C/EBP p32 was a significantly stronger transactivator of the mim-1 and neutrophil elastase promoters. We hypothesized that the NH2-terminal 32 amino acids may be important for interacting with additional proteins involved in the transcription of target genes of C/EBP p32, but not p30. The overall low transcriptional activation potential of C/EBP in heterologous cells could be a consequence of either low affinity for the selected sites or an indication that other factors are required either for cooperation with or activation of C/EBP in myeloid differentiation. In two model systems, we showed that a stronger transactivation can be mediated by the cooperation of C/EBP with the hematopoietic transcription factor c-myb. For the first time, we demonstrated that a C/EBP protein can directly interact with c-myb in vitro. Interacting regions are the DNA binding domain of c-myb and the carboxy-terminal half of C/EBP, common to all four C/EBP isoforms. The significance of this finding is supported by our functional studies using amino-terminal truncation mutants of C/EBP in transient transfections with c-myb which suggested an important functional role for the carboxy-terminal half of C/EBP in the cooperation with c-myb. Mink et al32 previously reported the interaction between the DNA binding domains of avian myeloblastosis virus v-myb and C/EBP. We conclude that the three mutations in the DNA binding domain of AMV v-myb (aa 91, 106, and 117), although important for differential binding to DNA motifs in comparison to E26 v-myb and c-myb,44 do not affect their binding to C/EBP proteins. However, the small reduction of cooperativity achieved by the insertion of 10 bp between the C/EBP and c-myb binding sites of the neutrophil elastase promoter suggests an additional mechanism. Recently, studies have shown that C/EBP interacted with the coactivator protein p300/CBP, which was important for the cooperation between v-myb and C/EBP.33 We did not observe an interaction between C/EBP p30 and CBP in pulldown assays. Additional studies will clarify whether differences exist among C/EBP isoforms and their interaction with coactivator proteins. A cooperation between C/EBP and c-myb may be relevant for target genes expressed in promyelocytes. Our data suggest a role for C/EBP in the transcriptional regulation of the neutrophil elastase promoter. This promoter is transcriptionally regulated by members of at least three transcription factor families: C/EBP, myb, and ets factors. If multiple family members with similar binding capacity are expressed in one cell type, predicting which factor is most important in vivo is difficult. The ets family members GABP and PU.1 are both expressed in myeloid cells. Recently, studies showed that GABP is a significantly more potent activator of transcription from the neutrophil elastase promoter than PU.1, suggesting that GABP is the important ets factor in vivo.45 Also, C/EBP and C/EBP are coexpressed in myeloid cells expressing neutrophil elastase. Both factors can bind to the promoter and synergize with c-myb. The relative contributions of C/EBP and C/EBP to the expression of the neutrophil elastase gene in normal myeloid differentiation remain to be elucidated. Interestingly, forced overexpression of C/EBP in NB4 cells increased clonal growth,2 a finding possibly related to its capacity to cooperate with c-myb, a transcription factor known to be involved in the regulation of hematopoietic cell proliferation.46 In conclusion, p32 and p30 isoforms of C/EBP act as transcriptional activators; and their potency is markedly enhanced by c-myb. Another partner may be required for efficient transcriptional activation by C/EBP p30 in late myeloid differentiation.     ACKNOWLEDGMENT The authors thank Dr Kleanthis Xanthopoulos for his helpful suggestions and his generosity in providing reagents.     FOOTNOTES Submitted July 27, 1998; accepted January 8, 1999. Supported in part by National Institutes of Health and US Army grants as well as by the C. + K. Koeffler + the Parker Hughes Fund. H.P.K. holds the Mark Goodson Chair in Oncology and is a member of the Jonsson Cancer Center. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact. Address reprint requests to H. Phillip Koeffler, MD, Cedars-Sinai Medical Center, Becker Building, Room B 213, 8700 Beverly Blvd, Los Angeles, CA 90048.     REFERENCES TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES 1. Antonson P, Stellan B, Yamanaka R, Xanthopoulos KG: A novel human CCAAT/enhancer binding protein gene, C/EBP is expressed in cells of lymphoid and myeloid lineages and is localized on chromosome 14q11.2 close to the T-cell receptor / locus. Genomics 35:30, 1996[Medline] [Order article via Infotrieve] 2. Chumakov AM, Grillier I, Chumakowa E, Chih D, Slater J, Koeffler HP: Cloning of the novel human myeloid-cell-specific C/EBP transcription factor. Mol Cell Biol 17:1375, 1997[Abstract] 3. Landschultz WH, Johnson PF, Adashi EY, Graves BJ, McKnight SL: Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 2:786, 1988[Abstract/Free Full Text] 4. Akira S, Isshiki H, Suguita T, Tanaba S, Kinishita S, Nishio Y, Hirano T, Kishimoto T: A nuclear factor for IL6 expression is a member of a C/EBP family. EMBO J 9:1897, 1990[Medline] [Order article via Infotrieve] 5. Cao Z, Umek RM, McKnight SL: Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5:1538, 1991[Abstract/Free Full Text] 6. Chang CJ, Chen TT, Lei HY, Chen DS, Lee SC: Molecular cloning of transcription factor, AGF/C/EBP that belongs to members of the C/EBP family. Mol Cell Biol 10:6642, 1990[Abstract/Free Full Text] 7. Descombes P, Schibler U: A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67:569, 1991[Medline] [Order article via Infotrieve] 8. Katz S, Kowentz-Leutz E, Muller C, Meese K, Ness SA, Leutz A: The NF-M transcription factor is related to C/EBP and plays a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells. EMBO J 12:1321, 1993[Medline] [Order article via Infotrieve] 9. Poli V, Mancini FP, Cortese R: IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63:643, 1990[Medline] [Order article via Infotrieve] 10. Roman C, Platero JS, Shuman JD, Calame K: Ig/EBP-1: A ubiquitously expressed immunoglobulin enhancer binding protein that is similar to C/EBP and heterodimerizes with C/EBP. Genes Dev 4:1404, 1990[Abstract/Free Full Text] 11. Kinoshita S, Akira S, Kishimoto T: A member of the C/EBP family, NF-IL6, forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc Natl Acad Sci USA 89:1473, 1992[Abstract/Free Full Text] 12. Williams PW, Cantwell CA, Johnson PF: A family of C/EBP related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes Dev 5:1553, 1991[Abstract/Free Full Text] 13. Ron D, Habener JF: CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant negative inhibitor of gene transcription. Genes Dev 6:439, 1992[Abstract/Free Full Text] 14. Osada S, Yamamoto H, Nishihara T, Imagawa M: DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J Biol Chem 271:3891, 1996[Abstract/Free Full Text] 15. Morosetti R, Park DJ, Chumakow AM, Grillier I, Shiohara M, Gombart AF, Nakamaki T, Weinberg K, Koeffler HP: A novel, myeloid transcription factor, C/EBP is upregulated during granulocytic, but not monocytic differentiation. Blood 90:2591, 1997[Abstract/Free Full Text] 16. Yamanaka R, Kim G-D, Radomska HS, Lekstrom-Himes J, Smith LT, Antonson P, Tenen D, Xanthopoulos K: CCAAT/enhancer binding protein  is preferentelly upregulated during granulocytic differentiation and its functional versatility is determined by alternative use of promoters and differential splicing. Proc Natl Acad Sci USA 94:6462, 1997[Abstract/Free Full Text] 17. Ossipow V, Desombles P, Schibler U: CCAAT/enhancer binding protein mRNA is translated into multiple proteins with different transcription activation potentials. Proc Natl Acad Sci USA 90:8219, 1993[Abstract/Free Full Text] 18. Williamson E, Xu HN, Gombart AF, Verbeek W, Chumakov AM, Friedman AD, Koeffler HP: Identification of transcriptional activation and repression domains in human C/EBP. J Biol Chem 273:14796, 1998[Abstract/Free Full Text] 19. Smith L, Hohaus S, Gonzalez DA, Dziennis S, Tenen D: PU.1 (Spi-1) and C/EBP regulate the granulocyte colony stimulating factor promotor in myeloid cells. Blood 88:1234, 1996[Abstract/Free Full Text] 20. Hohaus S, Petrovick MS, Voso MT, Sun Z, Zhang DE, Tenen DG: PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony stimulating factor receptor alpha gene. Mol Cell Biol 10:5830, 1995 21. Zhang DE, Hetherington CJ, Meyers S, Rhoades KL, Larson CJ, Chen HM, Hiebert SW, Tenen DG: CCAAT enhancer binding protein (C/EBP) and AML-1 (CBF alpha 2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol 16:1231, 1996[Abstract] 22. Sturrock A, Franklin KF, Hoidal JR: Human proteinase 3 expression is regulated by PU.1 in conjunction with a cytidine rich element. J Biol Chem 271:32392, 1996[Abstract/Free Full Text] 23. Nuchprayoon I, Meyer S, Scott LM, Suzow J, Hiebert S, Friedman AD: PEBP2 beta/CBF, the murine homolog of the myeloid AML-1 and PEBP2beta/CBF beta protooncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes, in immature myeloid cells. Mol Cell Biol 14:5558, 1994[Abstract/Free Full Text] 24. Austin GE, Zhao WG, Zhang W, Austin ED, Findley HW, Murtagh JJ Jr: Identification and characterisation of the human myeloperoxidase promoter. Leukemia 9:848, 1995[Medline] [Order article via Infotrieve] 25. Oelegeschlaeger M, Nuchprayoon I, Luescher B, Friedman AD: C/EBP, c-myb and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol Cell Biol 16:4717, 1996[Abstract] 26. Godambe SA, Chaplin DD, Takova T, Bellone CJ: Upstream NFIL6-like site located within a DNAse I hypersensitivity region mediates LPS-induced transcription of murine interleukin 1 beta gene. J Immunol 153:143, 1994[Abstract] 27. Pope RM, Leutz A, Ness SA: C/EBP beta regulation of the tumor necrosis factor alpha gene. J Clin Invest 94:1449, 1994 28. Williams SC, Du Y, Schwartz RC, Weiler SR, Ortiz M, Keller JR, Johnson PF: C/EBP is a myeloid specific activator of cytokine, chemokine, and macrophage-colony-stimulating factor receptor genes. J Biol Chem 273:13493, 1998[Abstract/Free Full Text] 29. Ness SA, Marknell A, Graf T: The v-myb oncogene product binds to and activates the promyelocyte-specific mim-1 gene. Cell 59:1115, 1989[Medline] [Order article via Infotrieve] 30. Ness SA, Kowentz-Leutz E, Casini T, Graf T, Leutz A: Myb and NFM: Combinatorial activators of myeloid genes in heterologous cell types. Genes Dev 7:749, 1993[Abstract/Free Full Text] 31. Oelgeschlaeger M, Jahnknecht R, Krieg J, Schreek S, Luescher B: Interaction of the coactivator CBP with myb proteins: Effects on myb-specific transactivation and on the cooperativity with NFM. EMBO J 15:2771, 1996[Medline] [Order article via Infotrieve] 32. Mink S, Kerber U, Klempnauer KH: Interaction of C/EBP and v-myb is required for synergistic activation of the mim-1 gene. Mol Cell Biol 16:1316, 1996[Abstract] 33. Mink S, Haenig B, Klempnauer KH: Interaction and functional cooperation of p300 and C/EBP. Mol Cell Biol 17:6609, 1997[Abstract] 34. Ida K, Kitabayashi I, Taki T, Taniwaki M, Noro K, Yamamoto M, Ohki M, Hayshi Y: Adenoviaral E1A-associated protein is involved in acute myeloid leukemia with t(11;22) (q23;q13) Blood 90:4699, 1997[Abstract/Free Full Text] 35. Giles RH, Dauwerse JG, Higgins C, Petrij F, Wessels JW, Beverstock GC, Dohner H, Jotterland-Belomo M, Falkenburg JH, Slater RM, van Ommen GJ, Hagemeijer A, van der Reijden BA, Breuning MH: Detection of CBP rearrangements in acute myeloid leukemia with t(8;16) Leukemia 11:2087, 1997[Medline] [Order article via Infotrieve] 36. Westendorf JJ, Yamamoto CM, Lenny N, Downing JR, Selsted ME, Hiebert SW: The t(8;21) fusion product AML-1-Eto associates with C/EBP, inhibits C/EBP alpha-dependent transcription, and blocks granulocytic differentiation. Mol Cell Biol 18:322, 1998[Abstract/Free Full Text] 37. Zhang DE, Zhang P, Wang N-D, Hetherington CJ, Darlington GJ, Tenen D: Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein -deficient mice. Proc Natl Acad Sci USA 94:569, 1997[Abstract/Free Full Text] 38. Tanaka T, Akira S, Yoshida K, Umemoto M, Yoneda Y, Shirafuji N, Fujiwara H, Suematsu S, Yoshida N, Kishimoto T: Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 80:353, 1995[Medline] [Order article via Infotrieve] 39. Yamanaka R, Barlow C, Lekstrom-Himes, Castilla LH, Liu PP, Eckhaus M, Decker T, Wynshaw-Boris A, Xanthopoulos K: Impaired granulopoiesis, myelodysplasia and early lethality in CCAAT/enhancer binding protein -deficient mice. Proc Natl Acad Sci USA 94:131187, 1997 40. Lunblad JR, Kwok RPS, Lawrence ME, Hurter ML, Goodman RH: Adenoviral E1A-associated protein 300 as a functional homologue of the transcriptional coactivator CBP. Nature 374:85, 1995[Medline] [Order article via Infotrieve] 41. Aziz N, Wu J, Dubendorff JW, Lipsick JS, Sturgill TW, Bender TP: c-myb and v-myb are differentially phosphorylated by p42mapk in vitro. Oncogene 8:2259, 1993[Medline] [Order article via Infotrieve] 42. Aziz N, Miglarese MR, Hendrickson RC, Shabanowitz J, Sturgill TW, Hunt DF, Bender TP: Modulation of c-myb induced transcription activation by a phosporylation site near the negative regulatory domain. Proc Natl Acad Sci USA 92:6429, 1995[Abstract/Free Full Text] 43. Chih DY, Chumakov AM, Park DJ, Silla AG, Koeffler HP: Modulation of mRNA expression of a novel human myeloid selective CCAAT/enhancer binding protein gene (C/EBP epsilon). Blood 90:2987, 1997[Abstract/Free Full Text] 44. Introna M, Golay J, Frampton J, Nakano T, Ness SA, Graf T: Mutations in v-myb alter the differentiation of myelomonocytic cells transformed by the oncogene. Cell 63:1287, 1990 45. Nuchprayoon I, Simkevich CP, Luo M, Friedman AD, Rosmarin AG: GABP cooperates with c-myb and C/EBP to activate the neutrophil elastase promoter. Blood 89:4546, 1997[Abstract/Free Full Text] 46. Graf T: Myb a transcriptional activator linking proliferation and differentiation in hematopoietic cells. Curr Opin Genet Dev 2:249, 1992[Medline] [Order article via Infotrieve] © 1999 by The American Society of Hematology.   0006-4971/99/9310-0016$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: R. Bedi, J. Du, A. K. Sharma, I. Gomes, and S. J. Ackerman Human C/EBP-{epsilon} activator and repressor isoforms differentially reprogram myeloid lineage commitment and differentiation Blood, January 8, 2009; 113(2): 317 - 327. [Abstract] [Full Text] [PDF] A. F. Gombart, J. Grewal, and H. P. Koeffler ATF4 differentially regulates transcriptional activation of myeloid-specific genes by C/EBP{epsilon} and C/EBP{alpha} J. Leukoc. Biol., June 1, 2007; 81(6): 1535 - 1547. [Abstract] [Full Text] [PDF] A. M. Chumakov, A. Silla, E. A. Williamson, and H. P. Koeffler Modulation of DNA binding properties of CCAAT/enhancer binding protein epsilon by heterodimer formation and interactions with NFkappaB pathway Blood, May 15, 2007; 109(10): 4209 - 4219. [Abstract] [Full Text] [PDF] H. Nakajima, N. Watanabe, F. Shibata, T. Kitamura, Y. Ikeda, and M. Handa N-terminal Region of CCAAT/Enhancer-binding Protein {epsilon} Is Critical for Cell Cycle Arrest, Apoptosis, and Functional Maturation during Myeloid Differentiation J. Biol. Chem., May 19, 2006; 281(20): 14494 - 14502. [Abstract] [Full Text] [PDF] E. A. Williamson, I. K. Williamson, A. M. Chumakov, A. D. Friedman, and H. P. Koeffler CCAAT/enhancer binding protein {epsilon}: changes in function upon phosphorylation by p38 MAP kinase Blood, May 15, 2005; 105(10): 3841 - 3847. [Abstract] [Full Text] [PDF] J. Kim, S. Sharma, Y. Li, E. Cobos, J. J. Palvimo, and S. C. Williams Repression and Coactivation of CCAAT/Enhancer-binding Protein {epsilon} by Sumoylation and Protein Inhibitor of Activated STATx Proteins J. Biol. Chem., April 1, 2005; 280(13): 12246 - 12254. [Abstract] [Full Text] [PDF] S. Gery, D. J. Park, P. T. Vuong, D. Y. Chih, N. Lemp, and H. P. Koeffler Retinoic acid regulates C/EBP homologous protein expression (CHOP), which negatively regulates myeloid target genes Blood, December 15, 2004; 104(13): 3911 - 3917. [Abstract] [Full Text] [PDF] F.-Q. Li, R. E. Person, K.-I. Takemaru, K. Williams, K. Meade-White, A. H. Ozsahin, T. Gungor, R. T. Moon, and M. Horwitz Lymphoid Enhancer Factor-1 Links Two Hereditary Leukemia Syndromes through Core-binding Factor {alpha} Regulation of ELA2 J. Biol. Chem., January 23, 2004; 279(4): 2873 - 2884. [Abstract] [Full Text] [PDF] S. Tavor, D. J. Park, S. Gery, P. T. Vuong, A. F. Gombart, and H. P. Koeffler Restoration of C/EBP{alpha} Expression in a BCR-ABL+ Cell Line Induces Terminal Granulocytic Differentiation J. Biol. Chem., December 26, 2003; 278(52): 52651 - 52659. [Abstract] [Full Text] [PDF] A. Khanna-Gupta, T. Zibello, H. Sun, P. Gaines, and N. Berliner Chromatin immunoprecipitation (ChIP) studies indicate a role for CCAAT enhancer binding proteins alpha and epsilon (C/EBPalpha and C/EBPepsilon ) and CDP/cut in myeloid maturation-induced lactoferrin gene expression Blood, May 1, 2003; 101(9): 3460 - 3468. [Abstract] [Full Text] [PDF] A. F. Gombart, S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, and H. P. Koeffler Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBPepsilon and PU.1 Blood, April 15, 2003; 101(8): 3265 - 3273. [Abstract] [Full Text] [PDF] S. Harju, K. J. McQueen, and K. R. Peterson Chromatin Structure and Control of {beta}-Like Globin Gene Switching Experimental Biology and Medicine, October 1, 2002; 227(9): 683 - 700. [Abstract] [Full Text] [PDF] C Gaillard, E Le Rouzic, C Creminon, and B Perbal Alteration of C-MYB DNA binding to cognate responsive elements in HL-60 variant cells Mol. Pathol., October 1, 2002; 55(5): 325 - 335. [Abstract] [Full Text] [PDF] H. Kishi, Z.-X. Jin, X.-C. Wei, T. Nagata, T. Matsuda, S. Saito, and A. Muraguchi Cooperative binding of c-Myb and Pax-5 activates the RAG-2 promoter in immature B cells Blood, January 15, 2002; 99(2): 576 - 583. [Abstract] [Full Text] [PDF] C. Nicot, R. Mahieux, C. Pise-Masison, J. Brady, A. Gessain, S. Yamaoka, and G. Franchini Human T-Cell Lymphotropic Virus Type 1 Tax Represses c-Myb-Dependent Transcription through Activation of the NF-{kappa}B Pathway and Modulation of Coactivator Usage Mol. Cell. Biol., November 1, 2001; 21(21): 7391 - 7402. [Abstract] [Full Text] [PDF] S. E. Lyons, B. C. Shue, A. C. Oates, L. I. Zon, and P. P. Liu A novel myeloid-restricted zebrafish CCAAT/enhancer-binding protein with a potent transcriptional activation domain Blood, May 1, 2001; 97(9): 2611 - 2617. [Abstract] [Full Text] [PDF] T. Kubota, S. Kawano, D. Y. Chih, Y. Hisatake, A. M. Chumakov, H. Taguchi, and H. P. Koeffler Representational difference analysis using myeloid cells from C/EBPepsilon deletional mice Blood, December 1, 2000; 96(12): 3953 - 3957. [Abstract] [Full Text] [PDF] E. Grotewold, M. B. Sainz, L. Tagliani, J. M. Hernandez, B. Bowen, and V. L. Chandler Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R PNAS, November 22, 2000; (2000) 250379897. [Abstract] [Full Text] K. Shimizu, I. Kitabayashi, N. Kamada, T. Abe, N. Maseki, K. Suzukawa, and M. Ohki AML1-MTG8 leukemic protein induces the expression of granulocyte colony-stimulating factor (G-CSF) receptor through the up-regulation of CCAAT/enhancer binding protein epsilon Blood, July 1, 2000; 96(1): 288 - 296. [Abstract] [Full Text] [PDF] K. R. Calvo, D. B. Sykes, M. Pasillas, and M. P. Kamps Hoxa9 Immortalizes a Granulocyte-Macrophage Colony-Stimulating Factor-Dependent Promyelocyte Capable of Biphenotypic Differentiation to Neutrophils or Macrophages, Independent of Enforced Meis Expression Mol. Cell. Biol., May 1, 2000; 20(9): 3274 - 3285. [Abstract] [Full Text] J.-G. Tang and H. P. Koeffler Structural and Functional Studies of CCAAT/Enhancer-binding Protein epsilon J. Biol. Chem., May 18, 2001; 276(21): 17739 - 17746. [Abstract] [Full Text] [PDF] K. K. Jacob and F. M. Stanley Elk-1, C/EBPalpha , and Pit-1 Confer an Insulin-responsive Phenotype on Prolactin Promoter Expression in Chinese Hamster Ovary Cells and Define the Factors Required for Insulin-increased Transcription J. Biol. Chem., June 29, 2001; 276(27): 24931 - 24936. [Abstract] [Full Text] [PDF] E. Grotewold, M. B. Sainz, L. Tagliani, J. M. Hernandez, B. Bowen, and V. L. Chandler Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R PNAS, December 5, 2000; 97(25): 13579 - 13584. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Verbeek, W. Articles by Koeffler, H. P. Search for Related Content PubMed PubMed Citation Articles by Verbeek, W. Articles by Koeffler, H. P. Related Collections Hematopoiesis and Stem Cells Social Bookmarking                   What's this?

	Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020