|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 10 (May 15), 1999:
pp. 3379-3390
Growth Factors and Cytokines Upregulate Gelatinase Expression in
Bone Marrow CD34+ Cells and Their Transmigration
Through Reconstituted Basement Membrane
By
Anna Janowska-Wieczorek,
Leah A. Marquez,
Jean-Marc Nabholtz,
Maria L. Cabuhat,
Jencet Montaño,
Hung Chang,
Jacob Rozmus,
James A. Russell,
Dylan R. Edwards, and
A. Robert Turner
From the Departments of Medicine and Oncology, University of Alberta,
Canadian Blood Services, Edmonton, Alberta, Canada; and the Departments
of Medicine and Biochemistry, The University of Calgary, Calgary,
Alberta, Canada.
 |
ABSTRACT |
The mechanism(s) underlying the release of stem/progenitor cells
from bone marrow into the circulation is poorly understood. We
hypothesized that matrix metalloproteinases (MMPs), especially gelatinases, which are believed to participate in the proteolysis of
basement membranes and in the migration of leukocytes, may facilitate
this process. First, we investigated whether CD34+
stem/progenitor cells express gelatinases A (MMP-2) and/or B (MMP-9)
and whether growth factors and cytokines (granulocyte colony-stimulating factor [G-CSF], granulocyte-macrophage
colony-stimulating factor [GM-CSF], stem cell factor [SCF],
macrophage colony-stimulating factor [M-CSF], interleukin-3 [IL-3],
IL-6, IL-8, and tumor necrosis factor- [TNF-]) are
able to modulate their expression. Next, we examined the transmigration
of these stem/progenitor cells through reconstituted basement membrane
(Matrigel) and its modulation by growth factors and cytokines.
CD34+ cells were obtained from steady-state bone marrow
and peripheral blood (from leukapheresis products collected either in
steady-state hematopoiesis or after mobilization with G-CSF plus
chemotherapy or G-CSF alone). We found that peripheral blood
CD34+ cells, regardless of whether they were mobilized or
not, strongly expressed both gelatinases (MMP-2 and MMP-9) in contrast
to steady-state bone marrow CD34+ cells, which did not.
However, all the growth factors and cytokines tested could induce MMP-2
and MMP-9 secretion by the latter cells. Moreover, the stimulatory
effects of G-CSF and SCF on both MMP-2 and MMP-9 secretion were found
to be significantly higher in CD34+ cells isolated from
bone marrow than in those from peripheral blood. In addition TNF-,
GM-CSF, and IL-6 increased the secretion of a partially active form of
MMP-2. Basal transmigration of bone marrow CD34+ cells
through Matrigel was lower than that of peripheral blood CD34+ cells (P < .0001), but growth factors and
cytokines increased it by 50% to 150%. Positive correlations were
established between expression of gelatinases and CD34+
cell migration (r > .9). The stimulatory effect of G-CSF was significantly greater on the migration of CD34+ cells
from bone marrow than on those from peripheral blood (P = .004). Moreover, CD34+ cell migration was reduced to
approximately 50% by antibodies to MMP-2 and MMP-9, tissue inhibitors
of metalloproteinases (rhTIMP-1 and -2), and
o-phenanthroline. TNF--induced gelatinase
secretion and migration of CD34+ cells and of clonogenic
progenitors (colony-forming unit-granulocyte-macrophage [CFU-GM], burst-forming unit-erythroid [BFU-E],
colony-forming unit granulocyte, erythroid, monocyte,
megakaryocyte [CFU-GEMM], and colony-forming
unit-megakaryocyte [CFU-MK]) were dose-dependent. Therefore, this study demonstrated that CD34+ cells that
are circulating in peripheral blood express both MMP-2 and MMP-9 and
transmigrate through Matrigel. In contrast, CD34+ cells
from steady-state bone marrow acquire similar properties after exposure
to growth factors and cytokines, which upregulate expression of
gelatinases and transmigration of these cells when they enter the
bloodstream. Hence, we suggest that growth factors and cytokines induce
release of stem/progenitor cells from bone marrow into peripheral blood
during mobilization, as well as during steady-state hematopoiesis, by
signaling through gelatinase pathways.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
PERIPHERAL BLOOD stem/progenitor cells
(PBSC) collected after mobilization with various stimuli, mostly
hematopoietic growth factors alone or in combination with chemotherapy,
have become the predominant source for autologous and more recently even for allogeneic transplantation.1 However, the
mechanisms that either govern the trafficking of hematopoietic
stem/progenitor cells between the bone marrow and blood in steady-state
hematopoiesis or upregulate their release into peripheral blood (after
administration of various mobilizing agents) remain poorly understood.
It is generally believed that peripheral blood stem/progenitor cells, such as mobilized CD34+ cells, originate from bone marrow
and that alteration of bone marrow stem/progenitor cell-stroma
adhesive interactions and subsequent transmigration of stem/progenitor
cells through the subendothelial basal lamina and the endothelial cell
layer occurs during mobilization.1-3 This latter step may
involve breaching of the basement membrane, which would necessitate the
production of matrix-degrading enzymes, especially those capable of
degrading type IV collagen. Gelatinases/type IV collagenases are
expressed by mature leukocytes and have been known to facilitate
transmigration of these cells from the bloodstream into
peripheral tissues (reviewed in Goetzl et al4), but their expression and their role in the transmigration of stem/progenitor cells has not been investigated.
Gelatinases/type IV collagenases belong to the matrix metalloproteinase
(MMP) family of at least 16 known endopeptidases (reviewed in
Birkedal-Hansen et al,5 Stetler-Stevenson et
al,6 and Chambers and Matrisian7) and consist
of 72-kD gelatinase A (MMP-2) and 92-kD gelatinase B (MMP-9).
Gelatinases are secreted as zymogens and possess a zinc-binding domain
at the active catalytic site like all other MMPs but, uniquely, have an
additional fibronectin-related collagen-binding domain. Both MMP-2 and
MMP-9 degrade denatured collagens (gelatins) as well as native collagen
type IV (which forms the basic scaffolding network of basement membrane
structures) and native collagen type V, vitronectin, and elastin. In
addition, MMP-2 can digest fibronectin, laminin, and collagen types VII and X. The activation of MMP zymogens (pro-MMPs) involves cleavage of
the N-terminal propeptide, which maintains latency by binding the zinc
at the active site, to produce an active form of lower molecular
weight.8 Pro-MMP-9 is activated through cleavage by other
MMPs such as MMP-3,9 whereas a membrane-type of MMP (MT-MMP) has been shown to mediate the activation of
pro-MMP-2.10,11 MMPs are susceptible to inhibition by
natural tissue inhibitors of metalloproteinases (TIMPs; TIMP-1, -2, -3, and -4)12 as well as synthetic inhibitors, eg,
o-phenanthroline. TIMPs inhibit metalloproteinase activity by
forming noncovalent complexes with active MMPs; however, TIMP-1 and
TIMP-2 may also form complexes with pro-MMP-9 and pro-MMP-2, respectively.5,6,12 TIMP-2 also plays a role in the
cellular activation of MMP-2 by forming a complex with cell surface
MT1-MMP, which acts as a receptor for pro-MMP-2. Small amounts of
TIMP-2 added to cells expressing MT1-MMP can enhance pro-MMP-2
activation, because this increases the concentration of the
MT1-MMP/TIMP-2 receptor for pro-MMP-2 on the cell surface. However, at
high TIMP-2 concentrations, all of the MT1-MMP molecules on the cell
surface are complexed with TIMP-2 and no active MT1-MMP remains to
initiate activation of pro-MMP-2.11
Gelatinases are produced by many cell types, including connective
tissue, endothelial, epithelial, and hematopoietic cells. Recently, we
reported that immature acute myelogenous leukemia (AML) cells express
gelatinases and are able to penetrate reconstituted basement membrane
(Matrigel13-15); other investigators have demonstrated the
same phenomena for malignant lymphoma cells.16 Among mature leukocytes, the secretion of gelatinases varies and is modulated by
cytokines, chemokines, and growth factors. MMP-9, stored in the
specific and gelatinase granules of neutrophils, is released immediately upon stimulation by tumor necrosis factor- (TNF-) or
interleukin-8 (IL-8).17-19 In monocytes/macrophages, MMP-9
synthesis is upregulated by TNF- and IL-1 .20,21 T
lymphocytes secrete MMP-9 constitutively, with IL-2 stimulating its
production as well as inducing MMP-2 secretion in these
cells.22 These MMPs not only degrade connective tissue
matrices to allow chemotaxis of leukocytes across basement membranes
and tissues, but have also been reported to facilitate the release of
active cytokines and growth factors, eg, TNF-, insulin-like growth
factor (IGF), and transforming growth factor-
(TGF-).4
The growth factors and cytokines that have been shown to stimulate
mobilization of stem/progenitor cells into peripheral blood include
granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), stem cell factor (SCF), IL-3, erythropoietin, IL-6, IL-1, IL-8, macrophage inflammatory protein-1, and Flt3 ligand (reviewed in To et al1). To shed some light on the mechanism(s) regulating the release of hematopoietic
stem/progenitor cells from bone marrow, we investigated whether various
growth factors and cytokines, including those used for mobilization, modulate the expression of gelatinases in these cells and whether they
have any effect on migratory properties. We present evidence that
growth factors and cytokines are able to induce the production of
gelatinases (MMP-2 and MMP-9) in bone marrow steady-state
CD34+ cells and stimulate the migration of these cells
through reconstituted basement membrane.
| |
MATERIALS AND METHODS |
CD34+ cells.
Normal bone marrow cells were obtained from unrelated or related donors
(Foothills Hospital [Calgary, Alberta, Canada] or Cross Cancer
Institute [Edmonton, Alberta, Canada]) or from hematologically normal
patients undergoing open heart surgery (University of Alberta Hospitals, Edmonton, Alberta, Canada) with donors' informed consent. Peripheral blood cells were collected by apheresis (at the Edmonton Blood Centre) from (1) donors in steady-state hematopoiesis, (2) donors
mobilized with G-CSF (Filgrastim [Amgen, Thousand Oaks, CA] at 5 µg/kg/d subcutaneously), and (3) patients with
stage II/III breast cancer without bone marrow involvement who had been mobilized with chemotherapy consisting of 500 mg/m2
intravenous (IV) 5-fluorouracil, 50 mg/m2 IV adriamycin,
and 500 mg/m2 IV cyclophosphamide (FAC) and G-CSF (same
dose as given above). Cells were suspended at a concentration of 7.5 × 106 cells/mL in serum-free Iscove's modified
Dulbecco's medium (IMDM; GIBCO Laboratories, Grand Island, NY),
layered over 60% Percoll (Pharmacia-Canada, Montreal, Quebec, Canada),
and centrifuged (700g for 20 minutes at 20°C), and the
interphase cells were collected. After washing 2× with IMDM,
cells were processed according to the CD34+ progenitor cell
isolation kit protocol (Miltenyi Biotec, Auburn, CA). Briefly, cells
were resuspended in phosphate-buffered saline (PBS; GIBCO) containing 5 mmol/L EDTA and 0.5% bovine serum albumin (BSA; Sigma, Oakville,
Ontario, Canada), spun, labeled with monoclonal hapten-conjugated CD34
antibody (clone QBEND/10) and an anti-hapten antibody conjugated to
colloidal super-paramagnetic Microbeads, and passed through
MidiMACS columns placed in the magnetic field of the MACS separator.
The CD34+ cells were obtained by removing the column from
the magnetic field and eluting with buffer and then reloading cells to
a second MidiMACS column and eluting as before. The evaluation of
CD34+ cell population purity was performed in the EPICS-XL
flow cytometry system (Coulter Electronics, Burlington, Ontario,
Canada). Cells were labeled with fluorescein isothiocyanate (FITC)-CD45
(clone J33) and phycoerythrin (PE)-CD34 (clone 581) monoclonal
antibodies (Immunotech, Marseille, France). A mouse
IgG1-FITC conjugate was used as the isotype control. Cell
fractions showing a CD34+ cell purity of 90% or greater,
as exemplified by representative histograms shown in
Fig 1, were used for subsequent
experiments.
View larger version (32K):
[in this window]
[in a new window]
| Fig 1.
Evaluation of CD34+ cell purity by flow
cytometry. CD34+ cell fractions from peripheral blood (A)
and bone marrow (B), separated using MidiMACS columns described in
Materials and Methods, were stained with CD45-FITC (J33)/CD34-PE (581)
monoclonal antibodies and sequential gating applied. Region A shows
CD45 events versus side scatter (SS) that are then analyzed for CD34-PE
staining (region B). The CD34+ events are then displayed
on another CD45 versus SS dot plot (region C), where the
CD34+ cells form a distinct cluster characterized by low
CD45/SS expression. Finally, the events in region C are analyzed by SS
and forward scatter (FS) parameters (region D) to define the true
CD34+ cells. The same gating regions for the
CD45-FITC/CD34-PE stained samples were used to analyze the IgG1/FITC
isotype control, and these events were subtracted from the number of
events in regions A and D to calculate the cell purity.
|
|
Cell-conditioned media.
After washing in serum-free IMDM, CD34+ cells and
CD34 mononuclear cells (MNC) were aliquoted into
sterile Eppendorf tubes (concentration of 1 to 2 × 106 cells/mL) and incubated for 2, 16, and 24 hours (at
37°C and 5% CO2) in the presence or absence of growth
factors or cytokines. Human recombinant G-CSF, GM-CSF, macrophage
colony-stimulating factor (M-CSF), IL-3, and IL-6 (all
from Genetics Institute, Cambridge, MA), SCF, and IL-8 (R & D Systems,
Minneapolis, MN) were added at a final concentration of 100 ng/mL each.
Human recombinant TNF- (Genentech, San Francisco, CA;
and R & D Systems) was added at final concentrations of 0.1, 1.0, and
20.0 ng/mL. The cell-conditioned media (supernatants) were collected
and analyzed by zymography or stored at  20°C until use. In
addition, serum-free media conditioned by HT-1080 and KG-1 cells (known
to secrete MMP-2 and MMP-9) were also collected as previously
described14,15 and used as positive controls for
zymographic analysis. In some experiments, 1 mmol/L of aminophenyl
mercuric acetate (APMA; Sigma), a synthetic MMP activator,23 was added to media conditioned by peripheral
blood CD34+ cells.
Zymographic analysis.
Gelatinolytic activities were assessed under nonreducing conditions
using a modified sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis.24 Fifteen microliters of supernatants
mixed with 5 µL of loading buffer (0.16 mol/L Tris-HCl, 50%
glycerol, 8% SDS, and 0.08% bromophenol blue) were applied onto a
10% or 12% polyacrylamide gel copolymerized with 2 mg/mL gelatin
(Sigma). Electrophoresis was performed using a mini-PROTEAN II
electrophoresis system (Bio-Rad Laboratories, Mississauga, Ontario,
Canada) under constant voltage (150 V) for 2 to 4 hours at 4°C. The
gels were washed 3× for 20 minutes each with 2.5% Triton X-100
(Sigma) to remove the SDS and to allow the electrophoresed enzymes to
renature before being incubated in zymography buffer (0.15 mol/L NaCl, 5 mmol/L CaCl2, 0.05% NaN3, 50 mmol/L
Tris-HCl, pH 7.5) for 24 to 48 hours at room temperature. The
gels were then stained with 0.05% Coomassie brilliant blue G-250
(Sigma) in 2.5:1:7 ethanol:acetic acid:water and destained with 2:1:7
isopropanol:acetic acid:water. Prestained standard high range (47 to
201 kD) protein markers (Bio-Rad) were used to determine the molecular
weights of the gelatinases. To determine whether zones of lysis
detected by zymography were produced by MMPs, parallel gels were
incubated in the presence of 1.0 mmol/L o-phenanthroline
(Sigma), a synthetic inhibitor of MMPs. Gels were laminated using
BioDesign GelWrap (BioDesign Inc, Carmel, NY) and photographed or
processed using a ScanJet 3c scanner and DeskScan II software (Hewlett
Packard, Palo Alto, CA). The intensity of the bands in zymography was
quantified using the Scion Image for Windows software (Scion
Corp, Frederick, MD).
Matrigel assay.
In vitro cell migration was determined in the Matrigel-based assay as
described25 and modified by our group.13
Briefly, 13-mm polycarbonate filters of 8-µm pore size
(Costar/Nucleopore, Toronto, Ontario, Canada) were coated with 25 µg
of Matrigel (Collaborative Biomedical Products, Bedford, MA). The lower
compartments of the modified (blind well) Boyden chambers (Neuro Probe
Inc, Gaithersburg, MD) were filled with IMDM supplemented with 0.1%
BSA, and the Matrigel-coated filters were placed between the upper and
lower compartments. CD34+ cells (freshly isolated from
steady-state bone marrow or mobilized peripheral blood) were suspended
in IMDM/0.1% BSA at a concentration of 1.5 × 106
cells/mL, placed in the upper compartments, and incubated for 3 hours
at 37°C in 5% CO2. Cells that had migrated through the Matrigel-coated filters were recovered from the lower compartments and
counted using a Neubauer hemocytometer. Percentage cell migration was
calculated from the ratio of the number of cells recovered from the
lower compartment to the total number of cells loaded in the upper
compartment. Each experiment was performed using at least four chambers
for each CD34+ cell sample and repeated at least 2×.
To examine the role of MMPs in the migration of CD34+ cells
through Matrigel, the specific inhibitors of MMPs,
o-phenanthroline (Sigma), recombinant human TIMP-1 (rhTIMP-1;
provided by Dr Dylan Edwards, The University of Calgary, Calgary,
Alberta, Canada), rhTIMP-2 (Cedarlane Laboratories, Hornby, Ontario,
Canada), anti-MMP-2, and anti-MMP-9 monoclonal antibodies (Oncogene
Research Products, Cambridge, MA) were also used. For these inhibition
experiments cells were preincubated for 30 minutes with 0.5 mmol/L
o-phenanthroline or for 2 hours with 10 µg/mL each of
rhTIMP-1, rhTIMP-2, anti-MMP-2, and anti-MMP-9 antibodies before being
loaded into the upper compartments of the Boyden chambers, and the
Matrigel assay was performed as before. The concentrations of the
inhibitors were determined as optimal for inhibition in preliminary
experiments using KG-1 cells.15 Incubation of the
CD34+ cells in the presence of o-phenanthroline for
3 hours and with the other inhibitors for up to 18 hours at 37°C,
5% CO2 had a negligible effect on cell viability, which
was 95% to 100% as determined by trypan blue staining.
To assess whether cytokines modulate migration through
Matrigel, the CD34+ cells were preincubated with 1.0 ng/mL
TNF- or 100 ng/mL GM-CSF, IL-6, G-CSF, IL-3, or SCF for 16 hours
before the Matrigel assay. The percentage of cell migration through
Matrigel was calculated from the ratio of percentage of cell migration
assayed in the presence of MMP inhibitors or cytokines to that in their
absence (controls).
Clonogenic assay.
The clonogenic assays were performed on input cells and cells
transmigrating through Matrigel as recovered from the lower Boyden
chambers. Briefly, not more than 1 × 103
cells suspended in 1 mL IMDM containing 0.9% methylcellulose (Stem
Cell Technologies, Vancouver, British Columbia, Canada), supplemented
with 30% human plasma, 10% phytohemagglutinin-stimulated human
leukocyte-conditioned medium (PHA-LCM), 2-mercaptoethanol (Sigma), and
1 U/mL human erythropoietin (R & D Systems) were plated in duplicate as
previously described.26 Colony-forming unit
granulocyte-macrophage (CFU-GM), burst-forming unit-erythroid (BFU-E),
colony-forming unit granulocyte, erythroid, macrophage, megakaryocyte
(CFU-GEMM), and colony-forming unit-megakaryocyte (CFU-MK) were counted
after 14 days of incubation at 37°C and 5% CO2 in
air. In addition, the effect of varying concentrations of
rhTNF- (0.1, 1.0, and 20.0 ng/mL) on migration of clonogenic progenitors through Matrigel was also assessed. For these experiments, cells were preincubated with TNF- before loading onto the upper Boyden chambers and then equal volumes of cell suspensions were obtained from the lower chambers and plated as before.
Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis.
Expression of MMP-2 and MMP-9 at the nucleic acid level was
investigated in CD34+ and CD34 (control)
cells using RT-PCR. The isolation of RNA was performed using the acid
guanidinium thiocyanate-phenol-chloroform extraction method.27 Approximately 2 µg of RNA was added to each
reaction mixture containing 4 µL GIBCO-BRL 5× First Strand
Buffer (375 mmol/L KCl, 15 mmol/L MgCl2, 250 mmol/L
Tris-HCl, pH 8.3, at room temperature), 2 µL N6 random
oligonucleotides (100 pmol), 2 µL dNTP mixture (containing 10 mmol/L
each of the deoxynucleotides dATP, dGTP, dCTP, and dTTP at neutral pH),
2 µL GIBCO-BRL SuperScript RT RNase H Reverse
Transcriptase, 0.2 µL of 1 mol/L dithiothreitol (DTT), 0.3 µL of ribonuclease inhibitor (RNAguard; Pharmacia), and 9.5 µL
GIBCO water (ddH2O, RNase-free). The samples were incubated at 42°C for 90 minutes and then heated to 95°C for 5 minutes to inactivate the enzyme. Finally, the RT products were cooled to 4°C
and stored until use. Multiplex PCRs were performed in a
primer-dropping technique modelled after Wong et al.28 Each
reaction mixture contained RT product (template DNA), the volume of
which was determined by the amount necessary to equalize the
intensities of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) bands
visualized during agarose gel electrophoresis. Additional ingredients
added to the reaction mixture were 5 µL of 10× PCR buffer (500 mmol/L KCl, 15 mmol/L MgCl2, and 100 mmol/L Tris-HCl), 1 µL of dNTP mixture (containing 10 mmol/L of each of the 4 deoxynucleotides), and 1 µL each of 5' and 3' starter primer pair (each primer had a concentration of 20 µmol/L). Sequences for human MMP-2 and MMP-9 were obtained from GenBank (Los Alamos, NM)
and used to design primer pairs. The sequence for the GAPDH primer was
obtained from Wong et al.28 The primers used were as
follows: MMP-2: 5'-primer, 5'GGCCCTGTCACTCCTGAGAT, and
3'-primer, 5'GGCATCCAGGTTATCGGGGA; MMP-9: 5'-primer,
5'CAACATCACCTATTGGATCC, and 3'-primer,
5'CGGGTGTAGAGTCTCTCGCT; and GAPDH: 5'-primer,
5'CGGAGTCAACGGATTTGGTCGTAT, and 3'-primer,
5'AGCCTTCTCCATGGTTGGTGAAGAC.
All of the reagents were kept on ice and Taq polymerase (0.2 µL for
each sample; Pharmacia) was added to the cold reaction mixture.
Thermocycling was started using a Perkin-Elmer Cetus thermocycler
(Norwalk, CT) at the optimum cycle number for each primer. Each PCR
cycle consisted of a heat-denaturation step at 94°C for 1 minute, a
primer-annealing step at 55°C for 1 minute, and a strand-elongation
step at 72°C for 1 minute. Aliquots of PCR product (~10 µL)
were electrophoresed on 1.8% agarose gels containing 0.1 mg/mL
ethidium bromide. Loading was equalized to the internal control mRNA
(GAPDH) to give equivalent signals. Gels were illuminated with UV light
and photographed using Polaroid film (Polaroid Corp,
Cambridge, MA).
RNA was also extracted from peripheral blood and bone marrow
CD34+ cell pellets obtained after 24 hours of incubation
with TNF- and subjected to RT-PCR analysis for MMP-2 and MMP-9 expression.
Statistical analysis.
Results of the densitometric analyses, Matrigel, and clonogenic assays
are shown as bar graphs and error bars representing the mean ± standard deviation of at least three independent experiments. Significant differences between means of paired samples were determined using the Student's t-test (Microsoft Excel, Redmond, WA) and a P value less than .05 was considered statistically
significant. Correlation between MMP expression (quantified by
densitometry) and migratory potential was determined using linear
regression analysis (Microsoft Excel).
| |
RESULTS |
Expression of MMP-2 and MMP-9 by CD34+ cells from
peripheral blood but not from steady-state bone marrow.
A comparison of the gelatinolytic activities in media conditioned by
high purity CD34+ cells (as shown in Fig 1), separated from
steady-state bone marrow and steady-state peripheral blood, after
incubation in serum-free media for 24 hours is shown in
Fig 2A (lanes 1 and 2). Gelatinolytic activities were not detectable in media conditioned by bone marrow CD34+ cells, whereas both 92- and 72-kD activities were
found in media conditioned by peripheral blood CD34+ cells.
Similarly, both gelatinolytic activities were present in media
conditioned by peripheral blood CD34+ cells obtained from
donors mobilized with G-CSF alone (lane 3) and from patients mobilized
with chemotherapy and G-CSF (lane 4). Light-density MNC separated from
leukapheresis products exhibited a very pronounced 92-kD activity but
no 72-kD activity (lane 5), which was identical to the gelatinase
secretion pattern found in media conditioned by MNC obtained from
steady-state bone marrow (lane 6). Previously, we showed that the 92-kD
activity is detectable by zymography in media conditioned for 24 hours
by 1 × 106 cells/mL MNC but not by 1 × 105 cells/mL or fewer, which makes highly unlikely the
possibility that the 92-kD activity observed in media conditioned by
peripheral blood CD34+ cell preparations in this study is
due to contamination by MNC.14 Figure 2B shows that bands
corresponding to 92- and 72-kD activities found in media conditioned by
KG-1 (standard) and by CD34+ cells were not detectable in
experiments with the inhibitor o-phenanthroline, indicating
that these bands of lysis were produced by MMP-9 and MMP-2.
View larger version (61K):
[in this window]
[in a new window]
| Fig 2.
Comparison of gelatinolytic activities and gene
expression of MMP-2 and MMP-9 in CD34+ cells obtained
from various sources. (A) Zymogram of media conditioned by
CD34+ cells from steady-state bone marrow (BM, lane 1),
steady-state peripheral blood (PB, lane 2), G-CSF-mobilized PB (lane
3), G-CSF plus chemotherapy-mobilized PB (lane 4), and
CD34 MNC from PB (lane 5) and BM (lane 6). The cells
were incubated in serum-free IMDM at 37°C and 5% CO2
for 24 hours and the cell-conditioned media were electrophoresed in
10% acrylamide containing 2 mg/mL gelatin. The data presented here are
representative of 12 BM, 2 unmobilized PB, 3 G-CSF-mobilized PB, and
12 G-CSF plus chemotherapy-mobilized PB experiments. (B) Effect of the
MMP inhibitor o-phenanthroline on the expression of gelatinases
by PB CD34+ cells. Media conditioned by KG-1 cells, known
to secrete MMP-9 and MMP-2, was used as the standard (Std). The gels
were incubated in the absence (left gel) and in the presence of 1.0 mmol/L o-phenanthroline (right gel) after electrophoresis. (C)
RT-PCR analysis of MMP-9 and MMP-2 mRNA transcripts expressed by
steady-state BM (lane 1) and PB (lane 2) CD34+ cells,
G-CSF-mobilized PB CD34+ cells (lane 3) and PB MNC (C,
lane 4). PCR products were electrophoresed on 2% agarose gels
containing 0.1 g/mL ethidium bromide. GAPDH was used as the mRNA
internal control to ensure equivalence of loading.
|
|
RT-PCR analysis of steady-state bone marrow CD34+ cells did
not show detectable levels of mRNA for either MMP-2 or MMP-9 (Fig 2C,
lane 1), whereas steady-state peripheral blood CD34+ cells
expressed high levels of both MMP-2 and MMP-9 mRNA (lane 2).
G-CSF-mobilized peripheral blood CD34+ cells also showed
bands for MMP-2 and MMP-9 mRNA, although these were faint (lane 3). MNC
from mobilized peripheral blood expressed mRNA for MMP-9 but not for
MMP-2 (lane 4). Gene expression of MMP-2 and MMP-9 as evaluated by
RT-PCR was consistent with the zymographic analysis of secreted
proteins from the various cell samples (Fig 2A).
Migration of CD34+ cells through Matrigel and the
effects of MMP inhibitors.
Assuming that the production of matrix-degrading MMPs by
CD34+ cells facilitates their migration across basal
lamina, we set out to investigate whether gelatinase secretion
correlates with transmigration across a reconstituted basement membrane
(Matrigel). CD34+ cells obtained from G-CSF-mobilized
peripheral blood showed a significantly higher (2.7×) percentage
of migration in the Matrigel-based assay than CD34+ cells
from steady-state bone marrow (6.7% ± 0.5% v
2.5% ± 0.8%, P < .0001; Fig
3A, left bars). The migration of CFU-GM progenitors was higher by a
similar fold (2.5×) for peripheral blood than for bone marrow
(0.5% v 0.2%), based on a clonogenic assay of input and
migrating cells (data not shown). On the other hand, CD34 cells (light-density mononuclear cells) from
both bone marrow and leukapheresis products of peripheral blood had
similar migration values (10.4% ± 4.1% v 9.2% ± 2.7%, P = .7; Fig 3A, right bars), which is consistent with
the secretion of MMP-9 by these cells (Fig 2A).
View larger version (30K):
[in this window]
[in a new window]
| Fig 3.
Migration of hematopoietic progenitor cells through
Matrigel and the effect of MMP inhibitors. (A) Migration of
CD34+ cells isolated from steady-state BM and
G-CSF-mobilized PB are shown (left bars). Migration of
CD34 MNC obtained from the same sources is also
presented (right bars). Graph bars show a significant difference
between BM and PB CD34+ cells (P < .0001) in
the percentage of migration, which is expressed as the mean ± SD (n
= 3 for BM and n = 5 for PB), whereas the percentage of
migration between the MNC was not statistically different (P
= .7). (B) Plating efficiency of PB CD34+ cells that
migrated through Matrigel compared with that of nonmigrating cells.
Equal numbers of cells (1 × 103 cells/mL) from the upper
(nonmigrating) and lower (migrating) compartments of Boyden chambers
were plated in quadruplicate and colonies were scored for CFU-GM,
BFU-E, CFU-GEMM, and CFU-MK after 14 days of incubation at 37°C and
5% CO2. (C) Effect of MMP inhibitors on the in vitro
migration of PB CD34+ cells. The final concentrations of
o-phenanthroline, anti-MMP-2, anti-MMP-9, rhTIMP-1, and
rhTIMP-2 and the preincubation conditions are described in Materials
and Methods. The basal migration of PB CD34+ cells was
set at 100% (control) and the percentages of migration in the presence
of the various inhibitors are represented as the mean ± standard
deviation from duplicate experiments relative to the control.
|
|
The plating efficiency of CFU-GM progenitors in the input population
and in the population of cells that migrated through Matrigel was
similar (P = .9; Fig 3B). There were only slight differences in
the relative proportions of BFU-E, CFU-GEMM, and CFU-MK among the cells
that migrated through Matrigel compared with the input cells.
The synthetic inhibitor of MMPs, o-phenanthroline, which was
found to obliterate gelatinolytic activities in zymograms (Fig 2B), was
also found to reduce the ability of CD34+ cells to cross
the Matrigel barrier to 44% of the control (lacking the inhibitor; Fig
3C). Other specific inhibitors of MMPs, namely anti-MMP-2 monoclonal
antibody, anti-MMP-9 monoclonal antibody, rhTIMP-1, and rhTIMP-2, also
significantly reduced the percentage of migration to 53%, 44%, 44%,
and 37% of the control, respectively (P < .0001 for all cases).
Growth factors and cytokines upregulate gelatinase secretion and cell
migration of CD34+ cells through Matrigel.
All of the growth factors and cytokines tested (G-CSF, GM-CSF, M-CSF,
SCF, IL-3, IL-6, IL-8, and TNF-) induced the secretion of both MMP-2
and MMP-9 activities by bone marrow CD34+ cells in varying
degrees. TNF-, GM-CSF, and IL-6 had the greatest stimulatory effect
on MMP-2 secretion (up to 17-, 6-, and 4-fold increases, respectively),
whereas M-CSF, TNF-, and GM-CSF increased MMP-9 production by
sixfold, fivefold, and fivefold, respectively (Fig 4A, left panel, and C). It is
noteworthy that the gelatinase activity of lower molecular weight
induced by TNF-, GM-CSF, and IL-6 in bone marrow CD34+
cells appeared first as diffuse lytic zones covering a range of
molecular weight rather than a distinct band of 72-kD activity. In
fact, when we performed zymography using a 12% polyacrylamide gel, we
were able to resolve the diffuse zones into two distinct bands
corresponding to 72-kD and 68-kD activities (Fig 4A, right panel). A
lower molecular weight band (62 kD) would have been expected had the
pro-enzyme been cleaved to yield its fully active form and therefore it
could be surmised that, in the presence of TNF-, GM-CSF, and IL-6,
pro-MMP-2 became partly activated (see below). TNF-, GM-CSF, and
IL-6 also significantly enhanced the expression of both MMP-2 (by 2.5- to 4.5-fold) and MMP-9 (by about 2-fold) activities in media
conditioned by peripheral blood CD34+ cells, whereas the
other growth factors tested (G-CSF, SCF, M-CSF, IL-8, and IL-3)
appeared to exert only slight or no stimulatory effect (Fig 4B, left
panel, and C). The upregulation of MMP-2 secretion brought about by
IL-3, TNF-, and IL-8 was significantly higher for steady-state bone
marrow CD34+ cells than for mobilized peripheral blood
CD34+ cells (P = .02, .01, and .003, respectively),
as was the stimulation of MMP-9 secretion by M-CSF and GM-CSF
(P = .009 and .05, respectively). Interestingly, G-CSF and SCF
produced a significantly higher increase in both MMP-2 and MMP-9
secretion by CD34+ cells from bone marrow compared with
those from peripheral blood (P = .02 and .001 for MMP-2, and
P = .03 and .05 for MMP-9, respectively). Again, as in media
conditioned by bone marrow CD34+ cells, in the presence of
TNF-, GM-CSF, and IL-6, a lower molecular weight band corresponding
to 68 kD was distinctly apparent in addition to the 72-kD band. The
synthetic MMP activator, APMA, converted these proenzyme forms to the
fully active 62-kD form (Fig 4B). It is therefore apparent that, in the
presence of TNF-, GM-CSF, and IL-6, pro-enzyme and intermediate
forms of MMP-2 are secreted into media conditioned by CD34+
cells.
View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
Effect of cytokines on gelatinase activity of
CD34+ cells from BM and PB. The cells were incubated for
24 hours in serum-free IMDM in the absence (control) or presence of a
cytokine, and then zymography was performed on 10% (A, left panel) or
12% (A, right panel, and B) acrylamide containing 2 mg/mL gelatin.
Data are representative of at least three experiments using
CD34+ cells from both BM and PB sources. The final
concentrations of cytokines are given in Materials and Methods. Media
conditioned by HT-1080 cells was used as the standard (Std) showing the
positions of the 92-kD (MMP-9) and 72-kD (MMP-2) activities in the gel.
To establish the identity of the band having molecular weight lower
than 72 kD, cell-conditioned media in the presence of TNF- was
preincubated with 1 mmol/L APMA for 30 minutes before loading of the
gel (B, left panel). (C) Densitometric analysis of gelatinolytic
activities (MMP-9 and MMP-2). The intensities of the bands were
quantitated relative to the control and expressed as fold increase ± standard deviations from two or three zymograms. The asterisks indicate
where statistical differences exist (P < .05) in MMP-9 and
MMP-2 activities of CD34+ cells from BM versus PB in
response to each cytokine.
|
|
The percentage of migration of bone marrow CD34+ cells in
the Matrigel assay was higher when the cells were preincubated with TNF-, GM-CSF, IL-6, G-CSF, and IL-3. TNF- had the greatest effect (Fig 5), which is consistent with the most
pronounced stimulatory effect of this cytokine on gelatinase secretion.
The stimulatory effects of TNF- and G-CSF on the migratory potential
of bone marrow CD34+ cells were significantly higher than
their effects on peripheral blood CD34+ cells (P = .015 and .004, respectively), whereas the effects of the other growth
factors and cytokines were not significantly different. The effects of
TNF-, GM-CSF, IL-6, and G-CSF on migration through Matrigel of
peripheral blood CD34+ cells also correlated with the
enhancement of both MMP-9 (r = .99) and MMP-2 (r = .998) activities by these cytokines. On the other hand, migration of
bone marrow CD34+ cells through Matrigel correlated more
strongly with MMP-2 (r = .986) than with MMP-9 activity
(r = .76).
View larger version (21K):
[in this window]
[in a new window]
| Fig 5.
Stimulatory effect of cytokines on the in vitro migration
of BM and PB CD34+ cells. The concentrations of TNF-,
GM-CSF, IL-6, G-CSF, IL-3, and SCF and the calculations for the
percentage of stimulation are described in Materials and Methods. Bar
graphs represent the mean percentage of stimulation relative to the
control, which is set at the baseline value of 0%, ± standard
deviation from duplicate experiments. *Significant difference in the
effect of TNF- and G-CSF on migration of BM versus PB
CD34+ cells (P = .015 and .004, respectively).
|
|
Stimulation of gelatinase expression and migration of progenitors
through Matrigel are TNF- dose-dependent.
The secretion of both MMP-2 and MMP-9 activities by peripheral blood
CD34+ cells increased with time and was further enhanced in
a time-dependent fashion by TNF- (Fig
6A). Conversely, the media conditioned by bone marrow CD34+
cells did not show any detectable level of either MMP-9 or MMP-2 activity despite incubation for up to 24 hours. However, after pretreatment of these cells with TNF-, both gelatinolytic activities could be detected and became more prominent with prolonged incubation time. RT-PCR analysis of mRNA from TNF--treated bone marrow
CD34+ cells showed an induction in MMP-9 and MMP-2
expression in comparison with untreated cells. In peripheral blood
CD34+ cells, TNF- stimulated mRNA expression of MMP-9
and MMP-2 (Fig 6B) by fourfold and sevenfold, respectively, as assessed
by densitometric analysis. The stimulatory effects of TNF- on
gelatinolytic activities secreted by peripheral blood CD34+
cells, as well as on the migration of these cells through Matrigel, were dose-dependent (Fig 6C and D). Preincubation of mobilized peripheral blood CD34+ cells with 1.0 and 20.0 ng/mL
TNF- for 16 hours before performing the Matrigel assay increased
their migration fourfold and 10-fold, respectively, relative to the
control (without TNF-). Incubation with TNF- also increased the
migratory potential of hematopoietic progenitor cells in a
dose-dependent manner (Fig 6D). Increasing the TNF- concentration
from 1 to 20.0 ng/mL increased by about fourfold the total number of
all types of progenitors (CFU-GM, BFU-E, CFU-GEMM, and CFU-MK) that
migrated through Matrigel into the lower chamber.
View larger version (52K):
[in this window]
[in a new window]
| Fig 6.
Effect of TNF- on gelatinolytic activities expressed
by PB and BM CD34+ cells and on migration of clonogenic
progenitors. (A) Time dependence of gelatinolytic activity and the
effect of TNF-. The zymographic analysis of gelatinases secreted by
CD34+ cells from PB and BM was performed in the absence
(control lanes) and presence of TNF- (final concentration, 1 ng/mL).
Cell-free supernates were withdrawn after incubating the cells at
37°C and 5% CO2 in serum-free IMDM at the times (2, 16, and 24 hours) indicated. Data are representative of three
independent experiments using CD34+ cells from both
steady-state BM and G-CSF-mobilized PB. (B) RT-PCR analysis of
transcripts expressed by PB and BM CD34+ cells in the
absence (c) or presence of 1 ng/mL TNF-. mRNA was isolated from cell
pellets obtained after incubating the cells at 37°C and 5%
CO2 in serum-free IMDM for 24 hours. GAPDH was used as the
mRNA internal control to ensure equivalence of loading. (C)
Dose-dependence of the stimulatory effect of TNF- on gelatinolytic
activity of PB CD34+ cells. Zymographic analysis of media
conditioned by PB CD34+ cells in the presence of various
concentrations of TNF-. The cells were incubated in serum-free IMDM
for 16 hours in the absence (c lane) and in the presence of 0.1, 1.0, and 20 ng/mL TNF-. (D) Migration of PB CD34+ cells and
clonogenic progenitor cells in response to various concentrations of
TNF- (0, 1.0, and 20.0 ng/mL). Bar graphs represent the mean and
standard deviations of duplicate experiments. There was a significant
increase in the percentage migration of CD34+ cells in
the presence of TNF- relative to the control (P = .016 for
1 ng/mL TNF- and P = .001 for 20 ng/mL TNF-).
For the clonogenic assay, cells suspended in equal volumes of media
obtained from the lower compartments of the Boyden chambers were
plated. The graph shows the mean number of CFU-GM, BFU-E, CFU-GEMM, and
CFU-MK progenitors scored from quadruplicate plates. Except for the
CFU-MK, the numbers of colony-forming progenitors in the presence of 1 and 20 ng/mL TNF- are significantly different (P  .005)
compared with the control.
|
|
| |
DISCUSSION |
In this study, we examined whether gelatinases (MMP-2 and MMP-9), which
degrade extracellular matrix (ECM) basement membranes and are
implicated in the migration of leukocytes as well as in the invasion
and metastasis of tumor cells,4-7 are involved in the
release of stem/progenitor cells from bone marrow. Our study shows that
CD34+ cells that entered the peripheral blood, but not
those located in the bone marrow during steady-state hematopoiesis,
strongly express both MMP-2 and MMP-9 and that functional differences
exist between these cells.
Cells expressing the CD34 surface antigen constitute a heterogeneous
population of hematopoietic cells, including primitive stem cells with
self-renewal capacity, and of progenitors committed to myeloid,
erythroid, and lymphoid development.29 There is some
evidence that circulating CD34+ cells differ phenotypically
and functionally from their bone marrow counterparts. Some
investigators reported that a larger proportion of peripheral blood
CD34+ cells expressed the CD33 antigen in comparison with
bone marrow CD34+ cells,30 whereas others
reported that a lower proportion of peripheral blood CD34+
cells expressed the c-kit ligand.31 Another study
demonstrated that, although CD34+ cells obtained from
G-CSF-mobilized peripheral blood and steady-state bone marrow (of the
same individuals) were equivalent on a cell-per-cell basis in the
content of both committed and very primitive hematopoietic progenitors,
these cells were found to have different cell cycling kinetics and
responses to cytokines.32 It was also reported that
steady-state bone marrow CD34+ cells do not express
Granzyme B and perforin, whereas peripheral blood CD34+
cells mobilized with chemotherapy and G-CSF secrete these
proteins.33 Our study shows further differences between
steady-state bone marrow CD34+ cells and circulating
peripheral blood CD34+ cells, because we were able to
demonstrate MMP-2 and MMP-9 expression, on both the gene and protein
levels, in the latter but not in the former.
Furthermore, we found that peripheral blood CD34+ cells
migrate through reconstituted basement membrane (Matrigel) more readily than steady-state bone marrow CD34+ cells, which do not
express gelatinases, suggesting that upregulation of MMP expression may
lead to enhanced transmigration. Although only a small proportion of
CD34+ cells transmigrated through Matrigel, we showed that
these cells were multipotential and committed progenitors (CFU-GEMM,
CFU-GM, BFU-E, and CFU-MK), indicating that, after transmigration,
these CD34+ cells sustain their clonogenic potential. We
also demonstrated that rhTIMP-1 and rhTIMP-2, monoclonal antibodies to
MMP-2 and MMP-9, and o-phenanthroline significantly reduced the
ability of peripheral blood CD34+ cells to traverse the
reconstituted basement membrane, indicating the role of MMPs in the
transmigration process. Previously, we reported that primary human
immature AML blast cells secrete MMP-2 and/or MMP-9 and penetrate the
Matrigel barrier, but we suggested that cysteine proteinases may also
participate in cell invasion through Matrigel.14,15 In this
study, because the complete obliteration of migratory ability in the
presence of MMP inhibitors was not achieved, it may be inferred that
other proteinases could also be involved in ECM proteolytic degradation
and subsequent CD34+ cell migration.
One of the striking features of MMPs is that they are inducible, ie,
their synthesis and secretion are controlled at the transcriptional and
posttranscriptional levels. There is now a growing body of experimental
evidence for the regulatory role of cytokines, chemokines, and growth
factors in the synthesis and secretion of MMPs (reviewed in Ries and
Petrides34 and Borden and Heller35). In this
study, we demonstrated that all of the growth factors and cytokines
tested, namely G-CSF, GM-CSF, SCF, IL-3, IL-6, M-CSF, IL-8, and
TNF-, were able to induce the secretion of MMP-9 and MMP-2 by bone
marrow CD34+ cells. The most pronounced stimulation of
MMP-2 was observed with TNF-, GM-CSF, and IL-6, whereas M-CSF,
TNF-, and GM-CSF had the greatest effects on MMP-9 activity.
Various cytokines and growth factors, including TNF-, TNF-, IL-1,
IL-6, epidermal growth factor, and TGF-, have been documented to
upregulate the secretion of MMP-9 in a variety of cell
types.4,34 For example, MMP-9 secretion in human
CD3+ and CD4+ T cells36 and
macrophages21 is augmented in response to TNF- and IL-1,
and in leukemic HL-60,37 KG-1 (our unpublished
data), U-937,38 and human sarcoma cell
lines39,40 in response to TNF-. The MMP-9 promoter gene
is regulated by a series of cis-acting elements, including
activation protein-1 (AP-1), SP-1, and nuclear factor binding to a
 B-like sequence (NF-B), which are indispensable for
cytokine-induced MMP-9 promoter activity.34,35,41,42 Although in this study transcription factors were not studied, we may
speculate that similar mechanisms could be operational in the induction
of the MMP-9 gene in hematopoietic CD34+ cells.
Our finding that all of the growth factors and cytokines tested in this
study upregulated expression of MMP-2 in bone marrow CD34+
cells was surprising, especially in view of the fact that the promoter
region of the MMP-2 gene does not have a TATA box or the common AP-1
element.35,43 In fact, upregulation of MMP-2 synthesis has
only been reported for TGF- in human fibroblasts,44 in
keratinocytes,45 and for IGF-1 in a murine lung carcinoma cell line.46 The mechanism(s) regulating MMP-2 expression
is still unclear, and factors such as increased calcium influx, ECM proteins (namely laminin and vitronectin, functioning via phospholipase and v3 integrin signaling pathways,
respectively), Ha-ras and c-erb oncogenes, and
tissue-specific enhancer/promoter elements have all been suggested to
play a role.46 Although our results provide
clear evidence that growth factors and cytokines regulate MMP-2
synthesis in bone marrow CD34+ cells and show that TNF-
upregulates MMP-2 expression on gene and protein levels, the precise
molecular mechanism(s) involved in the regulation of MMP-2 synthesis in
hematopoietic progenitor cells remains to be defined.
Moreover, we found that TNF-, as well as GM-CSF and IL-6, not only
stimulated the 72-kD proenzyme form of MMP-2, but also seemed to
trigger a catalytic cleavage of the propeptide to a partially activated
form (68 kD). In synovial fibroblasts, TNF- was reported to be able
to induce the fully activated (62 kD) form of MMP-2 through a mechanism
involving an MT-MMP.47 Previously, we described the
constitutive expression of MT-MMP by primary leukemic and KG-1
cells.15 In the present study, we also observed MT1-MMP
mRNA in normal CD34+ cells (data not shown), but the
regulatory role of cytokines on MT-MMP expression in CD34+
cells was not tested. It will be important to clarify further the
specific molecular pathways involved in cytokine-induced regulation of
MMPs in CD34+ cells.
Next, we demonstrated that the stimulatory effect of growth factors and
cytokines on MMP-2 and MMP-9 expression by CD34+ cells
translated into an enhancement of the migratory potential of these
cells. Positive correlations between the level of expression of MMP-2
and MMP-9 and the percentage of migration of CD34+ cells
were observed, implicating MMPs in this process. In particular, the
dose-dependent stimulation of gelatinase activity by TNF- resulted
in a concomitant increase in the number of CD34+ cells as
well as clonogenic CFU-GM, BFU-E, CFU-GEMM, and CFU-MK progenitors that
were able to migrate through the reconstituted basement membrane. In
other hematopoietic cells, eg, T lymphocytes, increased migration
across reconstituted basement membrane (Matrigel) has been attributed
to upregulation of MMP-9 and induction of MMP-2 by IL-222
or upregulation of MMP-9 by IL-2 and IL-4.48 In a human
osteosarcoma cell line, TNF- induced MMP-9 production and enhanced
osteosarcoma cell invasion through Matrigel.39
Growth factors and cytokines, apart from their well-established roles
in stem/progenitor cell proliferation, differentiation, and maturation,
have also been shown to alter the adhesive interactions between these
cells and bone marrow stroma. For example, IL-3, GM-CSF, and SCF were
shown to modify the functional states of very late antigen-4 (VLA-4)
and VLA-5.49 Also, combined treatment with anti-VLA-4 and
cytokines resulted in enhanced mobilization.50 It is likely
that, under normal steady-state conditions, adhesive interactions
between hematopoietic progenitor cells and the marrow stroma restrict
stem/progenitor cells to the bone marrow niches and disruption of these
interactions is necessary for the release of stem cells and their
passage through the basal lamina and endothelial layers.2,3
Furthermore, integrin/ECM interactions may also result in the induction
of MMP production. It has been shown that adhesion of murine T cells to
capillary endothelia through vascular cell adhesion molecule-1 (VCAM-1)
can induce MMP-2 secretion, which facilitates the transmigration of
these cells.51 Another study indicated that active MMP-2
directly binds v3 integrin.52 Thus, integrins may localize proteolytic activities to the cell surface.
We present evidence that all types of CD34+ cells
circulating in the blood stream, regardless of whether they are
mobilized (with G-CSF, with or without chemotherapy) or in steady-state hematopoiesis, express MMP-2 and MMP-9 and that a wide range of growth
factors and cytokines, including those used for stem cell mobilization
(eg, G-CSF, SCF, and GM-CSF), is able to induce these enzymes in
steady-state bone marrow CD34+ cells. From these data it is
tempting to speculate that various exogenously administered mobilizing
factors and also those growth factors and cytokines that are
endogenously secreted within the bone marrow microenvironment may
facilitate release of CD34+ cells from the bone marrow
through their modulatory effects on expression of MMPs. Moreover,
secretion of various MMPs by fibroblasts or osteoclasts53
may also be modulated by these factors and influence trafficking of
stem/progenitors cells between the various niches of bone marrow
stroma. Consequently, proteolysis of the basal lamina and migration of
progenitors through the endothelial layer into marrow sinuses and
peripheral blood could occur. In addition, we may speculate that the
strong gelatinase expression by peripheral blood CD34+
cells described here may suggest an explanation for the observed faster
hematopoietic recovery after transplantation of mobilized PBSC in
comparison with recovery after transplantation of steady-state bone
marrow cells.54 This would also imply that gelatinases facilitate not only the efficient mobilization of stem/progenitor cells
to peripheral blood, but also their engraftment after transplantation.
| |
FOOTNOTES |
Submitted November 2, 1998; accepted January 13, 1999.
Supported by a grant to A.J.-W. from the CRCS Blood Services, Research
& Development, and by Alberta Heritage Foundation for Medical Research
Summer Studentships to H.C. and J.R.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Anna Janowska-Wieczorek, MD, PhD,
Department of Medicine, University of Alberta, 8249-114 St, Edmonton,
Alberta, Canada T6G 2R8; e-mail: annajanowska{at}bloodservices.ca.
| |
REFERENCES |
1.
To LB, Haylock DN, Simmons PJ, Juttner CA:
The biology and clinical uses of blood stem cells.
Blood
89:2233, 1997[Free Full Text]
2.
Simmons PJ, Leavesley DI, Levesque JP, Swart BW, Haylock DN, To LB, Ashman LK, Juttner CA:
The mobilization of primitive hematopoietic progenitors into the peripheral blood, in
Murphy MJ
(ed):
Polyfunctionality of Hemopoietic Regulators: The Metcalf Forum. Stem Cells 12:187, 1994 (suppl 1)
3.
Papayannopoulou T, Priestley GV, Nakamoto B:
Anti-VLA4/VCAM-1-induced mobilization requires cooperative signaling through the kit/mkit ligand pathway.
Blood
91:2231, 1998[Abstract/Free Full Text]
4.
Goetzl EJ, Banda MJ, Leppert D:
Matrix metalloproteinases in immunity.
J Immunol
156:1, 1996[Abstract]
5.
Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ, Birkedal-Hansen B, DeCarlo A, Engler JA:
Matrix metalloproteinases: A review.
Crit Rev Oral Biol Med
4:197, 1993[Abstract/Free Full Text]
6.
Stetler-Stevenson WG, Hewitt R, Corcoran M:
Matrix metalloproteinases and tumor invasion: From correlation and causality to the clinic.
Semin Cancer Biol
7:147, 1996[Medline]
[Order article via Infotrieve]
7.
Chambers AF, Matrisian LM:
Changing views of the role of matrix metalloproteinases in metastasis.
J Natl Cancer Inst
89:1260, 1997[Abstract/Free Full Text]
8.
Van Wart HE, Birkedal-Hansen H:
The cysteine switch: A principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family.
Proc Natl Acad Sci USA
87:5578, 1990[Abstract/Free Full Text]
9.
Murphy G, Knaüper V:
Relating matrix metalloproteinase structure to function: Why the "hemopexin" domain?
Matrix Biol
15:511, 1997[Medline]
[Order article via Infotrieve]
10.
Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M:
A matrix metalloproteinase expressed on the surface of invasive tumor cells.
Nature
370:61, 1994[Medline]
[Order article via Infotrieve]
11.
Knäuper V, Murphy G:
Membrane-type matrix metalloproteinases and cell surface-associated activation cascades for matrix metalloproteinases, in
Parks WC,
Mecham RP
(eds):
Matrix Metalloproteinases. San Diego, CA, Academic, 1998, p 199.
12.
Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP:
Tissue inhibitors of metalloproteinases: Structure, regulation and biological functions.
Eur J Cell Biol
74:111, 1997[Medline]
[Order article via Infotrieve]
13.
Janiak M, Hashmi HR, Janowska-Wieczorek A:
Use of the Matrigel-based assay to measure the invasiveness of leukemic cells.
Exp Hematol
22:559, 1994[Medline]
[Order article via Infotrieve]
14.
Matsuzaki A, Janowska-Wieczorek A:
Unstimulated human acute myelogenous leukemia blasts secrete matrix metalloproteinases.
J Cancer Res Clin Oncol
123:100, 1997[Medline]
[Order article via Infotrieve]
15.
Sawicki G, Matsuzaki A, Janowska-Wieczorek A:
Expression of the active form of MMP-2 on the surface of leukemic cells accounts for their in vitro invasion.
J Cancer Res Clin Oncol
124:245, 1998[Medline]
[Order article via Infotrieve]
16.
Kossakowska AE, Hinek A, Edwards DR, Lim MS, Zhang C-L, Breitman DR, Prusinkiewicz C, Stabbler AL, Urbanski LS, Urbanski SJ:
Proteolytic activity of human non-Hodgkin's lymphomas.
Am J Pathol
152:565, 1998[Abstract]
17.
Borregaard N, Cowland JB:
Granules of the human neutrophilic polymorphonuclear leukocyte.
Blood
89:3503, 1997[Free Full Text]
18.
Hanlon WA, Stolk J, Davies P, Humes JL, Mumford R, Bonney RJ:
rTNF-alpha facilitates human polymorphonuclear leukocyte adherence to fibrinogen matrices with mobilization of specific and tertiary but not azurophilic granule markers.
J Leukoc Biol
50:43, 1991[Abstract]
19.
Masure S, Proost P, Van Damme J, Opdenakker G:
Purification and identification of 91-kDa neutrophil gelatinase. Release by the activating peptide interleukin-8.
Eur J Biochem
198:391, 1991[Medline]
[Order article via Infotrieve]
20.
Welgus HG, Senior RM, Parks WC, Kahn AJ, Ley TJ, Shapiro SD, Campbell EJ:
Neutral proteinase expression by human mononuclear phagocytes: A prominent role of cellular differentiation.
Matrix Suppl
1:363, 1992[Medline]
[Order article via Infotrieve]
21.
Saren P, Welgus HG, Kovanen PT:
TNF- and IL-1 selectively induce expression of 92-kDa gelatinase by human macrophages.
J Immunol
157:4159, 1996[Abstract]
22.
Leppert D, Waubant E, Galardy R, Bunnett NW, Hauser SL:
T cell gelatinases mediate basement membrane transmigration in vitro.
J Immunol
154:4379, 1995[Abstract]
23.
Stetler-Stevenson WG, Krutzsch HC, Wacher MP, Margulies IMK, Liotta LA:
The activation of human type IV collagenase proenzyme.
J Biol Chem
264:1353, 1989[Abstract/Free Full Text]
24.
Heussen C, Dowdle EB:
Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates.
Anal Biochem
102:196, 1980[Medline]
[Order article via Infotrieve]
25.
Albini A, Iwamoto Y, Kleinman HK, Martin GR, Aaronson SA, Kozlowski JM, McEwan RN:
A rapid in vitro assay for quantitating the invasive potential of tumor cells.
Cancer Res
47:3239, 1987[Abstract/Free Full Text]
26.
Mayani H, Guilbert LJ, Clark SC, Janowska-Wieczorek A:
Inhibition of hematopoiesis in normal human long-term marrow cultures treated with recombinant human macrophage colony-stimulating factor.
Blood
78:651, 1991[Abstract/Free Full Text]
27.
Chomczynski P, Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
28.
Wong H, Anderson WD, Cheng T, Riabowol KY:
Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method.
Anal Biochem
223:251, 1994[Medline]
[Order article via Infotrieve]
29.
Sutherland DR, Keating A:
The CD34 antigen: Structure, biology and potential clinical applications.
J Hematother
1:115, 1992[Medline]
[Order article via Infotrieve]
30.
Bender JG, Unverzagt KL, Walker DE, Lee W, Van Epps DE, Smith DH, Stewart CC, To LB:
Identification and comparison of CD34-positive cells and their subpopulation from normal peripheral blood and bone marrow using multicolor flow cytometry.
Blood
77:2591, 1991[Abstract/Free Full Text]
31.
Möhle R, Hass R, Hunstein W:
Expression of adhesion molecules and c-kit on CD34+ hematopoietic progenitor cells: Comparison of cytokine mobilized blood stem cells with normal bone marrow.
J Hematother
2:483, 1993[Medline]
[Order article via Infotrieve]
32.
Lemoli RM, Tafuri A, Fortuna A, Petrucci MT, Ricciardi MR, Catani L, Rondelli D, Fogli M, Leopardi G, Ariola C, Tura S:
Cycling status of CD34+ cells mobilized into PB of healthy donors by recombinant human granulocyte colony-stimulating factor.
Blood
89:1189, 1997[Abstract/Free Full Text]
33.
Berthou C, Marolleau J-P, Lafaurie C, Soulie A, Dal Cortivo L, Bourge J-F, Benbunan M, Sasportes M:
Granzyme B and perforin lytic proteins are expressed in CD34+ peripheral blood progenitor cells mobilized by chemotherapy and granulocyte colony-stimulating factor.
Blood
86:3500, 1995[Abstract/Free Full Text]
34.
Ries C, Petrides PE:
Cytokine regulation of matrix metalloproteinase activity and its regulatory dysfunction in disease.
Biol Chem
375:345, 1995
35.
Borden P, Heller RA:
Transcriptional control of matrix metalloproteinases and the tissue inhibitors of matrix metalloproteinases.
Crit Rev Eukaryotic Gene Expression
7:159, 1997[Medline]
[Order article via Infotrieve]
36.
Johnatty RN, Taub DD, Reeder SP, Turcovski-Corrales SM, Cottam DW, Stephenson TJ, Rees RC:
Cytokine and chemokine regulation of proMMP-9 and TIMP-1 production by human peripheral blood lymphocytes.
J Immunol
158:2327, 1997[Abstract]
37.
Ries C, Kolb H, Petrides PE:
Regulation of 92-kD gelatinase release in HL-60 leukemia cells: Tumor necrosis factor- as an autocrine stimulus for basal- and phorbol ester-induced secretion.
Blood
83:3638, 1994[Abstract/Free Full Text]
38.
Watanabe H, Nakanishi I, Yamashita K, Hayakawa T, Okada Y:
Matrix metalloproteinase-9 (92 kDa gelatinase/type IV collagenase) from U937 monoblastoid cells: Correlation with cellular invasion.
J Cell Sci
104:991, 1993[Abstract]
39.
Kawashima A, Nakanishi I, Tsuchiya H, Roessner A, Obata K, Okada Y:
Expression of matrix metalloproteinase 9 (92-kDa gelatinase/ type IV collagenase) induced by tumor necrosis factor- correlates with metastatic ability in a human osteosarcoma cell line.
Virchows Arch
424:547, 1994[Medline]
[Order article via Infotrieve]
40.
Okada Y, Tsuchiya H, Shimizu H, Tomita K, Nakanishi I, Sato H, Seiki M, Yamashita K, Hayakawa T:
Induction and stimulation of 92-kDa gelatinase/type IV collagenase production in osteosarcoma and fibrosarcoma cell lines by tumor necrosis factor alpha.
Biochem Biophys Res Commun
171:610, 1990[Medline]
[Order article via Infotrieve]
41.
Lauricella-Lefebre MA, Castronovo V, Sato H, Seiki M, French DL, Merville MP:
Stimulation of the 92-kD type IV collagenase promoter and enzyme expression in human melanoma cells.
Invasion Metastasis
13:289, 1993[Medline]
[Order article via Infotrieve]
42.
Vilcek J, Lee TH:
Tumor necrosis factor: New insights into the molecular mechanisms of its multiple actions.
J Biol Chem
266:7313, 1991[Free Full Text]
43.
Benbow U, Brinckerhoff CE:
The AP-1 site and MMP gene regulation: What is all the fuss about?
Matrix Biol
15:519, 1997[Medline]
[Order article via Infotrieve]
44.
Overall CM, Wrana JL, Sodek J:
Independent regulation of collagenase, 72-kDa progelatinase and metalloendoproteinase inhibitor expression in human fibroblasts by transforming growth factor-beta.
J Biol Chem
264:1860, 1989[Abstract/Free Full Text]
45.
Salo T, Lyons JG, Rahemtulla F, Birkedal-Hansen H, Larjava H:
Transforming growth factor-beta 1 up-regulates type IV collagenase expression in cultured human keratinocytes.
J Biol Chem
266:11436, 1991[Abstract/Free Full Text]
46.
Long L, Navab R, Brodt P:
Regulation of the Mr 72,000 type IV collagenase by the type I insulin-like growth factor receptor.
Cancer Res
58:3243, 1998[Abstract/Free Full Text]
47.
Migita K, Eguchi K, Kawabe Y, Ichinose Y, Tsukada T, Aoyagi T, Nakamura H:
TNF--mediated expression of membrane-type matrix metalloproteinase in rheumatoid synovial fibroblasts.
Immunology
89:553, 1996[Medline]
[Order article via Infotrieve]
48.
Xia M, Leppert D, Hauser SL, Sreedharan SP, Nelson PJ, Krensky AM, Goetzl EJ:
Stimulus specificity of matrix metalloproteinase dependence of human T cell migration through a model basement membrane.
J Immunol
156:160, 1996[Abstract]
49.
Levesque JP, Leavesley DI, Niutta S, Vadas M, Simmons PJ:
Cytokines increase human hemopoietic cell adhesiveness by activation of very late antigen (VLA)-4 and VLA-5 integrins.
J Exp Med
181:1805, 1995[Abstract/Free Full Text]
50.
Craddock CF, Nakamoto B, Andrews RG, Priestley GV, Papayannopoulou T:
Antibodies to VLA4 integrin mobilize long-term repopulating cells and augment cytokine-induced mobilization in primates and mice.
Blood
90:4779, 1997[Abstract/Free Full Text]
51.
Romanic AM, Madri JA:
The induction of 72-kD gelatinase in T cells upon adhesion to endothelial cells is VCAM-1 dependent.
J Cell Biol
125:1165, 1994[Abstract/Free Full Text]
52.
Brooks PC, Stromblad S, Sanders LC, von Schalscha TL, Aimes RT, Stetler-Stevenson WG, Quigley JP, Cheresh DA:
Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin v3.
Cell
85:683, 1996[Medline]
[Order article via Infotrieve]
53.
Bord S, Horner A, Hembry RM, Reynolds JJ, Compston JE:
Distribution of matrix metalloproteinases and their inhibitor, TIMP-1, in developing human osteophytic bone.
J Anatomy
191:39, 1997
54.
Körbling M, Przepiorka D, Huh YO, Engel H, van Bisen K, Giralt S, Andersson B, Kleine HD, Seong D, Deisseroth AB, Andreeff M, Champlin R:
Allogeneic blood stem cell transplantation for refractory leukemia and lymphoma: Potential advantage of blood over marrow allografts.
Blood
85:1659, 1995[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. K.Y. Siu, E. S.Y. Wong, H. Y. Chan, H. Y.S. Ngan, K. Y.K. Chan, and A. N.Y. Cheung
Overexpression of NANOG in Gestational Trophoblastic Diseases: Effect on Apoptosis, Cell Invasion, and Clinical Outcome
Am. J. Pathol.,
October 1, 2008;
173(4):
1165 - 1172.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Shivtiel, O. Kollet, K. Lapid, A. Schajnovitz, P. Goichberg, A. Kalinkovich, E. Shezen, M. Tesio, N. Netzer, I. Petit, et al.
CD45 regulates retention, motility, and numbers of hematopoietic progenitors, and affects osteoclast remodeling of metaphyseal trabecules
J. Exp. Med.,
September 29, 2008;
205(10):
2381 - 2395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Spiegel, E. Zcharia, Y. Vagima, T. Itkin, A. Kalinkovich, A. Dar, O. Kollet, N. Netzer, K. Golan, I. Shafat, et al.
Heparanase regulates retention and proliferation of primitive Sca-1+/c-Kit+/Lin- cells via modulation of the bone marrow microenvironment
Blood,
May 15, 2008;
111(10):
4934 - 4943.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Marquez-Curtis, A. Jalili, K. Deiteren, N. Shirvaikar, A.-M. Lambeir, and A. Janowska-Wieczorek
Carboxypeptidase M Expressed by Human Bone Marrow Cells Cleaves the C-Terminal Lysine of Stromal Cell-Derived Factor-1{alpha}: Another Player in Hematopoietic Stem/Progenitor Cell Mobilization?
Stem Cells,
May 1, 2008;
26(5):
1211 - 1220.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. E. Cramer, S. Wagner, B. Li, J. Liu, R. Hansen, R. Reca, W. Wu, E. Z. Surma, D. A. Laber, M. Z. Ratajczak, et al.
Mobilization of Hematopoietic Progenitor Cells by Yeast-Derived {beta}-Glucan Requires Activation of Matrix Metalloproteinase-9
Stem Cells,
May 1, 2008;
26(5):
1231 - 1240.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Kimura, S. Teranishi, K. Fukuda, K. Kawamoto, and T. Nishida
Delayed Disruption of Barrier Function in Cultured Human Corneal Epithelial Cells Induced by Tumor Necrosis Factor-{alpha} in a Manner Dependent on NF-{kappa}B
Invest. Ophthalmol. Vis. Sci.,
February 1, 2008;
49(2):
565 - 571.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. E. Kleinman, M. R. Greives, S. S. Churgin, K. M. Blechman, E. I. Chang, D. J. Ceradini, O. M. Tepper, and G. C. Gurtner
Hypoxia-Induced Mediators of Stem/Progenitor Cell Trafficking Are Increased in Children With Hemangioma
Arterioscler. Thromb. Vasc. Biol.,
December 1, 2007;
27(12):
2664 - 2670.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U Berg, T Gustafsson, C J Sundberg, L Kaijser, C Carlsson-Skwirut, and P Bang
Interstitial IGF-I in exercising skeletal muscle in women
Eur. J. Endocrinol.,
October 1, 2007;
157(4):
427 - 435.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Fukuda, H. Bian, A. G. King, and L. M. Pelus
The chemokine GRO{beta} mobilizes early hematopoietic stem cells characterized by enhanced homing and engraftment
Blood,
August 1, 2007;
110(3):
860 - 869.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Grote, G. Salguero, M. Ballmaier, M. Dangers, H. Drexler, and B. Schieffer
The angiogenic factor CCN1 promotes adhesion and migration of circulating CD34+ progenitor cells: potential role in angiogenesis and endothelial regeneration
Blood,
August 1, 2007;
110(3):
877 - 885.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C.-H. Wang, N. Anderson, S.-H. Li, P. E. Szmitko, W.-J. Cherng, P. W.M. Fedak, S. Fazel, R.-K. Li, T. M. Yau, R. D. Weisel, et al.
Stem Cell Factor Deficiency Is Vasculoprotective: Unraveling a New Therapeutic Potential of Imatinib Mesylate
Circ. Res.,
September 15, 2006;
99(6):
617 - 625.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Mannello
Commentary: Multipotent Mesenchymal Stromal Cell Recruitment, Migration, and Differentiation: What Have Matrix Metalloproteinases Got to Do with It?
Stem Cells,
August 1, 2006;
24(8):
1904 - 1907.
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-R. Son, L. A. Marquez-Curtis, M. Kucia, M. Wysoczynski, A. R. Turner, J. Ratajczak, M. Z. Ratajczak, and A. Janowska-Wieczorek
Migration of Bone Marrow and Cord Blood Mesenchymal Stem Cells In Vitro Is Regulated by Stromal-Derived Factor-1-CXCR4 and Hepatocyte Growth Factor-c-met Axes and Involves Matrix Metalloproteinases
Stem Cells,
May 1, 2006;
24(5):
1254 - 1264.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nieborowska-Skorska, G. Hoser, L. Rink, M. Malecki, P. Kossev, M. A. Wasik, and T. Skorski
Id1 transcription inhibitor-matrix metalloproteinase 9 axis enhances invasiveness of the breakpoint cluster region/abelson tyrosine kinase-transformed leukemia cells.
Cancer Res.,
April 15, 2006;
66(8):
4108 - 4116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. J. Cortez, C. A. Lyman, S. Kottilil, H. S. Kim, E. Roilides, J. Yang, B. Fullmer, R. Lempicki, and T. J. Walsh
Functional Genomics of Innate Host Defense Molecules in Normal Human Monocytes in Response to Aspergillus fumigatus
Infect. Immun.,
April 1, 2006;
74(4):
2353 - 2365.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Goichberg, A. Kalinkovich, N. Borodovsky, M. Tesio, I. Petit, A. Nagler, I. Hardan, and T. Lapidot
cAMP-induced PKC{zeta} activation increases functional CXCR4 expression on human CD34+ hematopoietic progenitors
Blood,
February 1, 2006;
107(3):
870 - 879.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. Bauer, R. J. Bauer, and O. C. Velazquez
Angiogenesis, Vasculogenesis, and Induction of Healing in Chronic Wounds
Vascular and Endovascular Surgery,
July 1, 2005;
39(4):
293 - 306.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. Xu, E. Bruno, J. Chao, S. Huang, G. Finazzi, S. M. Fruchtman, U. Popat, J. T. Prchal, G. Barosi, R. Hoffman, et al.
Constitutive mobilization of CD34+ cells into the peripheral blood in idiopathic myelofibrosis may be due to the action of a number of proteases
Blood,
June 1, 2005;
105(11):
4508 - 4515.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Byk, J. Kahn, O. Kollet, I. Petit, S. Samira, S. Shivtiel, H. Ben-Hur, A. Peled, W. Piacibello, and T. Lapidot
Cycling G1 CD34+/CD38+ Cells Potentiate the Motility and Engraftment of Quiescent G0 CD34+/CD38-/low Severe Combined Immunodeficiency Repopulating Cells
Stem Cells,
April 1, 2005;
23(4):
561 - 574.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Perissinotto, G. Cavalloni, F. Leone, V. Fonsato, S. Mitola, G. Grignani, N. Surrenti, D. Sangiolo, F. Bussolino, W. Piacibello, et al.
Involvement of Chemokine Receptor 4/Stromal Cell-Derived Factor 1 System during Osteosarcoma Tumor Progression
Clin. Cancer Res.,
January 15, 2005;
11(2):
490 - 497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Wysoczynski, R. Reca, J. Ratajczak, M. Kucia, N. Shirvaikar, M. Honczarenko, M. Mills, J. Wanzeck, A. Janowska-Wieczorek, and M. Z. Ratajczak
Incorporation of CXCR4 into membrane lipid rafts primes homing-related responses of hematopoietic stem/progenitor cells to an SDF-1 gradient
Blood,
January 1, 2005;
105(1):
40 - 48.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. E. Baratelli, N. Heuze-Vourc'h, K. Krysan, M. Dohadwala, K. Riedl, S. Sharma, and S. M. Dubinett
Prostaglandin E2-Dependent Enhancement of Tissue Inhibitors of Metalloproteinases-1 Production Limits Dendritic Cell Migration through Extracellular Matrix
J. Immunol.,
November 1, 2004;
173(9):
5458 - 5466.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hagemann, S. C. Robinson, M. Schulz, L. Trumper, F. R. Balkwill, and C. Binder
Enhanced invasiveness of breast cancer cell lines upon co-cultivation with macrophages is due to TNF-{alpha} dependent up-regulation of matrix metalloproteases
Carcinogenesis,
August 1, 2004;
25(8):
1543 - 1549.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Avigdor, P. Goichberg, S. Shivtiel, A. Dar, A. Peled, S. Samira, O. Kollet, R. Hershkoviz, R. Alon, I. Hardan, et al.
CD44 and hyaluronic acid cooperate with SDF-1 in the trafficking of human CD34+ stem/progenitor cells to bone marrow
Blood,
April 15, 2004;
103(8):
2981 - 2989.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Krueger and K. Callis
Potential of Tumor Necrosis Factor Inhibitors in Psoriasis and Psoriatic Arthritis
Arch Dermatol,
February 1, 2004;
140(2):
218 - 225.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Jankowski, M. Kucia, M. Wysoczynski, R. Reca, D. Zhao, E. Trzyna, J. Trent, S. Peiper, M. Zembala, J. Ratajczak, et al.
Both Hepatocyte Growth Factor (HGF) and Stromal-Derived Factor-1 Regulate the Metastatic Behavior of Human Rhabdomyosarcoma Cells, But Only HGF Enhances Their Resistance to Radiochemotherapy
Cancer Res.,
November 15, 2003;
63(22):
7926 - 7935.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. N. Robinson, V. M. Pisarev, J. M. Chavez, R. K. Singh, and J. E. Talmadge
Use of Matrix Metalloproteinase (MMP)-9 Knockout Mice Demonstrates that MMP-9 Activity Is not Absolutely Required for G-CSF or Flt-3 Ligand-Induced Hematopoietic Progenitor Cell Mobilization or Engraftment
Stem Cells,
July 1, 2003;
21(4):
417 - 427.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Reca, D. Mastellos, M. Majka, L. Marquez, J. Ratajczak, S. Franchini, A. Glodek, M. Honczarenko, L. A. Spruce, A. Janowska-Wieczorek, et al.
Functional receptor for C3a anaphylatoxin is expressed by normal hematopoietic stem/progenitor cells, and C3a enhances their homing-related responses to SDF-1
Blood,
May 15, 2003;
101(10):
3784 - 3793.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Annabi, Y.-T. Lee, S. Turcotte, E. Naud, R. R. Desrosiers, M. Champagne, N. Eliopoulos, J. Galipeau, and R. Beliveau
Hypoxia Promotes Murine Bone-Marrow-Derived Stromal Cell Migration and Tube Formation
Stem Cells,
May 1, 2003;
21(3):
337 - 347.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Alain, K. Hirasawa, K. J. Pon, S. G. Nishikawa, S. J. Urbanski, Y. Auer, J. Luider, A. Martin, R. N. Johnston, A. Janowska-Wieczorek, et al.
Reovirus therapy of lymphoid malignancies
Blood,
December 1, 2002;
100(12):
4146 - 4153.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Libura, J. Drukala, M. Majka, O. Tomescu, J. M. Navenot, M. Kucia, L. Marquez, S. C. Peiper, F. G. Barr, A. Janowska-Wieczorek, et al.
CXCR4-SDF-1 signaling is active in rhabdomyosarcoma cells and regulates locomotion, chemotaxis, and adhesion
Blood,
September 18, 2002;
100(7):
2597 - 2606.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Salcedo, M. Martins-Green, B. Gertz, J. J. Oppenheim, and W. J. Murphy
Combined Administration of Antibodies to Human Interleukin 8 and Epidermal Growth Factor Receptor Results in Increased Antimetastatic Effects on Human Breast Carcinoma Xenografts
Clin. Cancer Res.,
August 1, 2002;
8(8):
2655 - 2665.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. A. McQuibban, G. S. Butler, J.-H. Gong, L. Bendall, C. Power, I. Clark-Lewis, and C. M. Overall
Matrix Metalloproteinase Activity Inactivates the CXC Chemokine Stromal Cell-derived Factor-1
J. Biol. Chem.,
November 16, 2001;
276(47):
43503 - 43508.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Janowska-Wieczorek, M. Majka, J. Kijowski, M. Baj-Krzyworzeka, R. Reca, A. R. Turner, J. Ratajczak, S. G. Emerson, M. A. Kowalska, and M. Z. Ratajczak
Platelet-derived microparticles bind to hematopoietic stem/progenitor cells and enhance their engraftment
Blood,
November 15, 2001;
98(10):
3143 - 3149.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. De Benedetti, C. Meazza, M. Oliveri, P. Pignatti, M. Vivarelli, T. Alonzi, E. Fattori, S. Garrone, A. Barreca, and A. Martini
Effect of IL-6 on IGF Binding Protein-3: A Study in IL-6 Transgenic Mice and in Patients with Systemic Juvenile Idiopathic Arthritis
Endocrinology,
November 1, 2001;
142(11):
4818 - 4826.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Shibata, Z. Zsengeller, K. Otake, N. Palaniyar, and B. C. Trapnell
Alveolar macrophage deficiency in osteopetrotic mice deficient in macrophage colony-stimulating factor is spontaneously corrected with age and associated with matrix metalloproteinase expression and emphysema
Blood,
November 1, 2001;
98(9):
2845 - 2852.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Kijowski, M. Baj-Krzyworzeka, M. Majka, R. Reca, L. A. Marquez, M. Christofidou-Solomidou, A. Janowska-Wieczorek, and M. Z. Ratajczak
The SDF-1-CXCR4 Axis Stimulates VEGF Secretion and Activates Integrins but does not Affect Proliferation and Survival in Lymphohematopoietic Cells
Stem Cells,
September 1, 2001;
19(5):
453 - 466.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Majka, A. Janowska-Wieczorek, J. Ratajczak, K. Ehrenman, Z. Pietrzkowski, M. A. Kowalska, A. M. Gewirtz, S. G. Emerson, and M. Z. Ratajczak
Numerous growth factors, cytokines, and chemokines are secreted by human CD34+ cells, myeloblasts, erythroblasts, and megakaryoblasts and regulate normal hematopoiesis in an autocrine/paracrine manner
Blood,
May 15, 2001;
97(10):
3075 - 3085.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Bellone, A. Carbone, N. Sibona, O. Bosco, D. Tibaudi, C. Smirne, T. Martone, C. Gramigni, M. Camandona, G. Emanuelli, et al.
Aberrant Activation of c-kit Protects Colon Carcinoma Cells against Apoptosis and Enhances Their Invasive Potential
Cancer Res.,
March 1, 2001;
61(5):
2200 - 2206.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Hidalgo and S. G. Eckhardt
Development of Matrix Metalloproteinase Inhibitors in Cancer Therapy
J Natl Cancer Inst,
February 7, 2001;
93(3):
178 - 193.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Janowska-Wieczorek, M. Majka, J. Ratajczak, and M. Z. Ratajczak
Autocrine/Paracrine Mechanisms in Human Hematopoiesis
Stem Cells,
February 1, 2001;
19(2):
99 - 107.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Majka, A. Janowska-Wieczorek, J. Ratajczak, M. A. Kowalska, G. Vilaire, Z. K. Pan, M. Honczarenko, L. A. Marquez, M. Poncz, and M. Z. Ratajczak
Stromal-derived factor 1 and thrombopoietin regulate distinct aspects of human megakaryopoiesis
Blood,
December 15, 2000;
96(13):
4142 - 4151.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. J. Lane, S. Dias, K. Hattori, B. Heissig, M. Choy, S. Y. Rabbany, J. Wood, M. A. S. Moore, and S. Rafii
Stromal-derived factor 1-induced megakaryocyte migration and platelet production is dependent on matrix metalloproteinases
Blood,
December 15, 2000;
96(13):
4152 - 4159.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Sweeney, G. V. Priestley, B. Nakamoto, R. G. Collins, A. L. Beaudet, and T. Papayannopoulou
Mobilization of stem/progenitor cells by sulfated polysaccharides does not require selectin presence
PNAS,
June 6, 2000;
97(12):
6544 - 6549.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.T. Peterson, H. Li, L. Dillon, and J. W. Bryant
Evolution of matrix metalloprotease and tissue inhibitor expression during heart failure progression in the infarcted rat
Cardiovasc Res,
May 1, 2000;
46(2):
307 - 315.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. G. Aprikyan, W. C. Liles, J. R. Park, M. Jonas, E. Y. Chi, and D. C. Dale
Myelokathexis, a congenital disorder of severe neutropenia characterized by accelerated apoptosis and defective expression of bcl-x in neutrophil precursors
Blood,
January 1, 2000;
95(1):
320 - 327.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. E. Kossakowska, D. R. Edwards, C. Prusinkiewicz, M. C. Zhang, D. Guo, S. J. Urbanski, T. Grogan, L. A. Marquez, and A. Janowska-Wieczorek
Interleukin-6 Regulation of Matrix Metalloproteinase (MMP-2 and MMP-9) and Tissue Inhibitor of Metalloproteinase (TIMP-1) Expression in Malignant Non-Hodgkin's Lymphomas
Blood,
September 15, 1999;
94(6):
2080 - 2089.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION