|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 10 (May 15), 1999:
pp. 3473-3486
A Novel Function for Transforming Growth Factor- 1:
Upregulation of the Expression and the IgE-Independent Extracellular
Release of a Mucosal Mast Cell Granule-Specific -Chymase, Mouse Mast
Cell Protease-1
By
Hugh R.P. Miller,
Steven H. Wright,
Pamela A. Knight, and
Elisabeth M. Thornton
From the Department of Veterinary Clinical Studies, Royal (Dick)
School of Veterinary Studies, The University of Edinburgh, Easter Bush
Veterinary Centre, Easter Bush, Roslin, Midlothian, Scotland.
 |
ABSTRACT |
Intestinal mucosal mast cells (IMMC) express granule neutral
proteases that are regulated by T-cell-derived cytokines, including interleukin-3 (IL-3) and IL-9, and by stem cell factor (SCF). The
IMMC-specific chymase, mouse mast cell protease-1 (mMCP-1), is released
in substantial quantities into the blood stream during gastrointestinal
allergic responses. We used cultured bone marrow-derived mast cells
(mBMMC) to identify cytokines that regulate the expression and
extracellular release of mMCP-1. When grown in IL-3-rich WEHI (15%
vol/vol) and 50 ng/mL recombinant rat SCF (rrSCF) bone marrow cells
supplemented with IL-9 (5 ng/mL) differentiated into mBMMC that
expressed a maximum of less than 250 ng mMCP-1/106 cells
and 189 ng mMCP-1/mL of culture supernatant. Supplementation of the
same three cytokines with transforming growth factor- 1 (TGF-1; 1 ng/mL) resulted in substantially enhanced
expression (6 µg/106 mBMMC) and extracellular release (2 µg/mL of culture supernatant) of mMCP-1. The response to
TGF-1 was dose-dependent, with maximal effect at 1 ng/mL, and was associated with immunohistochemical and ultrastructural
changes in the secretory granules. IL-9-induced expression of mMCP-1
may be due to endogenously expressed TGF-1, because it
was blocked by anti-TGF- antibodies. In conclusion, the expression
and extracellular release of the IMMC-specific chymase, mMCP-1, is
strictly regulated by TGF-1.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE PROLIFERATION, differentiation, and
survival of intestinal mucosal mast cells (IMMC) in murine rodents are
regulated by several distinct mechanisms. The most critical of these
involves the ligand for c-kit and its tyrosine kinase receptor
encoded by the c-kit proto-oncogene.1 The crucial
importance of this mechanism is demonstrated by the absence of IMMC in
murine rodents with mutations affecting the c-kit gene or of
its ligand,2,3 which is known as kit-ligand, Steel
factor, and stem cell factor (SCF), the designation that will be used
herein.1 Similarly, survival of IMMC undergoing hyperplasia
in response to nematode infection is also substantially reduced in
murine rodents treated with antibodies directed against SCF or against
c-kit.4,5 These studies on mutant mice and rats,
and using antibody treatments, show that the interaction of SCF and of
c-kit is absolutely essential for the generation and survival
of proliferating IMMC populations.2-5
The second mechanism that influences IMMC proliferation during
intestinal nematode infection is mediated by T cells6,7 and
both interleukin-3 (IL-3) and IL-4 are implicated in the proliferation of IMMC.8,9 Similarly, mice transgenic for increased
expression of IL-9, a mast cell growth factor,10 have
substantially increased numbers of IMMC in the absence of any
additional immunological stimulus in the gut.11
The mechanisms regulating the differentiation of IMMC are not
understood. In murine rodents, humans, and other species, IMMC are
morphologically, histochemically, and functionally distinct from
connective tissue mast cells (CTMC).12-14 Mucosal mast
cells are significant because of their involvement in gut
hypersensitivities,15 in gastric ulceration and
inflammation,16,17 and in protective responses against
gastrointestinal nematodes.18 Therefore, it is important to
determine the regulatory mechanisms which promote the tissue-specific
expression of genes unique to IMMC.
One of the key differences between IMMC and CTMC is in the expression
of secretory granule neutral proteases.19-21 In the mouse, the -chymase, mouse mast cell protease-1 (mMCP-1), is expressed only
by mast cells at mucosal surfaces.22,23 Similarly, rat mast
cell protease-II (rMCP-II), a -chymase highly homologous to
mMCP-1,19 and sheep mast cell protease-1 (sMCP-1) are
abundantly expressed by mucosal mast cells (MMC) but not
by CTMC.18,19 Each of these MMC-associated proteases is
secreted systemically and into the gut lumen during gastrointestinal
allergic responses.18,19
Attempts to generate an in vitro analog of IMMC in the mouse, using
bone marrow-derived mast cells (mBMMC), have not been successful. Early
studies in which mBMMC were grown in the presence of IL-3 alone
suggested that the cultured cells shared many features in common with
IMMC.13 However, it was subsequently shown that these cells
expressed little or none of the IMMC-specific chymases and that,
morphologically, they were distinct from IMMC.13,14,20 In
contrast, mBMMC supported by T-cell-derived conditioned
medium24 or by a combination of SCF/IL-9 or of SCF/IL-10
expressed the IMMC-specific chymase, mMCP-1.25,26
The initial aim of the present study was to determine whether the
constitutive systemic secretion of mMCP-1 seen in normal mice,27 which is greatly enhanced in mice transgenic for
the overexpression of IL-9,11 could be reproduced in vitro
using mBMMC. The first series of experiments addresses this question. The results show that IL-9 stimulates levels of mMCP-1 expression and
secretion by mBMMC in vitro that are much lower than might be expected
from in vivo studies.19,27 This indicates that additional
growth/differentiation factors are required.
Such factors could, like SCF,28 be associated with the
mucosal epithelium, because greater than 95% of IMMC differentiate intraepithelially in mouse intestine.29-31 One possible
candidate is transforming growth factor-1
(TGF-1), which is expressed by enterocytes, T cells,
eosinophils, and many other cells found in the intestinal
microenvironment.32,33 This cytokine has multiple
immunoregulatory roles, including that of augmenting the expression of
the surface integrins  E7 on both T cells
and mBMMC.34,35 TGF-1 modulates expression
of other genes in mast cells, including the Fc R1-induced
members of the chemokine family.36 Therefore, we reasoned
that the constitutive expression of SCF28 and of
TGF-132 by enterocytes could influence the differentiation of IMMC that are so intimately associated with gut epithelium.
The hypothesis that TGF-1 is a key regulatory signal in
the differentiation of IMMC was tested by growing mBMMC in the presence or absence of this cytokine. Our results show that the chymase mMCP-1
is expressed at very high levels and is released in a dose-dependant fashion into the supernatant when TGF-1 is added to the
cultures. They also show that the IL-9-induced expression of mMCP-1 is
probably regulated through autostimulation by endogenously secreted
TGF-1. This novel role for TGF-1 in the
regulation of the IgE- independant extracellular release of mMCP-1 has
substantial implications for our understanding of mast cell biology.
Importantly, the profound immunoregulatory influence that
TGF-1 is known to have at mucosal surfaces may now also
extend to the mucosal mast cell.
| |
MATERIALS AND METHODS |
Production of WEHI-3B IL-3-rich conditioned medium.
The mouse myelomonocyte cell line WEHI-3B37 (European
Collection of Animal Cell Cultures, Porton Down, Salisbury, UK) was grown in RPMI 1640 (Life Technologies Ltd, Paisley, UK),
10% heat-inactivated fetal calf serum (FCS; Serotec, Kidlington,
Oxford, UK), 2 mmol/L L-glutamine, 100 U/mL penicillin, and 100 µg/mL
streptomycin to high cell density. The resultant maximum supernatant
was tested for use as an IL-3-rich conditioned medium by its ability
to sustain growth of the IL- 3-dependent cell line AC-2.
Bone marrow mast cell culture.
Groups of five 10- to 12-week-old male BALB/c mice were killed and
their femurs were removed under sterile conditions. Bone marrow was
washed from the femurs using a 23-gauge needle and 5-mL syringe filled
with Dulbecco's modified Eagle's medium (DMEM; Life Technologies Ltd)
containing 10% FCS (Serotec), 100 U/mL penicillin, 100 µg/mL
streptomycin, 2.5 µg/mL fungizone, 2 mmol/L L-glutamine, and 1 mmol/L
sodium pyruvate (DMEM/FCS). Cells were suspended by passing them
through a 19-gauge needle 3 times, followed by filtration through
sterile lens tissue, and then were centrifuged at 230g for 7 minutes at room temperature. After resuspension in 50 mL DMEM/FCS, the
cells were counted in an Improved Neubauer counting chamber (×10
magnification) using 0.2% Nigrosin exclusion to measure viability.
Nucleated cells were counted after dilution in white blood cell
counting fluid. Cell cultures were set up in a humid 5%
CO2 incubator using 162 cm2 flat-bottomed
flasks or 24-well microtiter plates at 5 × 105
cells/mL in DMEM/FCS, containing various combinations of 15% WEHI-3B,
conditioned medium (15% WEHI), 50 ng/mL rrSCF (Amgen, Thousand Oaks,
CA), 5 ng/mL recombinant mouse IL-9 (rmIL-9; R&D Systems
Ltd, Abingdon, UK), and 1 ng/mL recombinant human TGF-1 (rhTGF-1; Sigma, Poole, UK). Where cultures were
maintained for more than 4 days, they were fed at 3- to 4-day
intervals. The concentrations of WEHI-3B and of SCF were determined in
a series of pilot experiments quantifying maximum bone marrow cell
growth with a yield of greater than 80% mBMMC within 7 days of
initiating the culture. Optimal concentrations of IL-9 and
TGF-1 were determined experimentally as described in Results.
Treatment of mBMMC cultures with anti-TGF-
antibodies.
mBMMC grown in culture for 7 days in various combinations of cytokines,
were incubated for 48 hours with chicken anti-TGF- antibody (R&D
Systems Ltd) or normal purified chicken IgG control (Sigma) at 1 µg/mL.
Preparation of cytosmears.
Cultured mBMMC (5 × 104 cells in 100 µL) were
cytocentrifuged (Shandon, Runcorn, Cheshire, UK) onto
clean glass slides for 5 minutes at 40g. The cytosmears were
air-dried and fixed in 4% paraformaldehyde in phosphate-buffered
saline (PBS), pH 7.5, for 45 minutes at 45°C24 and
stored in 70% ethanol at 4°C. Slides from each culture were also
immediately stained with Leishmans24 for morphological analysis, and others were fixed in Carnoy's fluid before staining with
toluidine blue for mast cell counts.24
Immunohistochemistry and toluidine blue staining of cytosmears.
Endogenous peroxidase activity in paraformaldehyde-fixed cytosmears was
eliminated by incubation for 30 minutes in methanol containing 1%
H2O2.24 Cytosmears were then washed
in H2O and nonspecific binding of antibodies was blocked
with PBS/0.5 mol/L NaCl containing 0.5% Tween-80 (Serotec Ltd,
Crawley, UK; PBS/T80). Cytosmears were probed with a rat
IgG1 monoclonal antibody (MoAb) raised against mMCP-1 (MoAb
RF6.1 maximum supernatant diluted 1:10 in PBS/T80)30 or rat
IgG1 (10 µg/mL) in PBS/T80 as negative control. Detection
was with biotinylated antirat IgG1 (Vector Laboratories
Ltd, Peterborough, UK) followed by Vectastain standard ABC
kit (Vector Laboratories Ltd) and diaminobenzidine (DAB) peroxidase substrate kit (Vector Laboratories Ltd), with hematoxylin as
counterstain. Slides were also probed with a biotinylated sheep
polyclonal antibody raised against mMCP-122 and detected
with the ABC/DAB system described above. Cytosmears fixed in Carnoy's
were stained with 0.5% toluidine blue (pH 0.5)
overnight,24 washed in distilled H2O, and
counterstained for 30 seconds with 1% eosin in 70% ethanol. All
slides were washed, dehydrated, and mounted in DPX (Fisher Scientific
UK, Loughborough, UK). Median cell counts were compared using the
nonparametric Mann-Whitney test (Minitab) with significance levels of
P < .05.
Cell pellets and supernatants for enzyme-linked immunosorbent assay
(ELISA) and Western blotting.
Cells (2.5 × 106) were washed 3 times in PBS and
centrifuged at 230g for 7 minutes. The supernatant was
discarded and the cell pellet was frozen at  70°C for use in
ELISA and Western blotting. Cell supernatants were obtained before
feeding the culture. The cells were centrifuged at 230g for 7 minutes, and 1 mL of the supernatant was removed and frozen at
70°C.
ELISA to quantify mMCP-1.
The concentration of mMCP-1 in culture supernatants and in cell pellets
was measured as descibed previously24 but using a modified
ELISA incorporating MoAb RF 6.1.30 Median mMCP-1 concentrations were compared using the nonparametric Mann-Whitney test
(Minitab) with significance levels of P < .05.
Western blotting.
Western blotting of material from cell pellets lysed by repeated
freeze-thawing and detection with MoAb RF 6.1 was performed as
previously described.30 The detection system used was
alkaline phosphatase-labeled monoclonal antirat IgG1
(Sigma) followed by incubation with 5-bromo 4-chloro 3-indolyl
phosphate/nitro blue tetrazolium (BCIP/NBT).
Flow cytometry to detect c-kit expression.
At various stages of bone marrow culture, 5 × 105
cells from each culture were centrifuged at 230g for 7 minutes
and incubated on ice with rat anti-c-kit MoAb
(ACK-2)4 (a gift from Dr H. Faulkner, University of
Manchester, Manchester, UK) at 3 µg IgG/mL for 30 minutes in PBS containing 1% bovine serum albumin (BSA) and normal rat
IgG (Sigma) was used as a control at the same concentration. The cells
were washed in PBS and incubated on ice for 30 minutes with
biotinylated antirat IgG (Vector Laboratories Ltd). Cells expressing
surface c-kit and binding MoAb ACK-2 and biotinylated mouse
antirat IgG were labeled with streptavidin phycoerythrin (R&D Systems
Ltd). Labeled cells were scanned on a Becton Dickinson fluorescence
activated flow cytometer (FACScan).
Detection of transcripts by reverse transcription-polymerase
chain reaction (RT-PCR).
Total RNA was extracted from cell pellets in 0.5 to 1 mL Tri-Reagent
(Sigma) according to the manufacturer's specifications. Semiquantitative RT-PCR was used to detect IMMC specific and
nonspecific products essentially as described in our previous
studies.38 Because mast cell-associated heparin can
copurify with RNA and is known to inhibit the PCR
reaction,39 aliquots of 4 µg RNA were incubated with 4 U
heparinase I (Sigma), in addition to 115 U deoxyribonuclease I (Sigma)
to remove any contaminating genomic DNA, in 5 mmol/L Tris-HCl, pH 7.5, 1 mmol/L CaCl2, and 40 U RNAase inhibitor (Promega,
Southampton, UK) in a total volume of 40 µL for 2 hours
at 25°C and then for 5 minutes at 95°C. Serial dilutions of the
heparinase-treated samples were reverse transcribed in 20 µL volumes
containing 1, 0.1, 0.01, or 0.001 µg RNA, 1 mmol/L dNTPs, 20 U RNAase
inhibitor, 2.5 µmol/L oligo dT primers, 1× RT buffer, 2.5 mmol/L MgCl2, and 50 U of avian myeloblastosis virus
(AMV) reverse transcriptase (Promega) at 42°C for 1 hour. After 5 minutes of incubation at 95°C, each RT reaction was
diluted 10-fold to 200 µL and 10 µL was used for each PCR reaction.
The cDNA was amplified for 1 minute at 94°C, 2 minutes at 63°C,
and 3 minutes at 72°C for 30 thermocycles in 50 µL volumes
containing 250 µmol/L dNTPs, 250 nmol/L of each primer, 1×
Boehringer Mannheim PCR buffer [5 mmol/L Tris-HCl, pH 9.2, 16 mmol/L (NH4)2SO4, 1.5 mmol/L
MgCl2], and 2.5 U Taq DNA polymerase (Boehringer Mannheim, Lewes, East Sussex, UK). Four pairs of oligonucleotide
primers were used to identify transcription of chymase genes commonly expressed in mouse mast cells: mMCP-1 (460 bp)40 5'
primer, 5'-GGAAAACTGGAGAGAAAGAACCTAC, and 3' primer,
5'-GACAGCTGGGGACAGAATGGGG; mMCP-2 (525 bp)41 5' primer, 5'-
ATTTCATTGCCTAGTTCCTCTGAC, and 3' primer, 5'-CAGGATGAGAACAGGCTGGGAT;
mMCP-4 (454 bp)42 5' primer, 5'-GTAATTCCTCTGCCTCGTCCTTC,
and 3' primer, 5'-GGACAGGATGGACACATGCTTT; and mMCP-5 (418 bp)43 5' primer, 5'-GGCAGAACAAACGTGAATGAGCC, and 3'
primer, 5'-AAGAACCTTCTGGAAGCTCAGGG. In addition, gene-specific oligonucleotide primers were used for mouse TGF-1 (406 bp)44 5' primer, 5'-CGGGGCGACCTGGGCACCATCCATGAC, and 3'
primer, 5'-CTGCTCCACCTTGGGCTTGCGACCCAC, and the mast cell nonspecific
housekeeping genes mouse glyceraldehyde 3-phosphate dehydrogenase
(G3PDH; 450 bp)45 5' primer, 5'-GAAGGGCTCATGACCACAGTCCATG, and 3' primer, 5'-TGTTGCTGTAGCCGTATTCATTGTC, or mouse -actin (514 bp) 5' primer, 5'-TGTGATGGTGGGAATGGGTCAG, and 3' primer, 5'-
TTTGATGTCACGCACGATTTCC (purchased from Stratagene, Cambridge, UK).
Primers for housekeeping genes were included in each set of PCR
reactions as a control to eliminate variations in the
heparinase/reverse transcription reactions that could affect the
efficiency of subsequent PCR reactions, in addition to controls
containing heparinase-treated RNA only (no cDNA). PCR products were
separated on 1.2% agarose gels stained with ethidium bromide and
visualized and recorded under UV light with a CCD camera linked to an
image processor (Oncor/Appligene, Watford, UK). The authenticity of the
PCR products were confirmed by Southern hybridization using
gene-specific oligonucleotide probes, as described
previously.38
| |
RESULTS |
Expression of mMCP-1 in the presence of IL-9.
Analysis of the differentiation of bone marrow cells has shown that a
combination of IL-3/SCF/IL-9 promotes the early differentiation of
mBMMC.46 To determine whether the presence of IL-9 promoted significant expression and secretion of mMCP-1, bone marrow cells grown
in IL-3-rich WEHI (15%), rrSCF (50 ng/mL), and rmIL-9 (5 ng/mL) and control cells grown in WEHI/rrSCF were harvested at intervals and the proportions of mMCP-1+ mBMMC, and the
content of mMCP-1 in the cell pellets and culture supernatants was compared.
The results of one such experiment are shown in
Fig 1. In both cultures, the percentage of
mast cells as assessed from Leishman-stained cytosmears was greater
than 80% by day 10 and remained at greater than 95% (>95% viable)
from day 14 until completion of the study. Expression of mMCP-1 on day
10 was low in both cultures, but the proportion mMCP-1+
cells increased rapidly, reaching a maximum of 57% in the presence of
rmIL-9, on day 16, and 3% mMCP-1+ mBMMC in the absence of
rmIL-9 (Fig 1A). The secretion of mMCP-1 into the culture supernatants
reflected the proportions of positive cells in the two populations with
a maximum concentration of 189 ng/mL in the rmIL-9
supplemented culture and less than 3 ng/mL in the controls
(Fig 1B). Concentrations of mMCP-1 in the cell pellets, similarly,
reflected the levels in the supernatants (Fig 1B and C). In four repeat
experiments, results were similar, except that mMCP-1+
mBMMC were often maximal (25% to 40%) at 11 to 14 days of culture and
that levels of mMCP-1 rarely exceeded 50 ng/mL of supernatant in the
rmIL- 9-supplemented cultures (see also below).
View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
Expression of mMCP-1 in long-term bone marrow cultures.
Cells were supplemented with rmIL- 9/WEHI/rrSCF ( ; I/W/S) or
WEHI/rrSCF ( ; W/S). In (A), the percentage of mMCP-1+
mast cells was assessed by immunohistochemical staining of cytosmears
with MoAb RF 6.1. (B) shows the concentrations of mMCP-1 in culture
supernatants (in nanograms per milliliter) quantified by ELISA. (C)
shows the concentrations of mMCP-1 in cell pellets (in nanograms per
106 cells).
|
|
Because it was possible that the concentrations of rmIL-9 in the
above-noted studies were not optimal, a dose-response experiment was
set up in which bone marrow cells were cultured in 15% WEHI, 50 ng/mL
rrSCF, and concentrations of 0.5, 5, and 25 ng rmIL-9/mL; cells and
supernatants were harvested 2, 4, 7, 9, and 11 days later. With all
three doses of rmIL-9, peak proportions of mMCP-1+ mBMMC
were detected on day 9 (Fig 2A), with a
slight trend towards a maximal response both for the percentage of
positive cells and for the concentration of mMCP-1 in supernatants at a
concentration of 5 ng rmIL-9/mL (Fig 2B). However, there was a greater
accumulation of intracellular mMCP-1 on day 11 in the culture
supplemented with 25 ng rmIL-9/mL (data not shown). Cell viability was
greater than 90% throughout, and mast cell numbers increased twofold
to threefold every 2 days between days 4 and 11.
View larger version (21K):
[in this window]
[in a new window]
| Fig 2.
(A) shows the dose response curves for the intracellular
expression of mMCP-1 as assessed by immunohistochemical staining of
cytosmears with MoAb RF 6.1 for mBMMC cultures set up in WEHI
(15%)/rrSCF (50 ng/mL) alone ( ) or in WEHI/rrSCF with 0.5 ng/mL
( ), 5 ng/mL ( ), or 25 ng/mL ( ) rmIL-9. (B) shows the
concentrations of mMCP-1 in supernatants from the mBMMC cultures
described in (A). (C) and (D) show expression of mMCP-1 in short-term
bone marrow cultures in which cells were cultured for 7 days in the
presence of WEHI/rrSCF (>90% mBMMC; >98% viable), before they
were transferred to separate flasks and cultured for a further 7 days
in quadruplicate in the presence of either WEHI/rrSCF or rmIL-9/rrSCF.
In (C), percentages of mMCP-1+ ( , ) and
chymase+ (,  ) mast cells were assessed by
immunohistochemical staining of cytosmears using MoAb RF 6.1 or sheep
polyclonal antibody that cross-reacts with other chymases. Results are
shown from mBMMC cultured in WEHI/rrSCF (, ) or rmIL-9/rrSCF
(, ). In (D), the concentration of mMCP-1 in supernatants was
assessed in quadruplicate mBMMC cultures grown in WEHI/rrSCF () or
rmIL-9/rrSCF (). Data are expressed as the mean ± SE.
|
|
It was reported that IL-3 suppressed the expression of mMCP-1 and
mMCP-2, but that when the cells were transferred to a culture medium
supplemented with rrSCF/rmIL-9, there was substantial expression of
these two chymases.25 Therefore, bone marrow cells were
cultured for 7 days in the presence of WEHI/rrSCF (>90% mBMMC;
>98% viable), before they were transferred to separate flasks and
cultured for a further 7 days in quadruplicate in the presence of
either WEHI/rrSCF or rmIL-9/rrSCF. There was negligible expression of
mMCP-1 in supernatants and cells in the absence of rmIL-9 (Fig 2C and
D), but when mBMMC were transferred to rmIL- 9/rrSCF the culture
supernatant and cells contained 11 ± 1 ng mMCP-1/mL (Fig 2D) and 24 ± 3 ng mMCP-1/106 cells, respectively, and 18% ± 2% of the mBMMC were positive for mMCP-1 by immunohistochemistry 7 days later (Fig 2C). Similarly, at all earlier time points, the
percentage mMCP-1+ values for the
rmIL-9/rrSCF-supplemented cultures were significantly increased
(P < .03) over the values for the cultures maintained in
WEHI/rrSCF (Fig 2C).
When the cytosmears were stained for the presence of other chymases, in
addition to mMCP-1, using a polyclonal antibody against mMCP-1,22 the proportion of chymase+ mBMMCs
remained constant in WEHI/rrSCfF, but increased significantly (P < .03) in the presence of rmIL-9 (Fig 2C).
The transfer of mBMMC to rmIL-9/rrSCF was associated with an initial
40% ± 13% decrease in cell numbers on day 2, followed by a 160% ± 38% increase on day 4 and steady state on day 7. In WEHI/rrSCF,
the mBMMC were in steady state on day 2, increased 142% ± 34% on
day 4, and had further increased by 83% ± 13% on day 7. However,
there was a significant (P < .03) decrease in cell viability
in the cells supplemented with rmIL-9/rrSCF to 56% ± 6% on day 7, whereas the viabilities of the WEHI/rrSCF cultures remained between
89% ± 4% and 93% ± 3% (n = 3).
TGF-1 promotes the enhanced expression
and secretion of mMCP-1.
Although the data given above were in agreement with previous studies
showing that a combination of rmIL-9/rrSCF promoted the expression of
mMCP-1, the proportions of mMCP-1+ cells rarely exceeded
50%, which contrasts with the in vivo picture, in which 100% of IMMC
recruited during the early stages of nematode infection are
mMCP-1+.29,30,47 Furthermore, the low nanogram
levels of mMCP-1 present in culture supernatants and cell pellets are
not commensurate with the microgram quantities noted in
vivo.19 Therefore, we reasoned that an additional factor
might be required to promote the expression and secretion of mMCP-1 and
of another -chymase associated with IMMC, mMCP-2.25,26
One potential candidate was TGF-1, because several
studies have shown that this cytokine is constitutively expressed by
enterocytes32 and because mBMMC have been shown to be
responsive to short-term (16 hours) exposure to this
cytokine.36 To test the hypothesis that
TGF-1 regulates the expression of IMMC-specific
-chymases, 4 flasks of bone marrow cells were cultured in the
presence of WEHI (15%), rrSCF (50 ng/mL), and rmIL-9 (5 ng/mL) for 7 days to produce greater than 95% mast cells that were greater than 90% c-kit+ by flow cytometry (data not shown) and
20% ± 4% mMCP-1+ by immunohistochemistry, with
typically vacuolated granules and numerous pseudopod- like cytoplasmic
extensions.13 The cells were split into 16 separate flasks
at 5 × 105 mBMMC/mL and supplemented with WEHI
(15%)/rrSCF (50 ng/mL)/rmIL-9 (5 ng/mL) to which was added either
vehicle alone or rhTGF-1 at a final concentration of 1 ng/mL of culture supernatant.
Within 48 hours of adding TGF-1, the proportion of
mMCP-1+ mBMMC increased from 20% ± 4% to 72% ± 0.3% (n = 2). At 4 days, the proportion had increased to 97% ± 1% (n = 4) and, at 7 days, 99% ± 0.5% (n = 4;
Fig 3A). The proportions of
mMCP-1+ mBMMC in the control flasks lacking
TGF-1 reached a maximum of 30% ± 5% (n = 3) at 7 days (Fig 3A). The differences between the values for control and
TGF-1-supplemented flasks were highly significant
(P < .001) 4 and 7 days after adding TGF-1
(days 11 and 14, Fig 3A and 3B). The substantial change in the
proportion of mMCP-1+ mBMMC, together with the greatly
increased intensity of staining (Fig 4b and
d) with time after supplementation with TGF-1,
was associated with a 500-fold increase in the level of mMCP-1 in the
culture supernatants (Fig 3B) and, although there was a gradual increase in the controls, maximum values were 44 ± 5 ng/mL on day
7, as opposed to 6,000 ± 900 ng/mL in the
TGF-1-supplemented samples (P < .001;
Fig 3B). Quantification of mMCP-1 in the cells recovered on
day 7 after adding TGF-1 (day 14), similarly, showed much higher concentrations of mMCP-1 in the
TGF-1-supplemented mBMMC than in controls (Fig 3C;
P < .001), and this was confirmed using Western
blotting (Fig 3D).
View larger version (49K):
[in this window]
[in a new window]
| Fig 3.
Upregulation of mMCP-1 expression in mBMMC
cultures after the addition of TGF-1. Four flasks of mBMMC were
cultured in the presence of WEHI/rrSCF/rmIL-9 (5 ng/mL) for 7 days to
produce greater than 95% mast cells which were 20% ± 4%
mMCP-1+. They were split into 16 separate flasks at 5 × 105 mBMMC/mL, and supplemented with WEHI/rrSCF/rmIL-9 to
which was added either vehicle alone or rhTGF-1 (1 ng/mL
of culture supernatant). (A) shows the percentage of
mMCP-1+ mast cells from mBMMC cultures with () or
without () addition of TGF-1 on day 7. Data are from
quadruplicate cultures except where stated. (B) shows the
concentrations of mMCP-1 in culture supernatants (in nanograms per
milliliter). (C) shows the concentration of mMCP-1 in cell pellets (in
nanograms per 106 cells) from these cultures 7 days after
the addition of rhTGF-1 () or in rmIL-9/WEHI/rrSCF
(). (D) is a Western blot to show mMCP-1 expression in mBMMC grown
in rhTGF-1/rmIL-9/WEHI/rrSCF (TGF-1) compared with an
equivalent loading from mBMMC grown in rmIL-9/WEHI/rrSCF (IL-9) as
detected by MoAb RF 6.1. A lane containing purified mMCP-1 (M1) was
included as a control. Extracts from 2.5 × 104 mBMMC were
loaded in the other lanes. Molecular weights in kilodaltons are shown.
(E) shows the RT-PCR products of chymase genes from total RNA extracted
from mBMMC cultures. RNA was from triplicate mBMMC cultures (A, B, and
C) in rhTGF-1/rmIL-9/WEHI/rrSCF (T/I/W/S) or
rmIL-9/WEHI/rrSCF (I/W/S) (7 days after addition of
TGF-1). Initial dilutions of the RNA template before
reverse transcription are indicated (1, 0.1, 0.01, and 0.001 µg/mL).
Primer sets used for PCR were specific for the mMCP-1, mMCP-2, mMCP-4,
mMCP-5, and -actin genes as indicated.
|
|
View larger version (113K):
[in this window]
[in a new window]
| Fig 4.
The morphology of mBMMC grown in the presence or absence
of TGF-1 is compared. Cytosmears are shown from mBMMC
cultured in rmIL-9/WEHI/rrSCF stained with Leishman's stain (a) or
MoAb RF 6.1 for mMCP-1 (b) and from mBMMC cultured in
rhTGF-1/rmIL-9/WEHI/rrSCF stained with Leishman's stain (c) or MoAb
RF 6.1 for mMCP-1 (d). mBMMC cultured in the presence of TGF-1 are
more rounded, lack pseudopodia, and are highly positive for mMCP-1
compared with those cultured in IL-9 alone (original magnification
×800). The ultrastructure of granules from mBMMC cultured in the
presence of TGF-1 or in WEHI/rrSCF/rmIL-9 alone are
shown in (e) and (f) (original magnification ×2,500). The granules
of mBMMC supplemented TGF-1 mBMMC are more
electron-dense.
|
|
In previous studies of the expression of mast cell granule proteases by
mBMMC, the levels of transcription of the IMMC-associated chymases
mMCP-1 and mMCP-2 and of the CTMC-associated chymases mMCP-4 and mMCP-5
were compared after the addition of rmIL-9 or rmIL-10, together with
SCF, to the cultured cells.25 Northern analysis showed
upregulated transcription of the mMCP-1 and mMCP-2 genes.25
Therefore, the transcription of these four chymases by the mBMMC
cultured for 7 days in the presence or absence of TGF-1
was, similarly, analyzed using semiquantitative RT-PCR (Fig
3E). In the culture supplemented with WEHI/rrSCF/rmIL-9, all four
proteases were expressed to a similar extent (Fig 3E), which is largely
in agreement with published data.25 When the culture was
supplemented with WEHI/rrSCF/rmIL-9/rhTGF-1, there was
substantial upregulation of transcription of mMCP-1 and mMCP-2 (Fig
3E), with no obvious variation in the transcription of mMCP-4 and
mMCP-5 (Fig 3E). These data are consistent with the immunohistochemical and ELISA results described above and suggest that TGF-1
coregulates the increased expression of mMCP-1 and mMCP-2 and is
without effect on mMCP-4 and mMCP-5.
At all stages of the culture, the cell viability remained at 95% to
98% and greater than 98% cells from both groups were strongly toluidine blue (pH 0.5) positive. However, there were substantial morphological differences between the two populations after Leishman's staining and at the ultrastructural level. Using light microscopy, control mBMMC grown in the absence of TGF-1 had
pseudopodia and the granules were vacuolated and less distinct (Fig
4a), as described previously by other workers.48 The
addition of TGF-1 was associated with a more compact
mBMMC, lacking pseudopodia, and with densely stained granules of
variable shape and size (Fig 4c).
Ultrastructurally, all of the cells (n = 54) exposed to
TGF-1 and harvested on day 7 contained homogeneous
granules with, in some instances, a less dense rim between the matrix
and granule membrane (Fig 4e) and, rarely, a crystalline core of the
type extensively described for the granules of IMMC in parasitized gut.49 By contrast, the granules of the control cells
(n = 40) were vacuolated and contained numerous small
vesicles and clusters of more dense material; this vacuolated granule
morphology (Fig 4f) has been described previously by
others.49 The morphology of the cells supplemented with
TGF-1 is, thus, quite distinct from that described
previously for mBMMC.13,49
Synergy between SCF and TGF-1 in the
expression and secretion of mMCP-1.
To identify the cytokines that best supported the expression and
secretion of mMCP-1, bone marrow cells were grown in flasks for 1 week
in WEHI/rrSCF (>80% BMMC, >90% viable) before they were
transferred at 5 × 105 cells/mL into 48-well plates
and cultured for a further 4 days in varying cytokine combinations as
shown in Table 1. When compared with
controls maintained in WEHI/rrSCF that supported the strongest growth
of mBMMC, showing a fourfold increase over the 4 days (Table 1), the
combination of rhTGF-1/rmIL-9/WEHI/rrSCF resulted in a
threefold increase in numbers of mBMMC (Table 1). In contrast, and as
reported previously,50 rhTGF-1/rrSCF was
associated with very poor cell viability and a decrease in cell
numbers.
View this table:
[in this window]
[in a new window]
|
Table 1.
Effect of Different Cytokines on Numbers and Viability
of mBMMC and on the Expression and Release of mMCP-1
|
|
In all of the cytokine combinations in which TGF-1 was
added, there was an increase in the proportion of mMCP- 1+
mBMMC and in the concentrations of mMCP-1 found in the culture supernatants (Table 1). However, by day 4 of culture, it was clear that
the maximal expression and secretion of mMCP-1 was associated with the
presence of TGF-1 and SCF and that either rmIL-9 or IL-3
(WEHI) synergized with these two cytokines to maintain cell viability.
These data confirm that the addition of IL-9 and of
TGF-1 to mBMMC maintained in WEHI/rrSCF promotes the
maximal cell growth in association with maximal expression and
secretion of mMCP-1. However, it would appear that, on a per cell
basis, maximum extracellular release of mMCP-1 occurred in the presence of TGF-1/IL-9/SCF.
Expression and secretion of mMCP-1 is directly related to the
concentration of TGF-1.
In the preceding experiment, the cultures were supplemented with
rhTGF-1 at 1 ng/mL, and it was not clear whether this
concentration was optimal for the induced expression of mMCP-1. It was
also not clear whether the rate of mBMMC growth was affected by the presence of TGF-1, because it is reported that
TGF-1 is inhibitory for mast cell growth.51
Therefore, cells grown for 7 days in WEHI/rrSCF (>95% mBMMC, <1%
mMCP-1+, >95% viable) were transferred into 48-well
plates at 5 × 105 mBMMC/mL and supplemented with WEHI
(15%)/rrSCF (50 ng/mL)/rmIL-9 (5 ng/mL) to which was added, in
quadruplicate wells, vehicle (controls) or rhTGF-1 at
final concentrations of 0.01, 0.1, 1, and 5 ng/mL. Supernatants and
cells for immunohistochemistry were harvested 2, 4, and 7 days later.
Similarly, cells were harvested from additional quadruplicate wells at
2 and 7 days to measure the content of stored mMCP-1.
Over the 7 days of the experiment, concentrations of 1 and 5 ng
TGF-1/mL augmented the expression and secretion of
mMCP-1 to the same extent (Fig 5A and C).
The content of stored mMCP-1 was not significantly different for these
two doses with, on day 7, concentrations of 4,708 ± 420 and
4,478 ± 448 ng mMCP-1/106 mBMMC. Whereas the
addition of lower doses of TGF-1 (10 and 100 pg/mL) was
without effect on the growth of the mBMMC over the 7-day period,
concentrations of 1 and 5 ng TGF-1/mL did result in some
growth inhibition on days 2 and 4 (P < .03), although significant growth of the cells in all the cultures occurred between days 4 and 7 (Fig 5B). The lower doses of 10 and 100 pg
TGF-1/mL induced the extracellular release of mMCP-1
(Fig 5C and D), and dose-response analysis on day 4 shows that the
extracellular release of mMCP-1 is strictly dose-related, with a
maximum release at 1 ng TGF-1/mL (Fig 5D). Similarly,
the intracellular storage of mMCP-1 was significantly greater than in
control cultures (P < .03), with, for example, 100 pg/mL
promoting expression in cell pellets of 239 ± 53 ng
mMCP-1/106 mBMMC on day 7.
View larger version (21K):
[in this window]
[in a new window]
| Fig 5.
The upregulation of mMCP-1 supplemented with
TGF-1 is dose-dependant. mBMMC were grown for 7 days in
WEHI/rrSCF, transferred into 48-well plates at 5 × 105
mBMMC/mL, and supplemented with WEHI/rrSCF/rmIL-9 to which was added,
in quadruplicate wells, WEHI/rrSCF/rmIL-9 alone () or 0.01 (),
0.1 (), 1 ( ), or 5 () ng/mL rhTGF-1. (A) shows
the percentage of mMCP-1+ mast cells. Counts from all the
TGF-1-supplemented cultures were significantly higher
than the WEHI/rrSCF/rm IL-9 controls on days 4 and 7 (P < .03). (B) shows the total numbers of mast cells per culture. The counts
from cultures supplemented with 1 or 5 ng/mL rhTGF-1
were significantly lower than in the controls on day 4 (P < .03). (C) shows the concentrations of mMCP-1 in culture supernatants
(in nanograms per milliliter). The mMCP-1 concentrations from all the
TGF-1-supplemented cultures were significantly higher
than the controls on days 4 and 7 (P < .03). (D) shows the
concentration of mMCP-1 detected in culture supernatants on day 4 plotted against concentrations of TGF-1.
|
|
In this experiment, supplementation with IL-9 in the control cultures
resulted in a minimal change in the number of mMCP-1+
mBMMC, but the levels of this chymase in culture supernatants increased
to 0.4 ± 0.1 ng/mL (Fig 5C), and in cell pellets reached 5.8 ± 1 ng/106 cells at day 7. These data show that the levels of
expression and secretion of mMCP-1 by mBMMC are related to both the
concentration of TGF-1 and the length of time the cells
are exposed to this cytokine. They also show that IL-9 stimulates a
relatively low level of mMCP-1 expression and extracellular release
that is significantly augmented by as little as 10 pg/mL of
TGF-1. Importantly, the release of mMCP-1 occurred in
the absence of any exogenous stimulus with secretagogue.
Continued expression and extracellular release of mMCP-1 requires the
continuous presence of TGF-1.
The capacity of mouse mast cells to express mMCP-1 in vivo appears to
be a consequence of their localization close to, or within, mucosal
epithelia.29-31 Furthermore, the expression of mMCP-1 in,
for example, the gastric mucosa varies according to exogenous
stimuli.30 Therefore, the first question is whether mBMMC
that have been induced to express and release mMCP-1 by addition of
TGF-1 continue to store and release this chymase when
TGF-1 is withdrawn from the culture. The second question was whether any other combination of cytokine supported mMCP-1 expression in the absence of TGF-1.
For this experiment, bone marrow cells were grown in the presence of
WEHI (15%)/rmIL-9 (5 ng/mL)/rrSCF (50 ng/mL) and
rhTGF-1 (1 ng/mL) for 7 days. These cultures yielded
15.2 × 105 mBMMC/mL, 88% viable, and
99.6% mMCP-1+, with 547 ng mMCP-1/mL of supernatant. Cells
were transferred in quadruplicate at 5 × 105/mL to
48-well plates and cultured in varying combinations of cytokines as
shown in Table 2. The withdrawal of
TGF-1 was associated with substantial decrease in the
concentrations of mMCP-1 in the supernatants, and this was already
apparent 2 days after withdrawing TGF-1 (Table 2).
By contrast, the levels of mMCP-1 in culture supernatants reached a
maximum 1.9 µg/mL in the presence of
rhTGF-1/rmIL-9/WEHI/rrSCF and of 2.5 µg/mL at 4 days
in the presence of rhTGF-1/rmIL-9/rrSCF, with an
intracellular accumulation of 10.3 µg mMCP-1/106 mBMMC
(Table 2). However, the viability of the cells in the latter culture
was only 66% when compared with 90% in cultures containing the same
combination of cytokines, but including WEHI (Table 2).
View this table:
[in this window]
[in a new window]
|
Table 2.
Effect of Withdrawal of TGF-1 on the
Number and Viability mBMMC and on the Expression and Release of
mMCP-1
|
|
Cell growth was greatest in the presence of WEHI/rrSCF, but this
combination was associated with a substantial decrease in the
percentage of mMCP-1+ cells and, at 4 days, intracellular
levels of 140 ng mMCP-1/106 mBMMC. These results confirm
that the continued presence of TGF-1 is required to
maintain the expression and release of mMCP-1 and that the combination
of rhTGF-1/rmIL-9/rrSCF promotes the greatest intracellular storage of mMCP-1. However, the presence of IL-3-rich WEHI appears to be important for supporting mBMMC viability and growth.
Expression of mMCP-1 is autostimulated by endogenous
TGF-1 in the presence of IL-9.
Previous studies have shown that, in the presence of IL-9 or IL-10,
there is increased expression of mMCP-1 and mMCP-2.25,26 The current work supports these observations, but shows that
TGF-1 is a much more potent stimulus for the expression
of mMCP-1 than IL-9. Therefore, it seemed possible that IL-9 was
promoting the endogenous secretion of active TGF-1
and/or the processing of latent TGF-1 and that low
levels of this cytokine were responsible for the suboptimal expression
and secretion of mMCP-1 in cultures containing IL-9.
To test this hypothesis, a pilot study was performed in which mBMMC
were grown in WEHI (15%)/rrSCF (50 ng/mL) for 7 days before transferring them in duplicate to 48-well plates supplemented with
rhTGF-1 (100 pg/mL)/rmIL- 9 (5 ng/mL)/WEHI (15%)/rrSCF
(50 ng/mL) or with rmIL-9/WEHI/rrSCF or WEHI/rrSCF at the same
concentrations. This concentration of TGF-1 resulted in
33% mMCP-1+ mBMMC 48 hours later, whereas the addition of
IL-9 resulted in 6% mMCP-1+ mBMMC. The addition of 1 µg/mL or 10 µg/mL chicken anti-TGF- antibody to these cultures
substantially suppressed the expression of mMCP-1 in both cultures
after 48 hours (Fig 6) compared with controls to which 1 or 10 µg/mL of chicken IgG was added.
View larger version (16K):
[in this window]
[in a new window]
| Fig 6.
Addition of anti-TGF- antibody results in reduced
expression of mMCP-1. mBMMC were grown in WEHI/rrSCF for 7 days before
transferring them in duplicate to 48-well plates supplemented with
rhTGF-1 (100 pg/mL)/rmIL-9 (5 ng/mL)/WEHI (15%)/rrSCF
(50 ng/mL) (T/I/W/S ) or with rmIL-9/WEHI/rrSCF (I/W/S) or WEHI/rrSCF
(W/S) at the same concentrations. To these cultures were also added
chicken anti-TGF- at 1 µg/mL () or 10 µg/mL ( ), or
chicken IgG control at 1 µg/mL () or 10 µg/mL ( ). The mean
percentages of mMCP-1+ mast cells were assessed by
immunohistochemical staining of cytosmears with MoAb RF 6.1 48 hours
after addition of the cytokines and antibodies (n = 2).
|
|
This experiment was repeated with minor modifications to measure the
effect of anti-TGF- on the extracellular release of mMCP-1. mBMMC
were grown in WEHI (15%)/rrSCF (50 ng/mL) for 7 days before
transferring them in quadruplicate to 48-well plates supplemented with
rhTGF-1/rmIL-9/WEHI/rrSCF, rmIL-9/rrSCF, or WEHI/rrSCF,
as described above, before the addition of anti-TGF- or chicken IgG
at 1 µg/mL. At 48 hours, the results were very similar to those of
the previous experiment; release of mMCP-1 was not detected in the
cultures supplemented with IL-9, despite 5% of the cells being
mMCP-1+ (Table 3). However, the
addition of anti-TGF- antibody significantly suppressed the
intracellular staining for mMCP-1 in both the IL-9- and
TGF-1-supplemented cultures (P < .03; Table
3). It also significantly suppressed the extracellular release of
mMCP-1 in the cultures supplemented with TGF-1
(P < .03; Table 3).
When the transcription of granule proteases was analyzed in cultures
stimulated with WEHI/rrSCF, with rhTGF-1 (100 pg/mL)/rmIL-9/WEHI/rrSCF, or with rmIL-9/WEHI/rrSCF in the presence of
anti-TGF- antibody or of control IgG, using semiquantitative
RT-PCR, there was almost complete suppression of transcription of
mMCP-1 and mMCP-2 by anti-TGF- antibody, but transcripts for mMCP-4
and mMCP-5 were apparently unaffected (Fig
7A). In contrast, abundant transcripts for TGF-1 were
detected in all cell pellets regardless of whether mBMMC were cultured
in the presence or absence of IL-9, of anti-TGF- antibody, or of
control chicken IgG (Fig 7B). These results support the
hypothesis that IL-9-induced mMCP-1 expression is mediated via
autostimulation with TGF-1 but suggest that the
mechanism of IL-9 stimulation of TGF-1 production is
posttranscriptional.
View larger version (62K):
[in this window]
[in a new window]
| Fig 7.
The RT-PCR products of chymase genes from total RNA
extracted from mBMMC cultures. Initial dilutions of the RNA template
before reverse transcription are indicated (1, 0.1, 0.01, and 0.001 µg/mL). (A) shows the RT-PCR products using primer sets specific for
the mMCP-1, mMCP-2, mMCP-4, mMCP-5, and G3PDH genes as indicated.
Target RNA was from mBMMC cultured in WEHI/rrSCF alone (W/S), in
rhTGF-1 (1 ng/mL)/rmIL-9 (5 ng/mL)/WEHI (15%)/rrSCF (50 ng/mL) (T/I/W/S), in rmIL-9/WEHI/rrSCF (I/W/S) (day 14, as described in
Fig 3), or in rmIL-9/WEHI/rrSCF (I/W/S) in the presence of
anti-TGF- antibody (TGF Ab) or a control antibody (Con Ab) as
indicated (cultures described in Fig 6). Transcription of mMCP-1 and
mMCP-2 is suppressed by the presence of anti-TGF- antibodies,
whereas transcripts for mMCP-4 and mMCP-5 are unaffected. Note the much
higher level of transcription of mMCP-1 and mMCP-2 in the culture
supplemented with TGF-1. (B) shows the RT-PCR products
using primer sets specific for the TGF-1 and G3PDH genes
as indicated. Target RNA was as described for (A). The transcripts for
TGF-1 appear to be unaffected by the culture conditions
or the presence of anti-TGF- antibodies.
|
|
| |
DISCUSSION |
Mast cell heterogeneity is recognized in many species, including
humans, but it has been difficult to determine the regulatory mechanisms underlying this heterogeneity, particularly with regard to
the apparent tissue specificity of granule chymase
expression.13,14 Mouse BMMC have been widely used to
explore the mechanisms of heterogeneity. They were originally
considered to be IMMC-like,48 although it has subsequently
been demonstrated that they lack the granule structure seen in vivo,
and do not express the IMMC-specific chymase mMCP-1.13,14
However, they do have the potential to develop into cells with the
morphology of CTMC,14 expressing mMCP-4, mMCP-5, and
CPA.14 It is also apparent that, under certain circumstances, they can be induced to express the -chymases
mMCP-140 and mMCP-2,25 although in our hands,
using T-cell-conditioned medium,24 the level of expression
of mMCP-1 was not commensurate with the level occurring in vivo in
nematode-infected gut.19,27
The present study focussed on the expression of mMCP-1 in mBMMC,
because this is the only chymase expressed uniquely at mucosal surfaces,27,30 and mechanisms that significantly upregulate expression in vitro are also likely to operate in vivo. The present data strongly suggest that TGF-1 is a potent stimulus
for the expression of mMCP-1 and that mBMMC cultured for several days in this cytokine not only express and release microgram quantities of
this chymase, but that the cells themselves are more heavily granulated
and the granules are more homogeneous than has been described
previously for mBMMC.14 Further work will be required to
show whether these cells are true homologs of mouse IMMC.
The culture system used was a modification of that described by Lantz
and Huff46 in which greater than 35% mBMMC are generated within 7 days and involved the supplementation of bone marrow cells in
either WEHI/rrSCF or WEHI/IL-9/rrSCF. In the present study, mast cell
differentiation was usually greater than 80% with both combinations of
cytokines by day 7, when the cells were exposed to other cytokine
combinations. The results are in agreement with previous studies
showing that WEHI/rrSCF was associated with barely detectable
expression of mMCP-1, but that the presence of IL-9 was associated with
upregulated expression of mMCP-1, albeit to low levels.25
Importantly, there was mBMMC heterogeneity as described previously
where a high proportion of cells did not express this
chymase.24 However, the addition of TGF-1
resulted in a very rapid increase in the expression of mMCP-1 in
greater than 95% of mBMMC, in increased transcription of mMCP-2, and
in substantial release of mMCP-1 into the supernatant.
The mMCP-1 responses were strictly dependant on the concentration of
TGF-1 in the culture. The expression and release of this
chymase fell substantially on withdrawal of TGF-1 from
the culture. Furthermore, using anti-TGF- antibodies, it was
evident that IL-9 probably induced mMCP-1 expression through a
TGF--dependant pathway. Together, these data suggest that
TGF-1 drives not only the mucosal mast cell-specific
expression, but also the IgE-independant release of mMCP-1. Such a
mechanism could explain why, in normal mice, there is systemic
secretion of mMCP-1 and why such high systemic levels of this protease
are evident at very early stages of intestinal nematode infection,
before specific IgE responses can be detected.18,27,47
It would appear that growth of 1-week-old, differentiated mBMMC is only
slightly inhibited by TGF-1, even at a maximal effective concentration of 1 ng/mL, provided that either IL-3 or IL-9 were also
present in the culture medium. This probably reflects the fact that
TGF-1 is inhibitory to the growth of early hematopoietic progenitor cells, but is less inhibitory to differentiated
hematopoietic cells.52 Nevertheless, the results in Table 1
are in agreement with previous studies that showed that a combination
of TGF-1 and SCF did not support mast cell
survival.50 However, other work suggested that
TGF-1 inhibited the growth of mBMMC without affecting
differentiation or activation of the cells.51
Interestingly, these studies were performed using recombinant IL- 3 or
WEHI-3B conditioned medium and TGF-151 and,
again, are in agreement with the results shown in Table 1. The
combination of WEHI and TGF-1 supported cell survival
without any significant growth when compared with WEHI/SCF- or
WEHI/SCF/IL-9/TGF-1-supplemented cultures. Similarly,
WEHI/TGF-1 supplementation induced only very low levels
of expression of mMCP-1 when compared with combinations that included
TGF-1/IL-9/SCF or TGF-1/WEHI/SCF.
Therefore, it is reasonable to conclude that the differentiation
process involving the expression of IMMC-specific secretory granule
proteases as well as hyperplasia of the population in parasitised gut
is optimal in the presence of all four cytokines. In vivo studies
clearly demonstrate the importance of IL-3,8,9
IL-9,11 and SCF4,5 in the induction of IMMC
hyperplasia; comparable experiments have yet to show whether the
TGF- family of cytokines are also functioning in this response.
It was beyond the scope of the present study to investigate other mast
cell parameters, apart from granule histochemistry and expression of
c-kit. However, based on the current observations and on
previous studies on short-term exposure to
TGF-1,35,36 it is probable that the
biochemistry and functional properties of mBMMC exposed to this
cytokine are substantially altered. It is also clear that the chymase
expression induced by TGF-1 is readily reversible and
that cells exposed to this cytokine lose their ability to express
mMCP-1 when it is withdrawn or its activity is blocked with
anti-TGF- antibodies.
The rapidity with which expression of mMCP-1 is induced and can be
measured in culture supernatants using sensitive immunoassays provides
a novel system in which to analyze TGF- receptor expression and
signal transduction pathways. For example, it should be possible to
determine the relative contributions of TGF- receptors I and II
(TI and TII) to the expression of mMCP-1 and, importantly, explore whether the mechanism of mRNA stabilization that is reported to
occur for mMCP-2 in the presence of exogenous IL-1026 also applies to the WEHI/SCF/IL-9/TGF-1-induced expression
and extracellular release of mMCP-1 described here. This is assuming
that IL-9 and IL-10 both induce autostimulation via endogenously
secreted TGF-. However, it was clear that IL-9 has no obvious effect
on TGF-1 transcription (Fig 7B). Some posttranslational
regulation, as has been well described for macrophages and
monocytes,33 may therefore be involved. It is interesting
to note, for example, that an IL-3-independent mast cell line as well
as IL-3-dependent mBMMC secrete significant quantities of bioactive
TGF- into the culture supernatant after IgE-dependent
activation.53 This suggests that mBMMC- derived latent
TGF- can be processed into an active form with an appropriate stimulus.
In the present study, IL-3 appears to have little or no inhibitory
effect on the expression of mMCP-1, which is in contrast with previous
data on the role of IL-3 in IL-9-induced mMCP-1 expression.25 The reasons for this are not clear but could
be due to the rather lower concentrations of SCF used in the current study. In general, IL-3-rich WEHI maintained mBMMC viability and was a
potent growth factor when in the presence of SCF alone (Table 1). There
was no obvious downregulation of mMCP-1 expression and extracellular
release when IL-9/SCF/TGF1 was supplemented with WEHI
(Table 1). It was more difficult to assign a role for IL-9, although
both in vivo11 and in vitro,10 IL-9 apparently stimulates mast cell proliferation. The growth and viability data (Table 1) show that mBMMC grown initially in IL-3-rich WEHI and SCF
continued to proliferate and maintained viability in the presence of
these two cytokines. Transfer of the cells to IL-9/SCF was, for
example, associated with a decline in cell viability over a 7-day
period. Similarly, transfer of cells grown in WEHI/SCF into cultures
supplemented with TGF-1/IL-9/SCF resulted in poor viability and poor proliferation, but a high proportion of
mMCP-1+ mBMMC and abundant release of mMCP-1 into the
culture supernatant (Table 1). Again, as mentioned above, the lower
concentrations of SCF (50 ng/mL compared with 200 ng/mL25)
may have contributed to the lower viability of mBMMC in the absence of
IL-3. Because in mice transgenic for overexpression of IL-9 there is
mucosal mast cell hyperplasia and substantial levels of mMCP-1 in the blood,11 it is reasonable to assume that IL-9 synergizes
with TGF-1 and SCF in promoting the maturation of IMMC
and the expression and secretion of mMCP-1.
These new data, showing that the expression and release of mMCP-1 is
highly TGF-1 dependant, extend the range of functions for this important cytokine. It will be of great interest to determine whether it will promote expression of mMCP-1 during the early differentiation of mBMMC, because it has been argued, on the basis of
previous studies in which mBMMC were exposed to IL-9 or IL-10, that
mMCP-1 is a gene expressed late in the differentiation of mBMMC.25 Our preliminary results suggest that expression of mMCP-1 can be detected as early as 48 hours after initiating bone marrow cultures, which is consistent with in vivo data on the early
expression of this protease in parasitised mouse gut.47 In
the longer term, analysis of the localization of the site of expression
of TGF-1 in parasitised gut, its regulation during helminth infection and in other gut allergies in which mucosal mast
cell hyperplasia has been reported, and the way in which it promotes
the expression and release of mMCP-1 and its regulation of other
IMMC-specific genes will throw new light on the mucosal role of the
TGF- family of cytokines.
| |
ACKNOWLEDGMENT |
The authors thank Dr H. Faulkner (University of Manchester) for rat
anti-c-kit MoAb (ACK-2), Jean Vaagenes for technical
assistance, and Cheryl Scudamore for helpful discussion. Thanks also to
Bob Munro for photography and Eileen Duncan and Liz Moore for
maintenance of Balb/C mice.
| |
FOOTNOTES |
Submitted October 12, 1998; accepted January 15, 1999.
Supported by Grant No. 050065 from the Wellcome Trust.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Hugh R.P. Miller, PhD,
Department of Veterinary Clinical Studies, Royal (Dick) School of
Veterinary Studies, The University of Edinburgh, Easter Bush Veterinary
Centre, Easter Bush, Roslin, Midlothian EH25 9RG, Scotland; e-mail:
Hugh.Miller{at}ed.ac.uk.
| |
REFERENCES |
1.
Galli SJ, Geissler EN, Zsebo KM:
The kit-ligand, stem cell factor.
Adv Immunol
55:1, 1994[Medline]
[Order article via Infotrieve]
2.
Arizono N, Kasugai T, Yamada M, Okada M, Morimoto M, Tei H, Newlands GF, Miller HR, Kitamura Y:
Infection of Nippostrongylus brasiliensis induces development of mucosal-type but not connective tissue-type mast cells in genetically mast cell-deficient Ws/Ws rats.
Blood
81:2572, 1993[Abstract/Free Full Text]
3.
Crowle PK, Reed ND:
Rejection of the intestinal parasite Nippostrongylus brasiliensis by mast cell deficient W/Wv anaemic mice.
Infect Immun
33:54, 1981[Abstract/Free Full Text]
4.
Donaldson LE, Schmitt E, Huntley JF, Newlands GFJ, Grencis RK:
A critical role for stem cell factor and c-kit in host protective immunity to an intestinal helminth.
Int Immunol
8:559, 1996[Abstract/Free Full Text]
5.
Newlands GFJ, Miller HRP, MacKellar A, Galli SJ:
Stem cell factor contributes to intestinal mucosal mast cell hyperplasia in rats infected with Nippostrongylus brasiliensis or Trichinella spiralis, but anti-stem cell factor treatment decreases parasite egg production during N. brasiliensis infection.
Blood
86:1968, 1995[Abstract/Free Full Text]
6.
Nawa Y, Miller HRP:
Adoptive transfer of the intestinal mast cell response in rats infected with Nippostrongylus brasiliensis.
Cell Immunol
42:225, 1979[Medline]
[Order article via Infotrieve]
7.
Mayrhofer G, Fisher R:
Mast cells in severely T-cell depleted rats and the response to infestation with Nippostrongylus brasiliensis.
Immunology
37:145, 1979[Medline]
[Order article via Infotrieve]
8.
Abe T, Nawa Y:
Worm expulsion and mucosal mast cell response induced by repetitive IL-3 administration in Strongyloides ratti-infected nude mice.
Immunology
63:181, 1988[Medline]
[Order article via Infotrieve]
9.
Madden KB, Urban JF, Ziltener HJ, Schrader JW, Finkelman FD, Katona IM:
Antibodies to IL-3 and IL-4 suppress helminth-induced intestinal mastocytosis.
J Immunol
147:1387, 1991[Abstract]
10.
Hultner L, Druez C, Moeller J, Uyttenhove C, Schmitt E, Rüde E, Dörmer P, Van Snick J:
Mast cell growth enhancing activity (MEA) is structurally related and functionally identical to the novel mouse T cell growth factor P40/TCGF III.
Eur J Immunol
20:1413, 1990[Medline]
[Order article via Infotrieve]
11.
Faulkner H, Humphreys M, Renauld JC, Van Snick J, Grencis R:
Interleukin-9 is involved in host protective immunity to intestinal nematode infection.
Eur J Immunol
27:2536, 1997[Medline]
[Order article via Infotrieve]
12.
Enerbäck L:
Mucosal mast cells in the rat and man.
Int Arch Allergy Appl Immunol
82:249, 1987[Medline]
[Order article via Infotrieve]
13.
Metcalfe DD, Baram D, Mekori YA:
Mast cells.
Physiol Rev
77:1033, 1997[Abstract/Free Full Text]
14.
Galli SJ:
New insights into `the riddle of the mast cell'. Microenvironmental regulation of mast cell development and phenotypic heterogeneity.
Lab Invest
62:5, 1990[Medline]
[Order article via Infotrieve]
15.
Crowe SE, Perdue MH:
Gastrointestinal food hypersensitivity: Basic mechanisms of pathophysiology.
Gastroenterology
103:1075, 1992[Medline]
[Order article via Infotrieve]
16.
Wong D, Ogle CW:
Chronic parenterally administered nicotine and stress-induced or ethanol-induced gastric mucosal damage in rats.
Eur J Pharmacol
292:157, 1995[Medline]
[Order article via Infotrieve]
17.
Catto-Smith AG, Ripper JL:
Mucosal mast cells and developmental changes in gastric absorption.
Am J Physiol
268:G121, 1995[Abstract/Free Full Text]
18.
Miller HRP:
Mucosal mast cells and the allergic response against nematode parasites.
Vet Immunol Immunopathol
54:331, 1996[Medline]
[Order article via Infotrieve]
19.
Miller HRP, Huntley JF, Newlands GFJ:
Mast cell chymases in helminthosis and hypersensitivity, in
Caughey GH
(ed):
Mast Cell Proteases in Immunology and Biology. New York, NY, Dekker, 1995, p 203.
20.
Hunt JE, Stevens RL:
Mouse mast cell proteases, in
Kitamura Y,
Yamamoto S,
Galli SJ,
Greaves MW
(eds):
Biological and Molecular Aspects of Mast Cell and Basophil Differentiation and Function. New York, NY, Raven, 1995, p 149.
21.
Irani AA, Shechter NM, Craig SS, De Blois G, Schwartz LB:
Two types of human mast cells that have distinct neutral protease compositions.
Proc Natl Acad Sci USA
83:4464, 1986[Abstract/Free Full Text]
22.
Newlands GFJ, Knox DP, Pirie-Shepherd SR, Miller HRP:
Biochemical and immunological characterization of multiple glycoforms of mouse mast cell protease-1: Comparison with an isolated murine serosal mast cell protease (mMMCP-4).
Biochem J
294:127, 1993
23.
Stevens RL, Friend DS, McNeil HP, Schiller V, Ghildyal N, Austen KF:
Strain-specific and tissue-specific expression of mouse mast cell secretory granule proteases.
Proc Natl Acad Sci USA
91:128, 1994[Abstract/Free Full Text]
24.
Newlands GFJ, Lammas DA, Huntley JF, MacKellar A, Wakelin D, Miller HRP:
Heterogeneity of murine bone marrow-derived mast cells: Analysis of their proteinase content.
Immunology
72:434, 1991[Medline]
[Order article via Infotrieve]
25.
Eklund KK, Ghildyal N, Austen KF, Stevens RL:
Induction by IL-9 and suppression by IL-3 and IL-4 of the levels of chromosome 14-derived transcripts that encode late-expressed mouse mast cell proteases.
J Immunol
151:4266, 1993[Abstract]
26.
Xia Z, Ghidyal N, Austen KF, Stevens RL:
Post-transcriptional regulation of chymase expression in mast cells. A cytokine-dependent mechanism for controlling the expression of granule neutral proteases of haematopoietic cells.
J Biol Chem
271:8747, 1996[Abstract/Free Full Text]
27.
Huntley JF, Gooden C, Newlands GFJ, MacKellar A, Lammas DA, Wakelin D, Woodbury RG, Miller HRP:
Distribution of intestinal mast cell proteinase in blood and tissues of normal and Trichinella-infected mice.
Parasite Immunol
12:85, 1990[Medline]
[Order article via Infotrieve]
28.
Klimpel GR, Langley KE, Wypych J, Abrams JS, Chopra AK, Niesel DW:
A role for stem cell factor (SCF): c-kit interaction(s) in the intestinal tract response to Salmonella typhimurium infection.
J Exp Med
184:271, 1996[Abstract/Free Full Text]
29.
Miller HRP, Huntley JF, Newlands GFJ, MacKellar A, Lammas DA, Wakelin D:
Granule proteinases define mast cell heterogeneity in the serosa and the gastrointestinal mucosa of the mouse.
Immunology
65:559, 1988[Medline]
[Order article via Infotrieve]
30.
Scudamore CL, McMillan L, Thornton EM, Wright SH, Newlands GFJ, Miller HRP:
Mast cell heterogeneity in the gastrointestinal tract. Variable expression of mouse mast cell protease-1 (mMCP-1) in intraepithelial mucosal mast cells in nematode-infected and normal BALB/c mice.
Am J Pathol
150:1661, 1997[Abstract]
31.
Friend DS, Ghildyal N, Gurish MF, Hunt J, Hu X, Austen KF, Stevens RL:
Reversible expression of tryptases and chymases in the jejunal mast cells of mice infected with Trichinella spiralis.
J Immunol
160:5537, 1998[Abstract/Free Full Text]
32.
Koyama S, Podolsky DK:
Differential expression of transforming growth factors and in rat intestinal epithelial cells.
J Clin Invest
83:1768, 1989
33.
Letterio JJ, Roberts AB:
Regulation of immune responses by TGF-.
Annu Rev Immunol
16:137, 1998[Medline]
[Order article via Infotrieve]
34.
Kilshaw PJ, Murant SJ:
Expression and regulation of beta-7 (beta-p) integrins on mouse lymphocytes; relevance to the mucosal immune-system.
Eur J Immunol
21:2591, 1991[Medline]
[Order article via Infotrieve]
35.
Smith TJ, Ducharme LA, Shaw SK, Parker CM, Brenner MB, Kilshaw PJ, Weis JH:
Murine M290 integrin expression modulated by mast cell activation.
Immunity
1:393, 1994[Medline]
[Order article via Infotrieve]
36.
Rumsaeng Y, Vliagoftis H, Om CK, Metcalfe DD:
Lymphotactin gene expression in mast cells following Fc receptor 1 aggregation. Modulation by TGF-, IL-4, dexamethasone, and cyclosporin A.
J Immunol
158:1353, 1997[Abstract]
37.
Crapper RM, Schrader JW:
Frequency of mast cell precursors in normal tissues determined by an in vitro assay: Antigen induces parallel increases in the frequency of P cell precursors and mast cells.
J Immunol
131:923, 1983[Abstract]
38.
Wastling HM, Knight P, Ure J, Wright S, Thornton EM, Scudamore CL, Mason J, Smith A, Miller HRP:
Histochemical and ultrastructural modification of mucosal mast cell granules in parasitized mice lacking the - chymase, mouse mast cell protease-1.
Am J Pathol
153:491, 1998[Abstract/Free Full Text]
39.
Tsai M, Miyamoto M, Tam S-Y, Wang Z, Galli SJ:
Detection of mouse mast cell-associated protease mRNA; heparinase treatment greatly improves RT-PCR of tissues containing mast cell heparin.
Am J Pathol
146:335, 1995[Abstract]
40.
Ghildyal N, McNeil HP, Stechschulte S, Austen KF, Silberstein D, Gurish MF, Somerville LL, Stevens RL:
IL- 10 induces transcription of the gene for mouse mast cell protease-1, a serine protease preferentially expressed in mucosal mast cells of Trichinella spiralis-infected mice.
J Immunol
149:2123, 1992[Abstract]
41.
Serafin WE, Reynolds DS, Rogelj S, Lane WS, Conder GA, Johnson SS, Austen F, Stevens RL:
Identification and molecular cloning of a novel mouse mucosal mast cell serine protease.
J Biol Chem
265:423, 1990[Abstract/Free Full Text]
42.
Serafin WE, Sullivan TP, Conder GA, Ebrahimi A, Marcham P, Johnson SS, Austen KF, Reynolds RS:
Cloning of the cDNA and the gene for mouse mast cell protease-4.
J Biol Chem
266:1934, 1991[Abstract/Free Full Text]
43.
McNeil HP, Austen KF, Somerville LL, Gurish MF, Stevens RL:
Molecular cloning of the mouse mast cell protease-5 gene.
J Biol Chem
266:20316, 1991[Abstract/Free Full Text]
44.
Derynck R, Jarrett JA, Chen EY, Goeddel DV:
The murine transforming growth factor- precursor.
J Biol Chem
261:4377, 1986[Abstract/Free Full Text]
45.
Sabath DE, Broome EH, Prystowsky MB:
Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte.
Gene
91:185, 1990[Medline]
[Order article via Infotrieve]
46.
Lantz CS, Huff TF:
Differential responsiveness of purified mouse c-kit+ mast cells and their progenitors to IL-3 and stem cell factor.
J Immunol
155:4024, 1995[Abstract]
47.
Wastling JM, Scudamore CL, Thornton EM, Newlands GFJ, Miller HRP:
Constitutive expression of mouse mast cell protease-1 in normal BALB/c mice and its up-regulation during intestinal nematode infection.
Immunology
90:308, 1997[Medline]
[Order article via Infotrieve]
48.
Sredni B, Friedman MN, Bland CE, Metcalfe DD:
Ultrastructural, biochemical and functional characteristics of histamine containing cells cloned from mouse bone marrow: Tentative identification as mucosal mast cells.
J Immunol
131:915, 1983[Abstract]
49.
Crowle PK, Phillips DE:
Characteristics of mast cells in Chediak-Higashi mice Light and electron microscope studies of connective tissue and mucosal mast cells.
Exp Cell Biol
51:130, 1983[Medline]
[Order article via Infotrieve]
50.
Mekori YA, Metcalfe DD:
Transforming growth factor- prevents stem cell factor-mediated rescue of mast cells from apoptosis after IL-3 deprivation.
J Immunol
153:2194, 1994[Abstract]
51.
Broide DH, Wasserman SI, Alvaro-Garcia J, Zvaifler NJ, Firestein GS:
Transforming growth factor-1 selectively inhibits IL-3-dependent mast cell proliferation without affecting mast cell function or differentiation.
J Immunol
143:1591, 1989[Abstract]
52.
Keller JR, Mantel C, Sing GK, Ellingsworth LR, Ruscetti SK, Ruscetti FW:
Transforming growth factor-1 selectively regulates early murine haematopoietic progenitors and inhibits the growth of IL-3 dependent myeloid leukaemia cell lines.
J Exp Med
168:737, 1988[Abstract/Free Full Text]
53.
Kendall JC, Li X-H, Galli SJ, Gordon JR:
Promotion of mouse fibroblast proliferation by IgE-dependent activation of mouse mast cells: Role for mast cell tumor necrosis factor and transforming growth factor-1.
J Allergy Clin Immunol
99:113, 1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
Z. Wiener, P. Pocza, M. Racz, G. Nagy, G. Tolgyesi, V. Molnar, J. Jaeger, E. Buzas, E. Gorbe, Z. Papp, et al.
IL-18 induces a marked gene expression profile change and increased Ccl1 (I-309) production in mouse mucosal mast cell homologs
Int. Immunol.,
December 1, 2008;
20(12):
1565 - 1573.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Zhao, G. Gomez, S.-H. Yu, J. J. Ryan, and L. B. Schwartz
TGF-{beta}1 Attenuates Mediator Release and De Novo Kit Expression by Human Skin Mast Cells through a Smad-Dependent Pathway
J. Immunol.,
November 15, 2008;
181(10):
7263 - 7272.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-i. Kashiwakura, W. Xiao, J. Kitaura, Y. Kawakami, M. Maeda-Yamamoto, J. R. Pfeiffer, B. S. Wilson, U. Blank, and T. Kawakami
Pivotal Advance: IgE accelerates in vitro development of mast cells and modifies their phenotype
J. Leukoc. Biol.,
August 1, 2008;
84(2):
357 - 367.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A. Knight, J. K. Brown, S. H. Wright, E. M. Thornton, J. A. Pate, and H. R.P. Miller
Aberrant Mucosal Mast Cell Protease Expression in the Enteric Epithelium of Nematode-Infected Mice Lacking the Integrin {alpha}v{beta}6, a Transforming Growth Factor-{beta}1 Activator
Am. J. Pathol.,
October 1, 2007;
171(4):
1237 - 1248.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Ekoff, A. Strasser, and G. Nilsson
Fc{epsilon}RI Aggregation Promotes Survival of Connective Tissue-Like Mast Cells but Not Mucosal-Like Mast Cells
J. Immunol.,
April 1, 2007;
178(7):
4177 - 4183.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Sheppard
Transforming Growth Factor {beta}: A Central Modulator of Pulmonary and Airway Inflammation and Fibrosis.
Proceedings of the ATS,
July 1, 2006;
3(5):
413 - 417.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Sasaki, T. Yoshimoto, H. Maruyama, T. Tegoshi, N. Ohta, N. Arizono, and K. Nakanishi
IL-18 with IL-2 protects against Strongyloides venezuelensis infection by activating mucosal mast cell-dependent type 2 innate immunity
J. Exp. Med.,
September 6, 2005;
202(5):
607 - 616.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T Gebhardt, A Lorentz, F Detmer, C Trautwein, H Bektas, M P Manns, and S C Bischoff
Growth, phenotype, and function of human intestinal mast cells are tightly regulated by transforming growth factor {beta}1
Gut,
July 1, 2005;
54(7):
928 - 934.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. L. Weller, S. J. Collington, J. K. Brown, H. R.P. Miller, A. Al-Kashi, P. Clark, P. J. Jose, A. Hartnell, and T. J. Williams
Leukotriene B4, an activation product of mast cells, is a chemoattractant for their progenitors
J. Exp. Med.,
June 20, 2005;
201(12):
1961 - 1971.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. E. Demeure, K. Brahimi, F. Hacini, F. Marchand, R. Peronet, M. Huerre, P. St.-Mezard, J.-F. Nicolas, P. Brey, G. Delespesse, et al.
Anopheles Mosquito Bites Activate Cutaneous Mast Cells Leading to a Local Inflammatory Response and Lymph Node Hyperplasia
J. Immunol.,
April 1, 2005;
174(7):
3932 - 3940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. K. Brown, A. D. Pemberton, S. H. Wright, and H. R.P. Miller
Primary Antibody-Fab Fragment Complexes: A Flexible Alternative to Traditional Direct and Indirect Immunolabeling Techniques
J. Histochem. Cytochem.,
September 1, 2004;
52(9):
1219 - 1230.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. K. Brown, P. A. Knight, A. D. Pemberton, S. H. Wright, J. A. Pate, E. M. Thornton, and H. R. P. Miller
Expression of Integrin-{alpha}E by Mucosal Mast Cells in the Intestinal Epithelium and Its Absence in Nematode-Infected Mice Lacking the Transforming Growth Factor-{beta}1-Activating Integrin {alpha}v{beta}6
Am. J. Pathol.,
July 1, 2004;
165(1):
95 - 106.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Funaba, T. Ikeda, M. Murakami, K. Ogawa, K. Tsuchida, H. Sugino, and M. Abe
Transcriptional Activation of Mouse Mast Cell Protease-7 by Activin and Transforming Growth Factor-{beta} Is Inhibited by Microphthalmia-associated Transcription Factor
J. Biol. Chem.,
December 26, 2003;
278(52):
52032 - 52041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Funaba, T. Ikeda, K. Ogawa, M. Murakami, and M. Abe
Role of activin A in murine mast cells: modulation of cell growth, differentiation, and migration
J. Leukoc. Biol.,
June 1, 2003;
73(6):
793 - 801.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rosbottom, C. L. Scudamore, H. von der Mark, E. M. Thornton, S. H. Wright, and H. R. P. Miller
TGF-{beta}1 Regulates Adhesion of Mucosal Mast Cell Homologues to Laminin-1 Through Expression of Integrin {alpha}7
J. Immunol.,
November 15, 2002;
169(10):
5689 - 5695.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A. Knight, S. H. Wright, J. K. Brown, X. Huang, D. Sheppard, and H. R. P. Miller
Enteric Expression of the Integrin {alpha}v{beta}6 Is Essential for Nematode-Induced Mucosal Mast Cell Hyperplasia and Expression of the Granule Chymase, Mouse Mast Cell Protease-1
Am. J. Pathol.,
September 1, 2002;
161(3):
771 - 779.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Pilette, Y. Ouadrhiri, J. Van Snick, J.-C. Renauld, P. Staquet, J.-P. Vaerman, and Y. Sibille
IL-9 Inhibits Oxidative Burst and TNF-{alpha} Release in Lipopolysaccharide-Stimulated Human Monocytes Through TGF-{beta}
J. Immunol.,
April 15, 2002;
168(8):
4103 - 4111.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. M. Blackwell and K. J. Else
B Cells and Antibodies Are Required for Resistance to the Parasitic Gastrointestinal Nematode Trichuris muris
Infect. Immun.,
June 1, 2001;
69(6):
3860 - 3868.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Ge, T. Jippo, Y.-M. Lee, S. Adachi, and Y. Kitamura
Independent Influence of Strain Difference and mi Transcription Factor on the Expression of Mouse Mast Cell Chymases
Am. J. Pathol.,
January 1, 2001;
158(1):
281 - 292.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. O. Sanchez Mejia, B. K. Lam, and J. P. Arm
Matrix-Associated Transforming Growth Factor-beta 1 Primes Mouse Bone Marrow-Derived Mast Cells for Increased High-Affinity Fc Receptor for Immunoglobulin E-Dependent Eicosanoid Biosynthesis
Am. J. Respir. Cell Mol. Biol.,
May 1, 2000;
22(5):
557 - 565.
[Abstract]
[Full Text]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
TGF-