|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3578-3582
Low Platelet 2 1 Levels in Type I von
Willebrand Disease Correlate With Impaired Platelet Function in a
High Shear Stress System
By
Jorge Di Paola,
Augusto B. Federici,
P.M. Mannucci,
Maria T. Canciani,
Marcie Kritzik,
Thomas J. Kunicki, and
Diane Nugent
From Children's Hospital of Orange County, Orange, CA; A. Bianchi
Bonomi Hemophilia and Thrombosis Center, I.R.C.C.S. Ospedale Maggiore
and University of Milano, Milan, Italy; The Scripps Institute, La
Jolla, CA.
 |
ABSTRACT |
Platelet adhesion to collagen-coated surfaces in whole blood under
flow conditions is mediated by both von Willebrand factor (vWF)-dependent recruitment of the platelet glycoprotein Ib-IX receptor complex and collagen interaction with the integrin
2 1. In type 1 von Willebrand disease
(vWD), platelet adhesive functions are impaired due to the decrease in
vWF levels in plasma and platelets. There are at least three alleles of
the human 2 gene, distinguishable by a cluster of silent
or noncoding sequence differences within a segment of the gene. Two
alleles, associated with low receptor density can be distinguished by
nucleotide 807C, while the third allele associated with high receptor
density, expresses nucleotide 807T. Gene frequencies of these alleles
in a normal population (n = 167) are 0.58 for 807C and 0.42 for 807T.
We measured the frequencies of these alleles in symptomatic patients
with five types of vWD (type 1, n = 78; type 2A, n = 25, type 2B, n
= 14; type 2M, n = 10; and type 3, n = 20). Compared with the
normal group, no significant difference in allele frequencies was
observed among individuals with types 2A, 2B, 2M, or 3 vWD. However,
the frequency of the 807C allele, associated with low collagen receptor density, among type 1 vWD patients (807C = .71; 807T = .29) was significantly higher than that of the normal population (P = .007). Also, in patients with vWD type 1 and borderline to normal
ristocetin-cofactor (vWF:RCo) activity values, collagen receptor
density correlates inversely with closure time in a high shear stress
system (platelet function analyzer [PFA-100]). We propose that low
platelet 2 1 density results in less
efficient primary platelet adhesion and may result in increased
tendency to bleed, as evidenced by the high frequency of this
polymorphism in patients with type 1 vWD compared with normal
individuals. In addition, this may account for the variability between
patients with similar levels of vWF antigen, but strikingly different
bleeding histories.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
PLATELET ADHESION TO collagen in damaged
vascular subendothelium is of pivotal importance to both the initiation
of platelet thrombus formation and procoagulant activity.1
This first step in thrombus formation is mediated by both von
Willebrand factor (vWF)-dependent recruitment of the glycoprotein
Ib-IX receptor complex and collagen interaction with the integrin,
2 1.2 The integrin,
2 1, mediates platelet adhesion to both
fibrillar (types I, III, and V) or nonfibrillar (types IV, VI, VII, and VIII) collagen.3-7 While the levels of the integrins
5 1 (fibronectin receptor) and
IIb 3 (fibrinogen receptor) can vary from
one individual to the next, this difference never exceeds a fraction of
the mean population level. However 2 1
levels can vary up to 10-fold in the general population, and this
correlates with differences in adhesiveness to type I or type III
collagens.8 This variation in
2 1 receptor density is associated with
differential inheritance of three alleles of the human 2 gene that
can be distinguished by multiple sequence differences in selected
introns and silent sequence differences in a segment of the coding
region.9,10 Because there is a correlation
between platelet adhesion to collagen and
2 1 receptor levels, differences in
2 1 receptor levels may influence the risk
for thrombosis or bleeding in vivo. While the risk is apparently
negligible among healthy individuals, it can become an important factor
in individuals who are otherwise predisposed toward thrombosis or
bleeding by an unrelated genetic or acquired condition, such as von
Willebrand disease (vWD).
Among inherited bleeding disorders, vWD is certainly the most common,
with a reported prevalence ranging from 0.8% to
1.3%.11,12 The pathogenesis of vWD is based on
quantitative and/or qualitative abnormalities of vWF,13 a
large, multimeric protein, encoded by a gene in chromosome 12, which
circulates in the blood plasma, but is also stored in granules of
endothelial cells and platelets.14 The most common form of
vWD, known as type 1, accounts for more than 70% of patients and is
caused by a quantitative deficiency of vWF.15 Type 1 is
very heterogeneous and several subtypes have been described according
to platelet vWF content.16 Moreover, in type 1 vWD,
platelet vWF cooperates with plasma vWF to determine the degree of
abnormalities in platelet-vessel wall interaction.17
Aside from the variation in vWF levels from one patient to the other,
it is difficult to explain the significant variation in bleeding
tendencies observed between patients with similar laboratory profiles
and similar levels of vWF. Thus, genetic and nongenetic factors may
augment or attenuate the likelihood of bleeding symptoms in these
patients.17 We postulate that variation in the integrin
2 1 density on the platelet surface might
be a major factor that influences bleeding in patients with type 1 vWD.
To test this hypothesis, we determined the 2 genotype in
148 patients with vWD by using restriction digest analysis of genomic
DNA. To show correlation between collagen receptor density and platelet
function, we also performed platelet adhesion and aggregation studies
in the platelet function analyzer (PFA-100, Behring, Dade, FL), a high
shear stress system that simulates platelet-based primary hemostasis in
vitro.18
 |
MATERIALS AND METHODS |
Patients.
We studied 148 symptomatic patients diagnosed with one of five types of
vWD as follows: type 1, n = 78; type 2A, n = 25; type 2B, n = 14; type
2M, n = 11; and type 3, n = 20. The diagnosis of vWD was based on
laboratory findings (plasma vWF levels, ristocetin cofactor activity
[vWF:RCo], factor VIII coagulant activity, and multimer analysis),
family and personal history of bleeding, and a prolonged bleeding time.
We also studied 99 age-sex-matched Italians and 68 non-Italian whites
without evidence of bleeding disorders and used them as controls.
Patient blood samples were collected at the Angelo Bianchi Bonomi
Hemophilia and Thrombosis Center, Milano, Italy and shipped to
Children's Hospital of Orange County (CHOC), Orange, CA. An additional
15 patients samples were harvested and processed at CHOC. Informed
consent was obtained in all cases following institutional guidelines.
Isolation and amplification of patient genomic DNA.
Genomic DNA was isolated from peripheral blood mononuclear cells by
using the method of Miller et al.19 The desired segment of
the 2 gene (581 kb) was amplified by polymerase chain
reaction (PCR) using a Perkin Elmer Cetus DNA Thermal Cycler (Norwalk, CT) and Taq polymerase (Pharmacia Biotech, Piscataway, NJ). The primers
used in the PCR reaction were: (1) 5' GATTTAACTTTCCCGACTGCCTTC 3' and (2) 5' CATAGGTTTTTGGGGAACAGGTGG 3'. The PCR
cycling conditions were: 94°C × 10 minutes, one cycle,
followed by 94°C × 1 minute, anneal 1 minute, 72°C × 1 minute, where the annealing was 69°C for two cycles,
67°C for two cycles, and 65° for 35 cycles. The PCR product is
a 581-bp segment located within the intron separating two exons that
encode the allelic polymorphisms at bp 807 and 873. Genomic DNA cloned
from individuals homozygous for 807C or 807T served as positive controls.
Detection and typing of 807T and 807C polymorphisms using Bgl II
restriction site.
Digestion of the PCR product was performed with the restriction enzyme
Bgl II (Pharmacia Biotech). Briefly, for each 40-µL reaction, 15 µL
of the PCR product, 4 µL of 10x restriction buffer (One-Phor-All
buffer Plus, Pharmacia Biotech), and 1 µL of Bgl II enzyme (× U/mL) were used. The PCR product was digested at 37°c for at least
2 hours and analyzed on a 1.5% agarose gel in 1x tris acetate EDTA
(TAE) buffer. The gel was stained with ethidium bromide
and visualized under ultraviolet (UV) light.
Platelet function studies.
Platelet adhesion and aggregation was evaluated in 32 patients with vWD
type1 in the PFA-100, as previously described by Fressinaud et
al.20 The PFA-100 assay was performed with two different types of cartridges (collagen/epinephrine and collagen/adenine diphosphate [ADP]), and values shown represent the mean of duplicate measurements. The statistical analysis of the results was performed using t-test.
 |
RESULTS |
We have previously shown that there are at least three alleles of the
human 2 gene distinguishable by a cluster of silent and/or noncoding sequence differences within a 4-kb segment of the gene
(Fig 1).10 A naturally occurring restriction
site for the enzyme, Bgl II, was found in intron G of the 807T allele. Thus, PCR products amplified from the 807T allele and spanning the Bgl
II site can be digested with Bgl II to generate two fragments of 343 and 238 bp, while product amplified from the 807C allele remains
undigested. Bgl II digestion of the 581 bp PCR product amplified from
genomic DNA of an individual heterozygous for these alleles yields
three fragments (581 bp, 343 bp, 238 bp) (Fig 2). The
gene frequencies of the 807C and 807T alleles in the control group (n = 167) were .58 and .42, respectively.

View larger version (10K):
[in this window]
[in a new window]
| Fig 1.
Segment of the human 2 gene and two of its
alleles (807T and 807C). The allele 807T shows a unique restriction
site for the enzyme, Bgl II, in the intron G, which is not present in
allele 807C.
|
|

View larger version (119K):
[in this window]
[in a new window]
| Fig 2.
Bgl II digest of the 581-bp PCR product amplified from
genomic DNA from six representative individuals. Lanes 1 and 2, homozygous 807T (high receptor density); lanes 3 and 4, heterozygous CT
(intermediate receptor density); lanes 5 and 6, homozygous 807C (low
receptor density). Lanes 7 and 8, cloned genomic DNA from individuals
homozygous for 807C and 807T, respectively, serving as positive
control. Lane 9, molecular weight markers.
|
|
Genomic DNA from 148 individuals diagnosed with vWD was analyzed, and
these results were compared with the control group as seen in
Table 1. By 2 analysis, it
was determined that the frequency of 807C allele associated with low
collagen receptor density in type 1 vWD patients is higher than that of
the normal population (P = .007), the frequencies of these
alleles being .71 for 807C and .29 for 807T. In the type 2M patients,
the P value was significant at P = .050, albeit not as
strong an association as that seen with type 1 vWD patients. On the
other hand, there is not a significant difference in allele frequencies
among patients with vWD type 2A (P = .246), 2B (P = .353), or 3 (P = .351), compared with the normal group.
View this table:
[in this window]
[in a new window]
|
Table 1.
Frequencies of the 807 Alleles in Patients With vWD Type
1, 2A, 2B, 2M, and 3 Compared With the Normal Controls
|
|
Platelet adhesion was analyzed in 32 patients with vWD type 1 in the
PFA-100 and results are shown in Fig 3. At
critically low vWF:RCo levels (<30 U/dL), the deficiency of vWF
overrides the allele effect on closure time in the PFA-100. When
vWF:RCo levels reach values between 40 to 80 U/dL, as seen in many type 1 patients, the effect of the allele on platelet adhesion to collagen is evident. As seen in Fig 3, patients with similar or identical vWF:RCo levels in the 40 to 80 U/dL range, the closure time is significantly longer in those patients who are homozygous for the 807C
allele (open circles). By t-test, the differences in closure
times between the patients homozygous for the 807C allele and the
patients homozygous for the 807T are statistically
significant, whether all the subjects with vWF:RCo greater
than 40 (P = .018) or just the ones between 40 and 80 (P = .003) are included.

View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
The effect of the 807 allele on platelet adhesion to
collagen. Results of the PFA-100 closure time of 32 patients with vWD
type 1 compared with their respective vWF:Rco (U/dL). Values represent
the mean of duplicated measurements with the epinephrine cartridge.
( ) CC; ( ) CT; ( ) TT.
|
|
 |
DISCUSSION |
Multiple advances in the molecular characterization, diagnosis, and
treatment of vWD have occurred over the last few years. However, it is
unclear why certain vWD type 1 patients develop more severe bleeding
symptoms than other patients with equivalent vWF
levels.21,22 Differences in severity of bleeding can even be detected in individuals with equivalent antigen level in the same
immediate family. Our findings suggest that the level of 2 1 on platelets may represent one of the
additional factors that determines severity of bleeding in this
particular disease.
It is possible that genetic factors directly related to the vWF
molecule and its mode of expression could also influence variability of
clinical presentation. One such factor is multiple heterozygosity for
mutations in the vWF gene.23 Furthermore, there is an
association of O blood type with vWF levels in the lower range of
normal.24 In addition, D'Alessio et al25 have
emphasized the important contribution of platelet vWF to platelet
adhesion to collagen in vWD type 1.
Other genetic factors, unrelated to the vWF gene, could also be
involved. Our results are consistent with the hypothesis that a low
level of the 2 1 receptor may result in
delayed primary platelet adhesion in patients with vWD type 1. Studies
have shown that the primary mechanism of platelet attachment to the
subendothelium is dependent on GPIb-IX-vWF interactions. A secondary
mechanism involving 2 1 binding to the
subendothelial collagen also plays an important role.10,26-28
The importance of 2 1 as a primary receptor that mediates platelet adhesion to collagen under flow conditions is underscored by the report of a patient lacking
glycoprotein Ia ( 2) whose platelets failed to respond to
collagen.7,27-29 Thus, a lower platelet
2 1 density, which has been shown to
correlate with decreased adhesiveness to collagen, together with a low
vWF level is likely to further impair the adhesion of the platelet to
damaged endothelium.
Our studies on individuals with type 1 vWD show a significantly higher
prevalence of the 807C allele, which is associated with low
2 1 density. As the patients with more
bleeding are more likely to be diagnosed, this increased association of
the low receptor phenotype in type 1 vWD suggests that the 807C
homozygous state may account for the variability in bleeding in vWD.
The studies in the PFA-100 show the influence of the
2 1 receptor density in platelet adhesion
in vWD type 1 patients who have a vWF:RCo activity in the 40 to 80 U/dL
range. In patients with vWD type 1 whose vWF:Rco activity is less than
30 U/dL, the collagen receptor density does not seem to play a major
role in closure time due to the fact that these patients' platelet
adhesion is extremely impaired. This may explain why the group of
patients with type 3 vWD did not show a significant difference of
allele frequencies when compared with the general population.
In most of the cases with type 2 and 3 vWD, a genetic defect has been
correlated with moderate to severe bleeding symptoms, while no clear
definition of the molecular basis of such defects is available for
mild-moderate type 1 vWD. Therefore, additional information about the
nature of bleeding in the latter group of patients will be very useful.
We are currently performing expanded studies in families with vWD type
1 to evaluate platelet 2 1 receptor
density variation as a possible mechanism for disparity in bleeding
symptoms. This newly described genetic marker must be included in
larger patient studies to determine its true role as a risk factor for
increased bleeding.
 |
ACKNOWLEDGMENT |
The authors would like to thank Peggy Nakagawa, MS and Diana
Rozenshteyn, BS for their excellent technical assistance and Dr Shirley
Williams for her help and suggestions.
 |
FOOTNOTES |
Submitted March 7, 1998; accepted January 12, 1999.
Supported by a grant from the Gustavus and Louise Pfeiffer Research
Foundation (awarded to T.J.K.).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Diane Nugent, MD, Children's Hospital of
Orange County, 455 South Main St, Orange, CA 92868.
 |
REFERENCES |
1.
Ross JM, McIntire LV, Moake JL, Rand JH:
Platelet adhesion and aggregation on human type VI collagen surfaces under physiological flow conditions.
Blood
85:1826, 1995[Abstract/Free Full Text]
2.
Sakariassen KS:
The role of platelet membrane glycoproteins Ib and IIb-IIIa in platelet adherence to human artery subendothelium.
Br J Haematol
63:681, 1986[Medline]
[Order article via Infotrieve]
3.
Kunicki TJ, Nurden AT, Pidard D, Russel NR, Caen JP:
Characterization of human platelet glycoprotein antigens giving rise to individual immunoprecipitates in crossed immunoelectropheresis.
Blood
58:1190, 1981[Abstract/Free Full Text]
4.
Pischel KD, Bluestein HG, Woods VL:
Platelet glycoprotein Ia, Ic, and IIa are physicochemically indistinguishable from the very late activation antigens adhesion related proteins of lymphocytes and other cells types.
J Clin Invest
81:505, 1988
5.
Kunicki TJ, Nugent DJ, Staats SJ, Orchekowski RP, Wayner EA, Carter WG:
The human fibroblast class II extracellular matrix receptor mediates platelet adhesion to collagen and is identical to the platelet glycoprotein Ia-IIa complex.
J Biol Chem
263:4516, 1988[Abstract/Free Full Text]
6.
Takada Y, Wayner EA, Carter WG, Hemler ME:
Extracellular matrix receptors, ECMR II and ECMR I, for collagen and fibronectin correspond to VLA-2 and VLA-3 in the family of heterodimers.
J Cell Biochem
37:385, 1988[Medline]
[Order article via Infotrieve]
7.
Saelman EUM, Nieuwenhuis HK, Hese KM, De Groot PG, Heijnen HFG, Sage EH, Williams S, McKeown L, Gralnick HR, Sixma JJ:
Platelet adhesion to collagens types I through VIII under conditions of stasis and flow is mediated by GPIa/IIa ( 2 1 integrin).
Blood
83:1244, 1994[Abstract/Free Full Text]
8.
Kunicki TJ, Orchekowski R, Annis D, Honda Y:
Variability of integrin 2 1 activity on human platelets.
Blood
82:2693, 1993[Abstract/Free Full Text]
9.
Kunicki TJ, Kritzik M, Annis DS, Nugent D:
Hereditary variation in platelet integrin 2 1 density is associated with two silent polymorphisms in the 2 gene coding sequence.
Blood
89:1939, 1997[Abstract/Free Full Text]
10.
Kritzik M, Tarantino MD, Nugent DJ, Santoso S, Kunicki TJ:
Nucleotide polymorphisms in the 2 gene define multiple alleles which are associated with differences in platelet 2 1.
Blood
92:2382, 1998[Abstract/Free Full Text]
11.
Rodeghiero F, Castaman G, Dini E:
Epidemiological investigation of the prevalence of von Willebrand's disease.
Blood
69:454, 1987[Abstract/Free Full Text]
12.
Werner EJ, Broxson EH, Tucker EL, Giroux D, Shults J, Ashbire TC:
Prevalence of von Willebrand disease in children: A multiethnic study.
J Pediatr
123:893, 1993[Medline]
[Order article via Infotrieve]
13.
Ruggeri ZM:
Pathogenesis and classification of von Willebrand disease.
Haemostasis
24:265, 1994[Medline]
[Order article via Infotrieve]
14.
Furlan M:
von Willebrand factor: Molecular size and functional activity.
Ann Hematol
72:341, 1996[Medline]
[Order article via Infotrieve]
15.
Nichols W, Ginsburg D:
von Willebrand disease.
Medicine
76:1, 1997[Medline]
[Order article via Infotrieve]
16.
Mannucci PM, Lombardi R, Bader R, Vianello L, Federici AB, Solinas S, Mazzucconiu MG, Mariani G:
Heterogeneity of type 1 von Willebrand's disease: Evidence for a subgroup withan abnormal von Willebrand factor.
Blood
66:796, 1985[Abstract/Free Full Text]
17.
Fressinaud E, Federici AB, Castaman G, Rostchild C, Rodeghiero F, Baumgartner HR, Mannucci PM, Meyer D:
The role of platelet von Willebrand factor in platelet adhesion and thrombus formation: A study of 34 patients with various subtypes of type 1 von Willebrand disease.
Br J Haematol
86:327, 1994[Medline]
[Order article via Infotrieve]
18.
Kundu S, Heilmann E, Sio R, Garcia C, Davidson R, Ostgaard R:
Description of an in vitro platelet function analyzer PFA-100TM.
Semin Thromb Hemost
21:106, 1995[Medline]
[Order article via Infotrieve] (suppl 2)
19.
Miller SA, Dwikes DD, Polesky HF:
A simple salting out procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res
16:1215, 1988[Free Full Text]
20.
Fressinaud E, Veyradier A, Truchaud F, Martin I, Boyer-Neumann C, Trossaert M, Meyer D:
Screening for von Willebrand disease with a new analyzer using high shear stress: A study of 60 cases.
Blood
91:1325, 1998[Abstract/Free Full Text]
21.
Sadler JE, Matsushita T, Dong Z, Tuley EA, Westfield LA:
Molecular mechanism and classification of von Willebrand disease.
Thromb Haemost
74:161, 1995[Medline]
[Order article via Infotrieve]
22.
Abildgaard CF, Suzuki Z, Harrison J, Jefcoat K, Zimmerman TS:
Serial studies in von Willebrand disease: Variability versus "variants".
Blood
56:712, 1980[Abstract/Free Full Text]
23.
Eikenboom JCJ, Reitsma PH, Peerlinck KMJ, Briet E:
Recessive inheritance of von Willebrand's disease type 1.
Lancet
341:982, 1993[Medline]
[Order article via Infotrieve]
24.
Gill JC, Endres-Brooks J, Bauer PJ, Marks WJ, Montgomery RR:
The effect of ABO blood group on the diagnosis of von Willebrand disease.
Blood
69:1691, 1987[Abstract/Free Full Text]
25.
d'Alessio P, Zwaginga JJ, de Boer HC, Federici AB, Rodeghiero F, Castaman G, Mariani G, Mannucci PM, de Groot PG, Sixma JJ:
Platelet adhesion to collagen in subtypes of type 1 von Willebrand's disease is dependent on platelet von Willebrand factor.
Thromb Haemost
64:227, 1990[Medline]
[Order article via Infotrieve]
26.
Gralnick HR, Kramer WS, McKeown LP, Garfinkel L, Pinot A, Williams SB, Krutzsch H:
Platelet adhesion at high shear rates: The roles of von Willebrand factor/GPIb and the 1 integrin 2 1.
Thromb Res
81:113, 1996[Medline]
[Order article via Infotrieve]
27.
Nieuwenhuis HK, Akkerman JWN, Houdijk WPM, Sixma JJ:
Human blood platelets showing no response to collagen fail to express surface glycoprotein Ia.
Nature
318:470, 1985[Medline]
[Order article via Infotrieve]
28.
Santoro SA, Zutter MM:
The 2 1 integrin: A collagen receptor on platelets and other cells.
Thromb Haemost
74:813, 1995[Medline]
[Order article via Infotrieve]
29.
Sixma JJ, Henrita van Zanteen G, Saelman EUM, Verkleij M, Lankhof H, Nieuwenhuis HK, de Groot PG:
Platelet adhesion to collagen.
Thromb Haemost
74:454, 1995[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Okumus, E. Kiyan, O. Arseven, L. Tabak, E. K. Bayrak, N. E. Unaltuna, and H. Issever
Platelet Glycoprotein Ia 807c/T and 873g/A Polymorphisms in Patients With Venous Thromboembolism
Clinical and Applied Thrombosis/Hemostasis,
January 1, 2007;
13(1):
101 - 103.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Goodeve, J. Eikenboom, G. Castaman, F. Rodeghiero, A. B. Federici, J. Batlle, D. Meyer, C. Mazurier, J. Goudemand, R. Schneppenheim, et al.
Phenotype and genotype of a cohort of families historically diagnosed with type 1 von Willebrand disease in the European study, Molecular and Clinical Markers for the Diagnosis and Management of Type 1 von Willebrand Disease (MCMDM-1VWD)
Blood,
January 1, 2007;
109(1):
112 - 121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cheli and T. J. Kunicki
hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1
Blood,
June 1, 2006;
107(11):
4391 - 4398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Yee, C. W. Sun, A. L. Bergeron, J.-f. Dong, and P. F. Bray
Aggregometry detects platelet hyperreactivity in healthy individuals
Blood,
October 15, 2005;
106(8):
2723 - 2729.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gruner, M. Prostredna, B. Aktas, A. Moers, V. Schulte, T. Krieg, S. Offermanns, B. Eckes, and B. Nieswandt
Anti-Glycoprotein VI Treatment Severely Compromises Hemostasis in Mice With Reduced {alpha}2{beta}1 Levels or Concomitant Aspirin Therapy
Circulation,
November 2, 2004;
110(18):
2946 - 2951.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kunicki, A. B. Federici, D. R. Salomon, J. A. Koziol, S. R. Head, T. S. Mondala, J. D. Chismar, L. Baronciani, M. T. Canciani, and I. R. Peake
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees
Blood,
October 15, 2004;
104(8):
2359 - 2367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R.-M. Siljander, I. C. A. Munnix, P. A. Smethurst, H. Deckmyn, T. Lindhout, W. H. Ouwehand, R. W. Farndale, and J. W. M. Heemskerk
Platelet receptor interplay regulates collagen-induced thrombus formation in flowing human blood
Blood,
February 15, 2004;
103(4):
1333 - 1341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. McBane II
Genetically Determined Procoagulant States and Heparin Use
Seminars in Cardiothoracic and Vascular Anesthesia,
December 1, 2003;
7(4):
427 - 442.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Best, Y. A. Senis, G. E. Jarvis, H. J. Eagleton, D. J. Roberts, T. Saito, S. M. Jung, M. Moroi, P. Harrison, F. R. Green, et al.
GPVI levels in platelets: relationship to platelet function at high shear
Blood,
October 15, 2003;
102(8):
2811 - 2818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Porto, A. M. Leone, A. Sciahbasi, F. Andreotti, J. H. Beer, L. Pontiggia, and R. Lassila
Increased Platelet Reactivity Due to Platelet Receptor Polymporphisms? Not in the Real World *
Arterioscler. Thromb. Vasc. Biol.,
September 1, 2003;
23(9):
1703 - 1704.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Rick, C. E. Walsh, and N. S. Key
Congenital Bleeding Disorders
Hematology,
January 1, 2003;
2003(1):
559 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Pontiggia, R. Lassila, S. Pederiva, H.-R. Schmid, M. Burger, and J. H. Beer
Increased Platelet-Collagen Interaction Associated With Double Homozygosity for Receptor Polymorphisms of Platelet GPIa and GPIIIa
Arterioscler. Thromb. Vasc. Biol.,
December 1, 2002;
22(12):
2093 - 2098.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Maeno, H. Koyama, H. Tahara, M. Komatsu, M. Emoto, T. Shoji, M. Inaba, T. Miki, Y. Okuno, and Y. Nishizawa
The 807T Allele in {alpha}2 Integrin Is Protective Against Atherosclerotic Arterial Wall Thickening and the Occurrence of Plaque in Patients With Type 2 Diabetes
Diabetes,
May 1, 2002;
51(5):
1523 - 1528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler. Thromb. Vasc. Biol.,
January 1, 2002;
22(1):
14 - 20.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cadroy, K. S. Sakariassen, J.-P. Charlet, C. Thalamas, B. Boneu, and P. Sie
Role of 4 platelet membrane glycoprotein polymorphisms on experimental arterial thrombus formation in men
Blood,
November 15, 2001;
98(10):
3159 - 3161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Furihata, K. J. Clemetson, H. Deguchi, and T. J. Kunicki
Variation in Human Platelet Glycoprotein VI Content Modulates Glycoprotein VI-Specific Prothrombinase Activity
Arterioscler. Thromb. Vasc. Biol.,
November 1, 2001;
21(11):
1857 - 1863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Jacquelin, M. D. Tarantino, M. Kritzik, D. Rozenshteyn, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Allele-dependent transcriptional regulation of the human integrin {alpha}2 gene
Blood,
March 15, 2001;
97(6):
1721 - 1726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Roest, J. J. Sixma, Y.-P. Wu, M. J. W. Ijsseldijk, M. Tempelman, P. J. Slootweg, P. G. de Groot, and G. H. van Zanten
Platelet adhesion to collagen in healthy volunteers is influenced by variation of both alpha 2beta 1 density and von Willebrand factor
Blood,
August 15, 2000;
96(4):
1433 - 1437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. von Beckerath, W. Koch, J. Mehilli, C. Bottiger, A. Schomig, and A. Kastrati
Glycoprotein Ia gene C807T polymorphism and risk for major adverse cardiac events within the first 30 days after coronary artery stenting
Blood,
June 1, 2000;
95(11):
3297 - 3301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood,
March 1, 2000;
95(5):
1517 - 1532.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Santoro
Platelet Surface Collagen Receptor Polymorphisms: Variable Receptor Expression and Thrombotic/Hemorrhagic Risk
Blood,
June 1, 1999;
93(11):
3575 - 3577.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Jacquelin, D. Rozenshteyn, S. Kanaji, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Characterization of Inherited Differences in Transcription of the Human Integrin alpha 2 Gene
J. Biol. Chem.,
June 22, 2001;
276(26):
23518 - 23524.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|