Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Di Paola, J.
Right arrow Articles by Nugent, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Paola, J.
Right arrow Articles by Nugent, D.
Related Collections
Right arrow Focus on Hematology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 93 No. 11 (June 1), 1999: pp. 3578-3582

Low Platelet &b.alpha;2beta 1 Levels in Type I von Willebrand Disease Correlate With Impaired Platelet Function in a High Shear Stress System

By Jorge Di Paola, Augusto B. Federici, P.M. Mannucci, Maria T. Canciani, Marcie Kritzik, Thomas J. Kunicki, and Diane Nugent

From Children's Hospital of Orange County, Orange, CA; A. Bianchi Bonomi Hemophilia and Thrombosis Center, I.R.C.C.S. Ospedale Maggiore and University of Milano, Milan, Italy; The Scripps Institute, La Jolla, CA.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Platelet adhesion to collagen-coated surfaces in whole blood under flow conditions is mediated by both von Willebrand factor (vWF)-dependent recruitment of the platelet glycoprotein Ib-IX receptor complex and collagen interaction with the integrin alpha 2beta 1. In type 1 von Willebrand disease (vWD), platelet adhesive functions are impaired due to the decrease in vWF levels in plasma and platelets. There are at least three alleles of the human alpha 2 gene, distinguishable by a cluster of silent or noncoding sequence differences within a segment of the gene. Two alleles, associated with low receptor density can be distinguished by nucleotide 807C, while the third allele associated with high receptor density, expresses nucleotide 807T. Gene frequencies of these alleles in a normal population (n = 167) are 0.58 for 807C and 0.42 for 807T. We measured the frequencies of these alleles in symptomatic patients with five types of vWD (type 1, n = 78; type 2A, n = 25, type 2B, n = 14; type 2M, n = 10; and type 3, n = 20). Compared with the normal group, no significant difference in allele frequencies was observed among individuals with types 2A, 2B, 2M, or 3 vWD. However, the frequency of the 807C allele, associated with low collagen receptor density, among type 1 vWD patients (807C = .71; 807T = .29) was significantly higher than that of the normal population (P = .007). Also, in patients with vWD type 1 and borderline to normal ristocetin-cofactor (vWF:RCo) activity values, collagen receptor density correlates inversely with closure time in a high shear stress system (platelet function analyzer [PFA-100]). We propose that low platelet alpha 2beta 1 density results in less efficient primary platelet adhesion and may result in increased tendency to bleed, as evidenced by the high frequency of this polymorphism in patients with type 1 vWD compared with normal individuals. In addition, this may account for the variability between patients with similar levels of vWF antigen, but strikingly different bleeding histories.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

PLATELET ADHESION TO collagen in damaged vascular subendothelium is of pivotal importance to both the initiation of platelet thrombus formation and procoagulant activity.1 This first step in thrombus formation is mediated by both von Willebrand factor (vWF)-dependent recruitment of the glycoprotein Ib-IX receptor complex and collagen interaction with the integrin, alpha 2beta 1.2 The integrin, alpha 2beta 1, mediates platelet adhesion to both fibrillar (types I, III, and V) or nonfibrillar (types IV, VI, VII, and VIII) collagen.3-7 While the levels of the integrins alpha 5beta 1 (fibronectin receptor) and alpha IIbbeta 3 (fibrinogen receptor) can vary from one individual to the next, this difference never exceeds a fraction of the mean population level. However alpha 2beta 1 levels can vary up to 10-fold in the general population, and this correlates with differences in adhesiveness to type I or type III collagens.8 This variation in alpha 2beta 1 receptor density is associated with differential inheritance of three alleles of the human alpha 2 gene that can be distinguished by multiple sequence differences in selected introns and silent sequence differences in a segment of the coding region.9,10 Because there is a correlation between platelet adhesion to collagen and alpha 2beta 1 receptor levels, differences in alpha 2beta 1 receptor levels may influence the risk for thrombosis or bleeding in vivo. While the risk is apparently negligible among healthy individuals, it can become an important factor in individuals who are otherwise predisposed toward thrombosis or bleeding by an unrelated genetic or acquired condition, such as von Willebrand disease (vWD).

Among inherited bleeding disorders, vWD is certainly the most common, with a reported prevalence ranging from 0.8% to 1.3%.11,12 The pathogenesis of vWD is based on quantitative and/or qualitative abnormalities of vWF,13 a large, multimeric protein, encoded by a gene in chromosome 12, which circulates in the blood plasma, but is also stored in granules of endothelial cells and platelets.14 The most common form of vWD, known as type 1, accounts for more than 70% of patients and is caused by a quantitative deficiency of vWF.15 Type 1 is very heterogeneous and several subtypes have been described according to platelet vWF content.16 Moreover, in type 1 vWD, platelet vWF cooperates with plasma vWF to determine the degree of abnormalities in platelet-vessel wall interaction.17

Aside from the variation in vWF levels from one patient to the other, it is difficult to explain the significant variation in bleeding tendencies observed between patients with similar laboratory profiles and similar levels of vWF. Thus, genetic and nongenetic factors may augment or attenuate the likelihood of bleeding symptoms in these patients.17 We postulate that variation in the integrin alpha 2beta 1 density on the platelet surface might be a major factor that influences bleeding in patients with type 1 vWD. To test this hypothesis, we determined the alpha 2 genotype in 148 patients with vWD by using restriction digest analysis of genomic DNA. To show correlation between collagen receptor density and platelet function, we also performed platelet adhesion and aggregation studies in the platelet function analyzer (PFA-100, Behring, Dade, FL), a high shear stress system that simulates platelet-based primary hemostasis in vitro.18


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Patients.   We studied 148 symptomatic patients diagnosed with one of five types of vWD as follows: type 1, n = 78; type 2A, n = 25; type 2B, n = 14; type 2M, n = 11; and type 3, n = 20. The diagnosis of vWD was based on laboratory findings (plasma vWF levels, ristocetin cofactor activity [vWF:RCo], factor VIII coagulant activity, and multimer analysis), family and personal history of bleeding, and a prolonged bleeding time. We also studied 99 age-sex-matched Italians and 68 non-Italian whites without evidence of bleeding disorders and used them as controls. Patient blood samples were collected at the Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, Milano, Italy and shipped to Children's Hospital of Orange County (CHOC), Orange, CA. An additional 15 patients samples were harvested and processed at CHOC. Informed consent was obtained in all cases following institutional guidelines.

Isolation and amplification of patient genomic DNA.   Genomic DNA was isolated from peripheral blood mononuclear cells by using the method of Miller et al.19 The desired segment of the alpha 2 gene (581 kb) was amplified by polymerase chain reaction (PCR) using a Perkin Elmer Cetus DNA Thermal Cycler (Norwalk, CT) and Taq polymerase (Pharmacia Biotech, Piscataway, NJ). The primers used in the PCR reaction were: (1) 5' GATTTAACTTTCCCGACTGCCTTC 3' and (2) 5' CATAGGTTTTTGGGGAACAGGTGG 3'. The PCR cycling conditions were: 94°C × 10 minutes, one cycle, followed by 94°C × 1 minute, anneal 1 minute, 72°C × 1 minute, where the annealing was 69°C for two cycles, 67°C for two cycles, and 65° for 35 cycles. The PCR product is a 581-bp segment located within the intron separating two exons that encode the allelic polymorphisms at bp 807 and 873. Genomic DNA cloned from individuals homozygous for 807C or 807T served as positive controls.

Detection and typing of 807T and 807C polymorphisms using Bgl II restriction site.   Digestion of the PCR product was performed with the restriction enzyme Bgl II (Pharmacia Biotech). Briefly, for each 40-µL reaction, 15 µL of the PCR product, 4 µL of 10x restriction buffer (One-Phor-All buffer Plus, Pharmacia Biotech), and 1 µL of Bgl II enzyme (× U/mL) were used. The PCR product was digested at 37°c for at least 2 hours and analyzed on a 1.5% agarose gel in 1x tris acetate EDTA (TAE) buffer. The gel was stained with ethidium bromide and visualized under ultraviolet (UV) light.

Platelet function studies.   Platelet adhesion and aggregation was evaluated in 32 patients with vWD type1 in the PFA-100, as previously described by Fressinaud et al.20 The PFA-100 assay was performed with two different types of cartridges (collagen/epinephrine and collagen/adenine diphosphate [ADP]), and values shown represent the mean of duplicate measurements. The statistical analysis of the results was performed using t-test.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We have previously shown that there are at least three alleles of the human alpha 2 gene distinguishable by a cluster of silent and/or noncoding sequence differences within a 4-kb segment of the gene (Fig 1).10 A naturally occurring restriction site for the enzyme, Bgl II, was found in intron G of the 807T allele. Thus, PCR products amplified from the 807T allele and spanning the Bgl II site can be digested with Bgl II to generate two fragments of 343 and 238 bp, while product amplified from the 807C allele remains undigested. Bgl II digestion of the 581 bp PCR product amplified from genomic DNA of an individual heterozygous for these alleles yields three fragments (581 bp, 343 bp, 238 bp) (Fig 2). The gene frequencies of the 807C and 807T alleles in the control group (n = 167) were .58 and .42, respectively.


View larger version (10K):
[in this window]
[in a new window]
 
Fig 1. Segment of the human alpha 2 gene and two of its alleles (807T and 807C). The allele 807T shows a unique restriction site for the enzyme, Bgl II, in the intron G, which is not present in allele 807C.



View larger version (119K):
[in this window]
[in a new window]
 
Fig 2. Bgl II digest of the 581-bp PCR product amplified from genomic DNA from six representative individuals. Lanes 1 and 2, homozygous 807T (high receptor density); lanes 3 and 4, heterozygous CT (intermediate receptor density); lanes 5 and 6, homozygous 807C (low receptor density). Lanes 7 and 8, cloned genomic DNA from individuals homozygous for 807C and 807T, respectively, serving as positive control. Lane 9, molecular weight markers.

Genomic DNA from 148 individuals diagnosed with vWD was analyzed, and these results were compared with the control group as seen in Table 1. By chi 2 analysis, it was determined that the frequency of 807C allele associated with low collagen receptor density in type 1 vWD patients is higher than that of the normal population (P = .007), the frequencies of these alleles being .71 for 807C and .29 for 807T. In the type 2M patients, the P value was significant at P = .050, albeit not as strong an association as that seen with type 1 vWD patients. On the other hand, there is not a significant difference in allele frequencies among patients with vWD type 2A (P = .246), 2B (P = .353), or 3 (P = .351), compared with the normal group.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Frequencies of the 807 Alleles in Patients With vWD Type 1, 2A, 2B, 2M, and 3 Compared With the Normal Controls

Platelet adhesion was analyzed in 32 patients with vWD type 1 in the PFA-100 and results are shown in Fig 3. At critically low vWF:RCo levels (<30 U/dL), the deficiency of vWF overrides the allele effect on closure time in the PFA-100. When vWF:RCo levels reach values between 40 to 80 U/dL, as seen in many type 1 patients, the effect of the allele on platelet adhesion to collagen is evident. As seen in Fig 3, patients with similar or identical vWF:RCo levels in the 40 to 80 U/dL range, the closure time is significantly longer in those patients who are homozygous for the 807C allele (open circles). By t-test, the differences in closure times between the patients homozygous for the 807C allele and the patients homozygous for the 807T are statistically significant, whether all the subjects with vWF:RCo greater than 40 (P = .018) or just the ones between 40 and 80 (P = .003) are included.


View larger version (16K):
[in this window]
[in a new window]
 
Fig 3. The effect of the 807 allele on platelet adhesion to collagen. Results of the PFA-100 closure time of 32 patients with vWD type 1 compared with their respective vWF:Rco (U/dL). Values represent the mean of duplicated measurements with the epinephrine cartridge. (open circle ) CC; (diamond ) CT; (bullet ) TT.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Multiple advances in the molecular characterization, diagnosis, and treatment of vWD have occurred over the last few years. However, it is unclear why certain vWD type 1 patients develop more severe bleeding symptoms than other patients with equivalent vWF levels.21,22 Differences in severity of bleeding can even be detected in individuals with equivalent antigen level in the same immediate family. Our findings suggest that the level of alpha 2beta 1 on platelets may represent one of the additional factors that determines severity of bleeding in this particular disease.

It is possible that genetic factors directly related to the vWF molecule and its mode of expression could also influence variability of clinical presentation. One such factor is multiple heterozygosity for mutations in the vWF gene.23 Furthermore, there is an association of O blood type with vWF levels in the lower range of normal.24 In addition, D'Alessio et al25 have emphasized the important contribution of platelet vWF to platelet adhesion to collagen in vWD type 1.

Other genetic factors, unrelated to the vWF gene, could also be involved. Our results are consistent with the hypothesis that a low level of the alpha 2beta 1 receptor may result in delayed primary platelet adhesion in patients with vWD type 1. Studies have shown that the primary mechanism of platelet attachment to the subendothelium is dependent on GPIb-IX-vWF interactions. A secondary mechanism involving alpha 2beta 1 binding to the subendothelial collagen also plays an important role.10,26-28 The importance of alpha 2beta 1 as a primary receptor that mediates platelet adhesion to collagen under flow conditions is underscored by the report of a patient lacking glycoprotein Ia (alpha 2) whose platelets failed to respond to collagen.7,27-29 Thus, a lower platelet alpha 2beta 1 density, which has been shown to correlate with decreased adhesiveness to collagen, together with a low vWF level is likely to further impair the adhesion of the platelet to damaged endothelium.

Our studies on individuals with type 1 vWD show a significantly higher prevalence of the 807C allele, which is associated with low alpha 2beta 1 density. As the patients with more bleeding are more likely to be diagnosed, this increased association of the low receptor phenotype in type 1 vWD suggests that the 807C homozygous state may account for the variability in bleeding in vWD. The studies in the PFA-100 show the influence of the alpha 2beta 1 receptor density in platelet adhesion in vWD type 1 patients who have a vWF:RCo activity in the 40 to 80 U/dL range. In patients with vWD type 1 whose vWF:Rco activity is less than 30 U/dL, the collagen receptor density does not seem to play a major role in closure time due to the fact that these patients' platelet adhesion is extremely impaired. This may explain why the group of patients with type 3 vWD did not show a significant difference of allele frequencies when compared with the general population.

In most of the cases with type 2 and 3 vWD, a genetic defect has been correlated with moderate to severe bleeding symptoms, while no clear definition of the molecular basis of such defects is available for mild-moderate type 1 vWD. Therefore, additional information about the nature of bleeding in the latter group of patients will be very useful. We are currently performing expanded studies in families with vWD type 1 to evaluate platelet alpha 2beta 1 receptor density variation as a possible mechanism for disparity in bleeding symptoms. This newly described genetic marker must be included in larger patient studies to determine its true role as a risk factor for increased bleeding.


    ACKNOWLEDGMENT

The authors would like to thank Peggy Nakagawa, MS and Diana Rozenshteyn, BS for their excellent technical assistance and Dr Shirley Williams for her help and suggestions.


    FOOTNOTES

Submitted March 7, 1998; accepted January 12, 1999.

Supported by a grant from the Gustavus and Louise Pfeiffer Research Foundation (awarded to T.J.K.).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Diane Nugent, MD, Children's Hospital of Orange County, 455 South Main St, Orange, CA 92868.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Ross JM, McIntire LV, Moake JL, Rand JH: Platelet adhesion and aggregation on human type VI collagen surfaces under physiological flow conditions. Blood 85:1826, 1995[Abstract/Free Full Text]

2. Sakariassen KS: The role of platelet membrane glycoproteins Ib and IIb-IIIa in platelet adherence to human artery subendothelium. Br J Haematol 63:681, 1986[Medline] [Order article via Infotrieve]

3. Kunicki TJ, Nurden AT, Pidard D, Russel NR, Caen JP: Characterization of human platelet glycoprotein antigens giving rise to individual immunoprecipitates in crossed immunoelectropheresis. Blood 58:1190, 1981[Abstract/Free Full Text]

4. Pischel KD, Bluestein HG, Woods VL: Platelet glycoprotein Ia, Ic, and IIa are physicochemically indistinguishable from the very late activation antigens adhesion related proteins of lymphocytes and other cells types. J Clin Invest 81:505, 1988

5. Kunicki TJ, Nugent DJ, Staats SJ, Orchekowski RP, Wayner EA, Carter WG: The human fibroblast class II extracellular matrix receptor mediates platelet adhesion to collagen and is identical to the platelet glycoprotein Ia-IIa complex. J Biol Chem 263:4516, 1988[Abstract/Free Full Text]

6. Takada Y, Wayner EA, Carter WG, Hemler ME: Extracellular matrix receptors, ECMR II and ECMR I, for collagen and fibronectin correspond to VLA-2 and VLA-3 in the family of heterodimers. J Cell Biochem 37:385, 1988[Medline] [Order article via Infotrieve]

7. Saelman EUM, Nieuwenhuis HK, Hese KM, De Groot PG, Heijnen HFG, Sage EH, Williams S, McKeown L, Gralnick HR, Sixma JJ: Platelet adhesion to collagens types I through VIII under conditions of stasis and flow is mediated by GPIa/IIa (alpha 2beta 1 integrin). Blood 83:1244, 1994[Abstract/Free Full Text]

8. Kunicki TJ, Orchekowski R, Annis D, Honda Y: Variability of integrin alpha 2beta 1 activity on human platelets. Blood 82:2693, 1993[Abstract/Free Full Text]

9. Kunicki TJ, Kritzik M, Annis DS, Nugent D: Hereditary variation in platelet integrin alpha 2beta 1 density is associated with two silent polymorphisms in the alpha 2 gene coding sequence. Blood 89:1939, 1997[Abstract/Free Full Text]

10. Kritzik M, Tarantino MD, Nugent DJ, Santoso S, Kunicki TJ: Nucleotide polymorphisms in the alpha 2 gene define multiple alleles which are associated with differences in platelet alpha 2beta 1. Blood 92:2382, 1998[Abstract/Free Full Text]

11. Rodeghiero F, Castaman G, Dini E: Epidemiological investigation of the prevalence of von Willebrand's disease. Blood 69:454, 1987[Abstract/Free Full Text]

12. Werner EJ, Broxson EH, Tucker EL, Giroux D, Shults J, Ashbire TC: Prevalence of von Willebrand disease in children: A multiethnic study. J Pediatr 123:893, 1993[Medline] [Order article via Infotrieve]

13. Ruggeri ZM: Pathogenesis and classification of von Willebrand disease. Haemostasis 24:265, 1994[Medline] [Order article via Infotrieve]

14. Furlan M: von Willebrand factor: Molecular size and functional activity. Ann Hematol 72:341, 1996[Medline] [Order article via Infotrieve]

15. Nichols W, Ginsburg D: von Willebrand disease. Medicine 76:1, 1997[Medline] [Order article via Infotrieve]

16. Mannucci PM, Lombardi R, Bader R, Vianello L, Federici AB, Solinas S, Mazzucconiu MG, Mariani G: Heterogeneity of type 1 von Willebrand's disease: Evidence for a subgroup withan abnormal von Willebrand factor. Blood 66:796, 1985[Abstract/Free Full Text]

17. Fressinaud E, Federici AB, Castaman G, Rostchild C, Rodeghiero F, Baumgartner HR, Mannucci PM, Meyer D: The role of platelet von Willebrand factor in platelet adhesion and thrombus formation: A study of 34 patients with various subtypes of type 1 von Willebrand disease. Br J Haematol 86:327, 1994[Medline] [Order article via Infotrieve]

18. Kundu S, Heilmann E, Sio R, Garcia C, Davidson R, Ostgaard R: Description of an in vitro platelet function analyzer PFA-100TM. Semin Thromb Hemost 21:106, 1995[Medline] [Order article via Infotrieve] (suppl 2)

19. Miller SA, Dwikes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215, 1988[Free Full Text]

20. Fressinaud E, Veyradier A, Truchaud F, Martin I, Boyer-Neumann C, Trossaert M, Meyer D: Screening for von Willebrand disease with a new analyzer using high shear stress: A study of 60 cases. Blood 91:1325, 1998[Abstract/Free Full Text]

21. Sadler JE, Matsushita T, Dong Z, Tuley EA, Westfield LA: Molecular mechanism and classification of von Willebrand disease. Thromb Haemost 74:161, 1995[Medline] [Order article via Infotrieve]

22. Abildgaard CF, Suzuki Z, Harrison J, Jefcoat K, Zimmerman TS: Serial studies in von Willebrand disease: Variability versus "variants". Blood 56:712, 1980[Abstract/Free Full Text]

23. Eikenboom JCJ, Reitsma PH, Peerlinck KMJ, Briet E: Recessive inheritance of von Willebrand's disease type 1. Lancet 341:982, 1993[Medline] [Order article via Infotrieve]

24. Gill JC, Endres-Brooks J, Bauer PJ, Marks WJ, Montgomery RR: The effect of ABO blood group on the diagnosis of von Willebrand disease. Blood 69:1691, 1987[Abstract/Free Full Text]

25. d'Alessio P, Zwaginga JJ, de Boer HC, Federici AB, Rodeghiero F, Castaman G, Mariani G, Mannucci PM, de Groot PG, Sixma JJ: Platelet adhesion to collagen in subtypes of type 1 von Willebrand's disease is dependent on platelet von Willebrand factor. Thromb Haemost 64:227, 1990[Medline] [Order article via Infotrieve]

26. Gralnick HR, Kramer WS, McKeown LP, Garfinkel L, Pinot A, Williams SB, Krutzsch H: Platelet adhesion at high shear rates: The roles of von Willebrand factor/GPIb and the beta 1 integrin alpha 2beta 1. Thromb Res 81:113, 1996[Medline] [Order article via Infotrieve]

27. Nieuwenhuis HK, Akkerman JWN, Houdijk WPM, Sixma JJ: Human blood platelets showing no response to collagen fail to express surface glycoprotein Ia. Nature 318:470, 1985[Medline] [Order article via Infotrieve]

28. Santoro SA, Zutter MM: The alpha 2beta 1 integrin: A collagen receptor on platelets and other cells. Thromb Haemost 74:813, 1995[Medline] [Order article via Infotrieve]

29. Sixma JJ, Henrita van Zanteen G, Saelman EUM, Verkleij M, Lankhof H, Nieuwenhuis HK, de Groot PG: Platelet adhesion to collagen. Thromb Haemost 74:454, 1995[Medline] [Order article via Infotrieve]


© 1999 by The American Society of Hematology.
 
0006-4971/99/9311-0119$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
CLIN APPL THROMB HEMOSTHome page
G. Okumus, E. Kiyan, O. Arseven, L. Tabak, E. K. Bayrak, N. E. Unaltuna, and H. Issever
Platelet Glycoprotein Ia 807c/T and 873g/A Polymorphisms in Patients With Venous Thromboembolism
Clinical and Applied Thrombosis/Hemostasis, January 1, 2007; 13(1): 101 - 103.
[Abstract] [PDF]


Home page
BloodHome page
A. Goodeve, J. Eikenboom, G. Castaman, F. Rodeghiero, A. B. Federici, J. Batlle, D. Meyer, C. Mazurier, J. Goudemand, R. Schneppenheim, et al.
Phenotype and genotype of a cohort of families historically diagnosed with type 1 von Willebrand disease in the European study, Molecular and Clinical Markers for the Diagnosis and Management of Type 1 von Willebrand Disease (MCMDM-1VWD)
Blood, January 1, 2007; 109(1): 112 - 121.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Cheli and T. J. Kunicki
hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1
Blood, June 1, 2006; 107(11): 4391 - 4398.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. L. Yee, C. W. Sun, A. L. Bergeron, J.-f. Dong, and P. F. Bray
Aggregometry detects platelet hyperreactivity in healthy individuals
Blood, October 15, 2005; 106(8): 2723 - 2729.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Gruner, M. Prostredna, B. Aktas, A. Moers, V. Schulte, T. Krieg, S. Offermanns, B. Eckes, and B. Nieswandt
Anti-Glycoprotein VI Treatment Severely Compromises Hemostasis in Mice With Reduced {alpha}2{beta}1 Levels or Concomitant Aspirin Therapy
Circulation, November 2, 2004; 110(18): 2946 - 2951.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Kunicki, A. B. Federici, D. R. Salomon, J. A. Koziol, S. R. Head, T. S. Mondala, J. D. Chismar, L. Baronciani, M. T. Canciani, and I. R. Peake
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees
Blood, October 15, 2004; 104(8): 2359 - 2367.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. R.-M. Siljander, I. C. A. Munnix, P. A. Smethurst, H. Deckmyn, T. Lindhout, W. H. Ouwehand, R. W. Farndale, and J. W. M. Heemskerk
Platelet receptor interplay regulates collagen-induced thrombus formation in flowing human blood
Blood, February 15, 2004; 103(4): 1333 - 1341.
[Abstract] [Full Text] [PDF]


Home page
SEMIN CARDIOTHORAC VASC ANESTHHome page
R. D. McBane II
Genetically Determined Procoagulant States and Heparin Use
Seminars in Cardiothoracic and Vascular Anesthesia, December 1, 2003; 7(4): 427 - 442.
[Abstract] [PDF]


Home page
BloodHome page
D. Best, Y. A. Senis, G. E. Jarvis, H. J. Eagleton, D. J. Roberts, T. Saito, S. M. Jung, M. Moroi, P. Harrison, F. R. Green, et al.
GPVI levels in platelets: relationship to platelet function at high shear
Blood, October 15, 2003; 102(8): 2811 - 2818.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
I. Porto, A. M. Leone, A. Sciahbasi, F. Andreotti, J. H. Beer, L. Pontiggia, and R. Lassila
Increased Platelet Reactivity Due to Platelet Receptor Polymporphisms? Not in the Real World *
Arterioscler. Thromb. Vasc. Biol., September 1, 2003; 23(9): 1703 - 1704.
[Full Text] [PDF]


Home page
ASH Education BookHome page
M. E. Rick, C. E. Walsh, and N. S. Key
Congenital Bleeding Disorders
Hematology, January 1, 2003; 2003(1): 559 - 574.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Pontiggia, R. Lassila, S. Pederiva, H.-R. Schmid, M. Burger, and J. H. Beer
Increased Platelet-Collagen Interaction Associated With Double Homozygosity for Receptor Polymorphisms of Platelet GPIa and GPIIIa
Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2093 - 2098.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Maeno, H. Koyama, H. Tahara, M. Komatsu, M. Emoto, T. Shoji, M. Inaba, T. Miki, Y. Okuno, and Y. Nishizawa
The 807T Allele in {alpha}2 Integrin Is Protective Against Atherosclerotic Arterial Wall Thickening and the Occurrence of Plaque in Patients With Type 2 Diabetes
Diabetes, May 1, 2002; 51(5): 1523 - 1528.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler. Thromb. Vasc. Biol., January 1, 2002; 22(1): 14 - 20.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Cadroy, K. S. Sakariassen, J.-P. Charlet, C. Thalamas, B. Boneu, and P. Sie
Role of 4 platelet membrane glycoprotein polymorphisms on experimental arterial thrombus formation in men
Blood, November 15, 2001; 98(10): 3159 - 3161.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Furihata, K. J. Clemetson, H. Deguchi, and T. J. Kunicki
Variation in Human Platelet Glycoprotein VI Content Modulates Glycoprotein VI-Specific Prothrombinase Activity
Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1857 - 1863.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Jacquelin, M. D. Tarantino, M. Kritzik, D. Rozenshteyn, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Allele-dependent transcriptional regulation of the human integrin {alpha}2 gene
Blood, March 15, 2001; 97(6): 1721 - 1726.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Roest, J. J. Sixma, Y.-P. Wu, M. J. W. Ijsseldijk, M. Tempelman, P. J. Slootweg, P. G. de Groot, and G. H. van Zanten
Platelet adhesion to collagen in healthy volunteers is influenced by variation of both alpha 2beta 1 density and von Willebrand factor
Blood, August 15, 2000; 96(4): 1433 - 1437.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. von Beckerath, W. Koch, J. Mehilli, C. Bottiger, A. Schomig, and A. Kastrati
Glycoprotein Ia gene C807T polymorphism and risk for major adverse cardiac events within the first 30 days after coronary artery stenting
Blood, June 1, 2000; 95(11): 3297 - 3301.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood, March 1, 2000; 95(5): 1517 - 1532.
[Full Text] [PDF]


Home page
BloodHome page
S. A. Santoro
Platelet Surface Collagen Receptor Polymorphisms: Variable Receptor Expression and Thrombotic/Hemorrhagic Risk
Blood, June 1, 1999; 93(11): 3575 - 3577.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Jacquelin, D. Rozenshteyn, S. Kanaji, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Characterization of Inherited Differences in Transcription of the Human Integrin alpha 2 Gene
J. Biol. Chem., June 22, 2001; 276(26): 23518 - 23524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Di Paola, J.
Right arrow Articles by Nugent, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Paola, J.
Right arrow Articles by Nugent, D.
Related Collections
Right arrow Focus on Hematology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020