|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3601-3609
RAPID COMMUNICATION
The Apoptosis Inhibitor Gene API2 and a Novel 18q Gene,
MLT, Are Recurrently Rearranged in the t(11;18)(q21;q21)
Associated With Mucosa-Associated Lymphoid Tissue Lymphomas
By
Judith Dierlamm,
Mathijs Baens,
Iwona Wlodarska,
Margarita Stefanova-Ouzounova,
Jesus Maria Hernandez,
Dieter Kurt Hossfeld,
Christiane De Wolf-Peeters,
Anne Hagemeijer,
Herman Van den Berghe, and
Peter Marynen
From the Department of Oncology and Hematology, University Hospital
Eppendorf, Hamburg, Germany; Center for Human Genetics and Flanders
Interuniversity Institute for Biotechnology, University of Leuven,
Leuven, Belgium; the Department of Hematology, University of Salamanca,
Salamanca, Spain; and the Department of Pathology, University of
Leuven, Belgium.
 |
ABSTRACT |
Marginal zone cell lymphomas of the mucosa-associated lymphoid
tissue (MALT) are the most common subtype of lymphoma arising at
extranodal sites. The t(11;18)(q21;q21) appears to be the key genetic
lesion and is found in approximately 50% of cytogenetically abnormal
low-grade MALT lymphomas. We show that the API2 gene, encoding
an inhibitor of apoptosis also known as c-IAP2, HIAP1, and
MIHC, and a novel gene on 18q21 characterized by several
Ig-like C2-type domains, named MLT, are recurrently rearranged
in the t(11;18). In both MALT lymphomas analyzed, the breakpoint in
API2 occurred in the intron separating the exons coding
respectively for the baculovirus IAP repeat domains and the caspase
recruitment domain. The breakpoints within MLT differed but the
open reading frame was conserved in both cases. In one case, the
translocation was accompanied by a cryptic deletion involving the 3'
part of API2. As a result, the reciprocal transcript was not
present, strongly suggesting that the API2-MLT fusion is
involved in the oncogenesis of MALT lymphoma.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
RECURRENT TRANSLOCATIONS acquired in a
multistep process of transformation leading to the evolution of
autonomous cell clones are well recognized in nodal B-cell lymphomas.
These translocations characterize distinct subtypes of disease and
involve genes controlling cell proliferation and apoptosis.
BCL2, which suppresses apoptosis, was cloned from the
t(14;18)(q21;q32) found in most cases of follicular B-cell lymphoma,
translocations involving the BCL1/CyclinD1 gene on chromosome
11q13 are seen in many cases of mantle cell lymphoma, and
c-MYC is rearranged in almost all Burkitt's
lymphomas.1
By contrast, the genetic mechanisms underlying the genesis and disease
progression of extranodal marginal zone B-cell lymphomas of
mucosa-associated lymphoid tissue (MALT) type, a distinct subtype of
B-cell non-Hodgkin's lymphoma (NHL), are not known.2 MALT lymphomas account for 5% to 10% of all NHLs, and the vast majority of
lymphomas arising at extranodal sites. They originate in a setting of
chronic inflammation triggered by chronic infection or autoimmune
disorders, such as Helicobacter pylori gastritis, Sjögren's syndrome, and Hashimoto's thyroiditis.3
In vitro experiments have shown that H pylori-specific T cells
provide contact dependent help for the growth of the malignant B cells of gastric MALT.4 The etiological link between low-grade
gastric MALT lymphomas and H pylori infection has also been
shown by the regression of some cases with antibiotic
therapy.5,6 The preferential use of Ig variable region
genes (VH) associated with autoimmune disorders indicate
that some marginal zone B-lymphomas may arise from autoreactive B
cells.7,8 Abnormal karyotypic data have been published for
only a limited number of MALT lymphomas.9-17 Recurrent
abnormalities in these cases include trisomies of chromosomes 3, 7, 12, and 18,11,17,18 the t(1;14)(p22;q32) that has been described in two cases,17 and the t(11;18)(q21;q21) that
represents the most frequent structural abnormality and seems to
characterize this disease entity.9,12,14
We herein present a detailed molecular genetic characterization of the
11q21 and 18q21 breakpoint regions in two cases of gastrointestinal
MALT lymphomas characterized by the t(11;18)(q21;q21) and show that the
API2 gene also known as c-IAP2,19
HIAP1,20 and MIHC,21 an
inhibitor of apoptosis, and a novel gene on 18q21, named MLT,
are rearranged in this translocation. Our data suggest that truncation
of the API2 gene distal to its three baculovirus IAP repeat
(BIR) domains and fusion of this truncated gene with the
carboxy-terminal region of MLT may lead to increased inhibition of apoptosis and thereby confer a survival benefit to MALT type B-cell lymphomas.
| |
MATERIALS AND METHODS |
Tumor specimens.
Two cases of low-grade extranodal gastrointestinal MALT lymphomas
displaying the t(11;18)(q21;q21) were selected from the files of the
Center for Human Genetics, University of Leuven, Belgium and the
Department of Hematology, University of Salamanca, Spain, based on the
availability of metaphase spreads and frozen tumor tissue. Case 1 presented with an extended multifocal gastrointestinal MALT lymphoma
involving the stomach, the small and large bowel, and the mesenteric
lymphnodes. Case 2 was diagnosed with a gastric MALT lymphoma with
secondary involvement of the spleen, the bone marrow, and the
peripheral blood. Both cases revealed H pylori-associated gastritis and showed the typical morphology and immunophenotype of
marginal zone B-cell lymphomas of MALT type2 including the tumor cell characteristics, extension of the marginal zones by tumor
cells, follicular colonization, lymphoepithelial lesions, expression of
IgM, CD19, CD20, Ig light chain restriction, and negativity for CD5,
CD10, and CD23.
Cytogenetic analysis.
Cytogenetic analysis was performed as described
previously11 using tissue of a small bowel biopsy (case 1)
and the spleen specimen (case 2). Both cases showed the
t(11;18)(q21;q21) as the sole cytogenetic abnormality (case 1:
46,XY,t(11;18)(q21;q21) [17]/46,XY [3]; case 2:
46,XX,t(11;18)(q21;q21) [6]/46,XX [14]). Fluorescence in situ
hybridization (FISH) was performed as previously described.22 Chromosomes 11 and 18 were identified by
cohybridization with chromosome 11 (pLC11A) and 18 (L1.84) specific
 -satellite probes in combination with G-banding using
4,6-diamidino-2-phenylindole-dihydrochlorid (DAPI) counterstain.
Yeast artificial chromosome (YAC) clones.
YAC clones derived from the Centre d'Etude du Polymorphisme Humain
(CEPH, Paris, France) human megaYAC library were selected from the YAC contig reported by Chumakov et al23 and data
obtained from URL http://www-genome.wi.mit.edu/cgi-bin/contig/yac_info at the Whitehead Institute for Biomedical Research (Cambridge, MA). In
addition, YAC A153A6 hybridizing to the BCL2 gene located at
18q2124 and a probe specific for the MLL gene on
11q23 (Oncor, Gaithersburg, MD) were used. Human YAC inserts were
selectively amplified using Alu-polymerase chain reaction
(PCR).25 To confirm their cytogenetic position and to
determine the relative order of the YAC clones, pairs of differentially
labeled YACs were hybridized to normal metaphase spreads obtained from
phytohemagglutinin (PHA)-stimulated peripheral blood lymphocytes of a
healthy donor.
P1 artificial chromosome (PAC) and plasmid clones.
PAC clones were isolated by screening high-density filters from the
Roswell Park Cancer Institute (RPCI; Buffalo, NY) libraries with
32P-labeled probes. A walking strategy was used to extend
the map. PAC end-fragments were rescued using a vectorette ligation
approach.26 The presence of the sequence tagged site (STS)
in the relevant PACs was confirmed by PCR and each PAC was analyzed by
FISH on normal metaphase spreads. BamHI subclones of PAC 152M5
were generated by ligation of gel-purified fragments in pUC18
(Pharmacia Biotech, Uppsala, Sweden), and transformation into XL10-gold
cells (Stratagene, La Jolla, CA). A BamHI restriction map was
generated by comparing the sequence of the ends of the BamHI
fragments to the sequence of random 1-kb subclones selected for
containing the BamHI restriction sites. To generate random
subclones of PAC 152M5, DNA was sheared by sonication, the fraction
around 1 kb was gel-purified (Qiaquick Gel Extraction; Qiagen, Hilden,
Germany), blunted, and ligated in pUC18, and transformed
into XL1-blue cells.
Reverse transcriptase (RT)-PCR and cloning.
Total RNA was extracted from tumor-infiltrated gastrointestinal and
splenic tissue using the Trizol Reagent (Life Technologies, Inc,
Rockville, MD). First-strand cDNA was reverse transcribed from 1 µg
of total RNA with Murine Moloney Leukemia Virus reverse transcriptase
(Life Technologies, Inc) according to standard procedures using a
random hexamer primer. After size fractionation on Microspin S-400 HR
columns (Pharmacia Biotech), a poly-A tail was added to the first
strand cDNA with dATP and terminal deoxynucleotidyl transferase
(Boehringer Mannheim, Mannheim, Germany). Double-stranded cDNA was then
generated using standard procedures with primer R2T8 (5'
CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTT 3'). Nested PCR was
performed using respectively primers MLTr1 (5'
CCTTCTGCAACTTCATCCAG 3') and MLTr2 (5' ATGGATTTGGAGCATCAACG
3') in combination with primers R2F1 (5' CCAGTGAGCAGAGTGACG 3') and
R2F2 (5' GAGGACTCGAGCTCAAGC 3'). Amplification products were cloned in
pGEM T-easy (Promega, Madison, WI). The API2-MLT fusion was
confirmed by RT-PCR on patient's RNA using the Titan RT-PCR system
(Boehringer Mannheim) with primers API2f1 (5'
CCAAGTGGTTTCCAAGGTGT 3') and MLTr2 and by sequence analysis of
the cloned amplification products.
The MLT consensus cDNA sequence was determined by performing
RACE (rapid amplification of cDNA ends) experiments on cDNA of patient
1. Several overlapping clones were analyzed to obtain the 5' and 3'
sequences of MLT (GenBank Accession No. AF130356).
| |
RESULTS |
FISH characterization of the 11q21 and 18q21 translocation.
Twelve YACs derived from the chromosomal region 11q21-22.3 and the
MLL probe were hybridized to metaphase spreads of case 1. Figure 1 shows their relative position in
relation to the t(11;18) breakpoints. The hybridization signals of YACs
906C5 and 921F3 were split by the translocation. Subsequent analysis
showed that YACs 906C5 and 921F3 also spanned the translocation
breakpoint of case 2.
View larger version (21K):
[in this window]
[in a new window]
| Fig 1.
Cytogenetics and YAC characterization of the t(11;18).
The YAC clones used in FISH analysis are indicated to the right of the
ideogram of each chromosome. The breakpoint is indicated by an arrow;
the YAC clones that yield split signals in both cases are in gray.
|
|
From the 9 YACs assigned to 18q21.1-22, 5 hybridized centromeric and 2 (including A153A6 containing the BCL2 gene) telomeric to the
translocation breakpoint (see Fig 1). The hybridization signals of YACs
949B6 and 817C6 were split by the translocation in both cases. YAC
949B6 contains three ordered STSs
(cen D18S887D18S1055D18S1129tel). FISH experiments with PAC
clones isolated for these STSs positioned the chromosome 18 breakpoint
in case 1 between D18S1055 and D18S1129. A walking strategy initiated
from both markers led to the identification of PAC 205G9 and 152M5,
which were shown to be split by the t(11;18) in both cases. The
breakpoints were further narrowed down by FISH analysis with
BamHI fragments subcloned from PAC 152M5 (Fig
2A). In case 1, fragment H was split by the
translocation, whereas in case 2 the breakpoint could be mapped to
fragment D (Fig 3).
View larger version (35K):
[in this window]
[in a new window]
| Fig 2.
Molecular structure of the t(11;18). The genomic
structure of the t(11;18) is shown in (A). In the center the MLT gene
is shown as the darkly shaded area on the normal 18q; API2 and
MMP20 are shown, respectively, as an open rectangle and a light
gray rectangle on the normal 11q (not drawn to scale). Below each gene
the PAC isolated for this gene is shown. For PAC 152M5 the position of
the different BamHI fragments used for FISH experiments are
indicated. On top the rearrangement in case 1 is illustrated: the
der(11) fuses the 5' end of API2 to the 3' end of MLT,
while on the der(18), as a result from the cryptic deletion of
chromosome 11, the 5' end of MLT is fused to the 5' end of
MMP20. The transcriptional orientation of each gene is
indicated by an arrow below each chromosome, showing that on the
der(18) MLT and MMP20 do have an opposite transcriptional orientation.
The genomic fusion fragments that were cloned from, respectively, the
der(11) and the der(18) are indicated by the double lines. Below, the
rearrangement of case 2 is shown: the der(11) fuses 5' API2 to
3' MLT. The breakpoint in API2 is identical to the one
in case 1; the breakpoint in MLT occurred upstream of the
breakpoint in case 1 (see 2B). FISH experiments suggest that the
der(18) is the balanced reciprocal of the der(11). The localization of
all breakpoints is indicated on the normal chromosomes by open
triangles. (B) The structure of the different fusion cDNAs. On top the
structure of API2 is shown with three aminoterminal BIR domains
separated from the carboxyterminal RING domain by a CARD domain. The
API2 cDNA is truncated after the third BIR domain and fused in
frame to MLT. As a result of the heterogeneity of the genomic
breakpoints in case 2, 582 additional nucleotides, encoding two Ig-like
C2 domains of MLT, are present in this fusion. An Ig gamma
VDJ4-like sequence in MLT is shown by a cross-hatched box. The
sequence and the translation of the different junction fragments is
shown underneath each cDNA.
|
|
View larger version (35K):
[in this window]
[in a new window]
| Fig 3.
FISH mapping of the chromosome 11 and 18 breakpoints. (A)
The hybridization signals of YAC 921F3 (green) and the BamHI
fragment H of PAC 152M5 (red) are both split by the translocation in
case 1. Signals of both probes are visible on the derivative
chromosomes 11 and 18. (B) In case 2, fragment D of PAC 152M5 (red)
shows split signals. The centromeric probes for chromosome 11 and 18 appear in green. (C) In case 1, PAC 532O24 (green) is seen on the
normal chromosome 11 and on the derivative chromosome 11 (C), whereas
this probe is split by the translocation in case 2 (D). The signals of
the centromeric probes are shown in red.
|
|
Cloning of the fusion genes.
To identify genes on chromosome 18q in the vicinity of the breakpoints,
the sequences derived from short random subclones from the
BamHI fragments D, B, H, and F were compared with the nucleotide databases. Subclone F24, mapping telomeric to the
breakpoint, contained a 178-bp fragment identical to a single EST
(IMAGE cDNA clone 1420842, GenBank Accession No. AA826328) that
resembles a hypothetical Caenorhabditis elegans gene (F22D3.6,
GenBank Accession No. U28993). The presence of canonical 5' and 3'
splice sequences flanking the 178 bp suggested that this represented an
exon of a human gene. A second exon with similarity to the same C
elegans gene product was predicted by computer analysis of subclone
B9, located centromerically to the breakpoint in case 1. RT-PCR
experiments confirmed that both exons were part of the same human
transcript and indicated the disruption of this gene (named MLT
for  ALT- ymphoma associated  ranslocation) by the
translocation in case 1. Sequence analysis of these RT-PCR products and
of 5' and 3' RACE products yielded a consensus MLT cDNA
sequence of 2,491 bp (GenBank Accession No. AF130356). The first ATG
start codon at bp 113 precedes an open reading frame of 2,184 bp, which
encodes a protein of 729 amino acids. A transcript of approximately
3,000 bp was detected upon Northern analysis (data not shown), which
suggests additional 5' and/or 3' MLT sequences.
To identify an eventual chromosome 11 fusion partner for MLT,
cDNA transcribed from RNA of case 1 was then used in 5' RACE experiments with two nested primers (MLTr1 and r2) derived from MLT sequences telomeric to the breakpoint. The amplification
products were cloned and eight clones with an average insert length of 800 bp were sequenced. Five clones contained uniquely MLT
sequences. The three remaining clones showed a fusion of MLT
sequences to the 5' part of the API2 gene, an inhibitor of
apoptosis mapped to chromosome 11q22. The API2 protein contains
three copies of the BIR at its amino-terminus and a caspase recruitment
domain or CARD27 followed by a carboxy-terminal zinc
binding RING finger domain.28 The chimeric API2-MLT
transcript contains bp 1-1446 of API2 (GenBank Accession No.
L49432) fused in frame with bp 786 of the MLT cDNA (GenBank
Accession No. AF130356). At the protein level the first 441 amino acids
(AA) of API2, containing the three BIR domains,
are fused to the carboxy-terminal part of MLT (Fig 2B).
Primers derived from the API2 and MLT cDNA sequences
(M&M) were then used to confirm this fusion directly by RT-PCR. An
amplification product with the expected size (445 bp) and sequence was
obtained for patient 1, confirming the existence of the chimeric
API2-MLT transcript. In contrast, using the same primers and
cDNA from patient 2, a 1,000-bp RT-PCR product was obtained, with again an API2-MLT fusion with a continuous open reading
frame. The breakpoint in the API2 gene occurred at the same
position as described for patient 1. However, the chimeric cDNA
contained an additional 582-bp MLT sequence in agreement with
the more centromeric localization of the 18q breakpoint in this case as
defined by FISH (Fig 2). The consensus cDNA sequences for both
API2/MLT fusions are shown in Fig
4.
View larger version (91K):
[in this window]
[in a new window]
| Fig 4.
Sequence of the API2-MLT chimeric cDNA. The 5'
API2 cDNA sequence (bp 1-1446 according to
GenBank Accession No. L49432) is shown in italic, the
additional 582 bp of MLT fused to API2 in case 2 are
shown in bold. The inframe API2-MLT fusion generates at bp
1446-1448 an AAT (N) for case 1, an AGA (R) in case 2. The three BIR
domains of API2 and the two Ig-like C2 domains (Ig-I C2) and
the domain similar to a mouse Ig  chain (VDJ4, GenBank Accession No.
M13070) of MLT are underlined. The sequence has been deposited
in GenBank under Accession No. AF123094.
|
|
Absence of a reciprocal MLT-API2 transcript.
To analyze the genomic events leading to the expression of a chimeric
API2-MLT transcript, we cloned the genomic breakpoints of case
1. To this aim, an 8-kb EcoRI fragment spanning the breakpoint was subcloned from fragment H. Southern hybridization with the 5'- and
the 3'-end-fragment of this clone detected rearranged EcoRI
fragments of, respectively, 7 kb containing the 5'-end of MLT
and 10 kb containing the 3'-end of MLT (Fig
5B). Long-distance inverse
PCR29 was used to amplify the genomic chromosome 11 sequences present in both chimeric fragments, and PAC clones
corresponding to these chromosome 11 sequences were isolated. To our
surprise, two independent sets of PAC clones were obtained. PAC 532O24
was isolated using chromosome 11 sequences derived from the der(11). This PAC was shown to contain the 5' end of API2. FISH
experiments with this PAC yielded signals on the normal 11 and the
der(11) of case 1. PAC 49A7, obtained with chromosome 11 sequences
derived from the der(18), however, did not contain API2, and
sequencing showed that this clone contained the MMP20 gene
instead (Fig 2). FISH experiments with this clone on case 1 resulted in
fluorescent signals on the normal 11 and the der(18). Taken together,
these data show that in case 1 the t(11;18) is associated with a
cryptic deletion of chromosome 11 sequences distal to the breakpoint, resulting in the absence of an MLT-API2 fusion. These data are in agreement with a localization of the MMP gene cluster
telomeric to API2. Because the exact distance is not known, we
cannot estimate the size of the deletion. Sequencing of the der(18)
fusion fragment showed that the MLT gene and the MMP20
gene are on opposite strands of the genome, thereby excluding the
expression of an MLT-MMP20 transcript. FISH experiments on case
2 detected a signal for the PAC 532O24 on the normal 11, the der(11),
and the der(18) consistent with the occurrence of a balanced
translocation and a breakpoint in API2. PAC 49A7 yielded
fluorescent signals on the normal 11 and the der(18) consistent with
the localization of the MMP20 gene distally to API2.
View larger version (42K):
[in this window]
[in a new window]
| Fig 5.
Molecular characterization of the fusions. (A) The
API2-MLT products obtained by RT-PCR from case 1 (lane 1) and
case 2 (lane 2). Size markers (M) are shown on the left, the negative
control ( ) is shown on the right. (B) The Southern blot detecting
the rearranged EcoRI fragments of case 1. The probes were
derived from an 8-kb EcoRI clone from chromosome 18 spanning
the breakpoint (see Fig 2A, center). Lane 1 shows hybridization with
the probe derived proximally to the breakpoint, lane 2 shows
hybridization with the probe derived distally to the breakpoint. The
arrow shows the normal 8-kb EcoRI fragment, the arrowheads show
the chimeric fragments of, respectively, 7 kb, derived from the der(18)
and 10 kb, originating from the der(11).
|
|
| |
DISCUSSION |
We show here that the t(11;18)(q21;q21) associated with extranodal
marginal zone B-cell lymphomas of the MALT type results in the
expression of a chimeric transcript fusing 5'-API2 on
chromosome 11 to 3'-MLT on chromosome 18.
Several observations point to the API2-MLT fusion as the
oncogenic lesion underlying the t(11;18). The chimeric cDNA was cloned from two independent tumors. In one case the genomic breakpoints were
also cloned and the structure of both genes and the localization of the
breakpoints is in agreement with the expression of the fusion
transcript. The cryptic deletion of the 3' part of API-2 in case 1 precludes the expression of a reciprocal MLT-API2 transcript in
this case. As a result of the deletion, the 5'-end of the MLT gene is fused to the 5'-end of the MMP20 gene on the der(18). Because both genes are present on opposite strands of the DNA, no
MLT-MMP20 transcript is expressed. Furthermore, FISH
experiments with PACs for, respectively, MLT, API2, and
MMP20 clearly suggest that in case 2 a balanced translocation
occurred not involving a break in the MMP20 gene, further
arguing against any significance of the MLT-MMP20 fusion.
API2 belongs to the family of inhibitor of apoptosis proteins
(IAP), which play an evolutionary conserved role in regulating programmed cell death in diverse species.30 The IAP
genes were first identified in baculoviruses in which they demonstrated
an ability to suppress the host cell apoptotic response to viral infection.31 Subsequently, five human IAP relatives
have been described: NIAP, API1 (also known as cIAP1,
HIAP2, MIHB), API2 (cIAP2, HIAP1, MIHC),
XIAP-hILP, and
survivin.19-21,32-35 The common structural features of all IAP family members is a motif termed BIR
occurring in one to three copies, a caspase recruitment domain or
CARD27 located between the BIR domain(s), and a
carboxy-terminal zinc binding RING finger domain28 that is
present in all IAPs with the exception of NIAP and
survivin. The human API1 and API2 proteins were
originally identified as proteins that are recruited to the cytosolic
domain of the tumor necrosis factor (TNF) receptor II via their
association with the TNF-associated factor (TRAF) proteins, TRAF-1 and
TRAF-2,19 and have been subsequently shown to suppress
different apoptotic pathways by inhibiting distinct caspases, such as
caspase-3, caspase-7, and pro-caspase-9.33,36
The function of the novel MLT gene located on chromosome 18q21
is not yet known. Its closest homologue is a hypothetical C elegans gene. The carboxy-terminal part of this gene is
characterized by the presence of two Ig-like C2-type domains and a
domain similar to the murine Ig chain VDJ4 sequence (GenBank
Accession No. M13070). The C2 domains are only present in the longer
fusion cDNA of case 2 and, thus, probably have no functional
significance in the tumor.
The molecular mechanism of action of the API2-MLT fusion
remains to be elucidated. We hypothesize that the fusion protein resulting from the t(11;18) may lead to increased inhibition of apoptosis and, thereby, confer a survival advantage to MALT lymphomas and allow antigen-independent proliferation. Indeed, MALT lymphomas have been shown to display low levels of apoptosis37 and to escape from FAS-mediated apoptosis.38 The truncation of
API2 after the BIR domains could release their anti-apototic
effects from regulation by the CARD and RING domains. Recent studies
have shown that the BIR domain-containing regions of API1 and
API2 are sufficient for inhibition of caspases and suppression
of apoptosis.33 The BIR domains of one of the
Drosophila homologues (DIAP1) were shown to suppress apoptosis
in the Drosophila eye disk, whereas the full-length protein
exhibited less activity. Moreover, transgenic flies overexpressing the
RING domain alone exhibited increased cell death in the eye, suggesting
that the RING domain may act as a negative regulator of cell death
suppression in some instances.32 On the other hand, a
specific role for the carboxy-terminal MLT domain is suggested
by its consistent presence in the fusion and by the recurrency of the
t(11;18) in MALT lymphoma. It is possible that the presence of the
MLT domain would stabilize the fusion protein, increase its
affinity for protein interaction, or influence its subcellular
localization, thereby modulating its interactions with other proteins.
The mechanism of gene deregulation by the t(11;18) differs from that
seen in most of the B-cell lymphoma-associated translocations, which
involve one of the Ig loci on 14q32, 2p12, or 22q11 and lead to
deregulated expression of the incoming oncogene due to the proximity of
potent B-cell transcriptional enhancers within the Ig
loci.39 In this case, the expression of the fusion gene is
driven from the promoter of its 5' partner, API2. The
observation that API2 mRNA is highly expressed in adult
lymphoid tissues, including spleen, thymus, and peripheral blood
lymphocytes, and also in fetal lung and kidney, is in agreement with
this.20
At the genomic level the rearrangements appear to be heterogeneous. The
breakpoint in MLT occurred in two different introns for both
cases. In the API2 gene the breakpoint occurred in the same
intron for both cases but it was associated with the deletion of the
3'-end of the gene in only one tumor. The cytogenetic analysis of MALT
lymphoma is often hampered by their poor proliferation in vitro.
However, we anticipate that the physical maps and the genomic clones
generated by this work will allow the development of sensitive
interphase FISH assays for this rearrangement. Alternatively, the
fusion mRNA or the fusion protein provide new molecular targets for
diagnosis. The identification and characterization of
API2-MLT-positive neoplasms should indicate whether they
represent a distinct clinicopathological subentity.
| |
ACKNOWLEDGMENT |
We are grateful to Dr G. Verhoef (Department of Hematology, University
of Leuver) and Dr M. Gonzales and Dr T. Flores (Department of
Hematology, University of Salamanca) for providing clinical data. We
thank Riet Somers and Anja Steyls for expert technical assistance.
| |
FOOTNOTES |
Submitted January 18, 1999; accepted March 8, 1999.
J.D. and M.B. contributed equally to the study and should both be
regarded as first authors.
Supported by Grants No. G.0153.96 and G.0377.97 of the Fonds voor
Wetenschappelijk Onderzoek-Vlaanderen (F.W.O.) (P.M.; A.H.) and Grant
No. 70-2175Dil from the Deutsche Krebshilfe/Dr Mildred Scheel Stiftung
für Krebsforschung (J.D.). P.M. is an `onderzoeksdirecteur' and M.B. a `Postdoctoraal onderzoeker' of the `Fonds voor
Wetenschappelijk OnderzoekVlaanderen.'
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Peter Marynen, PhD, Human
Genome Laboratory, Center for Human Genetics and Flanders
Interuniversity Institute for Biotechnology, Herestraat 49, B-3000
Leuven, Belgium; e-mail: Peter.Marynen{at}med.KULeuven.ac.be.
| |
REFERENCES |
1.
Croce CM:
Molecular biology of lymphomas.
Semin Oncol
20:31, 1993[Medline]
[Order article via Infotrieve]
2.
Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, DeWolf-Peeters C, Falini B, Gatter KC:
A revised European-American classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84:1361, 1994[Free Full Text]
3.
DeWolf-Peeters C, Pittaluga S, Dierlamm J, Wlodarska I, Van-den-Berghe H:
Marginal zone B-cell lymphomas including mucosa-associated lymphoid tissue type lymphoma (MALT), monocytoid B-cell lymphoma and splenic marginal zone cell lymphoma and their relation to the reactive marginal zone.
Leuk Lymphoma
26:467, 1997[Medline]
[Order article via Infotrieve]
4.
Hussell T, Isaacson PG, Crabtree JE, Spencer J:
Helicobacter pylori-specific tumour-infiltrating T cells provide contact dependent help for the growth of malignant B cells in low-grade gastric lymphoma of mucosa-associated lymphoid tissue.
J Pathol
178:122, 1996[Medline]
[Order article via Infotrieve]
5.
Wotherspoon AC, Doglioni C, Diss TC, Pan L, Moschini A, de-Boni M, Isaacson PG:
Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori.
Lancet
342:575, 1993[Medline]
[Order article via Infotrieve]
6.
Bayerdorffer E, Neubauer A, Rudolph B, Thiede C, Lehn N, Eidt S, Stolte M:
Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. MALT Lymphoma Study Group.
Lancet
345:1591, 1995[Medline]
[Order article via Infotrieve]
7.
Qin Y, Greiner A, Trunk MJ, Schmausser B, Ott MM, Muller HH:
Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type B-cell lymphoma.
Blood
86:3528, 1995[Abstract/Free Full Text]
8.
Tierens A, Delabie J, Pittaluga S, Driessen A, De Wolf-Peeters C:
Mutation analysis of the rearranged immunoglobulin heavy chain genes of marginal zone cell lymphomas indicates an origin from different marginal zone B lymphocyte subsets.
Blood
91:2381, 1998[Abstract/Free Full Text]
9.
Auer IA, Gascoyne RD, Connors JM, Cotter FE, Greiner TC, Sanger WG, Horsman DE:
t(11;18)(q21;q21) is the most common translocation in MALT lymphomas.
Ann Oncol
8:979, 1997[Abstract/Free Full Text]
10.
Clark HM, Jones DB, Wright DH:
Cytogenetic and molecular studies of t(14;18) and t(14;19) in nodal and extranodal B-cell lymphoma.
J Pathol
166:129, 1992[Medline]
[Order article via Infotrieve]
11.
Dierlamm J, Pittaluga S, Wlodarska I, Stul M, Thomas J, Boogaerts M, Michaux L, Driessen A, Mecucci C, Cassiman J-J, De Wolf-Peeters C, Van den Berghe H:
Marginal zone B-cell lymphomas of different sites share similar cytogenetic and morphologic features.
Blood
87:299, 1996[Abstract/Free Full Text]
12.
Horsman D, Gascoyne R, Klasa R, Coupland R:
t(11;18)(q21;q21.1): A recurring translocation in lymphomas of mucosa-associated lymphoid tissue (MALT)?
Genes Chromosomes Cancer
4:183, 1992[Medline]
[Order article via Infotrieve]
13.
Kubonishi I, Sugito S, Kobayashi M, Asahi Y, Tsuchiya T, Yamashiro T, Miyoshi I:
A unique chromosome translocation, t(11;12;18)(q13;q13;q12), in primary lung lymphoma.
Cancer Genet Cytogenet
82:54, 1995[Medline]
[Order article via Infotrieve]
14.
Ott G, Katzenberger T, Greiner A, Kalla J, Rosenwald A, Heinrich U, Ott MM, Muller HH:
The t(11;18)(q21;q21) chromosome translocation is a frequent and specific aberration in low-grade but not high-grade malignant non-Hodgkin's lymphomas of the mucosa-associated lymphoid tissue (MALT-) type.
Cancer Res
57:3944, 1997[Abstract/Free Full Text]
15.
Robledo M, Benitez J, Rivas C, Martinez CP:
Cytogenetic study of B-cell lymphoma of mucosa-associated lymphoid tissue (letter).
Cancer Genet Cytogenet
62:208, 1992[Medline]
[Order article via Infotrieve]
16.
Whang PJ, Knutsen T, Jaffe E, Raffeld M, Zhao WP, Duffey P, Longo DL:
Cytogenetic study of two cases with lymphoma of mucosa-associated lymphoid tissue.
Cancer Genet Cytogenet
77:74, 1994[Medline]
[Order article via Infotrieve]
17.
Wotherspoon AC, Pan LX, Diss TC, Isaacson PG:
Cytogenetic study of B-cell lymphoma of mucosa-associated lymphoid tissue.
Cancer Genet Cytogenet
58:35, 1992[Medline]
[Order article via Infotrieve]
18.
Dierlamm J, Michaux L, Wlodarska I, Pittaluga S, Zeller W, Stul M, Criel A, Thomas J, Boogaerts M, Delaere P, Cassiman JJ, DeWolf-Peeters C, Mecucci C, Van den Berghe H:
Trisomy 3 in marginal zone B-cell lymphoma: A study based on cytogenetic analysis and fluorescence in situ hybridization.
Br J Haematol
93:242, 1996[Medline]
[Order article via Infotrieve]
19.
Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV:
The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins.
Cell
83:1243, 1995[Medline]
[Order article via Infotrieve]
20.
Liston P, Roy N, Tamai K, Lefebvre C, Baird S, Cherton HG, Farahani R, McLean M, Ikeda JE, MacKenzie A, Korneluk RG:
Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes.
Nature
379:349, 1996[Medline]
[Order article via Infotrieve]
21.
Uren AG, Pakusch M, Hawkins CJ, Puls KL, Vaux DL:
Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.
Proc Natl Acad Sci USA
93:4974, 1996[Abstract/Free Full Text]
22.
Dierlamm J, Wlodarska I, Michaux L, La Starza R:
Successful use of the same slide for consecutive fluorescence in situ hybridization experiments.
Genes Chromosomes Cancer
16:261, 1996[Medline]
[Order article via Infotrieve]
23.
Chumakov IM, Rigault P, Le G, I, Bellanne CC, Billault A, Guillou S, Soularue P, Guasconi G, Poullier E, Gros I, Belova M, Sambucy J-L, Susini L, Gervy P, Gilbert F, Beaufils S, Bui H, Massart C, De Tand M-F, Dukasz F, Lecoulant S, Ougen P, Perrot V, Saumier M, Soravito C, Bahouayila R, Cohen-Akenine A, Barillot E, Bertrand S, Codani J-J, Caterina D, Georges I, Lacroix B, Lucotte G, Sahbatou M, Schmidt C, Sangouard M, Tubacher E, Dib C, Fauré S, Fizames C, Gyapay G, Millaseau P, Nguyen S, Muselet D, Vignal A, Morissette J, Menninger J, Lieman J, Desai T, Banks A, Bray-Ward P, Ward D, Hudson TJ, Gerety SS, Foote S, Stein L, Page DC, Lander ES, Weissenbach J, Le Paslier D, Cohen D:
A YAC contig map of the human genome.
Nature
377:175, 1995[Medline]
[Order article via Infotrieve]
24.
Poetsch M, Weber MK, Plendl HJ, Grote W, Schlegelberger B:
Detection of the t(14;18) chromosomal translocation by interphase cytogenetics with yeast-artificial-chromosome probes in follicular lymphoma and nonneoplastic lymphoproliferation.
J Clin Oncol
14:963, 1996[Abstract/Free Full Text]
25.
Lengauer C, Green ED, Cremer T:
Fluorescence in situ hybridization of YAC clones after Alu-PCR amplification.
Genomics
13:826, 1992[Medline]
[Order article via Infotrieve]
26.
Riley J, Butler R, Ogilvie D, Finniear R, Jenner D, Powell S, Anand R, Smith JC, Markham AF:
A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones.
Nucleic Acids Res
18:2887, 1990[Abstract/Free Full Text]
27.
Hofmann K, Bucher P, Tschopp J:
The CARD domain: A new apoptotic signalling motif.
Trends Biochem Sci
22:155, 1997[Medline]
[Order article via Infotrieve]
28.
Saurin AJ, Borden KL, Boddy MN, Freemont PS:
Does this have a familiar RING?
Trends Biochem Sci
21:208, 1996[Medline]
[Order article via Infotrieve]
29.
Willis TG, Jadayel DM, Coignet LJ, Abdul RM, Treleaven JG, Catovsky D, Dyer MJ:
Rapid molecular cloning of rearrangements of the IGHJ locus using long-distance inverse polymerase chain reaction.
Blood
90:2456, 1997[Abstract/Free Full Text]
30.
LaCasse EC, Baird S, Korneluk RG, MacKenzie AE:
The inhibitors of apoptosis (IAPs) and their emerging role in cancer.
Oncogene
17:3247, 1998[Medline]
[Order article via Infotrieve]
31.
Clem RJ, Fechheimer M, Miller LK:
Prevention of apoptosis by a baculovirus gene during infection of insect cells.
Science
254:1388, 1991[Abstract/Free Full Text]
32.
Hay BA, Wassarman DA, Rubin GM:
Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death.
Cell
83:1253, 1995[Medline]
[Order article via Infotrieve]
33.
Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC:
The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases.
EMBO J
16:6914, 1997[Medline]
[Order article via Infotrieve]
34.
Duckett CS, Nava VE, Gedrich RW, Clem RJ, Van-Dongen JL, Gilfillan MC, Shiels H, Hardwick JM, Thompson CB:
A conserved family of cellular genes related to the baculovirus iap gene and encoding apoptosis inhibitors.
EMBO J
15:2685, 1996[Medline]
[Order article via Infotrieve]
35.
Ambrosini G, Adida C, Altieri DC:
A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma.
Nat Med
3:917, 1997[Medline]
[Order article via Infotrieve]
36.
Deveraux QL, Roy N, Stennicke HR, Van-Arsdale T, Zhou Q, Srinivasula SM, Alnemri ES, Salvesen GS, Reed JC:
IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases.
EMBO J
17:2215, 1998[Medline]
[Order article via Infotrieve]
37.
Du M, Singh N, Husseuin A, Isaacson PG, Pan L:
Positive correlation between apoptotic and proliferative indices in gastrointestinal lymphomas of mucosa-associated lymphoid tissue (MALT).
J Pathol
178:379, 1996[Medline]
[Order article via Infotrieve]
38.
Greiner A, Seeberger H, Knörr C, Starostik P, Müller-Hermelinck HK:
MALT-type B-cell lymphomas escape the censoring FAS-mediated apoptosis.
Blood
92:484a, 1998 (abstr, suppl 1)
39.
Tycko B, Sklar J:
Chromosomal translocations in lymphoid neoplasia: A reappraisal of the recombinase model.
Cancer Cells
2:1, 1990[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
Translocation t(11;18) absent in early gastric marginal zone B-cell lymphoma of MALT type responding to eradication of Helicobacter pylori infection
- Birgit Alpen, Andreas Neubauer, Judith Dierlamm, Peter Marynen, Christian Thiede, Ekkehard Bayerdörffer, and Manfred Stolte
Blood 2000 95: 4014-4015.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
M. W. Tusche, L. A. Ward, F. Vu, D. McCarthy, M. Quintela-Fandino, J. Ruland, J. L. Gommerman, and T. W. Mak
Differential requirement of MALT1 for BAFF-induced outcomes in B cell subsets
J. Exp. Med.,
November 23, 2009;
206(12):
2671 - 2683.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Vucic and V. M. Dixit
Masking MALT1: the paracaspase's potential for cancer therapy
J. Exp. Med.,
October 26, 2009;
206(11):
2309 - 2312.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Paulli, L. Arcaini, M. Lucioni, E. Boveri, D. Capello, F. Passamonti, M. Merli, S. Rattotti, D. Rossi, R. Riboni, et al.
Subcutaneous 'lipoma-like' B-cell lymphoma associated with HCV infection: a new presentation of primary extranodal marginal zone B-cell lymphoma of MALT
Ann. Onc.,
October 25, 2009;
(2009)
mdp454v1.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. P. Siakantaris, G. A. Pangalis, E. Dimitriadou, F. N. Kontopidou, T. P. Vassilakopoulos, C. Kalpadakis, S. Sachanas, X. Yiakoumis, P. Korkolopoulou, M.-C. Kyrtsonis, et al.
Early-Stage Gastric MALT Lymphoma: Is It a Truly Localized Disease?
Oncologist,
February 1, 2009;
14(2):
148 - 154.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Jaffe, N. L. Harris, H. Stein, and P. G. Isaacson
Classification of lymphoid neoplasms: the microscope as a tool for disease discovery
Blood,
December 1, 2008;
112(12):
4384 - 4399.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Quijano, A. Lopez, A. Rasillo, S. Barrena, M. Luz Sanchez, J. Flores, C. Fernandez, J. M. Sayagues, C. S. Osuna, N. Fernandez, et al.
Association between the proliferative rate of neoplastic B cells, their maturation stage, and underlying cytogenetic abnormalities in B-cell chronic lymphoproliferative disorders: analysis of a series of 432 patients
Blood,
May 15, 2008;
111(10):
5130 - 5141.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Dierlamm, E. M. Murga Penas, S. Bentink, S. Wessendorf, H. Berger, M. Hummel, W. Klapper, D. Lenze, A. Rosenwald, E. Haralambieva, et al.
Gain of chromosome region 18q21 including the MALT1 gene is associated with the activated B-cell-like gene expression subtype and increased BCL2 gene dosage and protein expression in diffuse large B-cell lymphoma
Haematologica,
May 1, 2008;
93(5):
688 - 696.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Streubel, D. Huber, S. Wohrer, A. Chott, and M. Raderer
Reverse Transcription-PCR for t(11;18)(q21;q21) Staging and Monitoring in Mucosa-Associated Lymphoid Tissue Lymphoma.
Clin. Cancer Res.,
October 15, 2006;
12(20):
6023 - 6028.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Varfolomeev, S. M. Wayson, V. M. Dixit, W. J. Fairbrother, and D. Vucic
The Inhibitor of Apoptosis Protein Fusion c-IAP2{middle dot}MALT1 Stimulates NF-{kappa}B Activation Independently of TRAF1 AND TRAF2
J. Biol. Chem.,
September 29, 2006;
281(39):
29022 - 29029.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Dong, Y. Liu, J. Peng, L. Chen, T. Zou, H. Xiao, Z. Liu, W. Li, Y. Bu, and Y. Qi
The IRAK-1-BCL10-MALT1-TRAF6-TAK1 Cascade Mediates Signaling to NF-{kappa}B from Toll-like Receptor 4
J. Biol. Chem.,
September 8, 2006;
281(36):
26029 - 26040.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Y. Yeh, S.-H. Kuo, K.-H. Yeh, S.-E. Chuang, C.-H. Hsu, W. C. Chang, H.-I Lin, M. Gao, and A.-L. Cheng
A Pathway for Tumor Necrosis Factor-{alpha}-induced Bcl10 Nuclear Translocation: Bcl10 IS UP-REGULATED BY NF-{kappa}B AND PHOSPHORYLATED BY Akt1 AND THEN COMPLEXES WITH Bcl3 TO ENTER THE NUCLEUS
J. Biol. Chem.,
January 6, 2006;
281(1):
167 - 175.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nakagawa, Y. Hosokawa, M. Yonezumi, K. Izumiyama, R. Suzuki, S. Tsuzuki, M. Asaka, and M. Seto
MALT1 contains nuclear export signals and regulates cytoplasmic localization of BCL10
Blood,
December 15, 2005;
106(13):
4210 - 4216.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ohmae, Y. Hirata, S. Maeda, W. Shibata, A. Yanai, K. Ogura, H. Yoshida, T. Kawabe, and M. Omata
Helicobacter pylori Activates NF-{kappa}B via the Alternative Pathway in B Lymphocytes
J. Immunol.,
December 1, 2005;
175(11):
7162 - 7169.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Farinha and R. D. Gascoyne
Molecular Pathogenesis of Mucosa-Associated Lymphoid Tissue Lymphoma
J. Clin. Oncol.,
September 10, 2005;
23(26):
6370 - 6378.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P.-h. Tu, C. Giannini, A. R. Judkins, J. M. Schwalb, R. Burack, B. P. O'Neill, A. T. Yachnis, P. C. Burger, B. W. Scheithauer, and A. Perry
Clinicopathologic and Genetic Profile of Intracranial Marginal Zone Lymphoma: A Primary Low-Grade CNS Lymphoma That Mimics Meningioma
J. Clin. Oncol.,
August 20, 2005;
23(24):
5718 - 5727.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Levy, C. Copie-Bergman, C. Gameiro, M.-T. Chaumette, M.-H. Delfau-Larue, C. Haioun, A. Charachon, F. Hemery, P. Gaulard, K. Leroy, et al.
Prognostic Value of Translocation t(11;18) in Tumoral Response of Low-Grade Gastric Lymphoma of Mucosa-Associated Lymphoid Tissue Type to Oral Chemotherapy
J. Clin. Oncol.,
August 1, 2005;
23(22):
5061 - 5066.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Zucca and F. Bertoni
Another Piece of the MALT Lymphomas Jigsaw
J. Clin. Oncol.,
August 1, 2005;
23(22):
4832 - 4834.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Noy, J. Yahalom, L. Zaretsky, I. Brett, and A. D. Zelenetz
Gastric Mucosa-Associated Lymphoid Tissue Lymphoma Detected by Clonotypic Polymerase Chain Reaction Despite Continuous Pathologic Remission Induced by Involved-Field Radiotherapy
J. Clin. Oncol.,
June 1, 2005;
23(16):
3768 - 3772.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G Kocjan
BEST PRACTICE No 185 Cytological and molecular diagnosis of lymphoma
J. Clin. Pathol.,
June 1, 2005;
58(6):
561 - 567.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Lumbroso-Le Rouic, A. Vincent-Salomon, L. Desjardins, T. J. Molina, R. Dendale, G. Des Guetz, and D. Decaudin
Consecutive Conjunctival Melanoma and Extranodal Marginal Zone B-Cell Lymphoma of MALT Type in an Adult Patient
Arch Ophthalmol,
March 1, 2005;
123(3):
397 - 399.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Stoffel, M. Chaurushiya, B. Singh, and A. J. Levine
Activation of NF-{kappa}B and inhibition of p53-mediated apoptosis by API2/mucosa-associated lymphoid tissue 1 fusions promote oncogenesis
PNAS,
June 15, 2004;
101(24):
9079 - 9084.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. T. Lynch and M. Gadina
Ubiquitination for Activation: New Directions in the NF-{kappa}B Roadmap
Mol. Interv.,
June 1, 2004;
4(3):
144 - 146.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Hosokawa, H. Suzuki, Y. Suzuki, R. Takahashi, and M. Seto
Antiapoptotic Function of Apoptosis Inhibitor 2-MALT1 Fusion Protein Involved in t(11;18)(q21;q21) Mucosa-Associated Lymphoid Tissue Lymphoma
Cancer Res.,
May 15, 2004;
64(10):
3452 - 3457.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Jaffe
Common Threads of Mucosa-Associated Lymphoid Tissue Lymphoma Pathogenesis: From Infection to Translocation
J Natl Cancer Inst,
April 21, 2004;
96(8):
571 - 573.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Wohlfart, D. Sebinger, P. Gruber, J. Buch, D. Polgar, G. Krupitza, M. Rosner, M. Hengstschlager, M. Raderer, A. Chott, et al.
FAS (CD95) Mutations Are Rare in Gastric MALT Lymphoma but Occur More Frequently in Primary Gastric Diffuse Large B-Cell Lymphoma
Am. J. Pathol.,
March 1, 2004;
164(3):
1081 - 1089.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Streubel, D. Huber, S. Wohrer, A. Chott, and M. Raderer
Frequency of Chromosomal Aberrations Involving MALT1 in Mucosa-Associated Lymphoid Tissue Lymphoma in Patients with Sjogren's Syndrome
Clin. Cancer Res.,
January 15, 2004;
10(2):
476 - 480.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. C. Lucas, L. M. McAllister-Lucas, and G. Nunez
NF-{kappa}B signaling in lymphocytes: a new cast of characters
J. Cell Sci.,
January 1, 2004;
117(1):
31 - 39.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Sanchez-Izquierdo, G. Buchonnet, R. Siebert, R. D. Gascoyne, J. Climent, L. Karran, M. Marin, D. Blesa, D. Horsman, A. Rosenwald, et al.
MALT1 is deregulated by both chromosomal translocation and amplification in B-cell non-Hodgkin lymphoma
Blood,
June 1, 2003;
101(11):
4539 - 4546.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Okabe, H. Inagaki, K. Ohshima, T. Yoshino, C. Li, T. Eimoto, R. Ueda, and S. Nakamura
API2-MALT1 Fusion Defines a Distinctive Clinicopathologic Subtype in Pulmonary Extranodal Marginal Zone B-Cell Lymphoma of Mucosa-Associated Lymphoid Tissue
Am. J. Pathol.,
April 1, 2003;
162(4):
1113 - 1122.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Jin, M. Kalkum, M. Overholtzer, A. Stoffel, B. T. Chait, and A. J. Levine
CIAP1 and the serine protease HTRA2 are involved in a novel p53-dependent apoptosis pathway in mammals
Genes & Dev.,
February 1, 2003;
17(3):
359 - 367.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S Nakamura, T Matsumoto, S Nakamura, Y Jo, K Fujisawa, H Suekane, T Yao, M Tsuneyoshi, and M Iida
Chromosomal translocation t(11;18)(q21;q21) in gastrointestinal mucosa associated lymphoid tissue lymphoma
J. Clin. Pathol.,
January 1, 2003;
56(1):
36 - 42.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L Leoncini, S Lazzi, C Bellan, and P Tosi
Cell kinetics and cell cycle regulation in lymphomas
J. Clin. Pathol.,
September 1, 2002;
55(9):
648 - 655.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Mott, J. Schultz, P. Bork, and C. P. Ponting
Predicting Protein Cellular Localization Using a Domain Projection Method
Genome Res.,
August 1, 2002;
12(8):
1168 - 1174.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. D. Remstein, P. J. Kurtin, C. D. James, X.-Y. Wang, R. G. Meyer, and G. W. Dewald
Mucosa-Associated Lymphoid Tissue Lymphomas with t(11;18)(q21;q21) and Mucosa-Associated Lymphoid Tissue Lymphomas with Aneuploidy Develop Along Different Pathogenetic Pathways
Am. J. Pathol.,
July 1, 2002;
161(1):
63 - 71.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. H. Igney and P. H. Krammer
Immune escape of tumors: apoptosis resistance and tumor counterattack
J. Leukoc. Biol.,
June 1, 2002;
71(6):
907 - 920.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M Stolte, E Bayerdorffer, A Morgner, B Alpen, T Wundisch, C Thiede, and A Neubauer
Helicobacter and gastric MALT lymphoma
Gut,
May 1, 2002;
50(90003):
iii19 - 24.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Inagaki, J. K. C. Chan, J. W. M. Ng, M. Okabe, T. Yoshino, M. Okamoto, H. Ogawa, H. Matsushita, T. Yokose, Y. Matsuno, et al.
Primary Thymic Extranodal Marginal-Zone B-Cell Lymphoma of Mucosa-Associated Lymphoid Tissue Type Exhibits Distinctive Clinicopathological and Molecular Features
Am. J. Pathol.,
April 1, 2002;
160(4):
1435 - 1443.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Falini and D. Y. Mason
Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry
Blood,
January 15, 2002;
99(2):
409 - 426.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Starostik, J. Patzner, A. Greiner, S. Schwarz, J. Kalla, G. Ott, and H. K. Muller-Hermelink
Gastric marginal zone B-cell lymphomas of MALT type develop along 2 distinct pathogenetic pathways
Blood,
January 1, 2002;
99(1):
3 - 9.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Hara, N. Nakamura, T. Kuze, Y. Hashimoto, Y. Sasaki, A. Shirakawa, M. Furuta, K. Yago, K. Kato, and M. Abe
Immunoglobulin Heavy Chain Gene Analysis of Ocular Adnexal Extranodal Marginal Zone B-Cell Lymphoma
Invest. Ophthalmol. Vis. Sci.,
October 1, 2001;
42(11):
2450 - 2457.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Imoto, Z.-Q. Yang, A. Pimkhaokham, H. Tsuda, Y. Shimada, M. Imamura, M. Ohki, and J. Inazawa
Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas
Cancer Res.,
September 1, 2001;
61(18):
6629 - 6634.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Liu, H. Ye, A. Dogan, R. Ranaldi, R. A. Hamoudi, I. Bearzi, P. G. Isaacson, and M.-Q. Du
T(11;18)(q21;q21) is associated with advanced mucosa-associated lymphoid tissue lymphoma that expresses nuclear BCL10
Blood,
August 15, 2001;
98(4):
1182 - 1187.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Ma, C. Zhang, K. V. S. Prasad, G. J. Freeman, and S. F. Schlossman
Molecular cloning of Porimin, a novel cell surface receptor mediating oncotic cell death
PNAS,
July 24, 2001;
(2001)
171322898.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Hernandez, J. L. Garcia, N. C. Gutierrez, M. Mollejo, J. A. Martinez-Climent, T. Flores, M. B. Gonzalez, M. A. Piris, and J. F. San Miguel
Novel Genomic Imbalances in B-Cell Splenic Marginal Zone Lymphomas Revealed by Comparative Genomic Hybridization and Cytogenetics
Am. J. Pathol.,
May 1, 2001;
158(5):
1843 - 1850.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Morgner, S. Miehlke, W. Fischbach, W. Schmitt, H. Muller-Hermelink, A. Greiner, C. Thiede, J. Schetelig, A. Neubauer, M. Stolte, et al.
Complete Remission of Primary High-Grade B-Cell Gastric Lymphoma After Cure of Helicobacter pylori Infection
J. Clin. Oncol.,
April 1, 2001;
19(7):
2041 - 2048.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Thiede, T. Wundisch, B. Alpen, B. Neubauer, A. Morgner, M. Schmitz, G. Ehninger, M. Stolte, E. Bayerdorffer, and A. Neubauer
Long-Term Persistence of Monoclonal B Cells After Cure of Helicobacter pylori Infection and Complete Histologic Remission in Gastric Mucosa-Associated Lymphoid Tissue B-Cell Lymphoma
J. Clin. Oncol.,
March 15, 2001;
19(6):
1600 - 1609.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A MORGNER, E BAYERDORFFER, A NEUBAUER, and M STOLTE
Helicobacter pylori associated gastric B cell MALT lymphoma: predictive factors for regression
Gut,
March 1, 2001;
48(3):
290 - 292.
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Inagaki, M. Okabe, M. Seto, S. Nakamura, R. Ueda, and T. Eimoto
API2-MALT1 Fusion Transcripts Involved in Mucosa-Associated Lymphoid Tissue Lymphoma : Multiplex RT-PCR Detection Using Formalin-Fixed Paraffin-Embedded Specimens
Am. J. Pathol.,
February 1, 2001;
158(2):
699 - 706.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J Silke and D. Vaux
Two kinds of BIR-containing protein - inhibitors of apoptosis, or required for mitosis
J. Cell Sci.,
January 5, 2001;
114(10):
1821 - 1827.
[Abstract]
[PDF]
|
|
|
|
|
|
|
N. L. Harris, H. Stein, S. E. Coupland, M. Hummel, R. D. Favera, L. Pasqualucci, and W. C. Chan
New Approaches to Lymphoma Diagnosis
Hematology,
January 1, 2001;
2001(1):
194 - 220.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Cavalli, P. G. Isaacson, R. D. Gascoyne, and E. Zucca
MALT Lymphomas
Hematology,
January 1, 2001;
2001(1):
241 - 258.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. A. Arber
Molecular Diagnostic Approach to Non-Hodgkin's Lymphoma
J. Mol. Diagn.,
November 1, 2000;
2(4):
178 - 190.
[Full Text]
|
|
|
|
|
|
|
K. E. Conway, B. B. McConnell, C. E. Bowring, C. D. Donald, S. T. Warren, and P. M. Vertino
TMS1, a Novel Proapoptotic Caspase Recruitment Domain Protein, Is a Target of Methylation-induced Gene Silencing in Human Breast Cancers
Cancer Res.,
November 1, 2000;
60(22):
6236 - 6242.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. B. McConnell and P. M. Vertino
Activation of a Caspase-9-mediated Apoptotic Pathway by Subcellular Redistribution of the Novel Caspase Recruitment Domain Protein TMS1
Cancer Res.,
November 1, 2000;
60(22):
6243 - 6247.
[PDF]
|
|
|
|
|
|
|
J. Dierlamm, M. Baens, M. Stefanova-Ouzounova, K. Hinz, I. Wlodarska, B. Maes, A. Steyls, A. Driessen, G. Verhoef, P. Gaulard, et al.
Detection of t(11;18)(q21;q21) by interphase fluorescence in situ hybridization using API2 and MLT specific probes
Blood,
September 15, 2000;
96(6):
2215 - 2218.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Zucca, F. Bertoni, E. Roggero, and F. Cavalli
The gastric marginal zone B-cell lymphoma of MALT type
Blood,
July 15, 2000;
96(2):
410 - 419.
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Alpen, A. Neubauer, J. Dierlamm, P. Marynen, C. Thiede, E. Bayerdorffer, and M. Stolte
Translocation t(11;18) absent in early gastric marginal zone B-cell lymphoma of MALT type responding to eradication of Helicobacter pylori infection
Blood,
June 15, 2000;
95(12):
4014 - 4015.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. D. Remstein, C. D. James, and P. J. Kurtin
Incidence and Subtype Specificity of API2-MALT1 Fusion Translocations in Extranodal, Nodal, and Splenic Marginal Zone Lymphomas
Am. J. Pathol.,
April 1, 2000;
156(4):
1183 - 1188.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Baens, B. Maes, A. Steyls, K. Geboes, P. Marynen, and C. De Wolf-Peeters
The Product of the t(11;18), an API2-MLT Fusion, Marks Nearly Half of Gastric MALT Type Lymphomas without Large Cell Proliferation
Am. J. Pathol.,
April 1, 2000;
156(4):
1433 - 1439.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Motegi, M. Yonezumi, H. Suzuki, R. Suzuki, Y. Hosokawa, S. Hosaka, Y. Kodera, Y. Morishima, S. Nakamura, and M. Seto
API2-MALT1 Chimeric Transcripts Involved in Mucosa-Associated Lymphoid Tissue Type Lymphoma Predict Heterogeneous Products
Am. J. Pathol.,
March 1, 2000;
156(3):
807 - 812.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. M. Conway, S. Pollefeyt, J. Cornelissen, I. DeBaere, M. Steiner-Mosonyi, K. Ong, M. Baens, D. Collen, and A. C. Schuh
Three differentially expressed survivin cDNA variants encode proteins with distinct antiapoptotic functions
Blood,
February 15, 2000;
95(4):
1435 - 1442.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Macintyre, D. Willerford, and S. W. Morris
Non-Hodgkin's Lymphoma: Molecular Features of B Cell Lymphoma
Hematology,
January 1, 2000;
2000(1):
180 - 204.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Morgan, Y. Yin, A. D. Borowsky, F. Kuo, N. Nourmand, J. I. Koontz, C. Reynolds, L. Soreng, C. A. Griffin, F. Graeme-Cook, et al.
Breakpoints of the t(11;18)(q21;q21) in Mucosa-associated Lymphoid Tissue (MALT) Lymphoma Lie within or near the Previously Undescribed Gene MALT1 in Chromosome 18
Cancer Res.,
December 1, 1999;
59(24):
6205 - 6213.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rosenwald, G. Ott, S. Stilgenbauer, J. Kalla, M. Bredt, T. Katzenberger, A. Greiner, M. M. Ott, B. Gawin, H. Dohner, et al.
Exclusive Detection of the t(11;18)(q21;q21) in Extranodal Marginal Zone B Cell Lymphomas (MZBL) of MALT Type in Contrast to other MZBL and Extranodal Large B Cell Lymphomas
Am. J. Pathol.,
December 1, 1999;
155(6):
1817 - 1821.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Suzuki, M. Motegi, T. Akagi, Y. Hosokawa, M. Seto;, P. Marynen, and M. Baens
API1-MALT1/MLT Is Involved in Mucosa-Associated Lymphoid Tissue Lymphoma With t(11;18)(q21;q21)
Blood,
November 1, 1999;
94(9):
3270 - 3271.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. C. Lucas, M. Yonezumi, N. Inohara, L. M. McAllister-Lucas, M. E. Abazeed, F. F. Chen, S. Yamaoka, M. Seto, and G. Nunez
Bcl10 and MALT1, Independent Targets of Chromosomal Translocation in MALT Lymphoma, Cooperate in a Novel NF-kappa B Signaling Pathway
J. Biol. Chem.,
May 25, 2001;
276(22):
19012 - 19019.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. J. Clem, T.-T. Sheu, B. W. M. Richter, W.-W. He, N. A. Thornberry, C. S. Duckett, and J. M. Hardwick
c-IAP1 Is Cleaved by Caspases to Produce a Proapoptotic C-terminal Fragment
J. Biol. Chem.,
March 2, 2001;
276(10):
7602 - 7608.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. M. McAllister-Lucas, N. Inohara, P. C. Lucas, J. Ruland, A. Benito, Q. Li, S. Chen, F. F. Chen, S. Yamaoka, I. M. Verma, et al.
Bimp1, a MAGUK Family Member Linking Protein Kinase C Activation to Bcl10-mediated NF-kappa B Induction
J. Biol. Chem.,
August 10, 2001;
276(33):
30589 - 30597.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Ma, C. Zhang, K. V. S. Prasad, G. J. Freeman, and S. F. Schlossman
Molecular cloning of Porimin, a novel cell surface receptor mediating oncotic cell death
PNAS,
August 14, 2001;
98(17):
9778 - 9783.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION