|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3610-3616
RAPID COMMUNICATION
By
From Chiron Corporation, Emeryville, CA.
Dendritic cells (DC) take up antigen from the periphery and migrate
to the lymphoid organs where they present the processed antigens to T
cells. The propensity of DC to migrate changes during DC maturation and
is probably dependent on alterations in the expression of chemokine
receptors on the surface of DC. Secondary lymphoid tissue chemokine
(SLC), a recently discovered chemokine for naïve T cells, is
primarily expressed in secondary lymphoid organs and may be important
for colocalizing T cells with other cell types important for T-cell
activation. We show here that SLC is a potent chemokine for mature DC
but does not act on immature DC. SLC also induced calcium mobilization
specifically in mature DC. SLC and Epstein-Barr virus-induced molecule
1 ligand chemokine completely cross-desensitized the calcium response
of each other, indicating that they share similar signaling pathways in
DC. The finding that SLC is a potent chemokine for DC as well as
naïve T cells suggests that it plays a role in colocalizing
these two cell types leading to cognate T-cell activation.
DENDRITIC CELLS (DC) are dedicated
antigen-presenting cells that stimulate T-cell-dependent immune
responses.1,2 This process involves the capture and
processing of antigens by DC in the periphery, their migration to
regional lymph nodes via the lymphatics, and the presentation of the
processed antigens to T cells. Bacterial products such as
lipopolysaccharide (LPS) and inflammatory signals such as tumor
necrosis factor (TNF- SLC/6Ckine/exodus-2/TCA4 is a recently identified CC
chemokine.11-14 This chemokine has been reported to be
chemotactic to lymphocytes but not monocytes or neutrophils. SLC is
primarily expressed in secondary lymphoid tissues such as the lymph
nodes, Peyer's patches, spleen, and lymphatic
endothelium.11,15,16 Based on its preferential chemotactic
activity to naïve T lymphocytes, its expression in the high
endothelial venules (HEV) and T-cell areas within lymphoid
tissues and its ability to stimulate lymphocyte adhesion to ICAM-1, SLC
has been postulated to be a lymphoid tissue homing chemokine for
lymphocytes.15
We report here that SLC is also a potent chemokine for mature DC and
may be an additional cue guiding the migration of DC to secondary
lymphoid organs. Given its chemotactic activity to both mature DC and T
cells, SLC may serve as an important colocalization signal for these
cells during early phases of the cellular immune response.
Chemokines and Antibodies
Generation of DC
Chemotaxis Assays Migration assays were performed as described previously,18 with slight modifications. Briefly, 10,000 to 15,000 cells were added to each of the top chamber of 96-well microchemotaxis plates (101-5 Neuroprobe, Cabin John, MD). Microchemotaxis plates were incubated at 37°C for 2 hours. The number of cells in the bottom chamber was measured using the Cell Proliferation Reagent WST-1 (Roche Diagnostics, Indianapolis, IN) according to manufacturer's protocol. Each measurement was set up in triplicate and the average values and standard deviation were calculated. In some measurements the cells were preincubated with 100 ng/mL of pertussis toxin (PT) for 2 hours at 37°C.Calcium Mobilization Cells were incubated at 106 per mL of medium (see above) plus 10 mmol/L HEPES with 2 µmol/L Fluo-3AM (Molecular Probes, Eugene, OR) at 37°C for 30 minutes. Cells were washed and subsequently incubated with 1 µg/mL propidium iodide for 15 minutes at room temperature. Cells were washed again and were resuspended at 4 × 105 per mL in medium with 10 mmol/L HEPES. Fluo-3 fluorescence of viable cells (based on propidium iodide exclusion) was analyzed by flow cytometry.Flow Cytometric Analysis Analysis was performed on a fluorescence-activated cell sorter, FACScan (Becton Dickinson, Franklin Lakes, NJ) and the data acquired to a Macintosh 7100 (Cupertino, CA) running CellQuest v3.1 software. The acquired data was analyzed and displayed using FlowJo (Tree Star Inc, San Carlos, CA).Quantification of RNA Expression by Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and Light Cycler RT-PCR. Total RNA was isolated from cells using Trizol reagent (GIBCO/BRL, Gaithersburg, MD) according to the manufacturer's protocol. After treatment with RNase-free DNase, first-strand cDNA was synthesized by priming with oligo-dT12-18 using SuperScriptII Preamplification System (GIBCO/BRL) following the manufacturer's protocol. After RNaseH treatment, the cDNA was quantitated by spectrophotometric methods. Based on the published human sequences for CCR1-9, CXCR1-5, CX3CR1, and three orphan receptors, PCR oligonucleotides targeted to the regions close to the 3' end of the coding regions with the highest divergence among chemokine receptors were designed. The forward (f ) and reverse (r) primers, the expected fragment size, and the GenBank accession numbers for each gene is indicated as follows. CCR1 (f: TGACTCTGGGGATGCAAC, r: TCCACTCTCGTAGGCTTTCG, 538 bp, L10918). CCR2 (f: CCCTTATTTTCCACGAGGATGG, r: CGCTTGGTGATGTGCTTTCG, 407 bp, U03905). CCR3 (f: TGAGACTGAAGAGTTGTTTG, r: ATTGATAGGAAGAGAGAAGG, 280 bp, U51241). CCR4 (f: CAGCTCCCTGGAAATCAACATTC, r: CAGTCTTGGCAGAGCACAAAAAGG, 369 bp, X85740). CCR5 (f: CCAAAAGCACATTGCCAAACG, r: ACTTGAGTCCGTGTCACAAGCC, 136 bp, X91492). CCR6 (f: ATCCTGCCAGAGCGAAAAGC, r: CATTGTCGTTATCTGCGGTCTCAC, 248 bp, U68032). CCR7 (f: TGCCATCTACAAGATGAGCT, r: GGTGCTACTGGTGATGTTGA, 492 bp, L08176). CCR8 (f: TCTGAAGATGGTGTTCTACA, r: ACTTTTCACAGCTCTCCCTA, 486 bp, U45983). CCR9 (f: GCATGGGACCATTTGGAAGC, r: CAGTCATTTCCTCTTGGGCAGTAAG, 478 bp, Y12815). CXCR1 (f: CCTTCTTCCTTTTCCGCCAG, r: AAGTGTAGGAGGTAACACGATGACG, 512 bp, L19591). CXCR2 (f: CTTTTCCGAAGGACCGTCTACTC, r: TGTGCCCTGAAGAAGAGCCAAC, 545 bp, M73969). CXCR3 (f: AATACAACTTCCCACAGGTG, r: CAAGAGCAGCATCCACATCC, 391 bp, X95876). CXCR4 (f: GCTGTTGGCTGAAAAGGTGGTC, r: CACCTCGCTTTCCTTTGGAGA, 538 bp, X71635). CXCR5 (f: ACGTTGCACCTTCTCCCAAGAG, r: AGAGAGCCATTCAGCTTGCAGG, 299 bp, X68149). Bonzo (f: TTACCATGACGAGGCAATTTCC, r: ATAACTGGAACATGCTGGTGGC, 484 bp, af007545). V28 (f: TGAATGCCTTGGTGACTACCCC, r: GGAGAAATCAACGTGGACTGAGC, 456 bp, U20350). GPR5 (f: CTCCTCAATATGATCTTCTCCAT, r: TCTGCAGAAACAGGGTGAA, 438 bp, L36149). GPR-9-6 (f: GCCATGAGAGCACATACTTG, r: GCAGATGTCAATGTTGGTGGA, 441 bp, U45982). GAPDH primers were from Clontech (Palo Alto, CA) (no. 5406). For each PCR reaction, 0.5 µg of cDNA was used in 25-µL reactions containing 10 mmol/L Tris, 1.5 mmol/L MgCl2, 50 mmol/L KCl, pH 8.3, 1.25 U Taq DNA polymerase (Boehringer Mannheim), 0.2 mmol/L dNTP, and 50 pmol of each primer. PCR reactions were performed at 94°C, 1 minute, 60°C, 1 minute, 72°C, 1 minute for 30 cycles and analyzed on 2% agarose gels. Some PCR reactions were performed with a 1-minute annealing step at 55°C instead of 60°C. The specificity of each pair of primers for their respective gene was confirmed by cloning each of the PCR products into pCR2.1-TOPO (Invitrogen; Carlsbad, CA) and sequence verified (data not shown). Light cycler. Optimal light cycling conditions were used for these semi-quantitative PCR reactions. Each light cycling reaction (10 µL) contained: 50 mmol/L KCl, 10 mmol/L Tris-HCl pH 8.3, 2.5 mmol/L MgCl2, 250 µg/mL bovine serum albumin (BSA), 0.2 mmol/L dNTP, 1U DNA Taq Polymerase, 0.1 pmol of each primer, and 1:5,000 SYBR Green I (Molecular Probes). Four reactions were run for each primer set to establish a concentration curve (250 ng, 125 ng, 62.5 ng, and 31.25 ng cDNA) for dye intercalation calculations. The Light Cycler (Idaho Technology, Idaho Falls, ID) program consisted of one normalization cycle (65°C to 85°C to 95°C, hold 20 seconds), followed by 45 cycles of: denaturation (95°C for 5 seconds), annealing (3°C below Tm for 2 seconds) and extension (72°C for 30 seconds). The 45 cycles are followed by a single final step of: 60°C for 5 seconds, 95°C for 5 seconds, and 32°C for 20 seconds. Each pair of primers have 2°C or less difference in Tm and generated a product within the optimal range (100 to 500 bp) for SYBR Green I dye quantification. The sequences and annealing temperatures of the primers used are: CCR1 (f: CTTTTGGACCCCCTACAATTTGAC, r: AACCCAGCAGAGAGTTCATGCTC, 58°C), CCR2 (f: CTTCGTTGGGGAGAAGTTCAGAAGG, r: TGGAAGGCGTGTTTGTTGAAGTCAC, 62°C), CCR3 (f: TTGGAAATGACTGTGAGCGGAGC, r: TGAGCAAGTGCCTGTGGAAGAAGTG, 62°C), CCR4 (f: TGTTCACTGCTGCCTTAATCCCATC, r: TGGACTGCGTGTAAGATGAGCTGG, 60°C), CCR5 (f: CAGGTTGGACCAAGCTATGCAG, r: GTGGATCGGGTGTAAACTGAGC, 58°C), CCR6 (same as RT-PCR, 60°C), CCR7 (f: TCAACATCACCAGTAGCACCTGTG, r: CAGGTCCTTGAAGAGCTTGAAGAG, 58°C) and actin (f: CTTCCTTCCTGGGCATGGAG, r: GAACTAAGTCATAGTCCGCCTAG, 57°C). Because actin amplifications gave similar profiles for both the immature and mature DC cDNA samples, actin was used as a reference and all CCR samples were evaluated as to their abundance with respect to the actin of that cDNA sample.
Generation of Immature and Mature DC Immature DC were derived from monocytes isolated from human peripheral blood using GM-CSF and IL-4. To generate mature DC, we treated the cells with MCM or TNF- . MCM-treatment induced significant
upregulation of markers associated with DC maturation such as CD86,
CD83, and MHC class II surface expression. The mean fluorescence
channels for DC without or with MCM-treatment were 417 and 3624 for
CD86, 186 and 721 for CD83, 667 and 790 for CD40, 202 and 132 for CD14,
2401 and 2413 for CD1a, and 1242 and 3106 for HLA-DR, respectively.
These cells were also tested in an allogeneic MLR assay and the average
stimulation indices at a DC:T ratio of 1:100 were 17.6 and 47.2 for DC
before and after MCM-treatment, respectively (data not shown).
Therefore, the DC differentiated in this in vitro culture model
resemble their in vivo counterparts by both immunophenotype and function.
SLC and ELC are Chemotactic to Mature DC ELC, a chemokine expressed in secondary lymphoid organs,9,19,20 has previously been shown to be chemotactic for mature DC. SLC is another chemokine expressed in lymphoid tissues previously shown to be chemotactic for naïve T cells. Because CCR7 is a shared receptor for SLC and ELC15,16,21 and is upregulated upon DC maturation,8-10 we tested whether SLC was also chemotactic to mature DC using a Boyden chamber assay. A dose-dependent increase in the migration of MCM-treated (mature) DC in response to both SLC (Fig 1A) and ELC (Fig 1B) was observed. In contrast, mature DC did not respond to RANTES (Fig 1C), a chemokine previously shown to be chemotactic to immature DC.3 Similar results were also obtained with DC that were treated with TNF-
instead of MCM (Fig 1A and B). The migratory response of DC to SLC and
ELC was dependent on the DC maturation stage because immature DC did not respond to either SLC or ELC (Fig 1A and B) but were able to
migrate in response to RANTES (Fig 1C).
Mobilization of Intracellular Calcium by Mature DC in Response to SLC and ELC Because chemokines can cause rapid increases in intracellular calcium in responding cells,22 we next tested whether SLC and ELC induced calcium mobilization in mature and immature DC. SLC and ELC both induced rapid calcium mobilization in mature DC (Fig 2B and C), but not in immature DC (Fig 2A). In contrast, RANTES triggered a rapid calcium response in immature DC (Fig 2A), but not in mature DC (Fig 2B and C). These results closely paralleled the differential chemotactic responses observed in migration assays (Fig 1). As with the chemotaxis response, the calcium responses of MCM-treated cells to SLC and ELC were dose dependent (Fig 2D and E).
Cross-Desensitization of SLC and ELC Induced Ca2+ Mobilization We have consistently observed that SLC induced a stronger calcium response in mature DC than ELC at equivalent doses (Fig 2). Also, SLC-induced migration of mature DC has an ED50 of 6 ng/mL while that for ELC was 35 ng/mL (Fig 1A and B). Taken together, these observations suggested that SLC from the vendor has a higher specific activity than ELC. Indeed, pretreatment of DC with 100 ng/mL of SLC was sufficient to completely inhibit the calcium response to 500 ng/mL of ELC (Fig 2F). Conversely, pretreatment with 500 ng/mL of ELC abrogated most of the SLC-induced calcium response (Fig 2G). It has previously been shown in CCR7-transfected cells that SLC and ELC can cross-desensitize each other in calcium mobilization.16,21 These results indicated that SLC and ELC share similar signaling pathways in DC. It was recently reported that mature DC produce ELC in an autocrine fashion.10 Therefore, we also examined the mRNA expression of SLC in our immature and mature DC by RT-PCR but did not find either cell population to express SLC mRNA (data not shown).Chemokine Receptor mRNA Expression Before and After MCM-Treatment The upregulation of CCR7 upon DC maturation8,9 originally prompted our investigation and led to our identification of SLC as a chemokine for mature DC. Given the usefulness of chemokine receptor upregulation as an indicator, a comprehensive survey of chemokine receptor expression on DC before and after MCM-treatment was performed. Significant increases in mRNA expression of CCR4, CCR7, and CXCR5/BLR1, as well as decreases in CCR1, CCR5, and CXCR2 were observed upon DC maturation (Fig 3). CXCR1 expression was also consistently reduced upon MCM-treatment, despite a low basal level. A slight decrease in CCR2 and a slight increase in CCR8 were also observed, but no significant changes for CCR3, CCR6, CCR9, CXCR3, and CXCR4 were detected. No message for the orphan receptor GPR-9-6 was detected and there were no differences in the expression levels of CX3CR1, Bonzo, and GPR5 in mature and immature DC (data not shown). To confirm the validity of the semi-quantitative RT-PCR results, the expression levels of receptors reportedly involved in the binding of RANTES, ELC, and SLC (CCR1, 3-7) were examined using the Light Cycler, another semi-quantitative PCR method. As shown in Table 1, the quantitative data from the Light Cycler closely parallel the trends observed with the results from agarose gel analysis (Fig 3).
We thank Tim Brown and Marty Giedlin for our access to the FACS facility, and Mary Ellen Hammond, Gina Lapointe, Christoph Reinhard, and Mercedita Del Rosario for helpful advice on setting up the chemotaxis assays. We also thank Marty Giedlin and Xavier Paliard for critical reading of the manuscript, and Lucy Tang and M. Dee Gunn for helpful discussions.
Submitted December 23, 1998; accepted March 10, 1999.
V.W.F.C. and S.K. contributed equally to this article.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
Address reprint requests to Lewis T. Williams, MD, PhD, Chiron Corporation, 4.6, 4560 Horton St, Emeryville, CA 94608; e-mail: rusty_williams{at}cc.chiron.com.
1. Banchereau J, Steinman RM: Dendritic cells and the control of immunity. Nature 392:245, 1998[Medline] [Order article via Infotrieve]
2.
Hart DNJ:
Dendritic cells: Unique leukocyte populations which control the primary immune response.
Blood
90:3245, 1997 3. Sozzani S, Sallusto F, Luini W, Zhou D, Piemonti L, Allavena P, Van Damme J, Valitutti S, Lanzavecchia A, Mantovani A: Migration of dendritic cells in response to formyl peptides, C5a, and a distinct set of chemokines. J Immunol 155:3292, 1995[Abstract] 4. Morelli A, Larregina A, Chuluyan I, Kolkowski E, Fainboim L: Expression and modulation of C5a receptor (CD88) on skin dendritic cells. Chemotactic effect of C5a on skin migratory dendritic cells. Immunology 89:126, 1996[Medline] [Order article via Infotrieve] 5. Xu LL, Warren MK, Rose WL, Gong W, Wang JM: Human recombinant monocyte chemotactic protein and other C-C chemokines bind and induce directional migration of dendritic cells in vitro. J Leukoc Biol 60:365, 1996[Abstract] 6. Sozzani S, Luini W, Borsatti A, Polentarutti N, Zhou D, Piemonti L, D'Amico G, Power CA, Wells TN, Gobbi M, Allavena P, Mantovani A: Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines. J Immunol 159:1993, 1997[Abstract]
7.
Godiska R, Chantry D, Raport CJ, Sozzani S, Allavena P, Leviten D, Mantovani A, Gray PW:
Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells.
J Exp Med
185:1595, 1997
8.
Sozzani S, Allavena P, D'Amico G, Luini W, Bianchi G, Kataura M, Imai T, Yoshie O, Bonecchi R, Mantovani A:
Differential regulation of chemokine receptors during dendritic cell maturation: A model for their trafficking properties.
J Immunol
161:1083, 1998
9.
Dieu MC, Vanbervliet B, Vicari A, Bridon JM, Oldham E, Ait-Yahia S, Briere F, Zlotnik A, Lebecque S, Caux C:
Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites.
J Exp Med
188:373, 1998 10. Sallusto F, Schaerli P, Loetscher P, Schaniel C, Lenig D, Mackay CR, Qin S, Lanzavecchia A: Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur J Immunol 28:2760, 1998[Medline] [Order article via Infotrieve]
11.
Nagira M, Imai T, Hieshima K, Kusuda J, Ridanpaa M, Takagi S, Nishimura M, Kakizaki M, Nomiyama H, Yoshie O:
Molecular cloning of a novel human CC chemokine secondary lymphoid-tissue chemokine that is a potent chemoattractant for lymphocytes and mapped to chromosome 9p13.
J Biol Chem
272:19518, 1997 12. Hromas R, Kim C, Klemsz M, Krathwohl M, Fife K, Cooper S, Schnizlein-Bick C, Broxmeyer H: Isolation and characterization of Exodus-2, a novel C-C chemokine with a unique 37-amino acid carboxyl-terminal extension. J Immunol 159:2554, 1997[Abstract] 13. Hedrick J, Zlotnik A: Identification and characterization of a novel beta chemokine containing six conserved cysteines. J Immunol 159:1589, 1997[Abstract] 14. Tanabe S, Lu Z, Luo Y, Quackenbush E, Berman M, Collins-Racie L, Mi S, Reilly C, Lo D, Jacobs K, Dorf M: Identification of a new mouse beta-chemokine, thymus-derived chemotactic agent 4, with activity on T lymphocytes and mesangial cells. J Immunol 159:5671, 1997[Abstract]
15.
Gunn M, Tangemann K, Tam C, Cyster J, Rosen S, Williams L:
A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes.
Proc Natl Acad Sci USA
95:258, 1998 16. Willimann K, Legler DF, Loetscher M, Roos RS, Delgado MB, Clark-Lewis I, Baggiolini M, Moser B: The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7. Eur J Immunol 28:2025, 1998[Medline] [Order article via Infotrieve] 17. Bender A, Sapp M, Schuler G, Steinman RM, Bhardwaj N: Improved methods for the generation of dendritic cells from nonproliferating progenitors in human blood. J Immunol Methods 196:121, 1996[Medline] [Order article via Infotrieve]
18.
Rubbert A, Combadiere C, Ostrowski M, Arthos J, Dybul M, Machado E, Cohn MA, Hoxie JA, Murphy PM, Fauci AS, Weissman D:
Dendritic cells express multiple chemokine receptors used as coreceptors for HIV entry.
J Immunol
160:3933, 1998
19.
Yoshida R, Imai T, Hieshima K, Kusuda J, Baba M, Kitaura M, Nishimura M, Kakizaki M, Nomiyama H, Yoshie O:
Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7.
J Biol Chem
272:13803, 1997 20. Rossi D, Vicari A, Franz-Bacon K, McClanahan T, Zlotnik A: Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3alpha and MIP-3beta. J Immunol 158:1033, 1997[Abstract]
21.
Yoshida R, Nagira M, Kitaura M, Imagawa N, Imai T, Yoshie O:
Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7.
J Biol Chem
273:7118, 1998 22. Baggiolini M, Dewald B, Moser B: Human chemokines: an update. Annu Rev Immunol 15:675, 1997[Medline] [Order article via Infotrieve]
23.
Power CA, Church DJ, Meyer A, Alouani S, Proudfoot AE, Clark-Lewis I, Sozzani S, Mantovani A, Wells TN:
Cloning and characterization of a specific receptor for the novel CC chemokine MIP-3alpha from lung dendritic cells.
J Exp Med
186:825, 1997
24.
Greaves DR, Wang W, Dairaghi DJ, Dieu MC, Saint-Vis B, Franz-Bacon K, Rossi D, Caux C, McClanahan T, Gordon S, Zlotnik A, Schall TJ:
CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells.
J Exp Med
186:837, 1997
25.
Imai T, Chantry D, Raport CJ, Wood CL, Nishimura M, Godiska R, Yoshie O, Gray PW:
Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4.
J Biol Chem
273:1764, 1998
26.
Legler DF, Loetscher M, Roos RS, Clark-Lewis I, Baggiolini M, Moser B:
B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5.
J Exp Med
187:655, 1998 27. Gunn MD, Ngo VN, Ansel KM, Ekland EH, Cyster JG, Williams LT: A B-cell- homing chemokine made in lymphoid follicles activates Burkitt's lymphoma receptor-1. Nature 391:799, 1998[Medline] [Order article via Infotrieve] 28. Tang HL, Ngo VN, Cyster JG: ELC and MDC chemokine expression by mouse lymphoid tissue dendritic cells. J Leukoc Biol 64:81, 1998 29. Adema GJ, Hartgers F, Verstraten R, de Vries E, Marland G, Menon S, Foster J, Xu Y, Nooyen P, McClanahan T, Bacon KB, Figdor CG: A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature 387:713, 1997[Medline] [Order article via Infotrieve]
30.
Randolph GJ, Beaulieu S, Lebecque S, Steinman RM, Muller WA:
Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking.
Science
282:480, 1998
31.
Gunn MD, Kyuwa S, Tam C, Kakiuchi T, Matsuzawa A, Williams LT, Nakano H:
Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization.
J Exp Med
189:451, 1999 32. Nakano H, Tamura T, Yoshimoto T, Yagita H, Miyasaka M, Butcher EC, Nariuchi H, Kakiuchi T, Matsuzawa A: Genetic defect in T lymphocyte-specific homing into peripheral lymph nodes. Eur J Immunol 27:215, 1997[Medline] [Order article via Infotrieve]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. Illario, M. L. Giardino-Torchia, U. Sankar, T. J. Ribar, M. Galgani, L. Vitiello, A. M. Masci, F. R. Bertani, E. Ciaglia, D. Astone, et al. Calmodulin-dependent kinase IV links Toll-like receptor 4 signaling with survival pathway of activated dendritic cells Blood, January 15, 2008; 111(2): 723 - 731. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-m. Liang, C.-p. Zhong, R.-x. Sun, B.-b. Liu, C. Huang, J. Qin, S. Zhou, J. Shan, Y.-k. Liu, and S.-l. Ye Local Expression of Secondary Lymphoid Tissue Chemokine Delivered by Adeno-Associated Virus within the Tumor Bed Stimulates Strong Anti-Liver Tumor Immunity J. Virol., September 1, 2007; 81(17): 9502 - 9511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Maeda, H. Matsuyuki, K. Shimano, H. Kataoka, K. Sugahara, and K. Chiba Migration of CD4 T Cells and Dendritic Cells toward Sphingosine 1-Phosphate (S1P) Is Mediated by Different Receptor Subtypes: S1P Regulates the Functions of Murine Mature Dendritic Cells via S1P Receptor Type 3 J. Immunol., March 15, 2007; 178(6): 3437 - 3446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Donaghy, J. Wilkinson, and A. L. Cunningham HIV interactions with dendritic cells: has our focus been too narrow? J. Leukoc. Biol., November 1, 2006; 80(5): 1001 - 1012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Stolk, M. Leon-Ponte, M. Merrill, G. P. Ahern, and P. J. O'Connell IP3Rs are sufficient for dendritic cell Ca2+ signaling in the absence of RyR1 J. Leukoc. Biol., September 1, 2006; 80(3): 651 - 658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Jang, N. Sougawa, T. Tanaka, T. Hirata, T. Hiroi, K. Tohya, Z. Guo, E. Umemoto, Y. Ebisuno, B.-G. Yang, et al. CCR7 Is Critically Important for Migration of Dendritic Cells in Intestinal Lamina Propria to Mesenteric Lymph Nodes J. Immunol., January 15, 2006; 176(2): 803 - 810. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. F. Legler, P. Krause, E. Scandella, E. Singer, and M. Groettrup Prostaglandin E2 Is Generally Required for Human Dendritic Cell Migration and Exerts Its Effect via EP2 and EP4 Receptors J. Immunol., January 15, 2006; 176(2): 966 - 973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. de Noronha, S. Hardy, J. Sinclair, M. P. Blundell, J. Strid, O. Schulz, J. Zwirner, G. E. Jones, D. R. Katz, C. Kinnon, et al. Impaired dendritic-cell homing in vivo in the absence of Wiskott-Aldrich syndrome protein Blood, February 15, 2005; 105(4): 1590 - 1597. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Xiang, N. Mizutani, Y. Luo, C. Chiodoni, H. Zhou, M. Mizutani, Y. Ba, J. C. Becker, and R. A. Reisfeld A DNA Vaccine Targeting Survivin Combines Apoptosis with Suppression of Angiogenesis in Lung Tumor Eradication Cancer Res., January 15, 2005; 65(2): 553 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-F. He, G.-M. Zhang, X.-H. Wang, H. Zhang, Y. Yuan, D. Li, and Z.-H. Feng Blocking Programmed Death-1 Ligand-PD-1 Interactions by Local Gene Therapy Results in Enhancement of Antitumor Effect of Secondary Lymphoid Tissue Chemokine J. Immunol., October 15, 2004; 173(8): 4919 - 4928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-C. Yang, S. Hillinger, K. Riedl, L. Zhang, L. Zhu, M. Huang, K. Atianzar, B. Y. Kuo, B. Gardner, R. K. Batra, et al. Intratumoral Administration of Dendritic Cells Overexpressing CCL21 Generates Systemic Antitumor Responses and Confers Tumor Immunity Clin. Cancer Res., April 15, 2004; 10(8): 2891 - 2901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Colvin, A. E. Morelli, A. J. Logar, A. H. Lau, and A. W. Thomson Comparative evaluation of CC chemokine-induced migration of murine CD8{alpha}+ and CD8{alpha}- dendritic cells and their in vivo trafficking J. Leukoc. Biol., February 1, 2004; 75(2): 275 - 285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Ritter, A. Meissner, J. Ott, and H. Korner Analysis of the maturation process of dendritic cells deficient for TNF and lymphotoxin-{alpha} reveals an essential role for TNF J. Leukoc. Biol., August 1, 2003; 74(2): 216 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. de la Rosa, N. Longo, J. L. Rodriguez-Fernandez, A. Puig-Kroger, A. Pineda, A. L. Corbi, and P. Sanchez-Mateos Migration of human blood dendritic cells across endothelial cell monolayers: adhesion molecules and chemokines involved in subset-specific transmigration J. Leukoc. Biol., May 1, 2003; 73(5): 639 - 649. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. K. Choi, B. A. Fallert, M. A. Murphey-Corb, and T. A. Reinhart Simian immunodeficiency virus dramatically alters expression of homeostatic chemokines and dendritic cell markers during infection in vivo Blood, March 1, 2003; 101(5): 1684 - 1691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Abe, F. O. Yarovinsky, T. Murakami, A. N. Shakhov, A. V. Tumanov, D. Ito, L. N. Drutskaya, K. Pfeffer, D. V. Kuprash, K. L. Komschlies, et al. Distinct contributions of TNF and LT cytokines to the development of dendritic cells in vitro and their recruitment in vivo Blood, February 15, 2003; 101(4): 1477 - 1483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Tolba, W. J. Bowers, J. Muller, V. Housekneckt, R. E. Giuliano, H. J. Federoff, and J. D. Rosenblatt Herpes Simplex Virus (HSV) Amplicon-mediated Codelivery of Secondary Lymphoid Tissue Chemokine and CD40L Results in Augmented Antitumor Activity Cancer Res., November 15, 2002; 62(22): 6545 - 6551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Eo, U. Kumaraguru, and B. T. Rouse Plasmid DNA Encoding CCR7 Ligands Compensate for Dysfunctional CD8+ T Cell Responses by Effects on Dendritic Cells J. Immunol., October 1, 2001; 167(7): 3592 - 3599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sharma, M. Stolina, L. Zhu, Y. Lin, R. Batra, M. Huang, R. Strieter, and S. M. Dubinett Secondary Lymphoid Organ Chemokine Reduces Pulmonary Tumor Burden in Spontaneous Murine Bronchoalveolar Cell Carcinoma Cancer Res., September 1, 2001; 61(17): 6406 - 6412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-A. Kellermann and L. M. McEvoy The Peyer's Patch Microenvironment Suppresses T Cell Responses to Chemokines and Other Stimuli J. Immunol., July 15, 2001; 167(2): 682 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-f. Hsu, P. J. O'Connell, V. A. Klyachko, M. N. Badminton, A. W. Thomson, M. B. Jackson, D. E. Clapham, and G. P. Ahern Fundamental Ca2+ Signaling Mechanisms in Mouse Dendritic Cells: CRAC Is the Major Ca2+ Entry Pathway J. Immunol., May 15, 2001; 166(10): 6126 - 6133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Hjelmström Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines J. Leukoc. Biol., March 1, 2001; 69(3): 331 - 339. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. Sato, H. Kawasaki, H. Nagayama, M. Enomoto, C. Morimoto, K. Tadokoro, T. Juji, and T. A. Takahashi Signaling events following chemokine receptor ligation in human dendritic cells at different developmental stages Int. Immunol., February 1, 2001; 13(2): 167 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nakano and M. D. Gunn Gene Duplications at the Chemokine Locus on Mouse Chromosome 4: Multiple Strain-Specific Haplotypes and the Deletion of Secondary Lymphoid-Organ Chemokine and EBI-1 Ligand Chemokine Genes in the plt Mutation J. Immunol., January 1, 2001; 166(1): 361 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-C. Dieu-Nosjean, C. Massacrier, B. Homey, B. Vanbervliet, J.-J. Pin, A. Vicari, S. Lebecque, C. Dezutter-Dambuyant, D. Schmitt, A. Zlotnik, et al. Macrophage Inflammatory Protein 3{alpha} Is Expressed at Inflamed Epithelial Surfaces and Is the Most Potent Chemokine Known in Attracting Langerhans Cell Precursors J. Exp. Med., September 5, 2000; 192(5): 705 - 718. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Merad, L. Fong, J. Bogenberger, and E. G. Engleman Differentiation of myeloid dendritic cells into CD8alpha -positive dendritic cells in vivo Blood, September 1, 2000; 96(5): 1865 - 1872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sharma, M. Stolina, J. Luo, R. M. Strieter, M. Burdick, L. X. Zhu, R. K. Batra, and S. M. Dubinett Secondary Lymphoid Tissue Chemokine Mediates T Cell-Dependent Antitumor Responses In Vivo J. Immunol., May 1, 2000; 164(9): 4558 - 4563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Serody, E. J. Collins2, R. M. Tisch, J. J. Kuhns, and J. A. Frelinger T Cell Activity After Dendritic Cell Vaccination Is Dependent on Both the Type of Antigen and the Mode of Delivery J. Immunol., May 1, 2000; 164(9): 4961 - 4967. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hirao, N. Onai, K. Hiroishi, S. C. Watkins, K. Matsushima, P. D. Robbins, M. T. Lotze, and H. Tahara CC Chemokine Receptor-7 on Dendritic Cells Is Induced after Interaction with Apoptotic Tumor Cells: Critical Role in Migration from the Tumor Site to Draining Lymph Nodes Cancer Res., April 1, 2000; 60(8): 2209 - 2217. [Abstract] [Full Text]
|
|
|
|
 |
|
 P. Hjelmstrom, J. Fjell, T. Nakagawa, R. Sacca, C. A. Cuff, and N. H. Ruddle Lymphoid Tissue Homing Chemokines Are Expressed in Chronic Inflammation Am. J. Pathol., April 1, 2000; 156(4): 1133 - 1138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Drillenburg and S. T. Pals Cell adhesion receptors in lymphoma dissemination Blood, March 15, 2000; 95(6): 1900 - 1910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sato, H. Kawasaki, H. Nagayama, M. Enomoto, C. Morimoto, K. Tadokoro, T. Juji, and T. A. Takahashi TGF-{beta}1 Reciprocally Controls Chemotaxis of Human Peripheral Blood Monocyte-Derived Dendritic Cells Via Chemokine Receptors J. Immunol., March 1, 2000; 164(5): 2285 - 2295. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Brenner, C. Rossig, U. Sili, J. W. Young, and E. Goulmy Transfusion Medicine: New Clinical Applications of Cellular Immunotherapy Hematology, January 1, 2000; 2000(1): 356 - 375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. G. Cyster Chemokines and Cell Migration in Secondary Lymphoid Organs Science, December 10, 1999; 286(5447): 2098 - 2102. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 1999 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
TOP
ABSTRACT
INTRODUCTION
, MIP-5, and MDC have been reported to induce
the migration of immature DC in vitro.
) or TNF-
(
) compared to untreated immature cells (
), in
response to the indicated concentrations (in ng/mL) of (A) SLC or (B)
ELC. The percent migration (±SE) is based on the number of cells
added to the top chamber. (C) Migration of MCM-treated mature DC or
untreated (immature) DC in response to the indicated concentrations (in
ng/mL) of RANTES. Chemotactic index is the ratio of the number of cells
in the bottom chamber in the test case to the number of cells in the
absence of the chemokine. (D) Preincubation with 100 ng/mL pertussis
toxin (PT) inhibited SLC-induced migration of MCM-treated mature DC.
These results are representative of at least three independent
experiments.
i coupled receptor(s).
) or
treated with MCM (+) from days 5-8. First-strand cDNA were
synthesized and used in semi-quantitative PCR analysis. PCR products
from 30 cycles of amplification were visualized on an
ethidium-bromide-stained 2% agarose gel. Molecular-weight markers (in
kb) are shown to the left of the gels. The annealing temperatures for
all PCR reactions were 55°C except for CCR5, CCR6, CCR9, CXCR3,
CXCR5, CX3CR1, which were at 60°C. These results are
representative of seven or more experiments using three independent
pairs of cDNA.