Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weber, K. S.C.
Right arrow Articles by Weber, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weber, K. S.C.
Right arrow Articles by Weber, C.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 93 No. 11 (June 1), 1999: pp. 3685-3693

Monocyte Arrest and Transmigration on Inflamed Endothelium in Shear Flow Is Inhibited by Adenovirus-Mediated Gene Transfer of Ikappa B-&b.alpha;

By Kim S.C. Weber, Georg Draude, Wolfgang Erl, Rainer de Martin, and Christian Weber

From the Institut für Prophylaxe und Epidemiologie der Kreislaufkrankheiten, Ludwig-Maximilians Universität, München, Germany; the Karolinska Hospital, Centre of Molecular Medicine L8:03, Stockholm, Sweden; and the Vienna International Research Center, Department of Vascular Biology, Vienna, Austria.


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mobilization of nuclear factor-kappa B (NF-kappa B) activates transcription of genes encoding endothelial adhesion molecules and chemokines that contribute to monocyte infiltration critical in atherogenesis. Inhibition of NF-kappa B has been achieved by pharmacological and genetic approaches; however, monocyte interactions with activated endothelium in shear flow following gene transfer of the NF-kappa B inhibitor Ikappa B-alpha have not been studied. We found that overexpression of Ikappa B-alpha in endothelial cells using a recombinant adenovirus prevented tumor necrosis factor-alpha (TNF-alpha )-induced degradation of Ikappa B-alpha and suppressed the upregulation of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), and E-selectin mRNA and surface protein expression and the upregulation of transcripts for the chemokines monocyte chemoattractant protein 1 (MCP-1) and growth-related activity-alpha (GRO-alpha ) by TNF-alpha . This was associated with a reduction in endothelial MCP-1 secretion and GRO-alpha immobilization. Adhesion assays under physiological shear flow conditions showed that firm arrest, spreading, and transmigration of monocytes on TNF-alpha -activated endothelium was markedly inhibited by Ikappa B-alpha overexpression. Inhibition with monoclonal antibodies and peptide antagonists inferred that this was due to reduced expression of Ig integrin ligand as well as of chemokines specifically involved in these events. In contrast, rolling of monocytes was increased by Ikappa B-alpha transfer and was partly mediated by P-selectin; however, it appeared to be unaffected by the inhibition of E-selectin induction. Thus, our data provide novel evidence that selective modulation of NF-kappa B by adenoviral transfer of Ikappa B-alpha impairs the expression of multiple endothelial gene products required for subsequent monocyte arrest and emigration in shear flow and thus for monocyte infiltration in atherosclerotic plaques.
© 1999 by The American Society of Hematology.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MONOCYTE ADHESION and emigration involves sequential and overlapping interactions of signal molecules and is fundamental in the initial pathogenesis and progression of atherosclerosis.1-3 Whereas monocyte rolling on endothelium is mediated by selectins, activation of beta 1 and beta 2 integrins that bind to their endothelial ligands, vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1), respectively, is critical for firm adhesion and transmigration.2,3 The expression of VCAM-1 and ICAM-1 has been demonstrated in coronary atherosclerotic lesions, particularly in areas of neovascularization, and may contribute to leukocyte recruitment.4,5 Moreover, the CC chemokine monocyte chemoattractant protein 1 (MCP-1), which can trigger chemotaxis and extravasation of monocytes via its receptor CCR2, has been detected in atherosclerotic plaques.6-9 In addition, the induction and immobilization of the CXC chemokine growth-related activity-alpha (GRO-alpha ) can induce monocyte adhesion to endothelium stimulated by minimally modified low-density lipoprotein (LDL), implying a role in monocyte recruitment during atherogenesis.10 Inflammatory cytokines, such as tumor necrosis factor-alpha (TNF-alpha ), upregulate the endothelial adhesion molecules ICAM-1, VCAM-1, and E-selectin and the production of chemokines, eg, MCP-1, at the level of gene transcription involving the binding of nuclear factor-kappa B (NF-kappa B) to motifs in the promoter regions.11-14 Activation and nuclear translocation of NF-kappa B occurs in endothelial cells and requires the phosphorylation of its inhibitor Ikappa B-alpha , which is degraded by a proteasome-dependent pathway.15-18

Inhibition of NF-kappa B by increasing levels of Ikappa B-alpha in endothelial cells has been suggested to be of potential use in suppressing the inflammatory response.19-22 Adenovirus-mediated gene transfer may be a potentially specific and effective method of gene delivery into local areas of inflammation, such as atherosclerotic plaques or after balloon angioplasty.23-25 We used an adenoviral vector encoding Ikappa B-alpha to inhibit NF-kappa B activation and found that gene transfer of Ikappa B-alpha in endothelial cells impaired the TNF-alpha -induced upregulation of adhesion molecule and chemokine expression. This was associated with a reduction in firm adhesion and transmigration but not in rolling of monocytes on activated endothelium in shear flow. These data extend the understanding of the mechanisms of action exerted by adenovirus-mediated inhibition of NF-kappa B as a potential therapy in the prevention of atherogenesis and its consequences.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture and reagents.   Human umbilical vein endothelial cells (HUVEC) were used at passages 2 to 4 and grown in low serum PromoCell medium,26 and Mono Mac 6 cells (from Dr H.W.L. Ziegler-Heitbrock, Institut für Immunologie, Munich, Germany) were maintained as described.27,28 Monocytes were isolated from healthy human donors by NycoPrep density gradient centrifugation (Nycomed, Norway) and separated from platelets by multiple low gravity washes, as described.29 This protocol resulted in a purity of greater than 85% monocytes and a minimal contamination with platelets (<5%), as assessed by light scatter, staining for CD14 and P-selectin, and subsequent flow cytometric analysis that showed an overwhelming majority of P-selectin-negative monocytes (data not shown).

The ICAM-1 monoclonal antibody (MoAb) RR1/130 was from Dr R. Rothlein (Boehringer Ingelheim, CT). The beta 2 MoAb TS1/18 was from Dr L.B. Klickstein (Brigham & Women's Hospital, Boston, MA),31 the alpha 4 MoAb HP1/2 from Dr R. Lobb (Biogen, Cambridge, MA),32 and the blocking G1 and nonblocking S12 MoAbs to P-selectin from Dr R. McEver (University of Oklahoma).33,34 The peptide analogues 8-73 GRO-alpha and 9-76 MCP-135,36 were kind gifts from Dr I. Clark-Lewis (University of British Columbia, Vancouver, Canada). MoAbs to VCAM-1, E-selectin, MCP-1, or GRO-alpha and isotype controls were from Canon or R&D Systems (Wiesbaden, Germany) and reagents were from Sigma Chemical Co (Deisenhofen, Germany), unless otherwise stated.

Overexpression of adenovirally encoded Ikappa B-alpha in endothelial cells.   Construction of the adenoviral vector encoding for Ikappa B-alpha (rAd.Ikappa B-alpha ) and infection of endothelial cells were performed as previously described.20 Briefly, confluent HUVEC were washed with phosphate-buffered saline (PBS) and incubated with the adenovirus (multiplicity of infection [moi] of 100) in PBS for 30 minutes at 37°C, washed, and then cultured for 48 hours. Infection with a control adenoviral vector37 encoding green fluorescence protein (rAd.GFP) was performed at an equivalent moi of 100, and effective transduction was confirmed by analyzing GFP expression by flow cytometry, as described.37 Unless otherwise stated, cells were stimulated with TNF-alpha (100 U/mL) for 4 hours. Overexpression of Ikappa B-alpha may induce apoptosis in TNF-alpha -activated endothelial cells by suppressing induction of inhibitor of apoptosis proteins38; however, cell viability was determined to be greater than 95% under all conditions. For Western blot, cells left untreated or activated with TNF-alpha for 1 hour were lysed in sample buffer containing protease inhibitors and lysates were separated by 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred to nitrocellulose membranes and reacted with an MoAb to Ikappa B-alpha (Santa Cruz Biotechnology, Heidelberg, Germany). Blots were developed with chemiluminescence (ECL; Amersham, Braunschweig, Germany).

Reverse transcription-polymerase chain reaction (RT-PCR).   Total RNA was isolated by phenol/chloroform/isoamylalcohol extraction and cDNA was reverse transcribed from 2 µg RNA. PCR was performed and PCR products were analyzed by agarose gel electrophoresis and quantitated by high-performance liquid chromatography (HPLC) as described.26,39 Primer sequences were TTGCAGACCCTGCAGGGAAT (GRO-alpha , sense), TGGATTTGTCACTGTTCAGC (GRO-alpha , antisense), GTCTCTGCAACGCTTCTGTGCC (MCP-1, sense), AGTCG TGTGTCTTGGGTTGTGG (MCP-1, antisense), AGTAATAGTCCTCCTCATCATG (E-selectin, sense), and ACCATCTCAAGTGAAGAAAGAG (E-selectin, antisense) and as published for ICAM-1, VCAM-1, and beta -actin.39

Flow cytometry and quantification of MCP-1 protein.   Confluent HUVEC were trypsinized, washed, and reacted with saturating concentrations of MoAb for 30 minutes on ice, washed, and stained with fluorescein isothiocyanate (FITC)-or phycoerythrin (PE)-conjugated goat antimouse IgG (Boehringer Mannheim, Mannheim, Germany), washed, and analyzed in a FACScan (Becton Dickinson, Heidelberg, Germany).26,39 The concentration of MCP-1 protein present in the HUVEC supernatants was determined using a sandwich enzyme-linked immunosorbent assay (ELISA; R&D Systems) performed according to the manufacturer's protocols.

Monocyte adhesion and transmigration on endothelium in shear flow.   Laminar flow assays were performed as previously described.3,29,40 HUVEC were grown to confluence in 35-mm petri dishes that were assembled as the lower wall in a parallel wall flow chamber and mounted on the stage of an Olympus IMT-2 inverted microscope (Olympus Optical, Hamburg, Germany) with 20× and 40× phase contrast objectives. Monocytes (0.5 × 106/mL) or Mono Mac 6 cells (106/mL) suspended in Hanks' buffered salt solution containing 10 mmol/L HEPES, pH 7.4, 0.5% human serum albumin, and 1 mmol/L Mg2+, 1 mmol/L Ca2+ added shortly before the assay) were kept in a heating block at 37°C during assays and were perfused into the flow chamber at a rate of 1.5 dyn/cm2 for 5 minutes. The number of firmly adherent cells after 5 minutes was quantitated in multiple fields (at least 5 per experiment) by analysis of images recorded with a long integration JVC 3CCD video camera and a JVC SR L 900 E video recorder (JVC, Japan), and expressed as cells per square millimeter. The type of adhesion analyzed was restricted to primary, ie, direct interactions of monocytes with endothelium. Consistent with findings using a similar flow chamber,3 secondary attachment to already adherent monocytes that is mediated by L-selectin and results in the formation of linear strings41-43 occurred only sporadically at 1.5 dyn/cm2, accounting for a very small component of total interactions. The extent of secondary tethers may vary due to differences in the dimension, profile, and other design characteristics of the flow chambers used. The number of cells remaining bound, undergoing shape change, or transmigrating after 5-minute intervals was determined in high power fields, as described,2 and expressed as the percentage of cells that had firmly adhered. As an inverse measure of firm arrest, the number of cells rolling at reduced velocity on endothelium was determined within the last 30 seconds of the 5-minute intervals and was expressed as the percentage of all cells interacting with HUVEC in the field. Pretreatment with MoAbs was performed at 10 µg/mL. Data are expressed as the mean ± SD.

Statistics.   Statistical significance was determined by analysis of variance, and differences with P < .05 were considered to be significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Degradation and adenoviral overexpression of Ikappa B-alpha in activated HUVEC.   To study the effects of Ikappa B-alpha overexpression, HUVEC were infected with a recombinant adenovirus encoding Ikappa B-alpha .20 After 48 hours in culture, cells were challenged with TNF-alpha (100 U/mL) for 1 hour and the expression of Ikappa B-alpha was determined by Western blot. In unstimulated cells, Ikappa B-alpha was observed as a band of 37 kD (Fig 1, lane 1). Treatment of cells with TNF-alpha resulted in a marked decrease in detectable Ikappa B-alpha compared with untreated cells, consistent with the degradation of Ikappa B-alpha (Fig 1, lane 2).17,18 Cells infected with rAd.Ikappa B-alpha expressed substantially more Ikappa B-alpha than untreated cells, indicating the high efficiency of infection and protein expression (Fig 1, lane 3). Stimulation with TNF-alpha after rAd.Ikappa B-alpha infection decreased the expression of Ikappa B-alpha , which, however, remained higher than in uninfected cells (Fig 1, lane 4). This was confirmed by densitometrical analysis (data not shown). These data suggest that overexpression of Ikappa B-alpha prevents a substantial Ikappa B-alpha degradation and NF-kappa B mobilization induced by TNF-alpha .


View larger version (36K):
[in this window]
[in a new window]
 
Fig 1. Expression of Ikappa B-alpha in HUVEC. Confluent HUVEC were left untreated (lanes 1 and 2), infected with rAd.Ikappa B-alpha (moi 100; lanes 3 and 4), and/or stimulated with TNF-alpha for 1 hour (100 U/mL; lanes 2 and 4). Cell lysates were separated by 12.5% SDS-PAGE and Western blot was performed with MoAb to Ikappa B-alpha . Shown is a representative experiment.

Ikappa B-alpha inhibits mRNA transcription of endothelial signal molecules.   Activation of NF-kappa B is involved in upregulating the mRNA transcription of endothelial adhesion molecules and chemokines important in monocyte adhesion and transmigration.11-14,44-46 We used RT-PCR analysis with HPLC quantification to study the effect of Ikappa B-alpha on the induction of mRNA transcripts. Treatment of HUVEC with TNF-alpha (100 U/mL) for 4 hours regulated ICAM-1, VCAM-1, and E-selectin mRNA expression (Fig 2A), whereas overexpression of Ikappa B-alpha resulted in a reduction in mRNA levels after TNF-alpha stimulation (Fig 2A). Similarly, TNF-alpha increased the mRNA transcription of GRO-alpha and MCP-1, whereas infection with rAd.Ikappa B-alpha inhibited these effects (Fig 2B).


View larger version (24K):
[in this window]
[in a new window]
 
Fig 2. Adenoviral Ikappa B-alpha transfer inhibits TNF-alpha -induced endothelial adhesion molecule and chemokine mRNA expression. Cells were left untreated, infected with rAd.Ikappa B-alpha , and/or stimulated with TNF-alpha (100 U/mL) for 4 hours. RT-PCR was performed using specific primers for ICAM-1, VCAM-1, and E-selectin (A); for MCP-1 and GRO-alpha (B); and for beta -actin. Quantification was perfomed by HPLC analysis, and mRNA expression was reported as the percentage of beta -actin serving as an internal standard. Data are the mean ± SD of three separate experiments.

Inhibition of TNF-alpha -induced adhesion molecule expression by Ikappa B-alpha .   We determined whether rAd.Ikappa B-alpha infection impaired the surface expression of endothelial adhesion molecules by flow cytometric analysis. Untreated HUVEC expressed moderate levels of ICAM-1 and low levels of VCAM-1 and E-selectin (Fig 3A). Stimulation with TNF-alpha (100 U/mL for 4 hours) markedly increased the expression of ICAM-1, VCAM-1, and E-selectin (Fig 3B through D). Infection with rAd.Ikappa B-alpha almost completely inhibited the upregulation of adhesion molecules induced by TNF-alpha (Fig 3B through D). Thus, overexpression of Ikappa B-alpha prevented the upregulation of endothelial adhesion molecule surface expression.


View larger version (32K):
[in this window]
[in a new window]
 
Fig 3. Flow cytometric analysis of endothelial adhesion molecule after Ikappa B-alpha overexpression. (A) Untreated HUVEC were stained with MoAbs to ICAM-1 (stippled line), VCAM-1 (dashed line), E-selectin (dotted line), and isotype control (solid line). (B through D) Cells stimulated with TNF-alpha (100 U/mL) for 4 hours were stained with MoAbs (solid line) to ICAM-1 (B), VCAM-1 (C), E-selectin (D), or isotype control (B through D, dotted lines). Cells infected with rAd.Ikappa B-alpha and stimulated with TNF-alpha (100 U/mL for 4 hours) were stained with MoAbs (stippled line) to ICAM-1 (B), VCAM-1 (C), E-selectin (D), or isotype control (B through D, dashed lines). Shown is a representative experiment.

To control for effects of adenoviral infection itself, we infected HUVEC with the control vector rAd.GFP37 encoding GFP at an equivalent moi of 100 under identical conditions. Flow cytometric analysis showed a marked GFP expression in greater than 90% of HUVEC after 48 hours, confirming a high transduction efficiency (Fig 4A). Notably, infection of HUVEC with rAd.GFP under these conditions did not affect the surface expression of ICAM-1 in unstimulated HUVEC (Fig 4B) or in HUVEC stimulated with TNF-alpha (100 U/mL) for 4 hours (Fig 4C).


View larger version (16K):
[in this window]
[in a new window]
 
Fig 4. Flow cytometric analysis of endothelial adhesion molecule after infection with control vector rAd.GFP encoding GFP. (A) The expression of GFP in HUVEC was analyzed by flow cytometry after infection with rAd.GFP (solid line) or no treatment (dotted line) after 48 hours. (B and C) HUVEC infected with or without GFP control adenovirus were stimulated without (B) or with (C) TNF-alpha (100 U/mL) for 4 hours and were stained with MoAb to ICAM-1 (solid or stippled line) or isotype control (dotted or dashed line). Shown are representative histograms.

Effect of Ikappa B-alpha on endothelial secretion of chemokines.   It has been shown that MCP-1 is secreted by endothelium as a soluble protein, whereas GRO-alpha can be immobilized on the endothelial surface.10,47 An ELISA of HUVEC supernatants showed that stimulation with TNF-alpha for 4 hours induced an increase in secretion of MCP-1 protein that was completely prevented by overexpression of Ikappa B-alpha in HUVEC (Fig 5A). To determine the effects of rAd.Ikappa B-alpha on immobilized GRO-alpha , we measured the amount of surface-associated protein by flow cytometric analysis. We found that TNF-alpha stimulation increased the amount of GRO-alpha associated with the endothelial surface that was inhibited by overexpression of Ikappa B-alpha (Fig 5B).


View larger version (27K):
[in this window]
[in a new window]
 
Fig 5. Endothelial production of chemokines. HUVEC were left untreated, were infected with rAd.Ikappa B-alpha and/or stimulated with TNF-alpha (100 U/mL) for 4 hours. (A) Quantification of soluble MCP-1 was performed by ELISA. Data are the mean ± SD of three separate experiments performed in duplicate. (B) Flow cytometric analysis was performed to quantitate the amount of surface-associated GRO-alpha . Data are the mean ± SD of three separate experiments.

Effect of Ikappa B-alpha on monocyte interactions with endothelium in shear flow.   Firm adhesion of monocytes to endothelium under shear flow involves the alpha 4 and beta 2 integrins, known to interact with VCAM-1 and ICAM-1, respectively.2,3 Moreover, chemokines such as IP10, Mig, and eotaxin have been implicated in the arrest of T effector cells and eosinophils in shear flow, respectively.40,48 Recently, we have shown that surface-bound GRO-alpha is involved in monocyte arrest, whereas soluble MCP-1 mediates transmigration of monocytes on activated endothelium in shear flow.49 Hence, we studied the effects of Ikappa B-alpha overexpression on monocyte adhesion to activated endothelium under physiological flow conditions. After 48 hours in culture, HUVEC infected with rAd.Ikappa B-alpha or left untreated were stimulated with TNF-alpha (100 U/mL) for 4 hours and inserted as the bottom wall of a parallel flow chamber. Isolated human blood monocytes or monocytic Mono Mac 6 cells, which express a similar array of adhesion molecules and chemokine receptors,50 were perfused through the chamber at a constant shear rate of 1.5 dyn/cm2. After a 5-minute period of accumulation, the number of Mono Mac 6 cells firmly attached to uninfected HUVEC treated with TNF-alpha was determined to be 198 ± 46 cells/mm2 (Fig 6A). By comparison, overexpression of Ikappa B-alpha in HUVEC before TNF-alpha stimulation resulted in a significant inhibition in the number of cells firmly arrested after 5 minutes (59 ± 22 cells/mm2), whereas infection with the control vector rAd.GFP had no effect and thus did not confound cell arrest (Fig 6A). Because leukocytes can bind to adherent leukocytes via L-selectin,41-43 only direct interactions of monocytes with endothelium were included in this analysis. As described,2 a percentage of firmly attached cells was observed to undergo shape change or spreading and migrate towards interendothelial junctions and transmigrate. On uninfected HUVEC treated with TNF-alpha , 25.0% ± 5.7% of the firmly attached cells were found to undergo a shape change, spreading, or transmigration (Fig 6B). Infection of HUVEC with rAd.Ikappa B-alpha but not with control GFP adenovirus resulted in a clear reduction in the fraction of cells spreading or transmigrating (Fig 6B).


View larger version (36K):
[in this window]
[in a new window]
 
Fig 6. Effects of adenoviral-mediated Ikappa B-alpha expression on firm adhesion, transmigration, and rolling of monocytic cells on endothelial cells under physiological flow. HUVEC grown in 35-mm Petri dishes were left untreated (), were infected with rAd.Ikappa B-alpha (black-square), or were infected with the control vector rAd.GFP encoding GFP (). All cells were stimulated with TNF-alpha (100 U/mL) for 4 hours. Mono Mac 6 cells were perfused at a constant flow rate of 1.5 dyn/cm2. (A) The firm, shear-resistant attachment of monocytes to HUVEC was determined by counting the number of cells firmly attached per field after a 5-minute period. (B) Cells undergoing shape change and spreading or transmigration were counted after 5 minutes and expressed as the percentage of cells initially attached. Data are the mean ± SD of three independent experiments. *P < .05 versus uninfected control.

Analysis of experiments performed with isolated human blood monocytes showed that 110 ± 26 cells/mm2 had firmly attached after a 5-minute period on uninfected and TNF-alpha -treated HUVEC at a shear rate of 1.5 dyn/cm2 (Fig 7A). Of these firmly attached cells, 27.5% ± 4.9% appeared to spread or to transmigrate between endothelial cells (Fig 7B). Consistent with previous results,2,3 a combination of alpha 4 and beta 2 MoAbs markedly reduced firm arrest, as well as spreading and transmigration of monocytes (Fig 7A and B). Similarly, infection of HUVEC with rAd.Ikappa B-alpha significantly inhibited the shear-resistant adhesion of monocytes to TNF-alpha -activated endothelium as compared with uninfected controls (Fig 7A). Subsequently, the percentage of attached cells that underwent spreading or transmigration was lower on HUVEC overexpressing Ikappa B-alpha (Fig 7B). Consistent with recent findings,49 the inhibition with specific peptide antagonists showed that GRO-alpha is involved in monocyte arrest (Fig 7A), whereas MCP-1 contributes to monocyte transmigration on activated endothelium in shear flow (Fig 7B). Control peptides had no effect (data not shown). Preincubation of monocytes with a combination of blocking alpha 4 and beta 2 MoAb in addition to infection of HUVEC with rAd.Ikappa B-alpha resulted in a slightly although not significantly greater inhibition of monocyte arrest and of spreading/transmigration as compared with infection with rAd.Ikappa B-alpha or MoAb treatment alone (Fig 7A and B). Taken together, these data infer that, beyond effects on endothelial Ig integrin ligands, the reduced chemokine expression in rAd.Ikappa B-alpha -infected HUVEC is at least in part responsible for the inhibition of arrest and transmigration.


View larger version (21K):
[in this window]
[in a new window]
 
Fig 7. Effects of adenoviral-mediated Ikappa B-alpha expression on firm arrest, transmigration, and rolling of isolated blood monocytes on endothelial cells under physiological flow conditions. HUVEC were left untreated or were infected with rAd.Ikappa B-alpha and were stimulated with TNF-alpha (100 U/mL) for 4 hours. Monocytes were perfused at a constant flow rate of 1.5 dyn/cm2 after pretreatment with or without MoAbs to alpha 4 and beta 2, 8-73 GRO-alpha , or 9-76 MCP-1 peptide analogues (1 µg/mL each) for 30 minutes on ice before being perfused. (A) The firm attachment of monocytes to HUVEC was determined by counting the number of cells attached per field after a 5-minute period. (B) Cells undergoing spreading or transmigration were counted after 5 minutes and expressed as the percentage of cells initially attached. (C) The number of rolling cells within the field was counted in the last 30 seconds of the 5-minute period and was expressed as the percentage of cells interacting with endothelium. HUVEC were pretreated with a blocking (G1) or nonblocking P-selectin (S12) MoAb for 30 minutes at 37°C. Data are the mean ± SD of at least three independent experiments. *P < .05 versus uninfected control. **P < .05 versus rAd.Ikappa B-alpha -infected HUVEC.

We next investigated the effect of Ikappa B-alpha overexpression on selectin-mediated rolling interactions of monocytes on endothelium. Previous reports have demonstrated that rolling of monocytes on activated endothelium is largely mediated by interactions of L-selectin and P-selectin.2,3 On TNF-alpha -treated HUVEC, the rolling fraction of cells was found to be 21.2% ± 6.1% of cells in the field (Fig 7C). Because initial rolling is rapidly converted into integrin-mediated firm adhesion, cells were pretreated with MoAbs to alpha 4 and beta 2 integrins to inhibit arrest and facilitate analysis of rolling. This resulted in an increase in the rolling fraction of cells, thus serving as an inverse measure of firm arrest. Overexpression of Ikappa B-alpha in HUVEC followed by TNF-alpha stimulation similarly increased the rolling fraction of cells (34.5% ± 5.8% of cells in the field). Preincubation of rAd.Ikappa B-alpha -infected HUVEC with a blocking MoAb to P-selectin caused a clear reduction in the rolling fraction of cells (Fig 7C) and consequently an inhibition in firm arrest (47 ± 14 cells/mm2). In contrast, the nonblocking P-selectin MoAb had no effect on rolling or firm arrest. Thus, these results show that P-selectin is involved in monocyte rolling, a prerequisite for firm adhesion.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We have found that overexpression of the cytoplasmic NF-kappa B inhibitor Ikappa B-alpha suppressed the TNF-alpha -stimulated upregulation of ICAM-1, VCAM-1, and E-selectin and production of GRO-alpha and MCP-1 in endothelial cells. This was associated with a decrease in the adhesion and transmigration but not rolling of monocytes on activated endothelium in physiological flow and expands on previous findings that adenoviral gene transfer of Ikappa B-alpha effectively inhibits NF-kappa B-dependent processes20 in a functionally relevant system. Whereas TNF-alpha stimulation of uninfected HUVEC markedly reduced the levels of Ikappa B-alpha protein, most likely due to its proteolytic degradation,15-18 stimulation of rAd.Ikappa B-alpha -infected cells with TNF-alpha decreased the levels of Ikappa B-alpha that, however, remained higher than in control cells. Ikappa B-alpha expressed by adenoviral gene transfer may be phosphorylated and thus more susceptible to TNF-alpha -induced degradation; however, as observed with LPS stimulation, the overwhelming proportion of Ikappa B-alpha could not be processed.20 In comparison with the adenoviral techniques used here, retrovirus-mediated transfer of wild-type or a truncated form of Ikappa B-alpha did not result in a marked overexpression in HUVEC.22 This may be due in part to the presence of the nuclear localizing sequence in the adenoviral vector, but also reflects the high efficacy of infection by the adenovirus.

To our best knowledge, this is the first study demonstrating the effects of Ikappa B-alpha overexpression on leukocyte adhesion and transmigration in shear flow. As such, it clearly extends previous reports describing pharmacological and genetic approaches that inhibit NF-kappa B mobilization or increase the levels of Ikappa B-alpha .19-22,51,52 As previously found,18,20,21 we show that inhibition of NF-kappa B mobilization by overexpression of Ikappa B-alpha inhibited the induction of endothelial adhesion molecule mRNA and protein expression by TNF-alpha , in particular that of the integrin ligands ICAM-1 and VCAM-1. This was not due to apoptosis, because cell viability was unaltered after stimulation with TNF-alpha for 4 hours, whereas the onset of apoptosis occurs only after 6 hours.38 The effects were associated with a significant reduction in the ability of monocytic cells to firmly arrest and an increase in the rolling fraction of cells on rAd.Ikappa B-alpha -infected HUVEC under physiological flow conditions. It has been shown that a combination of blocking alpha 4 and beta 2 integrins inhibits the adhesion of monocytes2,3 and as an inverse measure of firm arrest, resulted in a shift to more rolling interactions on activated HUVEC in shear flow. Thus, the effects of Ikappa B-alpha overexpression are likely due to reduced expression of VCAM-1 and ICAM-1, ligands for the alpha 4 integrin VLA-4 and the beta 2 integrin LFA-1, respectively. In addition, subsequent spreading and transmigration of monocytes was reduced on rAd.Ikappa B-alpha -infected HUVEC. Because transendothelial migration of leukocytes requires the coordinated regulation of integrin avidity, particularly that of VLA-4 and LFA-1,29,53 impaired expression of their ligands may also contribute to decreased transmigration across rAd.Ikappa B-alpha -infected HUVEC.

Inhibition of NF-kappa B also suppressed the production of the chemokines MCP-1 and GRO-alpha in TNF-alpha -stimulated HUVEC, which are critically involved in monocyte adhesion and chemotaxis.14,44-46 Interestingly, overexpression of Ikappa B-alpha appeared to be slightly more effective in inhibiting firm monocyte arrest on endothelium. Recent reports have shown that CXC chemokines IP10 and Mig mediate rapid and shear-resistant arrest of T effector cells, whereas blocking the eotaxin receptor CCR3 in combination with an alpha 4 MoAb inhibited eosinophil arrest on activated endothelium.40,48 GRO-alpha can be immobilized to mmLDL-treated HUVEC and facilitate monocyte adhesion to endothelium,10 whereas monocyte transmigration appears to require a soluble gradient of MCP-1.47 Indeed, we have recently established a hierarchical involvement of chemokines in monocyte traffic on activated endothelium in shear flow, ie, monocyte arrest requires surface-bound GRO-alpha , whereas subsequent transmigration is mediated by MCP-1 presented in a soluble gradient created by removal of secreted protein in shear flow.49 We have confirmed here the contributions of these chemokines using peptide antagonists. Moreover, the combination of MoAb to integrins with peptide antagonists or with rAd.Ikappa B-alpha -infection of HUVEC appeared to slightly accentuate the inhibition of monocyte arrest, as well as spreading and transmigration. Thus, the reduction in GRO-alpha due to NF-kappa B inhibition may contribute to decreased monocyte adhesion in shear flow. In addition, overexpression of Ikappa B-alpha in HUVEC may result in a marked reduction in MCP-1 secretion that would impair the establishment of an MCP-1 gradient and thus monocyte transmigration. Hence, our data for the first time provide evidence that, in addition to effects on endothelial Ig integrin ligands, the reduced expression of specifically required chemokines in rAd.Ikappa B-alpha -infected HUVEC contributes to the inhibition of monocyte arrest and transmigration in shear flow.

Interestingly, overexpression of Ikappa B-alpha decreased firm adhesion but increased the rolling fraction of cells, indicating a shift to more rolling interactions. Blocking MoAb inhibition assays have shown that monocyte rolling on activated endothelium is largely mediated by P- and L-selectin, whereas no role for E-selectin was seen,2,3 suggesting that interactions of P- or L-selectin are sufficient. Although effects of NF-kappa B mobilization on E-selectin expression are well described,11,18,39 the regulation of P-selectin expression by the NF-kappa B/Ikappa B-alpha autoregulatory loop is not yet clear. Evidence with respect to the upregulation of P-selectin expression by TNF-alpha is not entirely conclusive.2,54,55 Moreover, proteasome inhibitors and antioxidants have been shown to decrease the expression of endothelial P-selectin independently of NF-kappa B inhibition.55 We found that rolling interactions of monocytes were not affected by NF-kappa B inhibition in endothelial cells and that P-selectin, which was not inhibited by overexpression of Ikappa B-alpha , plays a partial role in mediating monocyte rolling. These results are consistent with previous reports showing that rolling is not affected by E-selectin.2,3

Inhibition of NF-kappa B activation in endothelial cells has been suggested to be useful in dampening inflammatory responses.19-22 Notably, the inhibition of endothelial VCAM-1 and MCP-1 expression that can be specifically detected in atherosclerotic lesions4,5,9 appeared to be more prominent than that of ICAM-1, indicating a selective rather than general immunomodulatory effect. This was consistent with findings with PDTC or aspirin39,51 and may be due to differential contributions of a variant NF-kappa B site or dimer compositions to ICAM-1 transcription.13 Adenoviral gene transfer of Ikappa B-alpha may offer advantages in its localized applicability,23-25 but deleterious effects of inhibiting NF-kappa B translocation in large cell populations cannot be excluded. Previous reports have confirmed the efficacy of adenoviral gene transfer in normal, atherosclerotic, or balloon-injured blood vessels.23-25 Although infection with control adenovirus alone did not increase ICAM-1 expression or cell arrest in our assays, adenovirus-mediated gene transfer itself may result in an inflammatory response and antigenicity,56 which warrants further studies addressing the feasibility of adenoviral gene transfer in vivo. In conclusion, overexpression of Ikappa B-alpha in endothelium may reduce extravasation of monocytes and other leukocyte subsets and be of potential use in limiting the inflammatory response in areas of atherosclerosis or after balloon injury.


    ACKNOWLEDGMENT

The authors are grateful to Drs I. Clark-Lewis, R. Lobb, R. McEver, and R. Rothlein for providing valuable reagents and to Prof P.C. Weber for his continuing support.


    FOOTNOTES

Submitted October 14, 1998; accepted January 26, 1999.

Supported by Deutsche Forschungsgemeinschaft (We-1913/2) and August Lenz-Stiftung.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Kim S.C. Weber, MD, Institut für Prophylaxe und Epidemiologie der Kreislaufkrankheiten, Ludwig-Maximilians Universität, Pettenkoferstrasse 9, D-80336 Munich, Germany; e-mail: kim.weber{at}klp.med.uni-muenchen.de.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Ross R: The pathogenesis of atherosclerosis: A perspective for the 1990s. Nature 362:801, 1993[Medline] [Order article via Infotrieve]

2. Luscinskas FW, Ding H, Tan P, Cumming D, Tedder TF, Gerritsen ME: L- and P-selectins, but not CD49d (VLA-4) integrins, mediate monocyte initial attachment to TNF-alpha -activated vascular endothelium under flow in vitro. J Immunol 156:326, 1996

3. Kukreti S, Konstantopoulus K, Smith CW, McIntire LV: Molecular mechanisms of monocyte adhesion to IL-1beta -stimulated endothelial cells under physiologic flow conditions. Blood 89:4104, 1997[Abstract/Free Full Text]

4. Poston RN, Haskard DO, Coucher JR, Gall NP, Johnson-Tidey RR: Expression of intercellular adhesion molecule-1 in atherosclerotic plaques. Am J Pathol 140:665, 1992[Abstract]

5. O'Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE: Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation 93:672, 1996[Abstract/Free Full Text]

6. Kuhira T, Warr G, Loy J, Bravo R: Defects in macrophage recruitment and host defense in mice lacking the CCR2 chemokine receptor. J Exp Med 186:1757, 1997[Abstract/Free Full Text]

7. Boring L, Gosling J, Chensue SW, Kunkel SL, Farese RV Jr, Broxmeyer HE, Charo IF: Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice. J Clin Invest 100:2552, 1997[Medline] [Order article via Infotrieve]

8. Kuziel WA, Morgan SJ, Dawson TC, Griffin S, Smithies O, Ley K, Maeda N: Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proc Natl Acad Sci USA 94:12053, 1997[Abstract/Free Full Text]

9. Ylä-Herttuala S, Lipton BA, Sarkioja ME, Yoshimura T, Leonard EJ, Witztum JL, Steinberg D: Expression of monocyte chemotactic protein-1 in macrophage-rich areas of human and rabbit atherosclerotic lesions. Proc Natl Acad Sci USA 88:5252, 1991[Abstract/Free Full Text]

10. Schwartz D, Andalibi A, Chaverri-Almada L, Berliner JA, Kirchgessner T, Fang ZT, Tekamp-Olson P, Lusis AJ, Gallegos C, Fogelman AM, Territo MC: Role of the GRO family of chemokines in monocyte adhesion to mm-LDL-stimulated endothelium. J Clin Invest 94:1968, 1994

11. Montgomery KF, Osborn L, Hession C, Tizard R, Goff D, Vassallo C, Tarr PI, Bomsztyk K, Lobb R, Harlan JM, Pohlman TH: Activation of endothelial-leukocyte adhesion molecule 1 (ELAM-1) gene transcription. Proc Natl Acad Sci USA 88:6523, 1991[Abstract/Free Full Text]

12. Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins T: Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 176:1583, 1992[Abstract/Free Full Text]

13. Ledebur HC, Parks TP: Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells. Essential roles of a variant NF-kappa B site and p65 homodimers. J Biol Chem 270:933, 1995[Abstract/Free Full Text]

14. Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, Fukushima J, Kawamoto S, Ishigatsubo Y, Okubo T: NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol 153:2052, 1994[Abstract]

15. Henkel T, Machleidt T, Alkalay I, Krönke M, Ben-Neriah Y, Bauerle P: Rapid proteolysis of Ikappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature 365:182, 1993[Medline] [Order article via Infotrieve]

16. Traenckner EB-J, Wilk S, Bauerle PA: A proteasome inhibitor prevents activation of NF-kappa B and stabilizes a newly phosphorylated form of Ikappa B-alpha that is still bound to NF-kappa B. EMBO J 13:5433, 1994[Medline] [Order article via Infotrieve]

17. Read MA, Whitley MZ, Williams AJ, Collins T: NF-kappa B and Ikappa B-alpha : An inducible regulatory system in endothelial activation. J Exp Med 179:503, 1994[Abstract/Free Full Text]

18. Read MA, Neish AS, Luscinskas FW, Palombella VJ, Maniatis T, Collins T: The proteasome pathway is required for cytokine-induced endothelial-leukocyte adhesion molecule expression. Immunity 2:493, 1994

19. Chen CC, Rosenbloom CL, Anderson DC, Manning AM: Selective inhibition of E-selectin, vascular cell adhesion molecule-1, and intercellular adhesion molecule-1 expression by inhibitors of Ikappa B-alpha phosphorylation. J Immunol 155:3538, 1995[Abstract]

20. Wrighton CJ, Hofer-Warbinek R, Moll T, Eytner R, Bach FH, de Martin R: Inhibition of endothelial cell activation by adenovirus-mediated expression of Ikappa B-alpha , an inhibitor of the transcription factor NF-kappa B. J Exp Med 183:1013, 1996[Abstract/Free Full Text]

21. Pierce JW, Shoenleber R, Jesmok G, Best J, Moore SA, Collins T, Gerritsen ME: Novel inhibitors of cytokine-induced Ikappa B-alpha phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J Biol Chem 272:21096, 1997[Abstract/Free Full Text]

22. Lockyer JM, Colladay JS, Alperin-Lea WL, Hammond T, Buda AJ: Inhibition of nuclear factor-kappa B-mediated adhesion molecule expression in human endothelial cells. Circ Res 82:314, 1998[Abstract/Free Full Text]

23. Guzman RJ, Lemarchand P, Crystal RG, Epstein SE, Finkel T: Efficient and selective adenovirus-mediated gene transfer into vascular neointima. Circulation 73:2838, 1993

24. Schulik AH, Dong G, Newman KD, Virmani R, Dihek DA: Endothelium-specific in vivo gene transfer. Circ Res 77:475, 1995[Abstract/Free Full Text]

25. Ooboshi H, Rios D, Chu Y, Christenson SD, Faraci FM, Davidson BL, Heistad DD: Augmented adenovirus-mediated gene transfer to atherosclerotic vessels. Circulation 17:1786, 1997

26. Weber C, Erl W, Pietsch A, Ströbel M, Ziegler-Heitbrock HWL, Weber PC: Antioxidants inhibit monocyte adhesion by suppressing nuclear factor-kappa B mobilization and induction of vascular cell adhesion molecule-1 in endothelial cells stimulated to generate radicals. Arterioscler Thromb 14:1665, 1994[Abstract/Free Full Text]

27. Ziegler-Heitbrock HWL, Thiel E, Fütterer A, Herzog V, Wirtz A, Riethmüller G: Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int J Cancer 41:456, 1988[Medline] [Order article via Infotrieve]

28. Weber C, Aepfelbacher M, Haag H, Zieger-Heitbrock HWL, Weber PC: Tumor necrosis factor induces enhanced responses to platelet-activating factor and differentiation in human monocytic Mono Mac 6 cells. Eur J Immunol 23:852, 1993[Medline] [Order article via Infotrieve]

29. Weber C, Alon R, Springer TA: Sequential regulation of alpha 4beta 1 and alpha 5beta 1 integrin avidity by CC chemokines in monocytes: Implications for transendothelial chemotaxis. J Cell Biol 134:1063, 1996[Abstract/Free Full Text]

30. Rothlein R, Dustin ML, Marlin SD, Springer TA: A human intercellular adhesion molecule (ICAM-1) distinct from LFA-1. J Immunol 137:1270, 1986[Abstract]

31. Sanchez-Madrid F, Krensky AM, Ware CF, Robbins E, Strominger JL, Burakoff SJ, Springer TA: Three distinct antigens associated with human T lymphocyte-mediated cytolysis: LFA-1, LFA-2 and LFA-3. Proc Natl Acad Sci USA 79:7489, 1982[Abstract/Free Full Text]

32. Kamata T, Puzon W, Takada Y: Identification of putative ligand-binding sites of the integrin alpha 4beta 1 (VLA-4, CD49d/CD29). Biochem J 305:945, 1995

33. McEver RP, Martin MN: A monoclonal antibody to a membrane glycoprotein binds only to activated platelets. J Biol Chem 259:9799, 1984[Abstract/Free Full Text]

34. Geng J-G, Beviliqua MP, Moore KL, McIntyre TM, Prescott SM, Kim JM, Bliss GA, Zimmerman GA, McEver RP: Rapid neutrophil adhesion to activated endothelium mediated by GMP-140. Nature 343:757, 1990[Medline] [Order article via Infotrieve]

35. Jones SA, Dewald B, Clark-Lewis I, Baggiolini M: Chemokine antagonists that discriminated between interleukin-8 receptors. Selective blockers of CXCR2. J Biol Chem 272:16166, 1997[Abstract/Free Full Text]

36. Hong J-H, Clark-Lewis I: Antagonists of monocyte chemoattractant protein 1 identified by modification of functionally critical NH2-terminal residues. J Exp Med 181:631, 1995[Abstract/Free Full Text]

37. de Martin R, Raidl M, Hofer E, Binder BR: Adenovirus-mediated expression of green fluorescent protein. Gene Ther 4:493, 1997[Medline] [Order article via Infotrieve]

38. Stehlik C, de Martin R, Kumabashiri I, Schmid JA, Binder BR, Lipp J: Nuclear factor (NF)-kappa B-regulated X-chromosome-linked iap gene expression protects endothelial cells from TNF-alpha -induced apoptosis. J Exp Med 188:211, 1998[Abstract/Free Full Text]

39. Weber C, Erl W, Pietsch A, Weber PC: Aspirin inhibits nuclear factor-kappa B mobilization and monocyte adhesion in stimulated human endothelial cells. Circulation 91:1914, 1995[Abstract/Free Full Text]

40. Piali L, Weber C, LaRosa G, Mackay CR, Springer TA, Clark-Lewis I, Moser B: The chemokines IP10 and Mig induce rapid and shear-resistant adhesion of activated T lymphocytes to endothelial integrin ligands via CXCR3. Eur J Immunol 28:961, 1998[Medline] [Order article via Infotrieve]

41. Bargatze RF, Kurk S, Butcher EC, Jutila MA: Neutrophils roll on adherent neutrophils bound to cytokine-induced endothelial cells via L-selectin on rolling cells. J Exp Med 180:1785, 1994[Abstract/Free Full Text]

42. Alon R, Fuhlbrigge RC, Finger EB, Springer TA: Interactions through L-selectin between leukocytes and adherent leukocytes nucleate rolling adhesions on selectins and VCAM-1 in shear flow. J Cell Biol 135:849, 1996[Abstract/Free Full Text]

43. Lim YC, Snapp K, Kansas GS, Camphausen R, Ding H, Luscinskas FW: Important contributions to P-selectin glycoprotein ligand-1-mediated secondary capture to human monocyte adhesion to P-selectin, E-selectin, and TNF-alpha -activated endothelium under flow in vitro. J Immunol 161:2501, 1998[Abstract/Free Full Text]

44. Rollins BJ, Yoshimura T, Leonard EJ, Pober JS: Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. Am J Pathol 136:1229, 1990[Abstract]

45. Walz A, Meloni F, Clark-Lewis I, von Tscharner V, Baggiolini M: (Ca2+)i changes and respiratory burst in human neutrophils and monocytes induced by NAP-1/interleukin-8, NAP-2 and gro/MGSA. J Leukoc Biol 50:279, 1991[Abstract]

46. Parry GCN, Martin T, Felts KA, Cobb RR: IL-1beta -induced monocyte chemo-attractant protein-1 gene expression in endothelial cells is blocked by proteasome inhibitors. Arterioscler Thromb Vasc Biol 18:934, 1998[Abstract/Free Full Text]

47. Randolph GJ, Furie MB: A soluble gradient of endogenous monocyte chemoattractant protein-1 promotes the transendothelial migration of monocytes in vitro. J Immunol 155:3610, 1995[Abstract]

48. Kitayama J, Mackay CR, Ponath PD, Springer TA: The CC chemokine receptor CCR3 participates in stimulation of eosinophil arrest on inflammatory endothelium in shear flow. J Clin Invest 101:2017, 1998[Medline] [Order article via Infotrieve]

49. Weber KSC, von Hundelshausen P, Clark-Lewis I, Weber PC, Weber C: Differential immobilization and hierarchical involvement of chemokines in monocyte arrest and transmigration on inflamed endothelium in shear flow. Eur J Immunol 29:702, 1999

50. Erl W, Weber C, Wardemann C, Weber PC: Adhesion properties of Mono Mac 6 cells, a monocytic cell line with characteristics of mature human monocytes. Atherosclerosis 113:99, 1995[Medline] [Order article via Infotrieve]

51. Weber C, Negrescu E, Erl W, Pietsch A, Frankenberger M, Ziegler-Heitbrock HWL, Siess W, Weber PC: Inhibitors of protein tyrosine kinase suppress TNF-alpha -stimulated induction of endothelial adhesion molecules. J Immunol 155:445, 1995[Abstract]

52. Marui N, Offermann MK, Swerlick R, Kunsck C, Rosen CA, Ahmad M, Alexander RW, Medford RM: Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J Clin Invest 92:1866, 1993

53. Weber C, Lu C, Casasnovas J, Springer TA: Role of alpha Lbeta 2 integrin avidity in transendothelial chemotaxis of mononuclear cells. J Immunol 159:3968, 1997[Abstract]

54. Yao L, Pan J, Setiada H, Patel KD, McEver RP: Interleukin 4 or oncostatin M induces a prolonged increase in P-selectin mRNA and protein in human endothelial cells. J Exp Med 184:81, 1996[Abstract/Free Full Text]

55. Xia L, Pan J, Yao L, McEver RP: A proteasome inhibitor, an antioxidant, or a salicylate, but not a glucocorticoid, blocks constitutive and cytokine-inducible expression of P-selectin in human endothelial cells. Blood 91:1625, 1998[Abstract/Free Full Text]

56. Newman K, Dunn O, Owens J, Schulick A, Virmani R, Sukhova G, Libby P, Dichek D: Adenovirus-mediated gene transfer into normal rabbit arteries results in prolonged vascular cell activation, inflammation and neointimal hyperplasia. J Clin Invest 96:2955, 1995


© 1999 by The American Society of Hematology.
 
0006-4971/99/9311-0030$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Quinn, M. Henriques, T. Parker, A. S. Slutsky, and H. Zhang
Human neutrophil peptides: a novel potential mediator of inflammatory cardiovascular diseases
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H1817 - H1824.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. Nagarajan, R. L. Burris, B. W. Stewart, J. E. Wilkerson, and T. M. Badger
Dietary Soy Protein Isolate Ameliorates Atherosclerotic Lesions in Apolipoprotein E-Deficient Mice Potentially by Inhibiting Monocyte Chemoattractant Protein-1 Expression
J. Nutr., February 1, 2008; 138(2): 332 - 337.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
U. Zeiffer, A. Schober, M. Lietz, E. A. Liehn, W. Erl, N. Emans, Z.-q. Yan, and C. Weber
Neointimal Smooth Muscle Cells Display a Proinflammatory Phenotype Resulting in Increased Leukocyte Recruitment Mediated by P-Selectin and Chemokines
Circ. Res., April 2, 2004; 94(6): 776 - 784.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J.-J. Chiu, L.-J. Chen, P.-L. Lee, C.-I Lee, L.-W. Lo, S. Usami, and S. Chien
Shear stress inhibits adhesion molecule expression in vascular endothelial cells induced by coculture with smooth muscle cells
Blood, April 1, 2003; 101(7): 2667 - 2674.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen
Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential
Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. K. D. Ng, S. S. Deshpande, K. Irani, and B. R. Alevriadou
Adhesion of flowing monocytes to hypoxia-reoxygenation-exposed endothelial cells: role of Rac1, ROS, and VCAM-1
Am J Physiol Cell Physiol, July 1, 2002; 283(1): C93 - C102.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. K. Hansson
Immune Mechanisms in Atherosclerosis
Arterioscler. Thromb. Vasc. Biol., December 1, 2001; 21(12): 1876 - 1890.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Zernecke, K. S. C. Weber, and C. Weber
Combined modulation of the mesangial machinery for monocyte recruitment by inhibition of NF-kappa B
Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1881 - C1888.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. von Hundelshausen, K. S. C. Weber, Y. Huo, A. E. I. Proudfoot, P. J. Nelson, K. Ley, and C. Weber
RANTES Deposition by Platelets Triggers Monocyte Arrest on Inflamed and Atherosclerotic Endothelium
Circulation, April 3, 2001; 103(13): 1772 - 1777.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. P. A. Jersmann, C. S. T. Hii, J. V. Ferrante, and A. Ferrante
Bacterial Lipopolysaccharide and Tumor Necrosis Factor Alpha Synergistically Increase Expression of Human Endothelial Adhesion Molecules through Activation of NF-{kappa}B and p38 Mitogen-Activated Protein Kinase Signaling Pathways
Infect. Immun., March 1, 2001; 69(3): 1273 - 1279.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Weber, K. S. C. Weber, C. Klier, S. Gu, R. Wank, R. Horuk, and P. J. Nelson
Specialized roles of the chemokine receptors CCR1 and CCR5 in the recruitment of monocytes and TH1-like/CD45RO+ T cells
Blood, February 15, 2001; 97(4): 1144 - 1146.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weber, K. S.C.
Right arrow Articles by Weber, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weber, K. S.C.
Right arrow Articles by Weber, C.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020