|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3866-3875
The Susceptibility to X4 and R5 Human Immunodeficiency Virus-1
Strains of Dendritic Cells Derived In Vitro From
CD34+ Hematopoietic Progenitor Cells Is Primarily
Determined by Their Maturation Stage
By
Bruno Canque,
Youssef Bakri,
Sandrine Camus,
Micael Yagello,
Abdelaziz Benjouad, and
Jean Claude Gluckman
From ESA 7087 Université Paris 6-Centre Nationale de la
Recherche Scientifique, Laboratoire d'Immunologie Cellulaire de
l'Ecole Pratique des Hautes Etudes, hôpital
Pitié-Salpêtrière, Paris, France; and Laboratoire de
Biochimie, Faculté des Sciences, Rabat, Morocco.
 |
ABSTRACT |
Dendritic cells (DC) were sorted on day 8 from cultures of
CD34+ cells with stem cell factor/Flt-3 ligand/
granulocyte-macrophage colony-stimulating factor (GM-CSF)/tumor
necrosis factor- (TNF-)/interleukin-4 (IL-4). Exposing immature
CCR5+CXCR4lo/ DC to CCR5-dependent human
immunodeficiency virus (HIV)-1Ba-L led to productive and
cytopathic infection, whereas only low virus production occurred in
CXCR4-dependent HIV-1LAI-exposed DC. PCR analysis of the
DC 48 hours postinfection showed efficient entry of
HIV-1Ba-L but not of HIV-1LAI. CD40 ligand- or
monocyte-conditioned medium-induced maturation of
HIV-1Ba-L-infected DC reduced virus production by about 1 Log, while cells became CCR5. However,
HIV-1Ba-L-exposed mature DC harbored 15-fold more viral DNA than their immature counterparts, ruling out inhibition of virus
entry. Simultaneously, CXCR4 upregulation by mature DC coincided with
highly efficient entry of HIV-1LAI which, nonetheless,
replicated at the same low level in mature as in immature DC. In line
with these findings, coculture of HIV-1Ba-L-infected
immature DC with CD3 monoclonal antibody-activated autologous
CD4+ T lymphocytes in the presence of AZT decreased virus
production by the DC. Finally, whether they originated from
CD1a+CD14 or
CD1aCD14+ precursors, DC did not differ as
regards permissivity to HIV, although
CD1a+CD14 precursor-derived immature DC
could produce higher HIV-1Ba-L amounts than their
CD1aCD14+ counterparts. Thus, both DC
permissivity to, and capacity to support replication of, HIV is
primarily determined by their maturation stage.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
DENDRITIC CELLS (DC) and Langerhans cells
(LC) are presumed to play an important role in the natural history of
human immunodeficiency virus (HIV) infection.1,2 At the
earliest phase of infection, resident LC from the genital or rectal
mucosae are assumed to be among the first target cells of the virus,
and then to transport it by migrating to draining lymph nodes where, as
interdigitating DC, they interact with T lymphocytes (TL) and initiate
both the primary immune response to and productive infection of TL by
HIV, leading to its systemic spreading.3-5 During the chronic phase of HIV infection, DC are probably involved in destruction of CD4+ TL either by transmitting virus to uninfected TL or
by upregulating viral DNA transcription and subsequent virus production
in latently infected cells.6-10 Conversely, DC may also
contribute to long-term maintenance of an effective anti-HIV immune
response and, thereby, to control of viremia.11,12 Finally,
as in the murine LCMV model,13 a defect in DC function
and/or decreased DC numbers might participate to the immune collapse of
acquired immunodeficiency syndrome (AIDS).2,14
There is indeed evidence that LC and DC are susceptible to
HIV.1,15 Epidermal LC as well as blood and spleen DC from
HIV-infected patients harbor HIV DNA,16-18 express viral
RNA and proteins,19-21 and even contain
virions.19 In vitro, LC/DC isolated from the skin or blood,
or differentiated from CD34+ hematopoietic progenitor cells
(HPC) or monocytes, express CD4 and HIV coreceptors CCR3, CCR5, and
CXCR422-28; and they harbor HIV DNA after exposure to
CCR5-dependent (R5) or CXCR4-dependent (X4)
strains.4,22,24,25,29-32 However, data regarding the capacity of DC/LC to support virus replication are conflicting, ranging
from resistance to infection,33-35 nonproductive infection due to constitutive low capacity or inability to drive HIV
promoter,31,36,37 to productive infection with R5 and X4
isolates.24,29,38-40 The reasons for these discrepancies
are still unclear, but they may reflect different DC isolation
procedures and culture methods resulting in heterogeneous
populations as regards to both their activation/maturation stage and
origin.41
The in vitro differentiation model of DC from cord blood
CD34+ HPC represents a tool to reconcile these findings,
inasmuch as it allows the independent differentiation of two distinct
DC populations42: DC derived from CD1a+
precursors are phenotypically and functionally close to LC, whereas DC
derived from bipotent CD14+ DC-macrophage precursors
resemble monocyte-derived and germinal center DC.42-46 In
addition, depending on culture conditions ie, with or without
interleukin-4 (IL-4), CD40-ligand (CD40L), or monocyte-conditioned
medium (MCM)cells are obtained as either immature
CD1a+CD83 or mature
CD1alo/negCD83+ DC.45,47-50 Here we
examined the susceptibility to HIV of such DC populations, and we show
that their capacity to support replication of R5 or X4 laboratory
strains is primarily determined by their activation/maturation stage,
more than by their origin.
| |
MATERIALS AND METHODS |
Cord blood CD34+ HPC isolation, DC culture, and
labeling.
Normal cord blood (Laboratoire Senders, Hôpital Saint-Vincent de
Paul; Service de Gynécologie-Obstétrique, Hôpital
Saint-Antoine, Paris, France) was collected according to institutional
guidelines. After Ficoll-Paque (Pharmacia, Uppsala, Sweden)
centrifugation, mononuclear cells were enriched into low-density cells
by centrifugation on Percoll (density [d] =1.070;
Pharmacia). CD34+ HPC were purified with CD34
monoclonal antibody (MoAb) 561-coated M-450 Dynabeads (Dynal, Oslo,
Norway) as described,50 yielding 88% ± 7% pure viable
CD34+ cells (n = 21), and they were cultured under reported
conditions45,50 to promote DC differentiation. Briefly, 2 to 5 × 104/mL CD34+ HPC were cultured in
6-well plates (ATGC, Noisy le Grand, France) at 37°C in humidified
5% CO2, in RPMI 1640, 10% fetal calf serum (FCS;
Dutscher, Brumath, France), 1% glutamine, 1% antibiotics (GIBCO-BRL,
Paisley, UK), with the following human recombinant cytokines: 10 ng/mL
granulocyte-macrophage colony-stimulating factor (GM-CSF) (gift of
Schering Plough, Kenilworth, NJ), 50 ng/mL stem cell factor (SCF; R&D
Systems, Minneapolis, MN), 50 ng/mL Flt-3 ligand (FL; gift of Immunex,
Seattle, WA), and 50 U/mL tumor necrosis factor- (TNF-; Genzyme,
Cambridge, MA); 5 ng/mL of IL-4 (gift of Schering Plough) was added to
cultures from day 5 onward.
DC precursors were sorted on culture day 5 with a FACStar Plus (Becton
Dickinson, Mountain View, CA). Briefly, 5 to 106/mL washed
cells were incubated for 30 minutes at 4°C with PE-CD14 (LeuM3;
Becton Dickinson) and FITC-CD1a (Coulter, Coultronics, Margency,
France) MoAb diluted 1:50. Cells were resuspended in phosphate-buffered
saline (PBS), 2% FCS, and CD1a+CD14 and
CD1aCD14+ cells were sorted. Both
populations (96% ± 2% pure, n = 20) were cultured for 3 more days
before exposure to virus.
CD1a+ immature DC were sorted on culture day 8 with the RAM
IgG1 CELLection kit (Dynal). Beads were washed in PBS, 0.1% bovine serum albumin (BSA), and incubated for 30 minutes with CD1a T6 MoAb
(Coulter). They were washed again to remove unbound MoAb, mixed with
the cells (107/mL) at a 5:1 ratio, and incubated for 15 minutes at 4°C on a rotor. Rosetted cells were separated with a
magnet, and beads were detached with releasing buffer according to the
manufacturer's instructions. DC (97% ± 4% pure, n = 17) were
then cultured for 18 to 24 hours with GM-CSF/TNF-/IL-4 before
exposure to virus.
For assessing CD4, CCR5, and CXCR4 membrane expression by DC derived
either from CD1a+CD14 or
CD1aCD14+ precursors, cells were
cultured as described previously but, because of high residual
fluorescence after sorting, day 5 precursors were then sorted with the
RAM IgG1 CELLection kit, after which they were labeled with
PE-Leu3a/CD4 (Becton Dickinson), FITC-2D7/CCR5 and PE-12G5/CXCR4 (both
from Pharmigen, San Diego, CA) MoAb before analysis with a FACScalibur
(Becton Dickinson).
HIV strains and infection.
X4 HIV-1lai51 was purchased from Diagnostics
Pasteur (Marne la Coquette, France), and R5
HIV-1Ba-L52 was a gift from B. Asjö
(Bergen, Norway). Cells (0.5 to 1 × 106/mL) were
incubated for 3 hours with 500 TCID50 (tissue culture infectious dose 50%) of DNAse-treated virus supernatant.
Heat-inactivated (HI) virus (1 hour, 56°C) was used as negative
control. Cells were washed twice and further cultured in RPMI 1640, 10% FCS, supplemented with GM-CSF/TNF-/IL-4. Cytokines were added
every 4 days together with fresh medium (20% of the volume), and
viable cells were counted. The kinetics of virus production was
followed by sequential measurement of viral p24 in supernatants by
enzyme-linked immunosorbent assay (ELISA; Diagnostics Pasteur).
The effect of different activation/maturation signals on virus
replication was assessed 2 days postinfection (PI). HIV-infected DC
were harvested, washed twice to remove residual virions, and further
cultured with the same cytokines but with or without 1 µg/mL soluble
trimeric human CD40L (CD40LT; gift of Immunex), 2 ng/mL transforming
growth factor- 1 (TGF-1; Genzyme), 250 U IL-2 (gift of Chiron,
Amsterdam, The Netherlands) or MCM at 25% final
concentration.49
When the effect of recombinant macrophage inflammatory protein
(MIP)-1, MIP-1, RANTES (regulated on activation normal T-cell expressed and secreted), or stromal cell-derived factor (SDF)-1 on
virus entry was examined, 1 µmol/L of either chemokine was added 30 minutes before exposure to virus and maintained in culture after infection.
Detection of HIV DNA.
HIV DNA was detected by nested polymerase chain reaction (PCR) as
described.30 Briefly, sorted DC (96% to 97% pure) were exposed for 90 minutes to 500 TCID50 of
HIV-1Ba-L or HIV-1lai and analyzed for the
presence of HIV pol DNA 2 days later. Cells (1 × 106/mL) were then washed and lysed in 10 mmol/L TRIS HCl,
pH 8.3, 50 nmol/L KCl, 0.5% Tween 20 (Biorad, Hercules, CA), 0.5%
Nonidet (Sigma, St Louis, MO). Proteinase K (20 µg/mL; Boehringer,
Mannheim, Germany) was added, lysates were incubated at 56°C for 1 hour, and proteinase K was inactivated at 95°C for 10 minutes.
Relative virus amounts in different samples were estimated by endpoint dilutions of the lysates in lysates of HIV A301
cells (1 × 106/mL). Serially diluted samples (30 µL) were added to 0.5 µmol/L of each primer and 0.2 µmol/L of
each dNTP (Pharmacia), 1.5 mmol/L MgCl2, and 1 U
Taq DNA polymerase (Boehringer) in 50 µL final. After 5 minutes at 94°C, 35 cycles were performed in an automated DNA
Thermal Cycler (Crocodile III; Appligene, Strasbourg, France), each
consisting of 30 seconds at 94°C, annealing at 55°C, and extension at 72°C. Pol primers were P3 (TGGGAAGTTCAATTAGG
AATACCAC) and P4 (CCTACATACAAATCATCCATGTATT).53 For the
nested PCR, 2 µL of amplified products was submitted to another
35-cycle amplification under the same conditions using internal primers
P5 (ATCAGTAACAGTACTGGATGTG) and P6 (GATAG ATAACTATGTCTGGATT). PCR
sensitivity (1 copy/3 × 104 cells) was determined
relative to serial dilutions of 8E5/LAV cells (1 copy/cell) in
HIV A301 parental cells. PCR was also performed with
globin primers PCO4 (CAACTTCATCCACGTTCACC) and GH2O
(GAAGAGCCAAGGACAGGTAC) (Perkin Elmer, Foster City, CA) as amplification
and DNA content controls. PCR products (15 µL) were electrophoresed
onto 2% agarose, and stained with ethidium bromide for UV visualization.
Detection of chemokines in culture supernatants.
Supernatants were kept at  70°C until used. MIP-1,
MIP-1, and RANTES levels were measured by ELISA according to the
manufacturer's instructions (R&D Systems).
Purification of cord blood CD4+ TL and coculture
with HIV-infected DC.
After CD34+ HPC purification, autologous cord blood TL were
enriched to  80% by sheep erythrocyte
rosetting.54 CD4+ TL (94% ± 3% pure, n = 9) were then purified by negative selection: residual monocytes were
depleted by adherence55 and CD8+ TL were
depleted with CD8 MoAb ITI-5C2-coated M-450 Dynabeads. Cocultures were
initiated by mixing 5 × 104 DC (96% ± 5% pure,
n = 10) at 72-hours PI, with 5 × 105 resting or
autologous CD4+ TL that had been activated with immobilized
CD3 MoAb (UCHT1; Immunotech, Marseille, France), as
described.56 Briefly, 10 µg/mL MoAb was added to wells of
6- or 12-well plates, and incubated for 90 minutes at 37°C. Wells
were washed thrice with cold PBS, and CD4+ TL were added
and cultured for 72 hours in RPMI 1640, 10% FCS. CD4+ TL
were preincubated with azidothymidine (AZT; 10 µmol/L) for 2 hours
before cocultures. These were conducted in RPMI 1640, 10% FCS,
supplemented with IL-2 (100 U/mL; Chiron), in the continuous presence
of 10 µmol/L AZT to block virus transmission to TL and to as yet
uninfected DC. Due to use of AZT and the short 24- to 96-hour coculture
period, virus production was assessed by quantifiying HIV RNA copies in
supernatants with the AMPLICOR HIV-1 MONITOR assay (gift of Roche
Diagnostic Systems, Branchburg, NJ). When cell-associated HIV RNA was
assessed, cells were washed twice in PBS and trypsinized to eliminate
residual and membrane-bound virions.
CD40-CD40L interactions in cocultures were assessed by preincubating
CD3 MoAb-activated CD4+ TL with 10 µg/mL CD40L/CD154 MoAb
M-90 (gift of Immunex) or irrelevant control mouse IgG1 (Sigma), 30 minutes before and during the whole coculture period.
| |
RESULTS |
Susceptibility of immature DC to R5 or X4 HIV strains.
We first examined immature DC for permissivity to, and capacity to
support, replication of R5 HIV-1Ba-L and X4
HIV-1LAI strains. CD34+ HPC were
cultured for 8 days as reported46,50,57: ie, continuously with SCF/FL/GM-CSF/TNF-, with IL-4 being added from day 5 onward. DC were then sorted and cultured further for 24 hours with GM-CSF/TNF-/IL-4 (referred to as "standard
condition" hereafter) before being exposed to virus. DC were then
cultured under the same conditions, with fresh medium and cytokines
being added every 4 days. To allow comparisons among different
long-term DC cultures, p24 levels were assessed relative to numbers of
viable cells remaining at each time point. In line with previous
findings,30 HIV-1Ba-L-exposed DC replicated
the virus, whereas no or more limited virus production occurred in
HIV-1lai-exposed DC, with p24 levels reaching 9 to 118 ng/105 cells versus 0.25 to 19 ng/105 cells (n = 3) on day 20 PI, respectively (Fig 1A).
Syncitia appeared from day 7-8 PI in HIV-1Ba-L-infected
cultures (Fig 1B), but no cytopathicity was noted in
HIV-1LAI-infected cultures. On day 20 PI, there remained
 20% viable cells relative to initially HIV-exposed DC in both
HIV-1Ba-L- and HIV-1lai-infected cultures as
well as in cultures exposed to heat-inactivated virus, an indication that cell viability did not accurately reflect cytopathicity. Of
note, absence of nonadherent CD14+ cells and of
adherent macrophages for the whole culture period rules out
participation of monocytes/macrophages to virus production in
HIV-1Ba-L-infected cultures (data not shown).
View larger version (51K):
[in this window]
[in a new window]
| Fig 1.
HIV infection of immature DC. (A) Kinetics of p24
production: Culture day 8 sorted CD1a+ DC were exposed 1 day later to 500 TCID50 of HIV-1LAI ( ) or
HIV-1Ba-L ( ), and further cultured with
GM-CSF/TNF-/IL-4; virus production in supernatants is expressed as
ng of p24/105 viable cells; p24 levels in heat-inactivated
virus-exposed DC were always <0.1 ng/105 viable cells.
(B) Morphologic examination of cells on day 8 PI with
HIV-1Ba-L, showing that DC are involved in typical
syncitia. Results of one of three experiments.
|
|
Limiting dilution analysis by nested PCR in DC obtained 48 hours PI
confirmed these findings by showing greater amounts of viral DNA in
HIV-1Ba-L- than in HIV-1LAI-exposed DC,
geometric mean endpoint titers then being 7 and <1, respectively
(Fig 2, and
Table 1). In line with these findings,
immature DC obtained under the same conditions homogeneously expressed
CCR5, and only a minority were CXCR4lo (see Figs 4A and
7A). At variance with another report,28
fluorescence-activated cell sorter (FACS) analysis of such DC stained
after saponine permeabilization did not disclose intracellular
retention of CXCR4 (data not shown).
View larger version (34K):
[in this window]
[in a new window]
| Fig 2.
Nested PCR detection of viral DNA in HIV-infected
immature DC. Culture day 8 sorted CD1a+ DC were exposed 1 day later to 500 TCID50 of HIV-1Ba-L or
HIV-1LAI. Relative HIV DNA content was assessed 48 hours PI
by limiting dilutions of infected cell lysates in uninfected A301 cell
lysates. DC that had been exposed to heat-inactivated (HI) virus were
used as negative controls and assayed undiluted. -Globin DNA level
was assessed as amplification and DNA content control. The PCR
sensitivity was 1 copy/3 × 104 cells, as determined in
parallel experiments by serial dilutions of 8E5/LAV cells (1 copy/cell)
in HIV A301 parental cells (data not shown). Results of
one of four experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Semi-quantitative Endpoint Dilution PCR Analysis of HIV
DNA Content in 48-Hour PI HIV-Infected DC Treated (mature DC) or Not
Treated (immature DC) With CD40L
|
|
Thus, CD34+ HPC-derived immature DC are permissive to, and
support replication of, R5 HIV-1Ba-L, an observation in
line with the current hypothesis that in vivo immature DC from mucosae
can select for R5 HIV strains.58,59
Maturation of HIV-1Ba-L-infected DC decreases virus
production.
We next examined whether, as reported with monocyte-derived
DC,58 maturation of CD34+ HPC-derived DC
interfered with the capacity to support virus replication. CD40LT or
MCM, both of which elicit DC maturation,45,49,60 were added
to immature sorted DC on day 3 PI with HIV-1Ba-L, and cells
were cultured further with these factors added to GM-CSF/TNF-/IL-4. This resulted in strongly reduced virus production
(Fig 3). For example, 12 days after
induction of maturation (day 15 PI), p24 levels were 1.1 ± 0.3 Log
and 0.8 ± 0.3 Log lower (n = 3) in the presence of CD40LT and MCM,
respectively, than in cultures under standard conditions. Of note, that
a similar effect was noted under both conditions indicates that
inhibition of virus replication actually results from DC maturation per
se, and not from the presence of chemokines in MCM or the possible
direct interference of CD40LT with virus binding or entry into cells.
Alternatively, culture of HIV-infected DC with TGF-1 or IL-2 being
added to GM-CSF/TNF-/IL-4, or with GM-CSF/TNF- only, did not
affect virus production (Fig 3, and data not shown).
View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
Effect of maturation on virus replication by HIV-infected
DC. From 48 hours PI with HIV-1Ba-L, DC obtained as in Figs
1 and 2 were cultured under standard conditions (std) with ( ) or
without ( ) TGF1, or they were induced to mature by adding CD40LT
( ) or MCM ( ) to GM-CSF/TNF-/IL-4, or they were cultured with
only GM-CSF/TNF- ( ). Virus production is expressed as in Fig 1.
Results of one of three experiments.
|
|
Thus, mature DC have reduced capacity to support HIV-1Ba-L
replication, and this may result from reduced virus transmission to
uninfected mature DC and/or decreased virus production by the DC
already infected at the time when CD40LT or MCM were added.
Mature DC are permissive to both R5 HIV-1Ba-L and X4
HIV-1LAI.
As an approach to investigate the mechanisms underlying this
phenomenon, we analyzed expression of HIV coreceptors on DC by FACS,
after 72-hour culture in the presence of CD40LT or MCM: CCR5 was then
no longer detectable whereas CXCR4 expression strongly increased
(Fig 4A). This led us to assess the
permissivity of mature DC to HIV. Sorted DC were induced to mature for
72 hours with CD40LT and exposed to HIV-1Ba-L or
HIV-1LAI. They were analyzed 48 hours later by
nested PCR for viral DNA (Fig 4B, and Table 1). The geometric mean
endpoint titer of 105 found in HIV-1Ba-L-exposed mature DC
clearly indicated that CCR5 downmodulation did not affect virus entry
in the cells. This suggested rather that HIV-1Ba-L infection of mature DC could be independent of CCR5, but this was ruled
out because 1 µmol/L RANTES or MIP-1, but not CXCR4 ligand
SDF-1, inhibited infection (data not shown). Analysis of the
same DC, exposed to HIV-1LAI under the same
conditions, showed endpoint titers of up to 10,000, with a geometric
mean titer of 630 (Table 1). HIV-1LAI infection was
inhibited by 1 µmol/L SDF-1, which argues for the role of CXCR4 in
this process (data not shown).
View larger version (57K):
[in this window]
[in a new window]
| Fig 4.
Permissivity of mature DC to HIV. (A) Expression of HIV
coreceptors: Culture day 8 sorted CD1a+ DC were cultured
for 48 hours under standard conditions, with or without CD40LT, and
labeled with FITC-CCR5 or PE-CXCR4 MoAbs; solid histograms: labeling
with an irrelevant MoAb; open histograms: staining by the relevant
MoAb; representative data of one of four experiments. (B) Nested PCR
detection of viral DNA in HIV-infected mature DC: DC that had been
cultured for 48 hours with GM-CSF/TNF-/IL-4 and CD40LT were exposed
to HIV-1Ba-L or HIV-1LAI; cell lysates were
prepared 48 hours PI. Comparative endpoint dilution analysis was
performed as in Fig 2; results of one experiment of five.
|
|
These findings show that, in contrast to their immature counterparts,
mature DC are permissive to both X4 HIV-1LAI and R5 HIV-1Ba-L.
CD40LT-induced DC maturation increases production of
-chemokines.
Because activation of DC via CD40 in a coculture system may induce
MIP-1 production,47 we also investigated if CD40LT
affected production of chemokines MIP-1, MIP-1, and RANTES.
Immature DC were cultured for 48 hours under standard conditions, with or without CD40LT, and chemokine levels in supernatants were measured. CD40 ligation increased levels of the chemokines by threefold to
sixfold, but at concentrations far below those reported as being able
to inhibit HIV infection61
(Table 2).
Mature DC replicate HIV-1LAI at the same level as
immature DC and to a greater extent than HIV-1Ba-L.
The fact that, like epidermal LC,28 mature
CD34+ HPC-derived DC upregulate CXCR4 and become highly
permissive to X4 HIV-1LAI, led us to examine their capacity
to support virus replication. Immature DC were cultured for 72 hours
with GM-CSF/TNF-/IL-4 plus CD40LT, exposed to HIV-1LAI
or HIV-1Ba-L, and cultured further under the same
conditions. As shown in Fig 5, the DC
exposed to HIV-1LAI produced more virus than those exposed
to HIV-1Ba-L, although geometric mean p24 levels reached at
day 20 PI were then only 1.23 and 0.33 ng/105 cells,
respectively. By comparison, day 20 PI geometric mean p24 levels were
found in independent experiments as being 2.12 and 33.4 ng/105 cells for immature DC infected with
HIV-1LAI and HIV-1Ba-L (n = 3),
respectively.
View larger version (13K):
[in this window]
[in a new window]
| Fig 5.
HIV-1LAI replication by mature DC. Culture
day 8 sorted CD1a+ DC were cultured for 48 hours under
standard conditions plus CD40LT, and they were then exposed to
HIV-1Ba-L () or to HIV-1LAI (). Virus
production is expressed as geometric mean ± SD ng p24/105
viable cells of three experiments. The p24 levels in HI virus-exposed
DC were always <0.1 ng/105 viable cells; levels in
HIV-1LAI- and HIV-1Ba-L-infected cultures
were significantly different as assessed by two-way analysis of
variance (P = .0015).
|
|
The fact that mature DC replicate HIV-1lai as well as
immature DC and more efficiently than HIV-1Ba-L should be
compared with Table 1 semi-quantitative PCR data which show that, 48 hours PI, mature DC harbor about sixfold more HIV-1lai than
HIV-1Ba-L DNA copies. Thus, even if, relative to immature
DC, mature DC may be more permissive to X4 than to R5 strains, they
apparently display overall reduced capacity to support virus replication.
CD3 MoAb-activated autologous CD4+ TL modulate virus
production by HIV-1Ba-L-infected immature DC.
We next questioned the physiological relevance of these findings by
studying whether activated autologous TL affected virus replication by
HIV-1Ba-L-infected immature DC. Because activated TL
upregulate CD40L, produce high levels of cytokines, and induce DC
maturation in cocultures (data not shown), one would expect that they
reproduced the effect of CD40LT on virus replication by
HIV-1Ba-L-infected DC.
To test this prediction, 72 hours PI with HIV-1Ba-L, 5 × 104 immature DC were mixed with 5 × 105 autologous CD4+ TL, either resting or that
had been activated with immobilized CD3 MoAb for 72 hours. Cocultures
were conducted in the presence of 10 µmol/L AZT to prevent virus
transmission to new cells. Indeed, preliminary experiments showed that
10 µmol/L AZT completely blocked HIV infection of DC as well as of
CD3 MoAb-activated CD4+ TL (data not shown), which ensured
us that virus was produced only by already infected DC in the
cocultures with TL. Virus production, estimated as HIV RNA copy
numbers, was indeed significantly reduced in supernatants of DC
cocultured with CD3 MoAb-activated but not with resting
CD4+ TL (Fig 6A). Because lower
RNA copy numbers in supernatants could result from intracellular
sequestration, we verified that cell-associated HIV RNA copy numbers
were about 1 Log lower than, and paralleled those found in,
supernatants under all conditions tested (data not shown).
Despite decreased virus production in supernatants, HIV-infected DC
still efficiently transmitted virus to activated CD4+ TL
when AZT was omitted from cocultures (Fig 6B), as
reported.1 These data show that activated autologous
CD4+ TL downregulate virus production in supernatant by
HIV-1-infected DC even though they are still able to transmit virus to
the TL.
View larger version (20K):
[in this window]
[in a new window]
| Fig 6.
Effect on virus production of coculturing
HIV-1Ba-L-infected immature DC with autologous
CD4+ TL. (A) Effect of activated CD4+ TL (n
= 9): 72 hours PI with HIV-1Ba-L, DC were cocultured or
not () with resting () or CD3 MoAb-activated () autologous
CD4+ TL (T4L) in the presence of AZT; virus production is
expressed as mean ± SD Log10 HIV RNA copy numbers; differences were
not statistically significant (paired Student's t-test) at any
time point when comparing DC only versus DC + resting
CD4+ TL; differences were significant when comparing DC + CD3-activated CD4+ TL versus DC + resting
CD4+ TL (24 hours: P = .02; 48 hours: P
= .02; 96 hours: P = .04), or versus DC only (24 hours:
P = .05; 48 hours: P = .04; 96 hours: P = .02). (B) Virus transmission from DC to CD3-activated
CD4+ TL (n = 4): 72 hours PI with
HIV-1Ba-L, DC were cocultured (/) or not (/)
with CD3 MoAb-activated T4L in the presence (open symbols) or absence
(black symbols) of AZT; differences between AZT+ and
AZT conditions were not significant (paired Student's
t-test) as regards DC cultured alone; in cocultures,
differences were significant at 48 hours (P = .04) and 96 hours (P = .001).
|
|
Finally, to evaluate the role of CD40 ligation in this system,
cocultures of HIV-1Ba-L-infected DC with CD3
MoAb-activated CD4+ TL were conducted in the presence of
CD40L/CD154 MoAb. The latter MoAb prevented decrease of virus
production for the first 48 hours in four of five experiments, although
differences did not reach statistical significance (mean Log10 HIV RNA
copy numbers: 5.76 v 5.44; P = .1; paired Student's
t-test). This, and the fact that at 96 hours of coculture HIV
RNA copy numbers returned to control levels, indicate that other
ligand-receptor interactions are also to be involved in this process.
HIV infection of CD1a+CD14
precursor-derived and CD1aCD14+
precursor-derived DC.
Because DC that differentiate from CD34+ HPC derive from
either CD1a+CD14 or
CD1aCD14+ precursors, and display
different phenotype, function, and susceptibility to
apoptosis,42-46 we finally examined whether they also
differed regarding susceptibility to HIV.
CD1a+CD14 and
CD1aCD14+ precursors were sorted on day
5 from cultures conducted under standard conditions, and cultured
further for 72 hours with GM-CSF/TNF-/IL-4 with or without CD40LT.
The two DC populations obtained then had comparable HIV coreceptor
expression patterns either as immature or as CD40L-driven mature cells
(Fig 7A). In line with these findings, nested PCR at 48 hours PI with HIV-1Ba-L or
HIV-1LAI showed comparable HIV DNA amounts in immature as
well as in mature DC derived from either
CD1a+CD14 or
CD1aCD14+ precursors (data not shown).
View larger version (40K):
[in this window]
[in a new window]
| Fig 7.
HIV infection of DC derived from
CD1a+CD14 or
CD1aCD14+ precursors. (A) Expression of
HIV coreceptors by immature and mature DC of either population:
CD1a+CD14 and
CD1aCD14+ DC precursors sorted on day 5 were cultured for 48 hours with SCF/FL/GM-CSF/TNF-/IL-4 with or
without CD40LT, and labeled with FITC-CCR5 or PE-CXCR4 MoAbs; open and
solid histograms are as in Fig 4A; representative composite results
from two experiments of five. (B) Immature DC derived from either
sorted CD1a+ CD14 () or
CD1aCD14+ () precursors were cultured
for 48 hours under the standard condition before exposure to
HIV-1Ba-L, the production of which is expressed as
geometric mean ± SD ng p24/105 viable cells;
differences were not statistically significant at any time point (n = 5).
|
|
The capacity of CD1a+CD14
precursor-derived and CD1aCD14+
precursor-derived immature DC to support HIV-1Ba-L
replication was then compared by following p24 levels in supernatants.
In five of seven experiments performed with different donors,
CD1a+CD14 precursor-derived DC produced
more virus than their CD1aCD14+
counterparts (Fig 7B): on day 20 PI, the geometric mean p24 level in
supernatants of DC differentiated from
CD1a+CD14 precursors was 61 ng/105 cells versus 17 ng/105 cells for
CD1aCD14+ precursor-derived DC; but, due
to variability of the data, differences did not reach statistical
significance (.1 < P > .05 by the paired Student's
t-test) at any time point.
The effect of DC maturation on virus production by DC of each
population, infected with HIV-1Ba-L, was then examined. On
day 20 poststimulation, p24 levels was reduced by 1.40 ± 1.35 Log in supernatants of CD1a+CD14
precursor-derived DC and by 0.60 ± 0.35 Log (n = 3) in those from
CD1aCD14+ precursor-derived DC treated
with CD40L, and by 1.20 ± 0.65 Log and 0.80 ± 0.25 Log (n = 4),
respectively, in their MCM-treated counterparts.
Altogether, these data show that although immature
CD1a+CD14 precursor-derived DC produce
more virus than CD1aCD14+
precursor-derived DC, the capacity of CD34+ HPC-derived DC
to support HIV replication is primarily determined by their maturation stage.
| |
DISCUSSION |
DC isolated from the skin or blood, or differentiated in vitro from
CD34+ HPC or monocytes, express CD4 and HIV coreceptors
CCR5 and CXCR4, and they are susceptible to HIV.22-30,32,59
Although their capacity to directly support HIV replication has long
been controversial,3,4,24,29,30,36,38,39,62,63 there is now
agreement that DC at least transmit HIV to CD4+ TL with
which they form large syncitia that strongly produce virus in
vitro.3,4,35,64-67 Susceptibility of DC to HIV may actually
vary according to their differentiation/maturation stage or their
origin. This possibility is supported by findings that monocyte-derived
DC are productively infected by R5 strains only when
immature58 and that, in contrast to their blood or dermal counterparts, epidermal LC can be productively infected by
HIV.24,40,65,68,69
Here we examined the susceptibility to HIV of DC differentiated in
vitro from cord blood CD34+ HPC. This system allows
concomitant differentiation of two major populations of DC, which
derive from either CD1a+ or CD14+ precursors
and differ as to their phenotype and function, and can be obtained as
immature or mature DC depending on culture conditions.42-46
We first found that sorted bulk immature CD1a+ DC, a
mixture of the two populations, were permissive to R5 strain HIV-1Ba-L to a much greater extent than to X4 strain
HIV-1LAI. These data agreed with HIV coreceptor expression
pattern on these DC, which homogeneously expressed CCR5 but were
CXCR4, as reported.23,26,28 They also
are in line with some reports,30,58 but at variance with
others,29,39 showing that CD34+ HPC-derived
immature CD1a+ DC can be productively infected by both X4
and R5 strains. These discrepancies probably relate to
different experimental conditions, in particular use of nonsorted DC
that are heterogeneous in that they comprise not only immature DC but
also cells of the granulocyte lineage and
CD13hiLin intermediate precursors which
are also susceptible to HIV.30,50
Maturation of HIV-1Ba-L-infected DC induced with CD40LT or
MCM resulted in inhibition of virus production. This coincided with
CCR5 downmodulation at the cell surface, in line with a previous report23 but at variance with another,26 which
suggested that decreased virus production could result from inhibition
of entry into cells. However, 48 hours PI, mature
HIV-1Ba-L-exposed DC harbored about 15-fold more HIV DNA
than their immature counterparts and, in line with other
reports,22,26 RANTES or MIP-1 inhibited HIV-1Ba-L infection of mature DC, indicating that the virus
used CCR5 even though it was undetectable by FACS. Simultaneously, mature DC upregulated membrane CXCR4, which then allowed
efficient entry of X4 HIV-1LAI. However,
HIV-1lai replicated at the same level in mature as in
immature DC, though more efficiently than HIV-1Ba-L; but,
overall, virus production was much lower than that of
HIV-1Ba-L-infected immature DC. Permissivity
of DC to X4 strains, if not the capacity to replicate the virus,
appears thus as depending on their maturation stage.
As to the mechanisms responsible for low virus replication in mature
DC, our data suggest that this should be due to a postentry block of
the virus replication cycle and not to inhibition of HIV RNA
retrotranscription, inasmuch as HIV-exposed mature DC harbored from 15 to >600-fold more HIV DNA than their immature counterparts.25,36,37,58 We also found that DC maturation was associated with increased production of chemokines MIP-1, MIP-1, and RANTES, but at levels in supernatants that were far below
those reported as being able to inhibit HIV infection.61 Because it is possible that the immunoreactive chemokine species detected by ELISA do not obligatorily represent all bioavailable species,70 increased chemokine levels may still somehow
contribute to limitation of HIV-1Ba-L spreading in cultures
of mature DC.
Coculture of HIV-infected DC and TL have already been performed by
other groups to evaluate the functional capacity of HIV-infected or
-exposed DC, or to examine virus transmission to
TL.2-4,33-35,63,66,67,71-73 Here we examined if, given the
capacity of TL to induce DC maturation in cocultures, they may then
affect virus production by HIV-infected DC. To this end, short-term
assays were conducted in the presence of AZT to ensure that subsequent
virus production was exclusively supported by the already infected DC.
Indeed, autologous CD3 MoAb-activated CD4+ TL elicited
decreased virus production by DC, stressing the physiological relevance
of our findings on the effect of DC maturation on virus replication.
However, from our experiments it could not be concluded that CD40L/CD40
interactions were exclusively responsible for the effect of activated
TL in this system, indicating that other interactions are certainly
involved. Interestingly, we also confirmed here that, despite reduced
virus production in supernatant, mature DC still efficiently
transmitted virus to TL if cocultures were conducted without AZT.
Finally, we examined whether susceptibility of DC to HIV is influenced
by their origin. Indeed, both immature and mature DC derived from
either CD1a+CD14 or
CD1aCD14+ precursors expressed
equivalent levels of CXCR4 and CCR5, and harbored comparable HIV DNA
amounts when exposed to HIV-1Ba-L or HIV-1LAI,
which indicates that they probably do not differ as regards their
permissivity to virus entry and retrotranscription. HIV-1Ba-L-infected immature DC derived from
CD1a+CD14 precursors could produce more
virus than their CD1aCD14+
precursor-derived counterparts, but the differences were limited and
did not reach statistical significance. This observation could be
compared with those suggesting that skin LC are apparently more
permissive to HIV than derm or blood
DC.24,40,65,69 In addition, inducing maturation with MCM or
CD40LT of HIV-1Ba-L-infected DC of both origins reduced
virus production in the same manner, indicating that the capacity to
support HIV replication depends on the maturation stage rather than on
the origin of DC.
In conclusion, our results confirm and extend other studies regarding
the contribution of DC in the pathophysiology of HIV infection. That
immature DC replicate better R5 than X4 strains is in line with the
current view that DC from the vaginal or rectal mucosae select for R5
strains, accounting thus for the prominence of these strains during
primary infection.58,59,74 In addition, by creating foci of
infection in CD4+ TL-rich area of lymphoid organs, DC could
be major contributors to the variants founder effect reported to occur
there.75 The possible role of mature DC appears more
complex: through CXCR4 upregulation, they could participate in the
selection of X4 variants in vivo76-78; given their
permissivity to both X4 and R5 strains and reduced capacity to support
replication, they could serve as long-term virus reservoirs in
chronically infected patients79; but their low capacity to
support HIV replication, together with their increased chemokine
production, also suggests they could contribute to limit replication of
R5 strains and promote local recruitment of helper CD4+ TL
and CD8+ CTL, thus promoting maintenance of an effective
immune response in patients.
| |
ACKNOWLEDGMENT |
We gratefully acknowledge the help of the following colleagues: Prof J. Milliez and his staff of the Service de
Gynécologie-Obstétrique, Hôpital Saint-Antoine
(Paris, France) for the gift of cord blood samples; Drs E. Thomas and
E. Marakovski (Immunex, Seattle, WA) for their help and gift of
recombinant Flt-3 ligand and CD40 ligand, and CD40L MoAb M-90; Dr D. Théophile (Roche Diagnostic Systems, Neuilly sur Seine, France)
for the gift of AMPLICOR HIV-1 MONITORTM assay kits; Dr J. Maral (Chiron, Amsterdam, The Netherlands) for the gift of recombinant
IL-2; Prof B. Asjö (University of Bergen, Norway) for the gift of
the HIV-1Ba-L strain; and Schering Plough (Kenilworth, NJ)
for the gift of recombinant GM-CSF and IL-4.
| |
FOOTNOTES |
Submitted October 8, 1998; accepted January 26, 1999.
Supported by the Agence Nationale de Recherche contre le SIDA,
Université Paris 6, the Centre national de la Recherche
Scientifique, and the Association pour la Recherche sur les
Déficits Immunitaires Viro-Induits (Paris, France).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Jean Claude Gluckman, MD, Laboratoire
d'Immunologie, CERVI, hôpital de la
Pitié-Salpêtrière, 83 Blvd de l'Hôpital, 75651 Paris Cedex 13, France; e-mail:
jean-claude.gluckman{at}psl.ap-hop-paris.fr.
| |
REFERENCES |
1.
Cameron P, Pope M, Granelli-Pipern A, Steinman RM:
Dendritic cells and the replication of HIV-1.
J Leukoc Biol
59:158, 1996[Abstract]
2.
Knight S, Patterson S:
Bone marrow-derived dendritic cells, infection with human immunodeficiency virus, and immunopathology.
Annu Rev Immunol
15:593, 1997[Medline]
[Order article via Infotrieve]
3.
Pope M, Betjes MG, Romani N, Hirmand H, Cameron PU, Hoffman L, Gezelter S, Schuler G, Steinman RM:
Conjugates of dendritic cells and memory T lymphocytes from skin facilitate productive infection with HIV-1.
Cell
78:389, 1994[Medline]
[Order article via Infotrieve]
4.
Pope M, Gezelter S, Gallo N, Hoffman L, Steinman RM:
Low levels of HIV-1 infection in cutaneous dendritic cells promote extensive viral replication upon binding to memory CD4+ T cells.
J Exp Med
182:2045, 1995[Abstract/Free Full Text]
5.
Spira AI, Marx PA, Patterson BK, Mahoney J, Koup RA, Wolinsky SM, Ho DD:
Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques.
J Exp Med
183:215, 1996[Abstract/Free Full Text]
6.
Frankel SS, Wenig BM, Burke AP, Mannan P, Thompson LD, Abbondanzo SL, Nelson AM, Pope M, Steinman RM:
Replication of HIV-1 in dendritic cell-derived syncytia at the mucosal surface of the adenoid.
Science
272:115, 1996[Abstract]
7.
Finzi D, Hermankova M, Pierson T, Carruth LM, Buck C, Chaisson RE, Quinn TC, Chadwick K, Margolick J, Brookmeyer R, Gallant J, Markowitz M, Ho DD, Richman DD, Siliciano RF:
Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy.
Science
278:1295, 1997[Abstract/Free Full Text]
8.
Chun TW, Carruth L, Finzi D, Shen X, DiGiuseppe JA, Taylor H, Hermankova M, Chadwick K, Margolick J, Quinn TC, Kuo YH, Brookmeyer R, Zeiger MA, Barditch-Crovo P, Siliciano RF:
Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection.
Nature
387:183, 1997[Medline]
[Order article via Infotrieve]
9.
Chun T, Stuyver L, Mizell S, Ehler L, Mican J, Baseler M, Lloyd A, Nowak M, Fauci A:
Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy.
Proc Natl Acad Sci USA
94:13193, 1997[Abstract/Free Full Text]
10.
Wong JK, Hezareh M, Gunthard HF, Havlir DV, Ignacio CC, Spina CA, Richman DD:
Recovery of replication-competent HIV despite prolonged suppression of plasma viremia.
Science
278:1291, 1997[Abstract/Free Full Text]
11.
Rosenberg E, Billingsley J, Caliendo A, Boswell S, Sax P, Kalams S, Walker B:
Vigorous anti-HIV-1-specific CD4+ T cell responses associated with control of viremia.
Science
278:144, 1997[Free Full Text]
12.
Oldstone MB:
HIV versus cytotoxic T lymphocytesThe war being lost.
N Engl J Med
337:1306, 1997[Free Full Text]
13.
Borrow P, Evans CF, Oldstone MB:
Virus-induced immunosuppression: Immune system-mediated destruction of virus-infected dendritic cells results in generalized immune suppression.
J Virol
69:1059, 1995[Abstract]
14.
Kellerstein M, McCune J:
T cell turn-over in HIV-1 disease.
Immunity
7:583, 1997[Medline]
[Order article via Infotrieve]
15.
Knight SC:
Infection of dendritic cells with HIV type 1.
AIDS Res Hum Retroviruses
10:1591, 1994[Medline]
[Order article via Infotrieve]
16.
Cimarelli A, Zambruno G, Marconi A, Girolomoni G, Bertazzoni U, Giannetti A:
Quantitation by competitive PCR of HIV-1 proviral DNA in epidermal Langerhans cells of HIV-infected patients.
J Acquir Immune Defic Syndr
7:230, 1994
17.
McIlroy D, Autran B, Cheynier R, Wain-Hobson S, Clauvel JP, Oksenhendler E, Debre P, Hosmalin A:
Infection frequency of dendritic cells and CD4+ T lymphocytes in spleens of human immunodeficiency virus-positive patients.
J Virol
69:4737, 1995[Abstract]
18.
Patterson S, Roberts MS, English NR, Macatonia SE, Gompels MN, Pinching AJ, Knight SC:
Detection of HIV DNA in peripheral blood dendritic cells of HIV-infected individuals.
Res Virol
145:171, 1994[Medline]
[Order article via Infotrieve]
19.
Tschachler E, Groh V, Popovic M, Mann DL, Konrad K, Safai B, Eron L, diMarzoVeronese F, Wolff K, Stingl G:
Epidermal Langerhans cellsA target for HTLV-III/LAV infection.
J Invest Dermatol
88:233, 1987[Medline]
[Order article via Infotrieve]
20.
Frankel SS, Tenner-Racz K, Racz P, Wenig BM, Hansen CH, Heffner D, Nelson AM, Pope M, Steinman RM:
Active replication of HIV-1 at the lymphoepithelial surface of the tonsils.
Am J Pathol
151:89, 1997[Abstract]
21.
Henry M, Uthman A, Ballaun C, Stingl G, Tschachler E:
Epidermal Langerhans cells of AIDS patients express HIV-1 regulatory and structural genes.
J Invest Dermatol
103:593, 1994[Medline]
[Order article via Infotrieve]
22.
Ayehunie S, Garcia-Zepeda EA, Hoxie JA, Horuk R, Kupper TS, Luster AD, Ruprecht RM:
Human immunodeficiency virus-1 entry into purified blood dendritic cells through CC and CXC chemokine coreceptors.
Blood
90:1379, 1997[Abstract/Free Full Text]
23.
Delgado E, Finkel V, Baggiolini M, Mackay C, Steinman RM, Granelli-Piperno A:
Mature dendritic cells respond to SDF-1, but not to several beta-chemokines.
Immunobiology
198:490, 1998[Medline]
[Order article via Infotrieve]
24.
Dittmar MT, Simmons G, Hibbitts S, O'Hare M, Louisirirotchanakul S, Beddows S, Weber J, Clapham PR, Weiss RA:
Langerhans cell tropism of human immunodeficiency virus type 1 subtype A through F isolates derived from different transmission groups.
J Virol
71:8008, 1997[Abstract]
25.
Granelli-Piperno A, Moser B, Pope M, Chen D, Wei Y, Isdell F, O'Doherty U, Paxton W, Koup R, Mojsov S, Bhardwaj N, Clark-Lewis I, Baggiolini M, Steinman RM:
Efficient interaction of HIV-1 with purified dendritic cells via multiple chemokine coreceptors.
J Exp Med
184:2433, 1996[Abstract/Free Full Text]
26.
Rubbert A, Combadiere C, Ostrowski M, Arthos J, Dybul M, Machado E, Cohn M, Hoxie J, Murphy PM, Fauci A, Weissman D:
Dendritic cells express multiple chemokine receptors used as coreceptors for HIV entry.
J Immunol
160:3933, 1998[Abstract/Free Full Text]
27.
Sozzani S, Luini W, Borsatti A, Polentarutti N, Zhou D, Piemonti L, D'Amico G, Power C, Wells T, Gobbi M, Allavena P, Mantovani A:
Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines.
J Immunol
159:1993, 1997[Abstract]
28.
Zaitseva M, Blauvelt A, Lee S, Lapham CK, Klaus-Kovtun V, Mostowski H, Manischewitz J, Golding H:
Expression and function of CCR5 and CXCR4 on human Langerhans cells and macrophages: Implications for HIV primary infection.
Nat Med
3:1369, 1997[Medline]
[Order article via Infotrieve]
29.
Blauvelt A, Asada H, Saville MW, Klaus-Kovtun V, Altman DJ, Yarchoan R, Katz SI:
Productive infection of dendritic cells by HIV-1 and their ability to capture virus are mediated through separate pathways.
J Clin Invest
100:2043, 1997[Medline]
[Order article via Infotrieve]
30.
Canque B, Rosenzwajg M, Camus S, Yagello M, Bonnet ML, Guigon M, Gluckman JC:
The effect of in vitro human immunodeficiency virus infection on dendritic-cell differentiation and function.
Blood
88:4215, 1996[Abstract/Free Full Text]
31.
Cameron PU, Lowe MG, Crowe SM, O'Doherty U, Pope M, Gezelter S, Steinman RM:
Susceptibility of dendritic cells to HIV-1 infection in vitro.
J Leukoc Biol
56:257, 1994[Abstract]
32.
Cameron PU, Lowe MG, Sotzik F, Coughlan AF, Crowe SM, Shortman K:
The interaction of macrophage and non-macrophage tropic isolates of HIV-1 with thymic and tonsillar dendritic cells in vitro.
J Exp Med
183:1851, 1996[Abstract/Free Full Text]
33.
Weissman D, Li Y, Orenstein JM, Fauci AS:
Both a precursor and a mature population of dendritic cells can bind HIV. However, only the mature population that expresses CD80 can pass infection to unstimulated CD4+ T cells.
J Immunol
155:4111, 1995[Abstract]
34.
Cameron PU, Forsum U, Teppler H, Granelli-Piperno A, Steinman RM:
During HIV-1 infection most blood dendritic cells are not productively infected and can induce allogeneic CD4+ T cells clonal expansion.
Clin Exp Immunol
88:226, 1992[Medline]
[Order article via Infotrieve]
35.
Pinchuk LM, Polacino PS, Agy MB, Klaus SJ, Clark EA:
The role of CD40 and CD80 accessory cell molecules in dendritic cell-dependent HIV-1 infection.
Immunity
1:317, 1994[Medline]
[Order article via Infotrieve]
36.
Granelli-Piperno A, Pope M, Inaba K, Steinman RM:
Coexpression of NF-kappa B/Rel and Sp1 transcription factors in human immunodeficiency virus 1-induced, dendritic cell-T-cell syncytia.
Proc Natl Acad Sci USA
92:10944, 1995[Abstract/Free Full Text]
37.
Tsunetsugu-Yokota Y, Akagawa K, Kimoto H, Suzuki K, Iwasaki M, Yasuda S, Hausser G, Hultgren C, Meyerhans A, Takemori T:
Monocyte-derived cultured dendritic cells are susceptible to human immunodeficiency virus infection and transmit virus to resting T cells in the process of nominal antigen presentation.
J Virol
69:4544, 1995[Abstract]
38.
Chehimi J, Prakash K, Shanmugam V, Collman R, Jackson SJ, Bandyopadhyay S, Starr SE:
CD4-independent infection of human peripheral blood dendritic cells with isolates of human immunodeficiency virus type 1.
J Gen Virol
74:1277, 1993[Abstract/Free Full Text]
39.
Kim Warren M, Rose W, Cone J, Rice W, Turpin J:
Differential infection of CD34+ cell-derived dendritic cells and monocytes with lymphocyte-tropic and monocyte-tropic HIV-1 strains.
J Immunol
158:5035, 1997[Abstract]
40.
Ludewig B, Holzmeister J, Gentile M, Gelderblom HR, Rokos K, Becker Y, Pauli G:
Replication pattern of human immunodeficiency virus type 1 in mature Langerhans cells.
J Gen Virol
76:1317, 1995[Abstract/Free Full Text]
41.
Gluckman JC, Canque B, Chapuis F, Rosenzwajg M:
In vitro generation of human dendritic cells and cell therapy.
Cyt Mol Cell Ther
3:187, 1997
42.
Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, Banchereau J:
CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF alpha.
J Exp Med
184:695, 1996[Abstract/Free Full Text]
43.
De Saint-Vis B, Fugier-Vivier I, Massacrier C, Gaillard C, Vanbervliet B, Ait-Yahia S, Banchereau J, Liu YJ, Lebecque S, Caux C:
The cytokine profile expressed by human dendritic cells is dependent on cell subtype and mode of activation.
J Immunol
160:1666, 1998[Abstract/Free Full Text]
44.
Caux C, Massacrier C, Vanbervliet B, Dubois B, Durand I, Cella M, Lanzavecchia A, Banchereau J:
CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocyte-macrophage colony-stimulating factor plus tumor necrosis factor alpha: II. Functional analysis.
Blood
90:1458, 1997[Abstract/Free Full Text]
45.
Canque B, Camus S, Yagello M, Gluckman JC:
IL-4 and CD40 Ligation differently affect the differentiation, maturation, and function of human CD34+ cell-derived CD1a+CD14 and CD1aCD14+ dendritic cell precursors in vitro.
J Leukoc Biol
64:235, 1998[Abstract]
46.
Canque B, Camus S, Yagello M, Gluckman JC:
Special susceptibility to apoptosis of CD1a+ dendritic cell precursors differentiating in vitro from cord blood CD34+ progenitors.
Stem Cells
16:218, 1998[Abstract/Free Full Text]
47.
Caux C, Massacrier C, Vanbervliet B, Dubois B, VanKooten C, Durand I, Banchereau J:
Activation of human dendritic cells through CD40 cross-linking.
J Exp Med
180:1263, 1994[Abstract/Free Full Text]
48.
Herbst B, Kohler G, Mackensen A, Veelken H, Kulmburg P, Rosenthal FM, Schaefer HE, Mertelsmann R, Fisch P, Lindemann A:
In vitro differentiation of CD34+ hematopoietic progenitor cells toward distinct dendritic cell subsets of the Birbeck granule and MIIC-positive Langerhans cell and the interdigitating dendritic cell type.
Blood
88:2541, 1996[Abstract/Free Full Text]
49.
Romani N, Reider D, Heuer M, Ebner S, Kampgen E, Eibl B, Niederwieser D, Schuler G:
Generation of mature dendritic cells from human blood. An improved method with special regard to clinical applicability.
J Immunol Methods
196:137, 1996[Medline]
[Order article via Infotrieve]
50.
Rosenzwajg M, Canque B, Gluckman JC:
Human dendritic cell differentiation pathway from CD34+ hematopoietic precursor cells.
Blood
87:535, 1996[Abstract/Free Full Text]
51.
Wain-Hobson S, Vartanian J, Henry M, Chenciner M, Cheynier R, Delassus S, Pderoza Margins L, Sala M, Nguyere M, Guettard D, Klatzmann D, Gluckman JC, Rozenbaum W, Barré-Sinoussi F, Montagnier L:
LAV revisited: Origins of the early HIV-isolates from Institut Pasteur.
Science
252:961, 1991[Abstract/Free Full Text]
52.
Gartner S, Makovitz P, Markovitz DM, Kaplan M, Gallo RC:
The role of mononuclear phagocytes in HTLVIII/LAV infection.
Science
233:215, 1986[Abstract/Free Full Text]
53.
Laure F, Courgnaud V, Rouzioux C, Blanche S, Veber F, Burgard M, Jacomet C, Griscelli C, Brechot C:
Detection of HIV DNA in infants and children by means of the polymerase chain reaction.
Lancet
2:538, 1988[Medline]
[Order article via Infotrieve]
54.
Gluckman JC, Degoulet P:
Different stimulating capacity of monocytes and B lymphocytes in mixed leukocyte cultures: A dose response study.
Tissue Antigens
13:278, 1979[Medline]
[Order article via Infotrieve]
55.
Chapuis F, Rosenzwajg M, Yagello M, Ekman M, Biberfeld P, Gluckman JC:
Differentiation of human dendritic cells from monocytes in vitro.
Eur J Immunol
27:431, 1997[Medline]
[Order article via Infotrieve]
56.
Levine B, Bernstein W, Connors M, Craighead N, Lindsten T, Thompson C, June C:
Effects of CD28 costimulation on long term proliferation of CD4+ T cells in the absence of exogenous feeder cells.
J Immunol
159:592, 1997
57.
Rosenzwajg M, Camus S, Guigon M, Gluckman JC:
The influence of interleukin (IL)-4, IL-13, and Flt3 ligand on human dendritic cell differentiation from cord blood CD34+ progenitors cells.
Exp Hematol
26:63, 1998[Medline]
[Order article via Infotrieve]
58.
Granelli-Piperno A, Delgado E, Finkel V, Paxton W, Steinman RM:
Immature dendritic cells selectively replicate macrophage tropic (M-tropic) human immunodeficiency virus type 1, while mature cells efficiently transmit both M- and T-tropic virus to T cells.
J Virol
72:2733, 1998[Abstract/Free Full Text]
59.
Reece J, Handley A, Anstee E, Morrison W, Crowe S, Cameron PU:
HIV-1 selection by epidermal dendritic cells during transmission across human skin.
J Exp Med
187:1623, 1998[Abstract/Free Full Text]
60.
Caux C, Massacrier C, Dezutter-Dambuyant C, Vanbervliet B, Jacquet C, Schmitt D, Banchereau J:
Human dendritic Langerhans cells generated in vitro from CD34+ progenitors can prime naive CD4+ T cells and process soluble antigen.
J Immunol
155:5427, 1995[Abstract]
61.
Ylisastigui L, Vizzavona J, Drakopoulou E, Paindavoine P, Calvo CF, Parmentier M, Gluckman JC, Vita C, Benjouad A:
Synthetic full-length and truncated RANTES inhibit human immunodeficiency virus type 1 infection of primary macrophages.
AIDS
12:977, 1998[Medline]
[Order article via Infotrieve]
62.
Cameron PU, Freudenthal PS, Barker JM, Gezelter S, Inaba K, Steinman RM:
Dendritic cells exposed to human immunodeficiency virus type-1 transmit a vigorous cytopathic infection to CD4+ T.
Science
257:383, 1992
63.
Macatonia S, Patterson S, Knight S:
Suppression of immune responses by dendritic cells infected with HIV.
Immunology
67:285, 1989[Medline]
[Order article via Infotrieve]
64.
Tsunetsugu-Yokota Y, Yasuda S, Sugimoto A, Yagi T, Azuma M, Yagita H, Akagawa K, Takemori T:
Efficient virus transmission from dendritic cells to CD4+ T cells in response to antigen depends on close contact through adhesion molecules.
Virology
239:259, 1997[Medline]
[Order article via Infotrieve]
65.
Ludewig B, Gelderblom HR, Becker Y, Schafer A, Pauli G:
Transmission of HIV-1 from productively infected mature Langerhans cells to primary CD4+ T lymphocytes results in altered T cell responses with enhanced production of IFN-gamma and IL-10.
Virology
215:51, 1996[Medline]
[Order article via Infotrieve]
66.
Ayehunie S, Groves RW, Bruzzese AM, Ruprecht RM, Kupper TS, Langhoff E:
Acutely infected Langerhans cells are more efficient than T cells in disseminating HIV type 1 to activated T cells following a short cell-cell contact.
AIDS Res Hum Retroviruses
11:877, 1995[Medline]
[Order article via Infotrieve]
67.
Cameron PU, Pope M, Gezelter S, Steinman RM:
Infection and apoptotic cell death of CD4+ T cells during an immune response to HIV-1-pulsed dendritic cells.
AIDS Res Hum Retroviruses
10:61, 1994[Medline]
[Order article via Infotrieve]
68.
Zambruno G, Mori L, Marconi A, Mongiardo N, De Rienzo B, Bertazzoni U, Giannetti A:
Detection of HIV-1 in epidermal Langerhans cells of HIV-infected patients using the polymerase chain reaction.
J Invest Dermatol
96:979, 1991[Medline]
[Order article via Infotrieve]
69.
Zambruno G, Giannetti A, Bertazzoni U, Girolomoni G:
Langerhans cells and HIV infection.
Immunol Today
16:520, 1995[Medline]
[Order article via Infotrieve]
70.
Wagner L, Yang OO, Garcia-Zepeda EA, Ge Y, Kalam SA, Walker BD, Pasternack MS, Luster A:
-chemokines are released from HIV-1-specific cytolytic T-cell granules complexed to proteoglycans.
Nature
391:908, 1998[Medline]
[Order article via Infotrieve]
71.
Pope M, Elmore D, Ho D, Marx P:
Dendrite cell-T cell mixtures, isolated from the skin and mucosae of macaques, support the replication of SIV.
AIDS Res Hum Retroviruses
13:819, 1997[Medline]
[Order article via Infotrieve]
72.
Weissman D, Daucher J, Barker T, Adelsberger J, Baseler M, Fauci AS:
Cytokine regulation of HIV replication induced by dendritic cell-CD4-positive T cell interactions.
AIDS Re. Hum Retroviruses
12:759, 1996
73.
Weissman D, Barker TD, Fauci AS:
The efficiency of acute infection of CD4+ T cells is markedly enhanced in the setting of antigen-specific immune activation.
J Exp Med
183:687, 1996[Abstract/Free Full Text]
74.
Kahn JO, Walker BD:
Acute human immunodeficiency virus type 1 infection.
N Engl J Med
339:33, 1998[Free Full Text]
75.
Cheynier R, Henrichwark S, Hadida F, Pelletier E, Ocksenhendler E, Autran B, Wain-Hobson S:
HIV and T cell expansion in splenic white pulps is accompanied by infiltration of HIV-specific cytotoxic T lymphocytes.
Cell
78:373, 1994[Medline]
[Order article via Infotrieve]
76.
Connor R, Mohri H, Cao Y, Ho D:
Increased viral burden and cytopathicity correlate temporally with CD4+ T-lymphocyte decline and clinical progression in human immuno-deficiency virus type 1-infected individuals.
J Virol
67:177, 1993
77.
Cheng-Mayer C, Seto D, Tateno M, Levy J:
Biologic features of HIV that correlate with virulence in the host.
Science
240:80, 1998
78.
Tersmette R, DeGoede R, Al B, Winkel I, Gruters R, Cuypers H, Huisman H, Miedema F:
Differential syncitium-inducing capacity of human immunodeficiency virus isolates: Frequent detection of syncitium-inducing isolates in patients with acquired immuno-deficiency syndrome (AIDS) and AIDS-related complex (ARC).
J Virol
62:2026, 1988[Abstract/Free Full Text]
79.
Ho DD:
Toward HIV eradication or remission: the task ahead.
Science
280:1866, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
B. Liu, A. M. Woltman, H. L. A. Janssen, and A. Boonstra
Modulation of dendritic cell function by persistent viruses
J. Leukoc. Biol.,
February 1, 2009;
85(2):
205 - 214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Trapp, N. R. Derby, R. Singer, A. Shaw, V. G. Williams, S. G. Turville, J. W. Bess Jr., J. D. Lifson, and M. Robbiani
Double-Stranded RNA Analog Poly(I:C) Inhibits Human Immunodeficiency Virus Amplification in Dendritic Cells via Type I Interferon-Mediated Activation of APOBEC3G
J. Virol.,
January 15, 2009;
83(2):
884 - 895.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. van Montfort, A. A. M. Thomas, G. Pollakis, and W. A. Paxton
Dendritic Cells Preferentially Transfer CXCR4-Using Human Immunodeficiency Virus Type 1 Variants to CD4+ T Lymphocytes in trans
J. Virol.,
August 15, 2008;
82(16):
7886 - 7896.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Gilbert, R. Cantin, C. Barat, and M. J. Tremblay
Human Immunodeficiency Virus Type 1 Replication in Dendritic Cell-T-Cell Cocultures Is Increased upon Incorporation of Host LFA-1 due to Higher Levels of Virus Production in Immature Dendritic Cells
J. Virol.,
July 15, 2007;
81(14):
7672 - 7682.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. U. Cameron, A. J. Handley, D. C. Baylis, A. E. Solomon, N. Bernard, D. F. J. Purcell, and S. R. Lewin
Preferential Infection of Dendritic Cells during Human Immunodeficiency Virus Type 1 Infection of Blood Leukocytes
J. Virol.,
March 1, 2007;
81(5):
2297 - 2306.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Gilbert, C. Barat, R. Cantin, and M. J. Tremblay
Involvement of Src and Syk Tyrosine Kinases in HIV-1 Transfer from Dendritic Cells to CD4+ T Lymphocytes
J. Immunol.,
March 1, 2007;
178(5):
2862 - 2871.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Donaghy, J. Wilkinson, and A. L. Cunningham
HIV interactions with dendritic cells: has our focus been too narrow?
J. Leukoc. Biol.,
November 1, 2006;
80(5):
1001 - 1012.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Holl, M. Peressin, S. Schmidt, T. Decoville, S. Zolla-Pazner, A.-M. Aubertin, and C. Moog
Efficient inhibition of HIV-1 replication in human immature monocyte-derived dendritic cells by purified anti-HIV-1 IgG without induction of maturation
Blood,
June 1, 2006;
107(11):
4466 - 4474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Burleigh, P.-Y. Lozach, C. Schiffer, I. Staropoli, V. Pezo, F. Porrot, B. Canque, J.-L. Virelizier, F. Arenzana-Seisdedos, and A. Amara
Infection of Dendritic Cells (DCs), Not DC-SIGN-Mediated Internalization of Human Immunodeficiency Virus, Is Required for Long-Term Transfer of Virus to T Cells
J. Virol.,
March 15, 2006;
80(6):
2949 - 2957.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cavrois, J. Neidleman, J. F. Kreisberg, D. Fenard, C. Callebaut, and W. C. Greene
Human Immunodeficiency Virus Fusion to Dendritic Cells Declines as Cells Mature
J. Virol.,
February 15, 2006;
80(4):
1992 - 1999.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Wiley and S. Gummuluru
Immature dendritic cell-derived exosomes can mediate HIV-1 trans infection
PNAS,
January 17, 2006;
103(3):
738 - 743.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Williams, D. Mondal, and K. C. Agrawal
The HIV-1 Tat Protein Enhances Megakaryocytic Commitment of K562 Cells by Facilitating CREB Transcription Factor Coactivation by CBP
Experimental Biology and Medicine,
December 1, 2005;
230(11):
872 - 884.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Smed-Sorensen, K. Lore, J. Vasudevan, M. K. Louder, J. Andersson, J. R. Mascola, A.-L. Spetz, and R. A. Koup
Differential Susceptibility to Human Immunodeficiency Virus Type 1 Infection of Myeloid and Plasmacytoid Dendritic Cells
J. Virol.,
July 15, 2005;
79(14):
8861 - 8869.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Nobile, C. Petit, A. Moris, K. Skrabal, J.-P. Abastado, F. Mammano, and O. Schwartz
Covert Human Immunodeficiency Virus Replication in Dendritic Cells and in DC-SIGN-Expressing Cells Promotes Long-Term Transmission to Lymphocytes
J. Virol.,
May 1, 2005;
79(9):
5386 - 5399.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Popov, A.-L. Chenine, A. Gruber, P.-L. Li, and R. M. Ruprecht
Long-Term Productive Human Immunodeficiency Virus Infection of CD1a-Sorted Myeloid Dendritic Cells
J. Virol.,
January 1, 2005;
79(1):
602 - 608.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Balabanian, J. Harriague, C. Decrion, B. Lagane, S. Shorte, F. Baleux, J.-L. Virelizier, F. Arenzana-Seisdedos, and L. A. Chakrabarti
CXCR4-Tropic HIV-1 Envelope Glycoprotein Functions as a Viral Chemokine in Unstimulated Primary CD4+ T Lymphocytes
J. Immunol.,
December 15, 2004;
173(12):
7150 - 7160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Ganesh, K. Leung, K. Lore, R. Levin, A. Panet, O. Schwartz, R. A. Koup, and G. J. Nabel
Infection of Specific Dendritic Cells by CCR5-Tropic Human Immunodeficiency Virus Type 1 Promotes Cell-Mediated Transmission of Virus Resistant to Broadly Neutralizing Antibodies
J. Virol.,
November 1, 2004;
78(21):
11980 - 11987.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. de Repentigny, D. Lewandowski, and P. Jolicoeur
Immunopathogenesis of Oropharyngeal Candidiasis in Human Immunodeficiency Virus Infection
Clin. Microbiol. Rev.,
October 1, 2004;
17(4):
729 - 759.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Granelli-Piperno, A. Golebiowska, C. Trumpfheller, F. P. Siegal, and R. M. Steinman
HIV-1-infected monocyte-derived dendritic cells do not undergo maturation but can elicit IL-10 production and T cell regulation
PNAS,
May 18, 2004;
101(20):
7669 - 7674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Poudrier, X. Weng, D. G. Kay, Z. Hanna, and P. Jolicoeur
The AIDS-Like Disease of CD4C/Human Immunodeficiency Virus Transgenic Mice Is Associated with Accumulation of Immature CD11bHi Dendritic Cells
J. Virol.,
November 1, 2003;
77(21):
11733 - 11744.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Turville, J. Wilkinson, P. Cameron, J. Dable, and A. L. Cunningham
The role of dendritic cell C-type lectin receptors in HIV pathogenesis
J. Leukoc. Biol.,
November 1, 2003;
74(5):
710 - 718.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. Sanders, E. C. de Jong, C. E. Baldwin, J. H. N. Schuitemaker, M. L. Kapsenberg, and B. Berkhout
Differential Transmission of Human Immunodeficiency Virus Type 1 by Distinct Subsets of Effector Dendritic Cells
J. Virol.,
June 27, 2002;
76(15):
7812 - 7821.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X.-Q. Zhao, X.-L. Huang, P. Gupta, L. Borowski, Z. Fan, S. C. Watkins, E. K. Thomas, and C. R. Rinaldo Jr.
Induction of Anti-Human Immunodeficiency Virus Type 1 (HIV-1) CD8+ and CD4+ T-Cell Reactivity by Dendritic Cells Loaded with HIV-1 X4-Infected Apoptotic Cells
J. Virol.,
February 22, 2002;
76(6):
3007 - 3014.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Fantuzzi, I. Canini, F. Belardelli, and S. Gessani
HIV-1 gp120 Stimulates the Production of {{beta}}-Chemokines in Human Peripheral Blood Monocytes Through a CD4-Independent Mechanism
J. Immunol.,
May 1, 2001;
166(9):
5381 - 5387.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Bakri, C. Schiffer, V. Zennou, P. Charneau, E. Kahn, A. Benjouad, J. C. Gluckman, and B. Canque
The Maturation of Dendritic Cells Results in Postintegration Inhibition of HIV-1 Replication
J. Immunol.,
March 15, 2001;
166(6):
3780 - 3788.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Ancuta, Y. Bakri, N. Chomont, H. Hocini, D. Gabuzda, and N. Haeffner-Cavaillon
Opposite Effects of IL-10 on the Ability of Dendritic Cells and Macrophages to Replicate Primary CXCR4-Dependent HIV-1 Strains
J. Immunol.,
March 15, 2001;
166(6):
4244 - 4253.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Pohlmann, E. J. Soilleux, F. Baribaud, G. J. Leslie, L. S. Morris, J. Trowsdale, B. Lee, N. Coleman, and R. W. Doms
DC-SIGNR, a DC-SIGN homologue expressed in endothelial cells, binds to human and simian immunodeficiency viruses and activates infection in trans
PNAS,
February 27, 2001;
98(5):
2670 - 2675.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M Neumann, E Afonina, F Ceccherini-Silberstein, S Schlicht, V Erfle, G. Pavlakis, and R Brack-Werner
Nucleocytoplasmic transport in human astrocytes: decreased nuclear uptake of the HIV Rev shuttle protein
J. Cell Sci.,
January 5, 2001;
114(9):
1717 - 1729.
[Abstract]
[PDF]
|
|
|
|
|
|
|
R. S. Kornbluth
The emerging role of CD40 ligand in HIV infection
J. Leukoc. Biol.,
September 1, 2000;
68(3):
373 - 382.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Mummidi, G. Catano, L. Lam, A. Hoefle, V. Telles, K. Begum, F. Jimenez, S. S. Ahuja, and S. K. Ahuja
Extensive Repertoire of Membrane-bound and Soluble Dendritic Cell-specific ICAM-3-grabbing Nonintegrin 1 (DC-SIGN1) and DC-SIGN2 Isoforms. INTER-INDIVIDUAL VARIATION IN EXPRESSION OF DC-SIGN TRANSCRIPTS
J. Biol. Chem.,
August 24, 2001;
276(35):
33196 - 33212.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION