|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3940-3948
Expression and Functional Characterization of the -Isoform of the
Folate Receptor on CD34+ Cells
By
Joseph A. Reddy,
Laura S. Haneline,
Edward F. Srour,
Asok C. Antony,
D. Wade Clapp, and
Philip S. Low
From the Department of Chemistry, Purdue University, West Lafayette;
the Department of Pediatrics, Herman B. Wells Center for Pediatric
Research and the Department of Microbiology/Immunology, the Division of
Hematology-Oncology, the Department of Medicine, Indiana University
School of Medicine, Indianapolis; and the Roudebush Veterans Affairs
Medical Center, Indianapolis, IN.
 |
ABSTRACT |
We have investigated the expression and functional competence of
folate receptor (FR) isoforms on human hematopoietic cells. Using
immunofluorescence and reverse transcriptase-polymerase chain reaction
(RT-PCR) methodology, we find that a substantial fraction of
low-density mononuclear and CD34+ cells express both the
and isoforms of FR. The isoform of FR (the form most
commonly found on cancer cells) was surprisingly absent from all
hematopoietic cells examined. Compared with KB cells (a human cell line
known for its elevated expression of FR- ), the abundance of FR-
on CD34+ cell surfaces was relatively low ( 8% of KB
cell levels). Because many antifolates and folic acid-linked
chemotherapeutic agents enter malignant cells at least partially via FR
endocytosis, it was important to evaluate the ability of FR on
CD34+ cells to bind folic acid (FA). Based on three FR
binding assays, freshly isolated CD34+ cells were found
to display no affinity for FA. Thus, regardless of whether steps were
taken to remove endogenous folates before receptor binding assays, FR
on primitive hematopoietic cells failed to bind 3H-FA,
fluorescein isothiocyanate (FITC)-linked FA, or FA-derivatized liposomes. In contrast, analogous studies on KB cells showed high levels of receptor binding for all three FR probes. These studies show
that although multipotent hematopoietic progenitor cells express FR,
the receptor does not transport significant amounts of FA.
Consequently, antifolates and FA-linked chemotherapeutic agents that
can be engineered to enter malignant cells exclusively through the FR
should not harm progenitor/stem cell function.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE FOLATE RECEPTOR (FR) is a
single-chain cell-surface glycoprotein that binds folic acid (FA) and
mediates uptake of the vitamin by receptor-mediated
endocytosis.1-4 Three isoforms of the FR have been
identified and cloned to date. These are FR- from KB
cells,5 CaCo-2 cells,6 and
placenta7; FR- from placenta8; and FR-
and its truncated cogener, FR- ', from malignant hematopoietic
cells.9 These three FR isoforms share 70% sequence
identity,8 but FR- and FR- are attached to the cell
surface by a glycosylphosphatidylinositol anchor, while FR- is
secreted due to lack of an efficient signal for
glycosylphosphatidylinositol modification.9,10 FR- is
also generally expressed at levels much lower than FR- and FR- .
Despite divergence in their carboxyterminal sequences, FR- and
FR- display relatively similar affinities for FA, with
Kd values of 10 10 mol/L
and 10 9 mol/L, respectively.11 However,
FR- and FR- differ in their stereospecificities for reduced
folate coenzymes, with FR- having a significantly higher affinity
(50-fold) than FR- for the physiologic (6S) diastereoisomer of
N5-methyltetrahydrofolate.11-13 Importantly,
even the isoform of FR binds FA much more avidly ( 10
times) than it does any of the more reduced forms of the
vitamin.11
FR isoforms are not evenly distributed among the various tissues and
cell types of the body. Rather, FR- is primarily expressed on normal
epithelial cells and upregulated in malignant tissues deriving from the
same cell types.14-17 Similarly, FR- , which is less well
characterized than FR- , may be overexpressed primarily in neoplastic
tissues of nonepithelial origin.15 As a consequence of this
upregulation, FR has not only been exploited clinically as a diagnostic
marker for tumor tissue,14-17 but it has further been used
preclinically as a targeting receptor for delivery of imaging and
therapeutic agents to cancer cells.18-20 Thus, when FA is
covalently linked to a molecule via its -carboxyl group, its
affinity for cell-surface FR remains essentially unaltered, and the
cell internalizes the FA-conjugate in a manner similar to FA. Based on
this strategy, FR has been used to target FA-conjugated toxins,21 FA-linked imaging agents,18,22
FA-tethered liposomes,23,24 FA-drug
conjugates,20 FA-linked genes,25,26
FA-derivatized antibodies,27,28 and various
antifolates29 to cancer cells.
A major concern with any form of chemotherapy or radiation therapy
centers on the toxicity of the therapeutic agent to the cancer relative
to its toxicity to the bone marrow. Within the bone marrow are
hematopoietic stem and progenitor cells that exhibit the ability to
proliferate and differentiate into multiple hematopoietic lineages.
Because FA-linked therapeutic agents do not discriminate among the
various FR-expressing cells, the relative abundance and functional
activity of FR on malignant cells versus hematopoietic stem cells may
be decisive in determining which tumors can be targeted with acceptable
selectivity over stem cells. Although no information is currently
available on FR levels in CD34+ cells (ie, the
hematopoietic cell population containing stem and progenitor cells), FR
have been identified on mature erythrocytes, albeit in inactive
form,30 and also on erythroid hematopoietic progenitor
cells (burst-forming unit-erythroid [BFU-E]).31 In addition, FR have been detected on pluripotential (colony-forming unit
granulocyte, erythroid, monocyte, megakaryocyte [CFU-GEMM]) and
myeloid (colony-forming unit-granulocyte-macrophage [CFU-GM]) hematopoietic progenitors,31 as well as differentiated
myelocytic cells.32 In this study, we have undertaken to
evaluate the abundance and functional activity of FR on
CD34+ bone marrow cells. We report here that only the isoform and not the isoform of FR is measurably expressed on
CD34+ cells, albeit at lower levels than those observed for
FR- on cultured cancer cells. We further show that FR- on
CD34+ cells is unable to bind FA, even though the
-isoform is shown to readily mediate uptake of 3H-FA and
FA-conjugates after transfection into A549 cells (an FR-negative cell line).
 |
MATERIALS AND METHODS |
Cells.
KB cells, a human nasopharyngeal epidermal carcinoma cell line, and
A549 cells, a human lung carcinoma cell line (Purdue Cancer Center,
West Lafayette, IN), were cultured at 37°C in a humidified atmosphere containing 5% CO2. The cells were grown
continuously as a monolayer in folate-deficient Dulbecco's modified
Eagle's medium (FDMEM) (GIBCO-BRL, Gaithersburg, MD) supplemented with 10% heat inactivated fetal bovine serum (Hyclone Laboratories, Logan,
UT), penicillin (50 U/mL), streptomycin (50 µg/mL), and 2 mmol/L
L-glutamine. The normal complement of endogenous folates in the fetal
bovine serum brings the net folate concentration in the growth medium
to the low end of the physiologic range of folate concentrations found
in human plasma.
Bone marrow cells were obtained in heparinized syringes from healthy
adult donors. Low-density mononuclear cells (LDMNC) were prepared by
centrifugation on Ficoll-Hypaque (density 1.077 g/mL; Sigma Chemical
Company, St Louis, MO) for 30 minutes at 25°C. The institutional
review boards at Indiana and Purdue University have approved all experiments.
Specificity of the anti-FR antiserum.
The human placental FR was isolated to apparent homogeneity based on
its migration as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analytical gel filtration
chromatography.33 This purified protein was used to
generate polyclonal rabbit anti-human placental FR antiserum.
Subsequent studies8 have indicated that the purified human
placental FR used to generate the polyclonal antiserum contains both
FR- and FR- isoforms. Consistent with this observation, we have
found that the anti-FR antiserum cross-reacts with both and FR
isoforms. Additional data on the homogeneity of the placental FR
antigen used to generate the antiserum has been provided by
immunodiffusion studies.34
Studies that demonstrate that the strong fluorescence on the surface of
LDMNC from normal human bone marrow is the result of interaction of a
single species with the anti-FR antiserum have also been
published.34 In addition, following the surface iodination
of 9 × 107 LDMNC, only a single species of
glycosylated protein at 44 kD was immunoprecipitated
with anti-FR antiserum. Moreover, immunoprecipitation of particulate
membrane proteins from 4 × 108 LDMNC similarly
identified only a single glycosylated FR. Therefore, these data show
that anti-FR antiserum recognizes only a single species on the surface
of LDMNC.
Flow cytometric analysis of LDMNC and KB cells.
To phenotypically define which subsets of CD34+ cells
express FR, 2 × 106 LDMNC were stained with
anti-CD34-allophycocyanin (APC) and
anti-CD38-phycoerythrin (PE) or anti-CD15-PE (PharMingen, San Diego,
CA) for 20 minutes at 4°C and washed twice before anti-FR
incubation. For cell-surface labeling of FR, 2 × 106
LDMNC or KB cells were incubated with either 2 µL rabbit preimmune serum or rabbit anti-human FR antibody for 30 minutes on ice. The cells
were then washed, incubated similarly with fluorescein isothiocyanate
(FITC)-labeled goat anti-rabbit IgG, washed again three times, and
analyzed by flow cytometry on a FACScan (Becton Dickinson, San Jose, CA).
Purification of CD34+ cells by immunomagnetic selection.
CD34+ cells were initially purified by immunomagnetic
selection from LDMNC as previously described.35 Briefly,
mouse anti-human CD34 antibody (9C5; Baxter, Santa Anna, CA) was added
to cells (0.5 mg/106 LDMNC) and incubated on ice for 15 minutes. Cells were incubated with immunomagnetic microspheres coated
with sheep anti-mouse IgG1 (Dynal, Lake Success, NY) for 30 minutes at 4°C. The cell mixture was placed on a Dynabead magnet
(Dynal). In some experiments, adherent cells were enzymatically cleaved
from microspheres with chymopapain (Baxter, McGaw Park, IL). The magnet
was reapplied and CD34+ cells were collected from the
nonadherent fraction. The CD34+ cells were placed in
folate-deficient RPMI (GIBCO-BRL) containing 2% fetal calf serum and
either used immediately or stimulated overnight in the presence of 200 U/mL recombinant interleukin-6 (Boehringer Mannheim, Indianapolis, IN)
and 100 ng/mL recombinant stem cell factor (a generous gift from Amgen,
Thousand Oaks, CA). In other experiments, CD34+ cells were
purified using the MACS system (Miltyeni Biotech, Auburn, CA), which
does not require the use of chymopapain. Results were similar using
either system of CD34+ purification. CD34+ cell
purity was determined by fluorescence cytometry and ranged from 87% to
95% after immunomagnetic selection. When desired, CD34+
cells were washed with 1 mL phosphate-buffered saline (PBS) two times
and once with 1 mL 0.15 mol/L NaCl, 10 mmol/L Na-acetate, adjusted to
pH 3.5 to strip any externally bound folate from the cell surface.
After folate elution, the cells were returned to FDMEM.
Purification of CD34+ cells for reverse
transcriptase-polymerase chain reaction (RT-PCR).
The adherent cells were incubated with mouse anti-human CD34 conjugated
with PE (PharMingen, San Diego, CA). Cells were sorted by FACS (Becton
Dickinson) to obtain pure populations of hematopoietic cells for
RT-PCR. Bone marrow samples contained 1 to 2 × 106
CD34+ cells. Postsort analysis of cells was performed using
fluorescence cytometry to ensure purity.
RT-PCR.
Total RNA was isolated from CD34+ cells using the
Tri-reagent method exactly as specified by the manufacturer (Molecular
Research Center, Cincinnati, OH). A total of 0.5 µg of RNA was
reverse transcribed using a reverse transcription system as specified by the manufacturer (Promega, Madison, WI). Mouse RNA was used as a
negative control for the reverse transcription.
Amplification of total cellular RNA from each hematopoietic cell
population was performed using primers and conditions that have been
previously reported.9 The primers that were used and the
expected size of RNA amplified from each isoform are listed below.
|
5'CATGGCTGCAGCATAGAACCTCGC3' (sense) 639 bp
|
|
5'GTAGTAGGGGAGGCTCAGACAAGG 3' (antisense)
|
|
5'CATGGCTGCAGCATAGAACCTCGC3' (sense) 501 bp
|
|
5'CACAGCCAGCACCAGCCAGGAGCTG3' (antisense)
|
|
5'AGCGCATTCTGAACGTGCCCCTG3' (sense) 357 bp
|
|
5'CAGGAATCAATAATCCCACGAGACCG3' (antisense)
|
|
-actin 5'TGACGGGGTCACCCACACTGTGCCCATCTA3'
(sense)
361 bp
|
|
5'CTAGAAGCATTGCGGTGGACGATGGAGGG3' (antisense)
|
A total of 20 µL of PCR reaction mixture was electrophoresed on a 2%
agarose gel and transferred to a nylon filter (Gene Screen Plus, New
England Nuclear Corp, Boston, MA). The filter was hybridized using the
appropriate FR isoform cDNA labeled with 32P deoxycytidine
triphosphate (dCTP). Hybridization was performed at
68°C for 24 hours. Filters were washed at 55°C for 15 minutes and exposed to Kodak XAR film (Eastman-Kodak, Rochester,
NY) at 80°C for 24 hours. RNA samples were
amplified without reverse transcription to ensure there was no
contaminating genomic DNA. cDNAs for the , , and FR isoforms
were used as positive PCR controls. -Actin was used as an internal control.
Liposome preparation.
FA-derivatized liposomes were constructed by conjugating FA to
distearoylphosphatidylethanolamine (DSPE) via a 250Å long
polyethyleneglycol (PEG) spacer (FA-PEG-PE), and incorporating the FA
tethered lipid at 2 mol% in a 1:1 molar mixture of egg
phosphatidylcholine and cholesterol.23,24 Control
(nontargeted) liposomes were similarly formulated using nontargeted
PEG-PE in place of FA-PEG-PE. Briefly, 50 mg of egg
phosphatidylcholine, 16.5 mg of cholesterol (Avanti Polar Lipids,
Alabaster, AL), and 5 mg of FA-PEG-DSPE or PEG-DSPE were dissolved in 3 mL of chloroform. The lipids were dried under reduced pressure to form
a thin film and then rehydrated in 0.5 mL of 10 mmol/L calcein in PBS,
pH 7.4. The suspension was then subjected to 10 cycles of freezing and
thawing and extruded 10 times through a 100-nm polycarbonate membrane
(Nucleopore, Pleasanton, CA). The resulting liposomes encapsulating the
fluorescent dye were then separated from free calcein on a Sepharose
CL-4B column (Pharmacia, Uppsala, Sweden) preequilibrated with PBS. The
final lipid concentration was 67 mg/mL.
Uptake of FA-PEG-liposomes by cells.
FA-PEG-liposomes or PEG-liposomes encapsulating calcein (50 µL) were
diluted in 1 mL FDMEM and added to CD34+ cells (1 × 105) or to monolayers of KB cells (5 × 105). The cells were then incubated at 37°C for 4 hours. The cells were washed three times with PBS and analyzed by
fluorescence cytometry on a FACScan (Becton Dickinson). From every
sample, 10,000 gated events (light scatter gates were used to discard cellular debris) were collected in the list-mode. List-mode data were
then analyzed using PC-LYSY5 analysis software (Becton Dickinson).
Retroviral packaging cell line construction.
The retroviral backbone MSCVneo was obtained from Dr Robert Hawley
(Sunnybrook Health Science Centre, Toronto, Ontario,
Canada).36 All molecular biology reagents
were obtained from Boehringer Mannheim unless otherwise stated. MSCVneo
plasmid was digested with XhoI restriction endonuclease. The
cDNA for the FR- isoform, generously provided by Dr Manohar Ratnam
(Medical College of Ohio, Toledo), was adapted with
XhoI linkers and ligated into the retroviral backbone using T4
DNA ligase. The ligated product was transformed into competent DH5
cells (GIBCO-BRL), plated onto ampicillin plates, and colony
hybridization was performed on resistant colonies using the full cDNA
as a probe. The completed retrovirus plasmid was transfected as
previously described37,38 into GP+Am12 packaging cells
provided by Dr Arthur Bank (Columbia University, New York, NY).39 Supernatant was collected from
individual clones and titered on NIH3T3 cells for neomycin resistance
as previously described.37,38 The clone chosen for all
further experimentation had a neomycin resistance titer of 1 × 106.
Expression of FR- in A549 cells.
A549 cells were transfected with recombinant retroviral supernatants
from the above high titer FR- clone. Transduced A549/FR- cells
were selected for neomycin resistance gene expression by growing in 1.0 mg geneticin/mL for 4 weeks. Untransduced A549 cells were used as the
negative control in all experiments.
Synthesis of FA-conjugated I125-labeled bovine serum
albumin (BSA).
Folic acid (10 mg; Sigma Chemical Co) was dissolved in anhydrous
dimethyl sulphoxide (DMSO) and incubated under stirring with 25 mg
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide for 30 minutes at room
temperature. The solution was then added to 150 mg BSA in 2 mL PBS, pH
7.4. After a 2-hour incubation with stirring at room temperature, the
reaction mixture was passed through a PD-10 desalting column (Bio-Rad
Laboratories, Hercules, CA) equilibrated in PBS to separate the
conjugated protein from excess free FA. The extent of FA conjugation
was determined to be approximately 2.5 FAs per BSA
molecule.40 To label the FA-BSA conjugate with I125, FA-BSA was dissolved in PBS and added to prewashed
Iodobeads (Pierce, Rockford, IL). NaI125 (Amersham,
Arlington Heights, IL) was then added and the mixture was
incubated for 30 minutes at room temperature. Free I125 was
separated from FA-BSA-I125 using a PD-10 desalting column
equilibrated in PBS, pH 7.4.
Measurement of 3H-FA or I125-BSA-FA uptake.
Cells were plated in 35-mm culture dishes at 5 × 105
cells per dish 48 hours before each experiment. Cells were incubated
with 100 nmol/L I125-BSA-FA or 3H-FA in 1 mL of
folate-deficient medium for 2 hours at 37°C. Each dish was then
washed either with 1 mL PBS three times to remove unbound FA or
FA-conjugate, or with 1 mL PBS two times and once with 1 mL 0.15 mol/L
NaCl, 10 mmol/L Na-acetate, adjusted to pH 3.5 to remove both unbound
material and strip any externally bound FA/FA-conjugates from the
surface. Cells were then lysed in 1% Triton X-100. The number of
molecules taken up/endocytosed per cell was calculated from the
measured radioactivity in the lysis medium.
3H-FA binding assay for secreted FR.
KB cells (5 × 105) or CD34+ cells (5 × 106) were washed twice with 1 mL PBS and incubated
with 1 mL of FDMEM containing 50 pmol of 3H-FA at 37°C
for either 2 hours or 20 hours. The medium was then collected and any
suspended cells were removed by centrifuging at 5,000g for 15 minutes. The supernatant was then fractionated on a Sephadex G-25
column equilibrated in PBS to separate free 3H-FA from
protein bound 3H-FA. The radioactivity in each 0.25-mL
fraction was measured in a liquid scintillation counter.
 |
RESULTS |
To obtain an initial indication of whether CD34+
hematopoietic cells might express an FR, a polyclonal antibody that
recognizes both FR- and FR- was incubated with purified
CD34+ cells and quantitated using fluorescence cytometry.
As shown in Fig 1A, a measurable fraction
of CD34+ cells expressed a cross-reactive polypeptide,
albeit at a relatively low level. Thus, using a gate that excluded
greater than 98% of cells labeled with preimmune serum, 20% of
CD34+ cells were FR positive as detected by the FR
antibody. These data suggest that a significant number of hematopoietic
stem/progenitor cells synthesize an isoform of FR and express FR on the
cell surface.

View larger version (23K):
[in this window]
[in a new window]
| Fig 1.
Flow cytometric analysis for expression of the FR. (Top)
CD34+ cells and KB cells were incubated with rabbit
preimmune serum or rabbit polyclonal antibody to placental FR for 30 minutes, washed, and incubated with secondary antibody (goat
anti-rabbit IgG-FITC) for 30 minutes to evaluate FR expression on each
cell population. Cells were then analyzed by fluorescence flow
cytometry, where log cell fluorescence is plotted on the x-axis and
cell number on the y-axis. The filled peak corresponds to cells treated
only with preimmune serum, while the open peak shows cells labeled with
anti-FR IgG. The results indicate that both CD34+ cells
and KB cells express FR on their cell surfaces. (Bottom)
CD34+ cells and KB cells were incubated with
FA-PEG-liposomes or PEG-liposomes containing calcein for 4 hours,
washed, and analyzed by fluorescence flow cytometry. The filled peak
represents PEG liposome staining and the open peak represents
FA-PEG-liposome staining. For CD34+ cells, the peaks for
FA-PEG-liposomes and PEG-liposomes overlay one another, showing no
detectable binding to FR. In contrast, FA-PEG-liposomes bind well to KB
cells.
|
|
For FR to be useful as a port of entry for the selective uptake of
antifolates and FA-conjugated chemotherapeutic drugs by cancer cells,
the level of FR expression on cancer cells must significantly exceed
its level on bone marrow cells. To obtain a preliminary estimate of the
relative magnitude of FR expression on CD34+ cells and
cancer cells, the same analysis was conducted on KB cells, a human
nasopharyngeal epidermal carcinoma cell line known for its elevated
expression of FR- .5 As seen in Fig 1, the mean
fluorescence intensity of the sorted KB cells was 12
times higher than the corresponding value for
CD34+ cells. However, because human ovarian cancer tissue
expresses FR at 1/20 the level of cultured KB cells (Mary Jo Turk,
et al, unpublished observations, May 1998), we conclude
that FR expression on CD34+ cells is comparable to its
expression in at least one human cancer tissue.
Two additional experiments were performed in an attempt to more
accurately quantitate the number of FR on the surface of
CD34+ cells. First, FA-targeted liposomes containing
encapsulated calcein as a fluorescent marker were incubated with both
the CD34+ and KB cells to allow liposome binding and the
consequent quantitation of FR abundance. As shown
previously23,24 and reconfirmed by flow cytometry in Fig 1,
KB cells bind the fluorescent FA-linked liposomes avidly, shifting
several log units along the fluorescence axis after incubation with the
liposomes containing FA-PEG-PE as their targeting ligand. Furthermore,
nontargeted liposomes, containing PEG-PE instead of FA-PEG-PE,
predictably display no affinity for the FR+ cultured cells.
In contrast, CD34+ cells, which exhibited clear immunologic
evidence for cell-surface FR expression, show no capacity to bind
FA-linked liposomes (Fig 1), suggesting that FR on CD34+
cells are unable to bind ligand. To confirm the refractory nature of
the FR on CD34+ cells, the same cells were incubated with
either 100 nmol/L 3H-FA or a FA-FITC conjugate shown
previously to bind avidly to FR-expressing cells. Consistent with the
liposome data, no significant binding of either FA compound is observed
(Fig 2). Finally, to ensure that even very
low levels of FR were not escaping detection, we examined binding with
a high specific activity I125-labeled FA-BSA conjugate and
again found no detectable binding to CD34+ cells (data not
shown). These data suggest that the FR on freshly isolated
CD34+ cells exists in a state that binds neither FA nor its
conjugates.

View larger version (29K):
[in this window]
[in a new window]
| Fig 2.
Comparison of binding of three FR ligands and FR
antiserum to KB and CD34+ cells. KB cells ( ) and
CD34+ cells ( ) were incubated with fluorescent
FA-derivatized liposomes (FA-liposome; 4 hours at 37°C), FA labeled
with fluorescein (FA-FITC; 1 hour at 37°C), 3H-FA
(3H-FA; 2 hours at 37°C), or rabbit antiserum to
placental FR (anti-FR; 30 minutes at 4°C). Fluorescent ligand
binding to cells was quantitated by FACS, while 3H-FA
binding was determined by scintillation counting. Relative uptake of
fluorescent ligands was calculated from the product of average cell
fluorescence intensity and percentage of positively gated cells. To
display the number of 3H-FA molecules taken up per cell on
the same axis as the fluorescent ligands, 3H-FA/cell values
were divided by a factor of 20.
|
|
One possible explanation for the inability of CD34+ cells
to bind FA and its conjugates is that the stem/progenitor cells could secrete significant quantities of FR, which would then compete for
binding to FR on the cell surface. To address this possibility, CD34+ and KB cells were incubated for 2 hours or 20 hours
in their normal growth medium (FDMEM) containing 50 nmol/L
3H-FA to allow 3H-FA binding to any competing
form of FR that might have been secreted/released into the medium.
After incubation, the cell culture medium was collected and analyzed by
gel filtration chromatography for protein bound 3H-FA. As
shown in Fig 3, considerable FA binding
activity was observed in the conditioned medium from the 2-hour
incubated KB cells, but no increase in 3H-FA binding could
be detected in either the 2-hour or 20-hour CD34+ cell
supernatant above the level already present in the unmodified FDMEM.
These data suggest that neither FR- nor any other isoform of the FR
is secreted into the medium of CD34+ cells over at least
the 20-hour duration of the experiment. In contrast, the supernatant
from the KB cells (which numbered 10-fold less than the number of
CD34+ cells used) contained a substantial amount of folate
binding protein not found in the medium in which the cells were grown. This soluble protein could be a released form of FR- , which could have been generated by the action of either a membrane-associated metalloprotease or an endogenous phospholipase.41,42

View larger version (22K):
[in this window]
[in a new window]
| Fig 3.
Gel filtration analysis of FR secretion by KB and
CD34+ cells. KB cells ( ) and CD34+ cells
( , ) were incubated for 2 hours ( , ) or 20 hours ( ) in
FDMEM containing 50 nmol/L 3H-FA. After incubation, the
growth medium was collected, and protein bound 3H-FA was
separated from free 3H-FA by gel filtration chromatography
on a Sephadex G-25 column. For comparison, fresh (unconditioned) FDMEM
was treated with 3H-FA and evaluated similarly ( ).
Protein bound 3H-FA eluted at 3 mL, while free
3H-FA eluted beyond 5 mL. Although considerable
protein-bound 3H-FA was apparently generated during the
2-hour incubation of KB cells, no measurable increase in
3H-FA binding capacity was detected in either the 2-hour or
20-hour supernatant of the CD34+ cells above the level
present in the unconditioned FDMEM.
|
|
An alternative explanation for the inability of FR on CD34+
cells to bind FA proposes that during overnight stimulation of the
cells in folate-deficient medium, the receptor might be degraded by
endogenous proteinases. To explore this issue, freshly isolated CD34+ cells were immediately examined for 3H-FA
binding before they were stimulated with cytokines or processed further
in any manner. As previously seen in Fig 2, the cells were again found
to be totally refractory to the added FA (data not shown). These data
confirm that the FR isoform on the surface of CD34+ cells
does not participate in FA binding.
FR expression increases with differentiation of CD34+
cells.
CD34+ antigen has been used to phenotypically characterize
hematopoietic stem/progenitor cells. CD34+ cells can be
further fractionated into subpopulations of immature and more
differentiated cells by evaluation of coexpression with other antigens.
For example, CD34+CD38+ cells contain more
mature progenitors and differentiated cells than
CD34+CD38 cells, which contain immature
stem/progenitor cells. In addition, coexpression of CD15 and CD34
defines a more differentiated population of myeloid cells. To determine
which subpopulations of CD34+ cells express FR, three-color
flow cytometry was conducted. As shown in
Fig 4A, both
CD34+CD38 and
CD34+CD38+ cells express FR. Interestingly,
CD34+CD38+ cells exhibit a slightly higher
level of FR expression compared with
CD34+CD38 cells. When
CD34+CD15+ cells were similarly evaluated, FR
expression was seen to be even further enhanced, as shown by the
increased fluorescence intensity and increased proportion of cells
expressing the FR (Fig 4B). From these data, it is clear that multiple
subpopulations of CD34+ cells express FR, including the
most immature population evaluated (CD34+CD38 ). Further, these data show
that as CD34+ cells become more differentiated, FR
expression increases.


View larger version (34K):
[in this window]
[in a new window]
| Fig 4.
Comparison of FR expression on multiple subpopulations of
CD34+ cells. LDMNC were stained with anti-CD34-APC and
either (A) anti-CD38-PE or (B) anti-CD15-PE (20 minutes at 4°C).
After washing, the cells were incubated with either rabbit preimmune
serum or anti-FR (30 minutes at 4°C), washed, and incubated with
the secondary antibody, goat anti-rabbit-FITC (30 minutes at 4°C)
before analyzing the cells by three-color fluorescence cytometry. (A)
FR expression (FL1 on x-axis) after anti-FR staining is shown for
CD34+CD38 (light gray) and
CD34+CD38+ (black) cells.
CD34+ cells that were incubated with preimmune serum are
represented by the dark gray peak in both (A and B). These data
indicate that a significant proportion of CD34+ cells
express FR and that CD34+CD38+ cells have
slightly higher levels of FR expression than
CD34+CD38 cells. (B) FR expression levels
on CD34+CD15 (black) and
CD34+CD15+ (light gray) cells are shown on
this histogram. The results show that the more differentiated
CD34+CD15+ cells have an increased
proportion that express FR. In addition,
CD34+CD15+ cells are shifted to the right
further than any other population evaluated, suggesting that these
cells have an increased number of FR/cell.
|
|
and , but not FR isoforms are
expressed on CD34+ cells.
When total RNA from various cell types was reverse transcribed,
amplified by PCR and hybridized using the appropriate 32P
dCTP-labeled FR isoform cDNA, the FR- , FR- , and FR-
transcripts gave the expected cDNA fragments of 639, 501, and 357 bp,
respectively. RT-PCR of LDMNC and CD34+ cells from three
individual bone marrow specimens also yielded reproducible FR isoform
expression patterns. Figure 5 illustrates results obtained from one representative experiment. The data show that
LDMNC do not express FR- , but do express FR- and FR- . Similarly, CD34+ cells express both the and FR
isoforms. Because FR- is secreted and not retained on the cell
surface,9,10 it will not have contributed to the flow
cytometry analysis in Figs 1 and 4. Taken together, these data confirm
the expression of FR in CD34+ cells.

View larger version (17K):
[in this window]
[in a new window]
| Fig 5.
RT-PCR of FR isoforms in hematopoietic cells. RNA was
isolated from LDMNC and CD34+ cells. RNA was reverse
transcribed into cDNA and sequences unique to the , , and FR
isoforms were amplified. PCR reactions were separated on a 2% agarose
gel, transferred to a nylon filter, and hybridized using the
appropriate FR isoform cDNA. cDNAs for each FR isoform were used as
positive controls and mouse RNA was used as a negative control. LDMNC
and CD34+ cells express the FR- and FR- isoforms
but not FR- .
|
|
Evaluation of FR- binding in a transfected cell line.
The lack of detectable FA uptake by FR on CD34+ cells was
not anticipated. Indeed, FA binding to both and isoforms of FR on other cell types has already been documented,11 and
endocytosis by FR- receptors is equally well
established.1 A very recent study has also suggested that
FR- can mediate endocytosis of 3H-FA.43
Nevertheless, to confirm that FR-mediated endocytosis of FA and its
conjugates can indeed be catalyzed by isoform receptors, two
additional studies were conducted. First, a cultured cell line (A549
cells) lacking measurable FR was transduced with FR- and then shown
to express the FR transgene product on its cell surface (compare FACS
of the parent and FR- transduced A549 cells in
Fig 6A). Examination of 3H-FA
uptake by the same cells (Fig 6B) shows that the A549/FR- cells bind
significantly more of the labeled ligand (1.1 × 106
molecules/cell) than the A549 controls (2.1 × 105
molecules/cell). Further, when the cells are briefly subjected to low
pH treatment to remove externally bound folate, 7.6 × 105 molecules of 3H-FA remain associated with
the A549/ -FR cells. Because this fraction of acid resistant ligand
is generally accepted as the internalized population of
3H-FA, we conclude that A549 cells expressing FR- are
capable of both binding and internalizing 3H-FA.



View larger version (53K):
[in this window]
[in a new window]
| Fig 6.
Evaluation of the binding and endocytosis of
3H-FA and FA-labeled bovine serum albumin by cultured cells
lacking (A549) or expressing (A549/FR- ) the isoform of the FR.
(A) A549 cells, a human lung carcinoma cell line expressing no
detectable FR, were transfected with the isoform of FR
(A549/ -FR) and examined by flow cytometry for expression of the isoform, as described in Materials and Methods. The filled peaks
correspond to cells treated only with preimmune serum, while the open
peaks show cells labeled with anti-FR IgG. (B) Cells were incubated
with 100 nmol/L 3H-FA for 2 hours at 37°C and then
washed three times in PBS, pH 7.4, to remove unbound
ligand ( ) or three times in sodium acetate buffer, pH 3.5, to strip
all externally bound ligand from the cells ( ). (C) Binding and
endocytosis of 125I-labeled serum albumin (100 nmol/L) was
conducted similarly, except to distinguish specific from nonspecific
binding, uptake was also evaluated in the presence of a 10,000 times molar excess of free FA to competitively block all
folate-specific sites ( ).
|
|
Because 3H-FA, but not FA-linked macromolecules, can also
enter cells via a reduced folate carrier,44 a second
experiment was conducted to unequivocally establish the ability of
FR- to mediate internalization of FA/FA-conjugates by an endocytic
mechanism. For this purpose, 125I-labeled bovine serum
albumin was either derivatized covalently with FA or left unmodified,
and its association with A549/FR- cells was quantitatively examined.
As seen in Fig 6C, FA-derivatized albumin is taken up by A549/FR-
cells in a manner that is competitively blocked by excess free FA,
indicating that its cell association is mediated by the FR. Retention
of roughly half of this bound radioactivity after removal of
surface-associated material by low pH wash further documents that part
of the FA-derivatized 125I-labeled serum albumin has been
endocytosed. In contrast, neither binding nor endocytosis of FA-linked
serum albumin is observed to exceed nonspecific binding (binding not
competitively blocked by free FA) by untransduced A549 cells. These
data firmly establish the ability of FR- to facilitate uptake of FA
and its covalent conjugates by receptor-mediated endocytosis, and they
also suggest that CD34+ cells must process or present the
receptor differently to display it at the cell surface in a nonbinding state.
 |
DISCUSSION |
We have shown that a subpopulation of CD34+ hematopoietic
cells expresses the isoform of FR on its cell surfaces, and that although this isoform can mediate endocytosis of FA and its conjugates in other cell types, it is unable to facilitate detectable FA transport
in CD34+ cells. Unfortunately, despite several attempts to
clarify this anomalous behavior, the absence of folate binding activity
by FR on CD34+ remains unexplained. Indeed, several
possibilities were considered: first, because FR- is anchored to the
membrane by a glycosylphosphatidylinositol-anchor, it was possible
that the small amounts of glycosylphosphatidylinositol-specific phospholipase C/D that are normally present in fetal calf serum could
have cleaved and released the FR from the membrane. However, no FR
could be detected in the conditioned medium from CD34+cells
(Fig 3), and furthermore, had FR been released, no FR antigen would
have been observed on the CD34+cells, because the anti-FR
antiserum was raised against a C-terminally truncated
(metalloprotease-generated) FR protein and does not recognize the
glycosylphosphatidylinositol-anchor or the C-terminal residues of FR. A
second possibility is that the chymopapain used during processing of
some preparations of CD34+ cells (see Materials and
Methods) could have somehow altered folate binding without releasing
the protein antigen from the cell surface. To resolve this issue, we
performed the LDMNC sorting/processing in the absence of chymopapain
and still obtained similar results. The third possibility was that the
endogenous folate binds so tightly to the FR that conventional
acid-stripping methods failed to release it from the cell surface. This
is, however, unlikely based on the lower affinity of FR- when
compared with FR- (which is easily stripped of bound folate by acid
treatment). Thus, none of these trivial possibilities can explain our data.
While the absence of FA binding activity may at first seem perplexing,
it is at least not inconsistent with recent observations on other
hematopoietic cells. Thus, Antony et al30 have previously described the expression of an inactive FR on erythrocytes and their
precursor cells, and Ratnam et al will soon be reporting a similar
phenomenon for neutrophils (M. Ratnam, personal communication, September 1998). Although Antony et al31,34
have also provided evidence that a functional FR is essential for
normal differentiation of LDMNC into their mature forms, their
investigations were conducted on cells that had been aggressively
stimulated to differentiate for 7 to 14 days and not on the freshly
isolated quiescent CD34+ cells used here. It is, therefore,
conceivable that a change in the functionality of FR could ensue in
response to a change in proliferation/differentiation of hematopoietic
cells. This hypothesis is consistent with our observations that
CD34+CD38+ cells and CD34+
CD15+ cells exhibited progressively increasing FR
expression when compared with more immature subpopulations of
CD34+ cells and with the earlier data.34 It
will obviously be important to define the stimuli that might promote
such a change in the activity of hematopoietic cell surface FRs.
Given the above observation on FR functionality in freshly isolated
CD34+ cells, the question naturally arises as to why the
primitive hematopoietic cells express any FR at all. Three tentative
explanations can be envisioned. First, FR- may serve a function in
CD34+ cells that is distinct from its role in folate
uptake. Thus, IGF-2 receptors also mediate internalization of
mannose-6-phosphate containing ligands,45 and integrin
receptors participate both in signal transduction and cell adhesion
processes.46 If FR- were also to perform an alternative
structural or catalytic function, its refractory response to folates
may, in fact, be incidental. Second, as speculated above, the inactive
FR- could be a precursor or product of the active receptor that will
be/was required for cell function during another stage of cellular
development. Thus, a number of well-characterized receptors require
stimulation before they express their biologic activity (eg, integrin
IIb/IIIa during platelet activation), and many others can be
desensitized/inactivated after execution of their normal function.
Finally, the inactive FR- on CD34+ cells may, in fact,
serve no function, but simply represent a gene product whose expression
is not well regulated.
Finally, the apparent absence of a functional FR on the surfaces of
hematopoietic progenitor and/or stem cells raises the possibility that
the main route for FA uptake by these cells could be through the
reduced folate carrier. Given the frequent overexpression of FR- on
epithelial cancers14,15 and FR- on nonepithelial cancers,15 the opportunity would seem to exist to design a
chemotherapeutic agent that could avoid bone marrow toxicity. Thus, by
constructing an antifolate or FA-chemotherapeutic agent conjugate that
could enter cells only by FR-mediated endocytosis, FR-expressing cancer cells could be targeted leaving FR-inactive hematopoietic cells unharmed. Several antifolates under current development display a
preference for FR-mediated over carrier-catalyzed uptake,47 and to the best of our knowledge, all FA-drug conjugates enter cells
exclusively via FR-mediated endocytosis. Consequently, this latter
class of drugs should be nondetrimental to hematopoietic cells.
 |
ACKNOWLEDGMENT |
We thank Dr M. Ratnam for his generous gifts of an antibody to FR-
and the cDNA for FR- and YingJuan Lu for providing us with FA-FITC.
 |
FOOTNOTES |
Submitted September 14, 1998; accepted January 22, 1999.
Supported in part by Grants No. GM24417, P50DK49218, IF32, and
HL09851-01 from the National Institutes of Health, Bethesda, MD, and by
Endocyte, Inc, West Lafayette, IN.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Philip S. Low, PhD, Department
of Chemistry, 1393 Brown Bldg, Purdue University, West Lafayette, IN
47907-1393.
 |
REFERENCES |
1.
Kamen BA, Wang MT, Streckfuss AJ, Peryea X, Anderson RGW:
Delivery of folates to the cytoplasm of MA104 cells is mediated by a surface membrane receptor that recycles.
J Biol Chem
263:13602, 1988[Abstract/Free Full Text]
2.
Anderson RGW, Kamen BA, Rothberg KG, Lacey SW:
Potocytosis: Sequestration and transport of small molecules by caveolae.
Science
255:410, 1992[Free Full Text]
3.
Antony AC:
The biological chemistry of folate receptors.
Blood
79:2807, 1992[Free Full Text]
4.
Antony AC:
Folate receptors.
Annu Rev Nutr
16:501, 1996[Medline]
[Order article via Infotrieve]
5.
Sadasivan E, Rothenberg SP:
The complete amino acid sequence of a human folate binding protein from KB cells determined from the cDNA.
J Biol Chem
264:5806, 1989[Abstract/Free Full Text]
6.
Lacey SW, Sanders JM, Rothberg KG, Anderson RG, Kamen BA:
Complementary DNA for the folate binding protein correctly predicts anchoring to the membrane by glycosyl-phosphatidylinositol.
J Clin Invest
84:715, 1989
7.
Elwood PC:
Molecular cloning and characterization of the human folate-binding protein cDNA from placenta and malignant tissue culture (KB) cells.
J Biol Chem
264:14893, 1989[Abstract/Free Full Text]
8.
Ratnam M, Marquardt H, Duhring JL, Freisheim JH:
Homologous membrane folate binding proteins in human placenta: Cloning and sequence of a cDNA.
Biochemistry
28:8249, 1989[Medline]
[Order article via Infotrieve]
9.
Shen F, Ross JF, Wang X, Ratnam M:
Identification of a novel folate receptor, a truncated receptor, and receptor type beta in hematopoietic cells: cDNA cloning, expression, immunoreactivity, and tissue specificity.
Biochemistry
33:1209, 1994[Medline]
[Order article via Infotrieve]
10.
Shen F, Wu M, Ross JF, Miller D, Ratnam M:
Folate receptor type gamma is primarily a secretory protein due to lack of an efficient signal for glycosylphosphatidylinositol modification: Protein characterization and cell type specificity.
Biochemistry
34:5660, 1995[Medline]
[Order article via Infotrieve]
11.
Wang X, Shen F, Freisheim JH, Gentry LE, Ratnam M:
Differential stereospecificities and affinities of folate receptor isoforms for folate compounds and antifolates.
Biochem Pharmacol
44:1898, 1992[Medline]
[Order article via Infotrieve]
12.
Brigle KE, Westin EH, Houghton MT, Goldman ID:
Characterization of two cDNAs encoding folate-binding proteins from L1210 murine leukemia cells. Increased expression associated with a genomic rearrangement.
J Biol Chem
266:17243, 1991[Abstract/Free Full  |