|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 11 (June 1), 1999:
pp. 3964-3972
Somatic Mutations Within the Untranslated Regions of Rearranged Ig
Genes in a Case of Classical Hodgkin's Disease as a Potential
Cause for the Absence of Ig in the Lymphoma Cells
By
Andrea Jox,
Thomas Zander,
Ralf Küppers,
Johannes Irsch,
Holger Kanzler,
Martin Kornacker,
Heribert Bohlen,
Volker Diehl, and
Jürgen Wolf
From the Department of Internal Medicine I and the Institute for
Genetics, University of Cologne, Cologne, Germany.
 |
ABSTRACT |
Hodgkin-Reed-Sternberg (H-RS) cells are clonal B cells carrying Ig
gene rearrangements. However, in situ hybridization methods failed to
demonstrate Ig gene expression in H-RS cells of classical Hodgkin's
disease (HD). Because somatic mutations rendering potentially functional Ig gene rearrangements nonfunctional were detected in some
cases of the disease, it was speculated that H-RS cells in classical HD
may have lost the ability to express antigen receptor as a rule.
Recently, we established a novel cell line (L1236) from H-RS cells of a
patient with mixed cellularity subtype of HD. L1236 cells harbor a
potentially functional VH1 and a potentially functional
V 3 gene rearrangement. However, no antibody expression was detected. To show potential reasons for this lack of Ig expression, we analyzed the genomic organization of the Ig genes and their transcription in the primary and cultivated H-RS cells of this patient.
The H-RS cells were found to have switched their isotype to IgG4,
confirming their mature B-cell nature. By amplifying cDNA from L1236
cells as well as from frozen biopsy material transcripts of the
V3 and the VH1 gene rearrangement were
detected for both sources of cDNA. However, Northern blot
hybridization of L1236 RNA failed to demonstrate VH1 and
V3 transcripts, indicating only a low level of
transcription. Sequence analysis of the promoter and leader regions of
the VH1 gene rearrangement from L1236 cells as well as from
lymphoma-affected tissue showed a somatic mutation in the conserved
octamer motif of the promoter region. Somatic mutations were also
detected within the 3' splice site of the leader intron and
adjacent nucleotides in the rearranged V light chain
gene, leading to aberrant splicing. These mutations might prevent the
generation of adequate amounts of functional Ig gene transcripts as
template for translation into protein. Thus, mutations in H-RS cells
that prevent Ig gene expression might also be located outside the
coding region of the Ig genes.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
IN HODGKIN'S DISEASE (HD), the malignant
Hodgkin-Reed-Sternberg (H-RS) cells represent only a minority of 0.1%
to 1% of all cells in affected tissue. They are surrounded by T
lymphocytes, histiocytes, fibroblasts, eosinophils, and other
nonmalignant cells. Because of the scarcity of H-RS cells in tumor
tissue, their genetic characterization has been a major problem in the past. Until recently, clonality and cellular origin of these cells has
remained an open question.
The isolation of single H-RS cells from frozen tissue
sections1 or cytospins2 by micromanipulation
followed by polymerase chain reaction (PCR) analysis now allows
molecular analysis of single H-RS cells. Using these methods, detection
of Ig gene rearrangements in single H-RS cells of classical HD (ie,
nodular sclerosis, mixed cellularity [mc], lymphocyte depleted) has
shown their B-cell origin.1,3-8 In most of the cases, Ig
gene rearrangements amplified from multiple H-RS cells showed a clonal
relationship. Evidence for clonality of H-RS cells in classical HD has
also been provided by detection of clonal chromosomal aberrations using
fluorescence in situ hybridization on HD-derived cell suspensions
with9 and without10 simultaneous
immunophenotyping. Thus, H-RS cells arise from a single B-cell clone in
most if not all cases. The presence of somatic mutations within the
rearranged Ig genes of H-RS cells implied their derivation from
germinal center (GC) B cells or their descendants.1,7,8
In 4 of 13 cases of classical HD analyzed by us,1,7,8 stop
codons were introduced by somatic mutation into originally functional V
gene rearrangements, rendering them nonfunctional. Such crippling
mutations physiologically occur in mutating GC B cells. However, GC B
cells harboring crippling mutations are usually eliminated by apoptosis
and do not leave the GC microenvironment. Only GC B cells that acquired
favorable mutations resulting in increased affinity to the respective
antigen can leave the GC as memory B cells or plasma cell
precursors.11 Thus, the finding of crippling mutations in
some cases of classical HD identified GC B cells that escaped apoptosis
as the precursors of the tumor clone, at least in these cases. It has
been speculated that H-RS cells in classical HD might be derived from
crippled GC B cells as a rule.8
In 1 of the 13 cases, potentially functional Ig gene rearrangements for
both heavy and  light chain genes were amplified from single H-RS
cells.7 Thus, H-RS cells of this case might have retained
the ability to express antigen receptor. Fortunately, a cell line
(L1236) could be established from the peripheral blood of this patient
suffering from relapse of mc HD.12 Using molecular analysis
of Ig gene rearrangements, the derivation of L1236 cells from the H-RS
cells in the patient could be demonstrated.7 The in vitro
cultivation of the L1236 cells enabled us to perform a detailed
analysis of the genomic organization of the Ig genes and their
transcription and translation. Class switch recombination to C 4 was
demonstrated in the rearranged Ig genes in L1236 and primary H-RS
cells. Transcription of Ig genes was detected at a very low level, and
no protein was found at all. Somatic mutations within their promoter
and leader regions were identified as the most likely mechanism for
downregulation of Ig gene expression.
| |
MATERIALS AND METHODS |
Tissue samples and cell lines.
L1236 is an Epstein-Barr virus (EBV)-negative H-RS cell line
established from the peripheral blood of a patient suffering from a
relapse of mc HD with extensive bone marrow involvement.12 Sections from fresh frozen tissue of the patient's bone marrow were
used to analyze Ig gene expression and structure in primary H-RS cells.
L1309 is an EBV-immortalized lymphoblastoid cell line (LCL) that has
been established in our laboratory from the peripheral blood of a
healthy donor by superinfection of B lymphocytes with the EBV strain
B95-8. L1309 was used as positive control for analyzing expression of
rearranged Ig genes. CO is an HD-derived cell line with T-cell receptor
gene rearrangements13 and was used as a negative control.
In addition, U937, a cell line of myeloid origin14 was used
as a negative control for the detection of Ig gene transcripts by
Northern blot analysis. All cell lines were grown in suspension at
37°C in RPMI 1640 medium (Life Technologies, Eggenstein, Germany) supplemented with 10% fetal calf serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 2 mmol/L glutamine in an atmosphere
containing 5% CO2.
DNA extraction and Southern blot analysis.
High molecular weight DNA was extracted from cell lines using standard
protocols.15 DNA was extracted from frozen tissue sections
using the trizol reagent according to the manufacturer's instructions
(Life Technologies). Ten micrograms of cellular DNA extracted from cell
lines was cleaved with the restriction enzyme BamHI, separated
by electrophoresis for 36 hours at 1 V/cm on a 0.8% agarose gel, and
transferred onto a nylon filter (Hybond N; Schleicher und Schuell,
Dassel, Germany). For detection of the C genes, a C4 DNA probe
covering all C4 exons and hybridizing to all C
genes16 was used. The probes were 32P-labeled
and hybridized using standard conditions.15
RNA extraction and Northern blot hybridization.
Total cellular RNA was extracted from cell lines by the guanidinium
isothiocyanate method.17 From frozen tissue
sections RNA was extracted using the trizol reagent according to the
manufacturer's instructions (Life Technologies). Poly A+ RNA was
separated from total RNA according to the protocol for the Oligotex
mRNA midi kit (Qiagen, Hilden, Germany). Ten micrograms of
total RNA or 5 µg of poly A+ RNA was separated on a 1% agarose gel,
transferred onto a nylon filter (Biotechnology Systems, NEN, Research
Products, Boston, MA), and hybridized with a 32P-labeled
DNA probe under standard conditions.18 For detection of Ig
heavy chain transcripts, the C4 probe was used16
(see also Southern blot analysis). For the detection of Ig light chain transcripts, a 2.1-kb Sac I/EcoRI fragment of the
human Ig light chain constant region gene was used.19
Reverse transcription-PCR (RT-PCR) for amplification of Ig gene
transcripts.
cDNA was generated using an adapter oligonucleotide (AP2) AAG GAT CCG
TCG ACA TC (T)17 and Moloney murine leukemia virus
(M-MLV) reverse transcriptase (Pharmacia, Freiburg,
Germany). For amplification of Ig gene transcripts and Ig constant
region genes, several oligonucleotides were used (see below). PCR was
performed in a 50 µL reaction mixture containing 50 mmol/L KCl, 2.5 or 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, and 25 µmol/L of each oligonucleotide. PCR was performed according to
different protocols (see below). Denaturation was always performed for
1 minute at 95°C. One unit of Taq DNA polymerase (Promega,
Mannheim, Germany) was added during the first denaturation step. All
amplifications were performed in a Trio Thermoblock (Biometra,
Göttingen, Germany). When a two-step PCR was performed, 1 µL of
the first round was used as template in the second round.
PCR-oligonucleotides.
Sequences of the VH1 oligonucleotides were as follows:
21-2UIS: gaggtatgaaataatctgtc; VH1LAs: gaatgacagtcttctaaactgg; 5-1CDR2: ccggtgttggctcgacaatg; 3H1: gtggccattgtagttcccac; GIn5:
aggaccctgcccctgacctaag; and GC23: ggggtcttcgtggctcacgtc. Sequences of
the V3 oligonucleotides were as follows: VK3P:
tggtctttgcagctgaaagct; VK3L: atggaagccccagcgcagctt; VK3As:
gctaagttggtgccaatgctgtc; 3K3: aacgtcaccggaggccactta; and CK: ttcaactgctcatcagatggaggg.
Amplification of DNA and cDNA fragments.
Amplification of the 5' untranslated region of the
VH1 gene rearrangement of L1236 cells was performed by
single-step PCR (5' oligonucleotide: 21-2UIS; 3'
oligonucleotide: 3H1; 2.5 mmol/L MgCl2; annealing at
58°C for 1 minute and extension at 72°C for 3 minutes for 35 cycles; length of the product: 616 bp). Amplification of the 5'
untranslated region of the VH1 gene rearrangement of primary H-RS cells from the bone marrow specimen was performed by
PCR (5' oligonucleotide: 21-2UIS; 3' oligonucleotide: 3H1; 2.5 mmol/L MgCl2; annealing at 58°C for 1 minute and
extension at 72°C for 3 minutes for 40 cycles; length: 616 bp;
sequence oligonucleotide VH1LAS). Amplification of the 5'
untranslated region of the V gene rearrangement of L1236
cells was performed by single-step PCR (5' oligonucleotide: VK3P;
3' oligonucleotide: 3K3; 2.5 mmol/L MgCl2; annealing
at 61°C for 1 minute and extension at 72°C for 90 seconds for
35 cycles; length: 665 bp). Amplification of the 5' untranslated
region of the V gene rearrangement of primary H-RS cells
from the bone marrow specimen was performed by a two-step PCR (first
round: 5' oligonucleotide: VK3P; 3' oligonucleotide: 3K3;
2.5 mmol/L MgCl2; annealing at 61°C for 1 minute
and extension at 72°C for 90 seconds for 35 cycles; length:
665 bp; second round: 5' oligonucleotide: VK3P; 3'
oligonucleotide: VK3As; 2.5 mmol/L MgCl2; annealing at
58°C for 1 minute and extension at 72°C for 90 seconds for 35 cycles; length: 470 bp). A single-step RT-PCR was performed to detect
VH1 transcripts in L1236 cells and primary H-RS cells
(5' oligonucleotide: 5-1CDR2; 3' oligonucleotide: GC23; 1.5 mmol/L MgCl2; annealing at 59°C for 1 minute and
extension at 72°C for 90 seconds for 40 cycles; length: 661 bp).
Detection of V transcripts in L1236 and primary H-RS
cells was performed by single-step RT-PCR (5' oligonucleotide:
VK3L; 3' oligonucleotide: 3K3; 1.5 mmol/L MgCl2;
annealing at 60°C for 1 minute and extension at 72°C for 90 seconds for 40 cycles; length: 356 bp).
V/C transcripts in L1236 cells were
detected by RT-PCR (5' oligonucleotide: VK3L; 3'
oligonucleotide: CK; 2.5 mmol/L MgCl2; annealing at
58°C for 1 minute and extension at 72°C for 90 seconds for 40 cycles; length: 440 bp). The C4 gene in
L1236 cells was amplified by a single-step PCR (5'
oligonucleotide: GIn5; 3' oligonucleotide: GC23; 2.5 mmol/L
MgCl2; annealing at 58°C for 1 minute and extension at
72°C for 90 seconds for 35 cycles; length: C4: 234 bp).
Sequence analysis.
PCR products were separated on a 1% agarose gel and extracted from the
gel using a gel extraction kit (Qiagen, Hilden, Germany). PCR products
were directly sequenced using either the Ready Reaction DyeDeoxyTerminator cycle sequencing kit (Applied Biosystems,
Weiterstadt, Germany) or using a cycle sequencing kit (Life
Technologies). Sequencing reactions were performed according to the
manufacturers' protocols. Sequence reaction products were separated on
an 8% polyacrylamide gel under denaturing conditions. Results were
obtained by either autoradiography or using an automated sequencer
(ABI377; Applied Biosystems).
| |
RESULTS |
L1236 cells have performed class switching.
Southern blot hybridization of BamHI-digested L1236 DNA with a
C probe showed only one rearranged fragment and none of the germline
C fragments (Fig 1). This suggests that
all C genes on one chromosome were deleted and that on the other
chromosome class switch recombination was targeted to the most 3'
C gene, ie, C4. To confirm this, PCR was performed with genomic
DNA of L1236 cells using oligonucleotides suitable to amplify all C genes. Sequence analysis of the resulting PCR product confirmed that
only C4 was retained in L1236 cells (data not shown). Further studies showed that class switch recombination to C4 had occurred on
the allele harboring the potentially functional VH1 gene
rearrangement (see below and Fig 5).
View larger version (36K):
[in this window]
[in a new window]
| Fig 1.
Southern blot analysis to detect class switch
recombination in L1236 cells. (Upper part) After digestion of genomic
DNA with BamHI, the organization of the C genes was analyzed
in L1236 cells (lane 1) in comparison with the HD-derived cell line Co
(lane 2) known to have germline configuration of the C
genes.20 The C probe used in the analysis recognizes all
C genes and the  gene. As expected, the DNA of Co shows all
germline fragments for the IgG subclasses. The two IgH loci located on
the two chromosomes 14 show a polymorphism for the pseudo C
(), the C2, and the C4 genes resulting in two fragments for
these (indicated as /2), whereas only one fragment appears for C1
and C3 each. This pattern is in accordance with the results
described by Linsley et al.21 For L1236 DNA, only one
fragment is detectable, indicating that on one allele class switch
recombination was targeted to the most 3' gene (ie, C4),
whereas on the other allele all C genes were deleted. (Lower part)
Map of the human IgH locus. This map does not take into account the
different haplotypes for the , the C2, and the C4 genes and
is not to scale. B, BamHI; E, EcoRI.
|
|
Ig transcripts in L1236 cells are undetectable by Northern blot
analysis.
Using various antibodies against human heavy as well as light
chain protein, no staining was observed in the L1236 cell line when
flow cytometry (Ig light chain12) or immunocytochemistry (IgG heavy chain, Ig light chain; data not shown) was performed. We
thus wanted to know if the failure to detect Ig in L1236 cells was
caused by a lack of or downregulation of either translation or
transcription of the Ig genes. For the detection and quantification of
Ig gene transcription in L1236 cells, Northern blot analysis was
performed. Hybridization of total cellular L1236 RNA with specific
probes for the C or the C genes showed neither C
nor C transcripts (Fig 2).
By comparison, hybridization of RNA extracted from the
B-cell-derived cell line L1309 showed the expected transcripts. The
T-cell-derived cell line CO and the myeloid cell line U937, both
used as controls, gave the expected negative results. To increase the
sensitivity of the method, poly A+ RNA was extracted to
detect C transcripts. Again, no transcripts were
detected in L1236 by hybridization of the C probe (Fig 2). Hybridization with a glyceraldehyde phosphate dehydrogenase (GAPDH)
probe to check the quality and amount of mRNA showed that approximately
equal amounts of intact RNA were loaded on the gel for the various cell
lines. The Northern blot hybridization experiments thus showed that Ig
gene transcription in L1236 was below the sensitivity of the method.
View larger version (70K):
[in this window]
[in a new window]
| Fig 2.
Northern blot analysis for IgH and Ig transcription in
L1236 cells. Total cellular RNA of the cell lines was separated on an
agarose gel, transferred to a nylon filter, and probed with cDNA clones
for C (A, right) and C (B, top, left), respectively. Although the
LCL L1309 does express the membrane bound C heavy chain transcript
and the secreted C heavy chain transcript (A) as well as the light chain transcript (B), neither IgG nor Ig transcripts are
detected in L1236 cells (A, right: ethidium bromide staining of the gel
before blotting; B, bottom: hybridization for GAPDH transcripts to
control quality of total RNA). The cell lines U937 and CO serve as
negative controls for Ig gene transcripts. To increase the sensitivity
of Northern blot analysis for C, mRNA was separated on an agarose
gel, transferred to a nylon filter, and probed with a cDNA clone (B,
left, top). Again, no hybridization signal was obtained in L1236 mRNA.
L1309 cells serve as positive control. CO cells serve as negative
control. Hybridization with a GAPDH probe to check quality and amount
of mRNA showed that approximately equal amounts of intact RNA were
loaded on the gel for the various cell lines (B, bottom).
|
|
IgH and Ig transcripts can be detected by RT-PCR in cell line
L1236 and primary H-RS cells.
To increase the sensitivity for the detection of Ig gene transcripts in
L1236, RT-PCR was performed using two different oligonucleotide sets.
To amplify transcripts from the IgH gene, an oligonucleotide chosen
from the CDRII was combined with a consensus oligonucleotide hybridizing to the second exon of all c genes. Because of the large
intron between the VH region genes and the first exon of the constant region gene, a product can be only amplified from spliced
RNA. Thus, the selected oligonucleotides were suitable for specific
amplification of transcripts. A product of the expected length was
generated by amplification of L1236 cDNA
(Fig 3). Sequence analysis showed an
identical sequence of the VHDHJH
region gene compared with the sequence previously amplified from
genomic DNA of L1236 cells,7 providing evidence that the
rearranged VH1 gene is transcribed. Sequence analysis of
the constant region confirmed that class switching to C4 had
occurred on the respective allele harboring the potentially
functional rearrangement and that the JH segment was
correctly spliced to the first exon of C4. Ig transcripts were
amplified using oligonucleotides hybridizing to a sequence in the
leader region of the rearranged V3 gene and to the
C gene or to the CDRIII, respectively
(Fig 4). Again, sequencing of the resulting
PCR product obtained from L1236 cDNA showed an identical sequence
compared with the V3 sequence amplified from genomic DNA
of L1236 cells.7 The J gene is correctly spliced to the
C gene (see Fig 7).
View larger version (83K):
[in this window]
[in a new window]
| Fig 3.
PCR analysis to detect IgH transcripts in L1236 cells as
well as in H-RS cells of the patient's affected bone marrow. Lane 1, L1236 cDNA; lane 2, L1309 cDNA; lane 3, section of the HD-affected bone
marrow, cDNA; lane 4, no template; lane 5, 100-bp ladder. Using an
oligonucleotide hybridizing to the CDRII of the VH1 gene
rearrangement in L1236 cells in combination with an oligonucleotide
hybridizing to the second exon of all the 4 genes, a specific
product was amplified from cDNA obtained from L1236 cells as well as
from cDNA obtained from the patient's bone marrow. No product was
amplified from the cDNA obtained from L1309 cells, indicating the
specificity of the product. Sequence analysis of the PCR product showed
the sequence of the VH1 gene rearrangement switched to
C4.
|
|
View larger version (91K):
[in this window]
[in a new window]
| Fig 4.
PCR analysis to detect Ig transcripts in L1236 cells
as well as in H-RS cells of the patient's affected bone marrow. Lane
1, L1236, DNA; lane 2, L1236 cDNA; lane 3, section of the patient's
affected bone marrow, cDNA; lane 4, no template; lane 5, 100-bp ladder.
Using an oligonucleotide hybridizing to the V leader
sequence and an oligonucleotide hybridizing to the CDRIII of the
rearranged V genes, a specific product was amplified
from DNA as well as cDNA. The products differ in length due to splicing
of the leader intron. V transcripts were amplified and
sequenced from L1236 cells as well as from the bone marrow section. The
cDNA of the bone marrow section showed a slight contamination with DNA,
resulting in an additional band.
|
|
The transcription of the IgH and Ig chain genes in L1236 cells as
demonstrated by PCR could reflect an in vitro effect observed after
culturing of L1236 cells. The VH1 gene rearrangement
obtained from L1236 cells was already used as an H-RS cell-specific
marker gene to detect these cells during the course of the disease in various affected tissues obtained from the patient from whom the cell
line was established.25,26 Therefore, H-RS cell-specific oligonucleotides could be generated for specific amplification of Ig
gene transcripts from the H-RS cells in the affected bone marrow
specimen of this patient. Because of the low amount of H-RS cells in
the biopsy specimen, the sensitivity of PCR was increased by performing
40 cycles of PCR in one round of amplification. H-RS cell-specific transcripts (Fig 3) as well as transcripts (Fig 4) were amplified
from the bone marrow specimen, indicating that Ig genes were also
transcribed in vivo. Furthermore, this result confirmed that class
switching to C4 had occurred in the H-RS cells in the lymphoma tissue.
The upstream octamer element in the VH1 promoter region
is affected by somatic mutation.
Because it had recently been shown in the mouse that somatic
hypermutation can extend to the promoter region of V
genes,27 we wondered whether the low amount of Ig gene
transcripts in L1236 cells might be due to somatic mutations in this
region. Three regulatory elements within the VH promoter
region are known to be involved in the regulation of Ig gene
transcription.28 Of these, the conserved octanucleotide
5'-ATGCAAAT-3'29,30 is considered to exhibit a
dominant effect, both with regard to transcription efficiency and
B-cell specificity of Ig gene transcription. This sequence represents a
binding site for specific transcription factors31 and is
present within all known VH promoter sequences. In vitro
mutation of the octamer causes transcriptionally silent IgH
constructs.30,32 To analyze the promoter region of the VH1-rearrangement, a 5' oligonucleotide was selected
from the promoter region of the germline sequence HV1F1033
to which the rearranged VH1 gene shows the highest homology
and combined with oligonucleotides hybridizing specifically to the
mutated rearranged VH1 gene. A total of 128 bases 5'
of the leader sequence were amplified from L1236 DNA. In comparison
with the germline sequence, two mutations and one nucleotide deletion
were detected upstream of the leader exon
(Fig 5). One of the mutations affects the
first nucleotide of the octamer sequence that probably leads to loss of
octamer function (Fig 6 and see below).
This mutation was also found in the octamer of the rearranged H-RS
cell-specific VH1 gene amplified from the patients' bone
marrow.
View larger version (33K):
[in this window]
[in a new window]
| Fig 5.
Primary sequence data obtained from the 5'
untranslated region of the VH1 gene rearrangement of L1236
cells. The VH1 gene rearrangement was amplified using the
oligonucleotide 21-2UIS hybridizing to the 5' region of the
VH1 gene rearrangement and the oligonucleotide 3H1
hybridizing to the CDRIII of the VH1 gene rearrangement.
Sequencing was performed using the VH1LAS oligonucleotide hybridizing
to the leader region resulting in the antisense sequence. The sequence
is given above. Numbers indicate the nucleotide positions on the gel.
Note that the first position (number 182) of the octamer (number 175 until number 182) is mutated (A T; for comparison with
germline sequence, see also Fig 6).
|
|
View larger version (39K):
[in this window]
[in a new window]
| Fig 6.
Sequence of the VH1 gene rearrangement of
L1236 cells including part of the promoter region, the leader intron,
and part of the constant region. The sequence obtained from L1236 cells
is compared with germline sequences for the corresponding
VH, JH, and C4 genes (HV1F10,33
JH4b,34 and C4; Chai et al, unpublished
data; Genbank Accession No. L23566) -, sequence identity;
., nucleotide deletion. Aminoacid changes are indicated by the germline
amino acids given below the amino acid sequence of L1236. Codons are
numbered according to Kabat et al.35 Corresponding amino
acids are shown below each codon. The leader region, CDRI, CDRII, and
CDRIII are indicated. Sequence already published7 is
underlined. The sequence of C4 and JH4B was obtained from cDNA.
Therefore, no sequence is provided for the intron between JH4B and
C4. The RNA is correctly spliced. This sequence is available from
the EMBL database under accession no. AJ005570.
|
|
The 3' splice site of the leader intron of the potentially
functional V3 gene rearrangement is mutated in L1236
cells and in primary H-RS cells of the same donor.
In search for somatic mutations that might impair the transcription and
translation of the rearranged V3 gene, a fragment spanning part of the V promoter, the leader region and
part of the framework region I (FRI) were amplified by PCR and
sequenced. Oligonucleotides were selected from the germline
sequence.20 In the amplified fragment, a total of 32 somatic mutations was detected, 2 within the 5' untranslated
region, 1 within the first leader exon, 22 within the leader intron, 6 within the second leader exon, and 1 within the first 27 bp of the FRI.
The two mutations within the 5' untranslated region did not
affect any of the conserved promoter elements. The seven mutations
within the leader exons result in five amino acid replacements, four of
which are located within the five C-terminal amino acids of the leader
protein (Fig 7). One of the mutations
within the leader intron affects the 3' splice site. In
eukaryotic cells the sequence at the 3' end of introns has a
common structural motif consisting of 4 bp 5'(A/T/G)CAG3'.
The germline sequence of the leader intron of the V3
gene ends with TCAG. In L1236 cells, the G is mutated, destroying the
splice site. However, due to somatic mutations 6 bp upstream, a new
potential splice site consisting of the consensus sequence TCAG was
created by two point mutations changing CCAA into TCAG (Fig 7).
Aberrant splicing at this new splicing site leading to the insertion of
two amino acids into the leader peptide was indeed demonstrated by
amplifying and sequencing a cDNA fragment encompassing the leader and
FR1 sequence (Fig 7). The aberrant spliced transcript was also
amplified and sequenced from the affected bone marrow tissue, thus
excluding an in vitro artifact.
View larger version (36K):
[in this window]
[in a new window]
| Fig 7.
Sequence of the V3 gene rearrangement,
including part of the promoter region, the leader intron, and part of
the constant region. Sequence format is the same as in Fig 6. The
sequence obtained from L1236 cells is compared with germline sequences
for the corresponding V, J, and
C genes (L2,22
J1,23 and C24).
The aberrant splicing of the leader intron is indicated. The sequence
of J1 and C was obtained from cDNA. Therefore, the intron
sequence between J1 and C is not given.
The J gene is correctly spliced to the C gene. This
sequence is available from the EMBL database under accession no.
AJ005571.
|
|
| |
DISCUSSION |
H-RS cells in classical HD represent clonal populations of
B-cell-derived lymphoma cells.36 Sequence analysis of
rearranged Ig genes obtained from micromanipulated H-RS cells showed
the occurrence of somatic mutations within the rearranged Ig genes of
H-RS cells in all informative cases, indicating their derivation from
GC or memory B cells.1,7,8 Based on the finding of crippling mutations in some of the cases, it was suggested that H-RS
cells in classical HD as a rule are derived from crippled GC B cells
that lost the capacity to express (high-affinity) antigen receptor due
to somatic mutations.8,36
One of the HD cases analyzed in these studies appeared to be an
exception to this rule, because in this case both a potentially functional VH and VL chain gene rearrangement
were detected in H-RS cells.7 The establishment of a cell
line (L1236) permitted further detailed analysis of Ig gene structure
and expression in the H-RS cells of this case. Ig gene expression,
measured by fluorescence-activated cell sorting (FACS) analysis (Ig
light chain12) or immunostaining on cytospins (IgG heavy
chain, Ig light chain) was undetectable in L1236 cells. An analysis
of Ig gene expression in these cells at the RNA level was performed to
determine at which stage (transcription and/or translation) antibody
expression was blocked. In addition, we wanted to find out whether the
potentially functional V gene rearrangements in L1236 cells carry
crippling mutations outside the regions of the V genes sequenced
previously.7 Moreover, the availability of the cell line
L1236 offered the opportunity to investigate whether the Ig genes in
these H-RS cells not only accumulated somatic mutations, but also
performed class switch recombination.
Class switch recombination in L1236 cells was studied by Southern blot
analysis. Hybridization of L1236 DNA with probes detecting the various
constant region genes showed that class switch recombination to C4
had occurred on one allele. Whether class switch recombination to C4
leads to the expression of IgG transcripts in L1236 cells was analyzed
by RT-PCR using a C oligonucleotide and a VH1
oligonucleotide. A PCR product encoding the potentially functional
VH1 gene rearrangement correctly spliced to C4 was
amplified, showing that class switch recombination to C4 had taken
place on the allele carrying the potentially functional heavy chain
gene and had led to the expression of the respective RNA. The
VH1-C4 transcript was also amplified from the bone
marrow biopsy specimen, showing that this class switch recombination
had already occurred in the primary H-RS cells. This is the first
demonstration of isotype switching in primary H-RS cells.
Interestingly, class switch recombination to C4, which is rarely
used by normal B cells37 and can be induced by cytokines
preferentially released from TH2 cells, was also described
for the HD-derived cell line L428.20 Whether class switch
recombination to C4 is a frequent event in H-RS cells has to be established.
Neither Ig protein nor mRNA was detectable in L1236 cells when
immunostaining or Northern blot analysis was performed. However, Ig
heavy and light chain gene transcripts could be amplified from L1236
cells by RT-PCR. These results indicate that L1236 cells produce only a
very low amount of Ig gene transcripts. These transcripts were also
detected by RT-PCR in RNA extracted from a section of the affected bone
marrow tissue, showing that Ig gene transcription likewise took place
in the H-RS cells in vivo. Ig gene transcription in H-RS cells was
previously analyzed by several groups using in situ
hybridization.38-41 In only 1 of a total number of 95 cases of classical HD analyzed for heavy and/or light chain transcription were Ig transcripts detected in H-RS cells. Taking these studies and
the present work together, it appears that H-RS cells in at least some
cases of classical HD can express Ig transcripts, albeit at a low level
and below the sensitivity of current in situ hybridization methods.
Diffuse staining for both and  light chains was frequently observed within H-RS cells using
immunohistochemistry.30,38,42,43 However, this finding was
likely caused by artificial uptake of Ig, particularly because it is
now known that H-RS cells represent clonal B-cell populations.
Because V gene sequence analysis previously performed in L1236 cells
did not show any obvious crippling mutations,7 we wondered
whether the low level of Ig gene transcripts might be due to mutations
within upstream regulatory elements of the V region genes. Indeed, a
point mutation affecting the first nucleotide of the octamer motif
(ATGCAAAT) of the heavy chain promoter was detected in L1236 cells as
well as in the primary H-RS cells of the bone marrow specimen. An in
vitro expression study has shown that a mutation at this position (A
into C) drastically reduces Ig gene transcription.30
Although a polymorphism at position 2, 4, or
832,44 is sometimes observed within the
octamer sequence of human and murine heavy chain promoter regions,
sequence variation at the first position was never observed in
functional VH genes.32,44 When comparing the
inverted octamer sequence (ATTTGCAT) of human and murine
V genes, a polymorphism was sometimes observed for
positions 1 and 7 of the converted octamer sequence.45
Again, a polymorphism at the last position (corresponding to the first position of the octamer of VH genes) was never observed in
any of the mouse or human V octamer sequences analyzed
so far.45,46 This indicates that sequence variations at
distinct positions in the octamer motif occurred during evolution and
are at these positions compatible with functionality. However, the
absence of polymorphisms at position one of the heavy chain octamer
motif further supports the critical role of this position for the
functionality of the octamer. Thus, the low level of IgH chain gene
transcription in L1236 cells (and presumably also in primary H-RS
cells) of this particular case is most likely caused by the somatic
mutation affecting the first position of the octamer motif within the
heavy chain promoter.
No mutations were found within the promoter elements of the potentially
functional V3 gene. Therefore, the low amount of V
transcripts could not be attributed to an alteration of the
V promoter. By analyzing the V leader
intron, several somatic mutations were detected leading to the
destruction of the 3' splice site and to the establishment of a
new potential splice site 6 bp upstream. Sequence analysis of
V transcripts obtained from L1236 cells as well as from
the affected bone marrow tissue indeed showed aberrant splicing of pre-mRNA without alteration of the reading frame by using the newly
introduced 3' leader intron splicing site. However, alterations
of splice sites have been described that cause a retarded intron
removal due to a prolonged binding of spliceosomes.47 This
delayed splicing results in nuclear retention of pre-mRNA. Such a
mechanism might account for the low amount of V mRNA
transcripts in the H-RS cells analyzed.
The present study shows that the lack of Ig expression by H-RS cells in
classical HD can not only be caused by crippling mutations within the
coding sequence of rearranged Ig genes (like those generating stop
codons36), but also by mutations affecting regulatory elements. However, in other cases of HD, H-RS cells may harbor crippling mutations that a priori do not prevent Ig gene expression, eg, mutations that result in a reduced affinity of the antibody to the
respective antigen. GC B cells having acquired such mutations also
represent crippled GC B cells, because they are destined to die by
apoptosis under physiological conditions. H-RS cells that are derived
from this type of crippled GC B cells could potentially express antigen
receptor. However, expression of antibody in H-RS cells has never been
observed (see above). It may be that, in these cases, the aberrant
B-cell differentiation status of H-RS cells (exemplified by the absence
of B-lineage markers in most cases of classical HD; see
Drexler48 for review) leads to the downregulation of Ig
gene expression by a disregulation of B-cell-specific transcription
factors regulating Ig gene expression.
Taken together, in the H-RS cell line L1236 and the corresponding
primary H-RS cells of the patient, transcription of rearranged Ig heavy
and light chain genes in H-RS cells was detected at a minimal level.
Sequence analysis of DNA strongly suggested that downregulation of Ig
gene transcription is due to a mutation in the octamer promoter element
of the in-frame heavy chain gene rearrangement. Moreover, the 3'
splice site of the leader intron of the Ig light chain gene was
mutated, resulting in aberrant splicing. These observations, together
with the detection of class switch recombination, do not only confirm
the mature GC B-cell phenotype of H-RS cells, but also show that in
H-RS cell mutations that prevent expression of Ig genes can be located
outside the VDJ region.
| |
FOOTNOTES |
Submitted June 8, 1998; accepted January 28, 1999.
A.J. and T.Z. contributed equally to this work.
Supported by a grant of the Deutsche Forschungsgemeinschaft through SFB 502.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Jürgen Wolf, MD, Department of
Internal Medicine I, LFI E5 R310, Joseph Stelzmann Str. 9, 50931 Cologne, Germany; e-mail: Juergen.Wolf{at}medizin.uni-koeln.de.
| |
REFERENCES |
1.
Küppers R, Rajewsky K, Zhao M, Simons G, Laumann R, Fischer R, Hansmann ML:
Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development.
Proc Natl Acad Sci USA
91:10962, 1994[Abstract/Free Full Text]
2.
Trümper L, Brady HG, Bagg A, Gray D, Loke SL, Griesser H, Wagman R, Braziel R, Gascoyne RD, Vicini S, Iscove NN, Cossman J, Mak TW:
Single cell analysis of Hodgkin and Reed Sternberg cells: Molecular heterogeneity of gene expression and p53 mutations.
Blood
81:3097, 1993[Abstract/Free Full Text]
3.
Hummel M, Zieman K, Lammert H, Pileri S, Sabattini E, Stein H:
Hodgkin's disease with monoclonal and polyclonal populations of Reed-Sternberg cells.
N Engl J Med
333:901, 1995[Abstract/Free Full Text]
4.
Delabie J, Tierens A, Gavrilli T, Wu G, Weisenburger DD, Chan WC:
Phenotype, genotype and clonality of Reed-Sternberg cells in nodular sclerosis Hodgkin's disease: Results of a single-cell study.
Br J Haematol
94:198, 1996[Medline]
[Order article via Infotrieve]
5.
Hummel M, Marafioti T, Stein H:
Immunoglobulin V genes in Reed-Sternberg cells.
N Engl J Med
334:405, 1996 (letter)
6.
Küppers R, Kanzler H, Hansmann ML, Rajewsky K:
Immunoglobulin V genes in Reed-Sternberg cells.
N Engl J Med
333:901, 1996 (letter)
7.
Kanzler H, Hansmann ML, Kapp U, Wolf J, Diehl V, Rajewsky K, Küppers R:
Molecular single cell analysis demonstrates the derivation of a peripheral blood derived cell line (L1236) from the Hodgkin/Reed-Sternberg cells of a Hodgkin's lymphoma patient.
Blood
87:3429, 1996[Abstract/Free Full Text]
8.
Kanzler H, Küppers R, Hansmann ML, Rajewsky K:
Hodgkin and Reed Sternberg cells in Hodgkin's disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells.
J Exp Med
184:1495, 1996[Abstract/Free Full Text]
9.
Weber-Matthiesen K, Deerberg J, Poetsch M, Grote W, Schlegelberger B:
Numerical chromosome aberrations are present within the CD30+ Hodgkin and Reed Sternberg cells in 100% of analysed cases of Hodgkin's disease.
Blood
86:1464, 1995[Abstract/Free Full Text]
10.
Inghirami G, Marci L, Rosati S, Ying Zhu B, Yee HT, Knowles DM:
The Reed-Sternberg cells of Hodgkin's disease are clonal.
Proc Natl Acad Sci USA
91:9842, 1994[Abstract/Free Full Text]
11.
Rajewsky K:
Clonal selection and learning in the antibody system.
Nature
381:751, 1996[Medline]
[Order article via Infotrieve]
12.
Wolf J, Kapp U, Bohlen H, Kornacker M, Schoch C, Stahl B, Mücke S, von Kalle C, Fonatsch C, Schaefer HE, Hansmann ML, Diehl V:
Peripheral blood mononuclear cells of a patient with advanced Hodgkin's lymphoma give rise to permanently growing Hodgkin-Reed Sternberg cells.
Blood
87:3418, 1996[Abstract/Free Full Text]
13.
Jones DB, Scott CS, Wright DH, Stein H, Beverly PCL, Payne SV, Crawford DH:
Phenotypic analysis of an established cell line derived from a patient with Hodgkin's disease (HD).
Hematol Oncol
3:133, 1985[Medline]
[Order article via Infotrieve]
14.
Harris P, Ralph P:
Human leukemic models of myelomonocytic development: A review of the HL-60 and U937 cell lines.
J Leukoc Biol
37:407, 1985[Abstract]
15.
Sambrock J, Fritsch EF, Maniatis T:
Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Habor, NY, Cold Spring Habor Laboratory, 1989.
16.
Borzillo GV, Cooper MD, Kubagawa H, Landay A, Burrows PD:
Isotype switching in human B lymphocyte malignancies occurs by DNA deletion: Evidence for nonspecific switch recombination.
J Immunol
139:1326, 1987[Abstract]
17.
Chomczynski P, Sacchi N:
Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
18.
Feinberg A, Vogelstein B:
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
162:297, 1984
19.
Hieter PA, Max EE, Seidmann JG, Maizel JV, Leader P:
Cloned human and mouse kappa immunoglobulin constant and J region genes conserve homology in functional segments.
Cell
22:197, 1980[Medline]
[Order article via Infotrieve]
20.
Falk MH, Tesch H, Stein H, Diehl V, Jones D, Fonatsch C:
Phenotype versus immunoglobulin and T-cell receptor genotype of Hodgkin-derived cell lines: Activation of immature lymphoid cells in Hodgkin's disease.
Int J Cancer
40:262, 1987[Medline]
[Order article via Infotrieve]
21.
Linsley PS, Bech-Hansen NT, Siminovitch L, Cox DW:
Analysis of a break in chromosome 14 mapping to the region of the immunoglobulin heavy chain locus.
Proc Natl Acad Sci USA
80:1997, 1983[Abstract/Free Full Text]
22.
Liu M, Robbins DL, Crowley JJ, Sinha S, Kozin F, Kipps TJ, Carson DA, Chen PP:
Characterization of four homologous L chain variable region genes that are related to 6B6.6 idiotype positive human rheumatoid factor L chains.
J Immunol
142:688, 1989[Abstract]
23.
Hieter PA, Maizel JV, Leder P:
Evolution of human immunoglobulin J region genes.
J Biol Chem
257:1516, 1982[Abstract/Free Full Text]
24.
Rioux JD, Zdarska E, Newkirk MM, Rauch J:
Anti-DNA and anti-platelet specificities of SLE-derived autoantibodies: Evidence for CDR2H mutations and CDR3H motifs.
Mol Immunol
32:683, 1995[Medline]
[Order article via Infotrieve]
25.
Jox A, Zander T, Diehl V, Wolf J:
Clonal relapse in Hodgkin's disease.
N Engl J Med
337:499, 1997[Free Full Text] (letter)
26.
Jox A, Zander T, Kornacker M, Kanzler H, Küppers R, Diehl V, Wolf J:
Detection of identical Hodgkin-Reed Sternberg cell specific immunoglobulin gene rearrangement in a patient with Hodgkin's disease of mixed cellularity subtype at primary diagnosis and in relapse two and a half years later.
Ann Oncol
9:283, 1998[Abstract/Free Full Text]
27.
Rada C, Yelamos J, Dean W, Milstein C:
The 5' hypermutation boundary of chains is independent of local and neighbouring sequences and related to the distance from the initiation of transcription.
Eur J Immunol
27:3115, 1997[Medline]
[Order article via Infotrieve]
28.
Yoza BK, Roeder RG:
Identification of a novel factor that interacts with an immunoglobulin heavy chain promoter and stimulates transcription in conjunction with the lymphoid cell-specific factor OTF2.
Mol Cell Biol
10:2145, 1990[Abstract/Free Full Text]
29.
Parslow TG, Blair DL, Murphy WJ, Granner DK:
Structure of the 5' ends of immunoglobulin genes: A novel conserved sequence.
Proc Natl Acad Sci USA
91:2650, 1984
30.
Wirth T, Staudt L, Baltimore D:
An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity.
Nature
329:174, 1987[Medline]
[Order article via Infotrieve]
31.
Scheidereit CA, Hegyu A, Roeder RG:
Identification and purification of a human lymphoid specific octamer binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro.
Cell
51:783, 1987[Medline]
[Order article via Infotrieve]
32.
Ballard DW, Bothwell A:
Mutational analysis of the immunoglobulin heavy chain promoter region.
Proc Natl Acad Sci USA
83:9626, 1986[Abstract/Free Full Text]
33.
Soto-Gil R, Olee T, Klink BR, Kenny TP, Robbins DL, Carson DA, Chen PP:
A systematic approach to defining the germline gene counterparts of a mutated autoantibody from a patient with rheumatoid arthritis.
Arth Rheum
35:356, 1992[Medline]
[Order article via Infotrieve]
34.
Yamada M, Wassermann R, Reichard BA, Shane S, Caton AJ, Rovera G:
Preferential utilization of specific immunoglobulin heavy chain diversion and joining segments in adult human peripheral blood B lymphocytes.
J Exp Med
173:359, 1991
35.
Kabat EA, Wu TT, Reid-Miller M, Perry HM, Gottesman KS:
Sequence of Proteins of Immunological Interests. Bethesda, MD, US Government Printing Office, 1987.
36.
Küppers R, Rajewsky K:
The origin of Hodgkin and Reed Sternberg cells in Hodgkin's disease.
Annu Rev Immunol
16:471, 1998[Medline]
[Order article via Infotrieve]
37.
Calkhoven PG, Aalbers M, Koshte VL, Schilte PP, Yntema JL, Griffioen RW, Van-Nierop JC, Oranje AP, Aalberse RC:
Relationship between IgG1 and IgG4 antibodies to foods and the development of IgE antibodies to inhalant allergens. II. Increased levels of IgG antibodies to foods in children who subsequently develop IgE antibodies to inhalant allergens.
Clin Exp Allergy
21:99, 1991[Medline]
[Order article via Infotrieve]
38.
Hell K, Pringle JH, Hansmann ML, Lorenzen L, Colloby P, Lauder I, Fischer R:
Demonstration of light chain mRNA in Hodgkin's disease.
J Pathol
171:137, 1993[Medline]
[Order article via Infotrieve]
39.
von Wasilewski R, Wilkens MDL, Nolte M, Werner M, Georgii A:
Light chain mRNA in lymphocyte predominant and mixed cellularity Hodgkin's disease.
Mod Pathol
9:334, 1996[Medline]
[Order article via Infotrieve]
40.
Ruprai AK, Pringle JH, Angel CA, Kind CN, Lauder I:
Localization of immunoglobulin light chain mRNA expression in Hodgkin's disease by in situ hybridization.
J Pathol
164:37, 1991[Medline]
[Order article via Infotrieve]
41.
Yatabe Y, Oka K, Asai J, Mori N:
Poor correlation between clonal immunoglobulin gene rearrangement and immunoglobulin gene transcription in Hodgkin's disease.
Am J Pathol
149:1351, 1996[Abstract]
42.
Landaas TO, Godal T, Halvorsen TB:
Characterization of immunoglobulins in Hodgkin cells.
Int J Cancer
20:717, 1977[Medline]
[Order article via Infotrieve]
43.
Kadin M, Stiles DP, Levy R, Warnke R:
Exogenous immunoglobulin and the macrophage origin of Reed-Sternberg cells. Demonstration of immunoglobulin and the macrophage origin of Reed-Sternberg cells in Hodgkin's disease.
N Engl J Med
299:1208, 1978[Abstract]
44.
Atchison ML, Delmas V, Perry RP:
A novel upstream element compensates for an ineffectual octamer motif in an immunoglobulin V kappa promoter.
EMBO J
10:3109, 1990
45.
Schäble KF, Zachau HG:
The variable genes of the human immunoglobulin kappa locus.
Biol Chem Hoppe Seyler
374:1001, 1993[Medline]
[Order article via Infotrieve]
46.
Falkner FG, Zachau HG:
Correct transcription of an immunoglobulin kappa gene requires an upstream fragment containing conserved sequence elements.
Nature
310:71, 1984[Medline]
[Order article via Infotrieve]
47.
Maquat LE:
Nuclear mRNA transport.
Curr Opin Cell Biol
3:1004, 1991[Medline]
[Order article via Infotrieve]
48.
Drexler HG:
Recent results on the biology of Hodgkin and Reed-Sternberg cells. I. Biopsy material.
Leuk Lymphoma
8:283, 1992[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. Chiu, W. Xu, B. He, S. R. Dillon, J. A. Gross, E. Sievers, X. Qiao, P. Santini, E. Hyjek, J.-w. Lee, et al.
Hodgkin lymphoma cells express TACI and BCMA receptors and generate survival and proliferation signals in response to BAFF and APRIL
Blood,
January 15, 2007;
109(2):
729 - 739.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ushmorov, O. Ritz, M. Hummel, F. Leithauser, P. Moller, H. Stein, and T. Wirth
Epigenetic silencing of the immunoglobulin heavy-chain gene in classical Hodgkin lymphoma-derived cell lines contributes to the loss of immunoglobulin expression
Blood,
November 15, 2004;
104(10):
3326 - 3334.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Diehl, H. Stein, M. Hummel, R. Zollinger, and J. M. Connors
Hodgkin's Lymphoma: Biology and Treatment Strategies for Primary, Refractory, and Relapsed Disease
Hematology,
January 1, 2003;
2003(1):
225 - 247.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Torlakovic, A. Tierens, H. D. Dang, and J. Delabie
The Transcription Factor PU.1, Necessary for B-Cell Development Is Expressed in Lymphocyte Predominance, But Not Classical Hodgkin's Disease
Am. J. Pathol.,
November 1, 2001;
159(5):
1807 - 1814.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Leithauser, M. Bauerle, M. Q. Huynh, and P. Moller
Isotype-switched immunoglobulin genes with a high load of somatic hypermutation and lack of ongoing mutational activity are prevalent in mediastinal B-cell lymphoma
Blood,
November 1, 2001;
98(9):
2762 - 2770.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Brauninger, T. Spieker, K. Willenbrock, P. Gaulard, H.-H. Wacker, K. Rajewsky, M.-L. Hansmann, and R. Kuppers
Survival and Clonal Expansion of Mutating "Forbidden" (Immunoglobulin Receptor-deficient) Epstein-Barr Virus-infected B Cells in Angioimmunoblastic T Cell Lymphoma
J. Exp. Med.,
October 1, 2001;
194(7):
927 - 940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Theil, H. Laumen, T. Marafioti, M. Hummel, G. Lenz, T. Wirth, and H. Stein
Defective octamer-dependent transcription is responsible for silenced immunoglobulin transcription in Reed-Sternberg cells
Blood,
May 15, 2001;
97(10):
3191 - 3196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Re, M. Müschen, T. Ahmadi, C. Wickenhauser, A. Staratschek-Jox, U. Holtick, V. Diehl, and J. Wolf
Oct-2 and Bob-1 Deficiency in Hodgkin and Reed Sternberg Cells
Cancer Res.,
March 1, 2001;
61(5):
2080 - 2084.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
F. M. Raaphorst, F. J. van Kemenade, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, A. P. Otte, and C. J. L. M. Meijer
Coexpression of BMI-1 and EZH2 Polycomb Group Genes in Reed-Sternberg Cells of Hodgkin's Disease
Am. J. Pathol.,
September 1, 2000;
157(3):
709 - 715.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Marafioti, M. Hummel, H.-D. Foss, H. Laumen, P. Korbjuhn, I. Anagnostopoulos, H. Lammert, G. Demel, J. Theil, T. Wirth, et al.
Hodgkin and Reed-Sternberg cells represent an expansion of a single clone originating from a germinal center B-cell with functional immunoglobulin gene rearrangements but defective immunoglobulin transcription
Blood,
February 15, 2000;
95(4):
1443 - 1450.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kanzler, R. Kuppers, S. Helmes, H.-H. Wacker, A. Chott, M.-L. Hansmann, and K. Rajewsky
Hodgkin and Reed-Sternberg-like cells in B-cell chronic lymphocytic leukemia represent the outgrowth of single germinal-center B-cell-derived clones: potential precursors of Hodgkin and Reed-Sternberg cells in Hodgkin's disease
Blood,
February 1, 2000;
95(3):
1023 - 1031.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Kuppers, U. Klein, M.-L. Hansmann, and K. Rajewsky
Cellular Origin of Human B-Cell Lymphomas
N. Engl. J. Med.,
November 11, 1999;
341(20):
1520 - 1529.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION