|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 12 (June 15), 1999:
pp. 4034-4043
Angiogenesis and Hematopoiesis Induced by Kaposi's Sarcoma-Associated
Herpesvirus-Encoded Interleukin-6
By
Yoshiyasu Aoki,
Elaine S. Jaffe,
Yuan Chang,
Karen Jones,
Julie Teruya-Feldstein,
Patrick S. Moore, and
Giovanna Tosato
From the Division of Hematologic Products, Center for Biologics
Evaluation and Research, Food and Drug Administration, Bethesda, MD;
the Hematopathology Section, National Cancer Institute, National
Institutes of Health, Bethesda, MD; and the Department of Pathology,
School of Public Health, Columbia University, New York, NY.
 |
ABSTRACT |
Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human
herpesvirus 8 [HHV-8]) is a herpesvirus linked to the development of
Kaposi's sarcoma (KS), primary effusion lymphoma, and a proportion of
Castleman's disease. KSHV encodes viral interleukin-6 (vIL-6), which
is structurally homologous to human and murine IL-6. The biological
activities of vIL-6 are largely unknown. To gain insight into the
biology of vIL-6, we expressed vIL-6 in murine fibroblasts NIH3T3 cells
and inoculated stable vIL-6-producing clones into athymic mice. vIL-6
was detected selectively in the blood of mice injected with
vIL-6-expressing clones. Compared with controls, vIL-6-positive mice
displayed increased hematopoiesis in the myeloid, erythroid, and
megakaryocytic lineages; plasmacytosis in spleen and lymph nodes;
hepatosplenomegaly; and polyclonal hypergammaglobulinemia. vIL-6-expressing NIH3T3 cells gave rise to tumors more rapidly than
did control cells, and vIL-6-positive tumors were more vascularized than controls. Vascular endothelial growth factor (VEGF) was detected at higher levels in the culture supernatant of vIL-6-expressing cells
compared with controls, and immunohistochemical staining detected VEGF
in spleen, lymph nodes, and tumor tissues from mice bearing
vIL-6-producing tumors but not control tumors. Thus, vIL-6 is a
multifunctional cytokine that promotes hematopoiesis, plasmacytosis, and angiogenesis. Through these functions, vIL-6 may play an important role in the pathogenesis of certain KSHV-associated disorders.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
KAPOSI'S SARCOMA-associated herpesvirus
(KSHV; also known as human herpesvirus 8 [HHV-8]) is a gamma
herpesvirus originally identified in acquired immunodeficiency syndrome
(AIDS)-associated Kaposi's sarcoma (KS) lesions.1 KSHV
sequences are regularly detected in KS lesions from human
immunodeficiency virus (HIV)-infected and noninfected individuals,
primary effusion lymphoma, and a proportion of Castleman's
disease.2-6 Most HIV-infected individuals and a proportion
of normal adults are believed to be infected with this virus, although
the precise incidence is still unclear. KSHV encodes several cytokine-
and chemokine-like proteins, including a viral homologue of
interleukin-6 (vIL-6).7-10 vIL-6 exhibits 24.7% amino acid
identity to human IL-6 and 24.2% identity to murine IL-6, suggesting
that it may be the result of viral piracy of a useful cellular gene.
Cellular IL-6, a multifunctional cytokine that acts on a wide variety
of cells, serves as a growth factor for myeloma and plasmacytoma cells
and can promote the terminal differentiation of B cells into
Ig-secreting cells.11-13 It has been implicated in the
pathogenesis of multiple myeloma and several other malignancies, including cardiac myxoma, Castleman's disease, and Kaposi's
sarcoma.14-20 IL-6 can stimulate hematopoietic progenitor
cells21,22 and functions as a hepatocyte-stimulating factor
promoting the expression of several acute-phase genes.13
Expression of IL-6 accompanies neovascularization of the placenta,
certain tumors, and wound healing.23-25 In vitro, IL-6 was
found to induce vascular endothelial growth factor (VEGF) mRNA,
suggesting that the cytokine can promote angiogenesis indirectly by
inducing VEGF expression.26
Unlike cell-derived IL-6, there is limited information on the
biological activities of vIL-6. Recombinant vIL-6 was reported to
support the growth and survival of the IL-6-dependent mouse hybridoma
cell line B97,9 and the human myeloma cell line INA-6.10 Compared with cellular IL-6, vIL-6 required
approximately 1,000-fold larger amounts of protein for maximal cell
proliferation. Results of experiments in vitro have suggested that
vIL-6 uses gp130 for signaling,27 the same transduction
pathway used by IL-6 and by several IL-6-related cytokines, such as
leukemia inhibitory factor, oncostatin M, IL-11, and ciliary
neurotrophic factor.13 However, the relative contribution
of IL-6 receptor  subunit to vIL-6 signaling has been
controversial.9,10,27 Recently, it was proposed that the
IL-6 receptor chain displays low binding affinity for vIL-6 due to
amino acids substitutions in the vIL-6 molecule at positions that are
critical for cytokine binding to the receptor.10
To extend current understanding of the biological properties of vIL-6,
we have generated stable vIL-6-producing clones of NIH3T3 cells and
inoculated them into athymic mice. Results from these experiments in
vivo show that vIL-6 is a multifunctional cytokine that stimulates
hematopoiesis, plasmacytosis, and angiogenesis.
| |
MATERIALS AND METHODS |
Cell transfection.
To express KSHV-vIL-6 in NIH3T3 cells, a 695-bp fragment of KSHV-vIL-6
was obtained from BC-1 cells by polymerase chain reaction (PCR)7 and inserted into the BCMGSneo plasmid
vector.28 Transfections were performed by electroporation.
Transfected cells were selected in 400 µg/mL G418 (Life Technologies,
Gaithersburg, MD), and resistant colonies were isolated after 2 to 3 weeks. Stable transfectant colonies were cloned by end-point limiting dilution.
Western blotting.
Immunoblotting of vIL-6 was performed as described.7
Briefly, cells were washed twice in phosphate-buffered saline (PBS), and cell pellets were suspended in electrophoresis sample buffer at 2 × 104 cell equivalents/µL. The conditioned media
were concentrated 10-fold using Centriprep-10 (Amicon, Beverly,
MA) and mixed with the same volume of electrophoresis
sample buffer. After boiling for 10 minutes, 20 µL of each sample was
loaded into each lane of 10% to 20% tricine gel (NOVEX, San Diego,
CA). The electrophoresed proteins were transferred onto polyvinylidene
difluoride membranes (Immobilon-P; Millipore, Bedford, MA).
Immunostaining was performed using a polyclonal rabbit
anti-vIL-6-peptide antibody (Ab),7 followed by the
incubation with a horseradish-peroxidase conjugated antirabbit IgG Ab
(Amersham, Arlington Heights, IL). Immunocomplexes were visualized
using the chemiluminescence detection system (Amersham). Primary
effusion lymphoma BCP-1 cells were used as a positive control for
vIL-6.7
IL-6 bioassay.
The murine hybridoma cell line B9 was used to measure IL-6 bioactivity
by standard protocols.29 Briefly, serial dilutions of
supernatants were incubated with 2 × 103 cells per
well in a 96-well plate for 72 hours at 37°C, including a 6-hour
terminal pulse with 1 µCi/well of [3H]-thymidine
(Amersham). [3H]-thymidine incorporation was determined
after cell harvesting onto glass fiber filters.
vIL-6 fusion protein and anti-vIL-6 antisera.
A genomic DNA fragment of vIL-6 was amplified using oligonucleotide
primers vIL-6-5'-Bam (GGCGGATCCGGCAAGTTGCCG GACGGC) and vIL-6-3'-Hind (CCCAAGCTTATTACTTATCGTGGACGT). After digestion with BamHI and HindIII, the PCR product was ligated into the
expression vector pMAL-c2 (New England BioLabs, Beverly, MA), expressed
in Escherichia coli strain DH5 (Life Technologies), and
purified according to the manufacturer's instructions. The vIL-6
fusion protein has an amino terminal tag of maltose-binding protein
(MBP) and amino acids 22-204 of vIL-6. It thus excludes the putative amino terminal signal peptide.7,8 The fusion protein has a
calculated relative molecular weight of 64.3 kD. Using the B9 cell
proliferation assay, the half maximal proliferation derived from 75 ng/mL of MBP-vIL-6 and from 1 pg/mL of recombinant human IL-6. A
neutralizing Ab against vIL-6 was obtained by immunizing a rabbit with
MBP-vIL-6, and the IgG fraction was purified using Mab Trap G II Kit
(Pharmacia Biotech Products, Piscataway, NJ).
Tumorigenicity studies.
All animal experiments were performed according to National Institute
of Health guidelines for the care and handling of mice. Cells were
trypsinized, resuspended in PBS, and injected subcutaneously into the
right flanks of 6-week-old female BALB/c nu/nu mice (5 × 105 cells per 100 µL PBS per animal). Five mice were used
in each group, and experiments were performed twice. Tumor size was
estimated as the product of two-dimensional caliper measurements.
Enzyme-linked immunosorbent assay (ELISA) for VEGF.
Cells were cultured at 3 × 105 cells per well in
24-well plates for 72 hours, and VEGF in the conditioned medium was
measured using a mouse or human VEGF Quantikine kit (R&D Systems,
Minneapolis, MN), following the manufacturer's instructions.
Ig analysis.
ELISAs were performed using goat antimouse Ig (Cappel ICN, Costa Mesa,
CA) and affinity-purified rabbit antimouse IgG, rabbit antimouse IgM
(both alkaline phosphates-conjugated; Sigma Chemical Co, St Louis,
MO), or rabbit antimouse IgA (horse radish
peroxidase-conjugated; Bio-Rad, Hercules, CA) Abs, as
described.30 The appropriate murine Igs (Southern
Biotechnology Associates, Birmingham, AL) were used as standards.
Immunofluorescence and immunohistochemistry.
Indirect immunofluorescence staining of cells was performed as
described31 using polyclonal Ab against vIL-6 synthetic
peptides and antirabbit IgG-fluorescein isothiocyanate
(FITC; Sigma Chemical Co) Abs. Sections of tumors,
spleens, and lymph nodes were stained for vIL-6, Ig  light chain, or
VEGF by the avidin-biotin-peroxidase method using Vectastain Elite ABC
kit (Vector Laboratories, Burlingame, CA), as described.32
Deparaffinized sections were incubated for 2 hours with rabbit
polyclonal anti-vIL-6 Ab,7 polyclonal anti-VEGF Ab (Santa
Cruz Biotechnology, Santa Cruz, CA), or control rabbit total IgG
(Cappel ICN) at room temperature. Slides were then reacted with
biotinylated antirabbit IgG (1:100 dilution) for 30 minutes, according
to the manufacturer's instructions. Cytoplasmic Ig staining was
performed using biotinylated antimouse chain Ab (Caltag
Laboratories, Burlingame, CA), as described.33
Endothelial cell proliferation assay.
Human umbilical vein endothelial cells (HUVECs; passage 3 to 6),
obtained from American Type Culture Collection (Manassas, VA), were
maintained in RPMI 1640 medium (Biowhittaker, Walkersville, MD), 15%
fetal bovine serum (FBS; Biowhittaker), 20 U/mL porcine heparin (Sigma
Chemical Co), and 100 µg/mL endothelial cell growth supplement
(Calbiochem-Novabiochem, La Jolla, CA). The HUVECs were seeded onto
uncoated 96-well plates (2,000 or 4,000 cells per well) and the
mitogenicity assay was performed as described.34 For
preparation of conditioned media, cells (3 × 105
cells per well) were cultured in 24-well plates with G418-free medium
for 72 hours. For neutralization, conditioned media (1:2 dilution) were
incubated with 2 µg/mL of purified goat antimouse VEGF neutralizing
Ab (IgG; R&D Systems), 2 µg/mL of control goat IgG (Cappel ICN), or
10 µg/mL purified rabbit anti-vIL-6 neutralizing Ab for 1 hour at
room temperature and then added to culture.
Microtubule formation on Matrigel.
The assay was performed as previously described.34 Wells of
a 48-multiwell plate were coated with 100 µL per well of Matrigel (Collaborative Biomedical Products, Bedford, MA) and incubated for 30 minutes at 37°C. HUVECs (104 cells/well) in 0.2 mL
medium with 15% FBS were plated on the Matrigel substratum, and
conditioned medium was added once cells were attached (total culture
volume, 1 mL). Plates were observed after 24 hours. The assay was
performed in duplicate.
Proliferation assay of parental or transfected NIH3T3 cells.
Cells were seeded in flat-bottom 96-well plates at 2 × 103 cells per well in medium with 10% FBS and cultured for
72 hours. Proliferation was measured by 16-hour pulse with 1 µCi/well
of [3H]-thymidine. Cells were detached from the plates by
freezing at  30°C and thawing, and
[3H]-thymidine incorporation was measured after cell
harvesting onto glass fiber filters.
| |
RESULTS |
Establishment of vIL-6-tranfected NIH3T3 cells.
To generate stable vIL-6 transfectants, we used a high expression
plasmid vector, BCMGSneo.28 This vector contains bovine papillomavirus sequences that transform murine fibroblast NIH3T3 cells
and maintain the plasmid at an intermediate to high copy number in
episomal form.28,35,36 A 695-bp fragment of vIL-6 cDNA was
amplified by PCR,7 inserted into BCMGSneo, and transfected into NIH3T3 cells. Stable transfectants were selected, and the expression of recombinant vIL-6 was examined by Western blotting (representative results in Fig 1A). Using a
rabbit polyclonal Ab against vIL-6 synthetic peptides,7
cell lysates (Fig 1A, lane 3) and culture supernatants (Fig 1A, lane 5)
from vIL-6-transfected clones contained immunoreactive vIL-6 migrating
at approximately the same position as cell lysates of the
vIL-6-positive cell line BCP-1 (Fig 1A, lane 1). In contrast,
nontransfected parental cells (Fig 1A, lane 2) and a control clone
transfected with vector alone (Fig 1A, lane 6) tested negative for
vIL-6. By immunofluorescence (Fig 1B), the cytoplasm of
vIL-6-transfected cells stained positive with a rabbit antiserum
against vIL-6 peptides (upper panel), whereas vector-control
transfected cells (lower panel) were negative. We tested supernatants
from several vIL-6-transfected clones for their ability to support the
growth of indicator B9 cells. Supernatants from vIL-6-expressing cells
contained significantly greater amounts of B9 activity compared with
supernatants from vector-control transfectants and from parental NIH3T3
cells (Fig 1C). Based on the results of quantitative B9 cell
proliferation assays (Fig 1C), we selected a high (v6O; ~900 B9 U/mL)
and a low (v6H; ~300 B9 U/mL) vIL-6 producer clones for further
experiments. It should be noted that vector-control and vIL-6
transfectants, including v6O and v6H, displayed similar levels of
spontaneous proliferation in vitro (Fig 1D).
View larger version (27K):
[in this window]
[in a new window]
| Fig 1.
Characterization of stable vIL-6 transfectants. (A)
Western blotting with anti-vIL-6 peptide Ab of cell lysates from BCP-1
(lane 1); parental NIH3T3 (lane 2); NIH3T3 transfected with
BCMGSneo-vIL-6 (lane 3); NIH3T3 transfected with BCMGSneo (lane 4); and
conditioned media from NIH3T3 cells transfected with BCMGSneo-vIL-6
(lane 5) and with control BCMGSneo (lane 6). The conditioned media were
concentrated 10-fold using Centriprep-10 (Amicon). (B) Representative
vIL-6 staining by indirect immunofluorescence of vIL-6 (upper) and
vector control (lower) transfectants. (C) B9 cell proliferative
responses to serial dilutions of conditioned media from parental line
NIH3T3 (x); vector controls BN5 ( ); BN7 ( ); and vIL-6
transfectant v6C ( ); and v6H ( ), v6I ( ), and v6O ( ) clones.
Each data point is the average (±SD) of six determinations. (D)
Spontaneous proliferation of parental NIH3T3, vector control
transfected BN7 clone, and vIL-6 transfected clones v6H and v6O. Cells
(2,000 cells/well) were cultured for 72 hours in complete culture
medium. The results reflect mean proliferation (±SD) of triplicate
cultures.
|
|
vIL-6 promotes tumorigenesis.
vIL-6 transfectants (clones v6O and v6H) and a stable control clone
transfected with vector DNA (BN7) were inoculated (5 × 105 cells) into the flank of groups of 5 nude mice. The
vIL-6-producing NIH3T3 cells (v6O and v6H clones) gave rise to
progressively growing tumors at the site of inoculation more rapidly
than did control BN7 cells (Fig 2A). After
4 weeks, all injected animals developed a tumor. The mean size of
tumors derived from v6O cells was 326.8 mm2, from v6H was
102.8 mm2, and from control BN7 cells was 11.3 mm2.
View larger version (64K):
[in this window]
[in a new window]
| Fig 2.
Tumorigenicity of vIL-6-expressing NIH3T3 cells in nude
mice. Cells were injected subcutaneously into the right flanks of
6-week-old female BALB/c nu/nu mice (5 × 105 cells in 100 µL PBS per animal). Five mice were used in each group. (A)
Representative mice 4 weeks after injections with v6O (upper), v6H
(middle), or BN7 (lower) cells. (B) Tumor growth curves during 4 weeks
observation: v6O (), v6H (), and BN7 (). Values reflect the
mean (±SD) of tumor size. Time to tumor formation was 5 to 7 days in
v6O cells, 5 to 6 days in v6H cells, and 25 to 29 days in BN7 cells,
respectively. Data are representative of two independent experiments.
(C) Representative microscopic appearance of v6O- and v6H-derived tumor
tissues. Abundance of blood vessels in a selected area of tumor tissue
is shown (hematoxylin-eosin; original magnification × 100). (D)
Immunohistochemical staining of vIL-6 in the tumor tissue from v6O
cells (original magnification × 400). (E) vIL-6 detection in sera
(0.1 µL) from mice injected with BN7 (lanes 2 and 3), v6O (lanes 4 and 5), and v6H (lanes 6 and 7) cells by Western blotting. Whole cell
lysate of v6O cells was used as a positive control (lane 1).
|
|
Histological analysis of tumor tissues derived from vIL-6-expressing
cells showed proliferation of spindle-shaped cells with high mitotic
activity, compatible with high-grade fibrosarcoma (Fig 2C). Notably,
all tumors from vIL-6-expressing cells displayed abundant
neovascularization in selected areas of the tumors (Fig 2C) that was
absent from controls (not shown). In addition, tumor tissues from
vIL-6-producing clones showed marked infiltration of neutrophils and
basophils; occasionally, they also displayed mast cell infiltration
(not shown). Immunohistochemical staining demonstrated diffuse
expression of vIL-6 in all tumor tissues derived from vIL-6-expressing
cells (representative results in Fig 2D), but not from controls (not
shown). Western blot analysis detected the presence of vIL-6 in the
sera from all mice injected 4 weeks earlier with the vIL-6-producing
clones v6O and v6H; no vIL-6 was detected in sera from animals injected
with control BN7 cells (representative results shown in Fig 2E).
vIL-6 accelerated hematopoiesis in athymic mice.
All mice were killed 4 weeks after initial cell inoculation and their
organs were examined macroscopically and histologically. Representative
results from this analysis are depicted in
Fig 3. Moderate splenomegaly and mild
hepatomegaly were observed in the animals inoculated with
vIL-6-producing lines v6O and v6H compared with controls inoculated
with BN7 cells (Fig 3A). Histologically, the white pulp of spleens from
mice with vIL-6 expressing tumors was decreased in size compared with
controls (Fig 3B). Both mantle-zones and germinal centers were
decreased in number and size (Fig 3C). In the white pulp areas, there
was marked plasmacytosis with scattered Mott cells (not shown).
Immunohistochemical staining for cytoplasmic Ig light chain showed
positive cells, confirming the occurrence of plasma cell infiltration
both in the white and red pulp (Fig 3D). Scattered histiocytes were
also seen in the perifollicular areas (not shown). The mean serum IgG
level was increased by twofold and the mean IgA level was increased by
15-fold in mice inoculated with the vIL-6-producing v6O cells compared
with controls inoculated with vector-transfected BN7 cells, whereas the
mean IgM level was unchanged.
View larger version (88K):
[in this window]
[in a new window]
| Fig 3.
Effects of vIL-6-expressing cells in nude mice. (A)
Spleen and liver sizes of mice injected with control or vIL-6 producing
clones. Data reflect the mean (±SD) of the weights of spleens and
livers (5 mice in each group). Hematoxylin-eosin stained
spleens from (B) a control mouse and (C) a mouse injected with
vIL-6-expressing cells (original magnification × 40). (D)
Immunohistochemical staining for light chains of splenic white pulp
(original magnification × 1,000) of a mouse injected with
vIL-6-expressing cells showing plasmacytosis. Chloroacetate esterase
stained sections show (E) expansion of myeloid cells (stained
red), erythroid precursors, and megakaryocytes in the red pulp
(original magnification × 200) and (F) myeloid cell islands in the
liver (original magnification × 400) in a mouse injected with
vIL-6-expressing cells. (G) Hematoxylin-eosin-stained lymph node in a
mouse injected with vIL-6-expressing cells (original magnification × 800) showing plasmacytosis.
|
|
Chloroacetate esterase staining of spleen tissue showed a striking
expansion of erythroid, myeloid, and megakaryocytic lineages (Fig 3E).
Megakaryocytes were found to be 40.2, 17.3, and 4.4 per 10 powered-fields in the spleens from v6O-, v6H-, and BN7-bearing mice,
respectively. Foci of extramedullary haematopoiesis were also found as
myeloid cell islands in the liver (Fig 3F). In the bone marrow, a
marked predominance of myeloid cells and megakaryocytes and,
occasionally, plasma cell infiltration were observed (not shown).
Peripheral blood leukocyte counts were 26,040 ± 5,900 cells/µL in
the mice inoculated 4 weeks earlier with the vIL-6-producing v6O cells
as opposed to 5,618 ± 295 cells/µL in control mice inoculated with vector-transfected BN7 cells. The vast majority (90% to 97%) of
circulating white blood cells were mature granulocytes. Although not
enlarged, lymph nodes from mice bearing vIL-6-transfected cells
displayed marked plasmacytosis in the medullary cord compartment with
scattered Mott cells and Russell bodies (Fig 3G). Together, these
results showed that vIL-6 activates hematopoiesis in all three lineages
and induces the differentiation of B lymphocytes.
vIL-6 induces VEGF production.
As noted above, vIL-6-producing NIH3T3 cells gave rise to tumors more
rapidly than control cells. Increased tumorigenicity could not be
attributed to increased spontaneous proliferation of the
vIL-6-producing clones, but tumor tissues from vIL-6-expressing cells
were more vascularized compared with controls. Because human IL-6 has
been shown to induce the expression of the angiogenic factor VEGF that
can promote tumor growth by increasing tumor blood
supply,26,32 we tested whether vIL-6 could induce VEGF expression. Conditioned medium from the vIL-6 transfectants v6H, v6I,
and v6O contained 2 to 8 times more VEGF than did the parental NIH3T3
cells or the vector control BN7 cells (Fig
4A). In addition, levels of VEGF in these conditioned media correlated
directly with B9 cell activity in these media (Fig 1C). To test whether vIL-6 can induce VEGF secretion, we cultured for 72 hours the vIL-6-producing v6O cells in the presence of neutralizing Abs against
vIL-6. As shown (Fig 4B), supernatants from v6O cells incubated with
Abs against vIL-6 contained lower amounts of VEGF than supernatants of
v6O cells cultured in medium alone. This result suggested that vIL-6 in
the culture supernatant could stimulate VEGF production by NIH3T3
cells.
View larger version (11K):
[in this window]
[in a new window]
| Fig 4.
vIL-6 induces VEGF secretion. (A) Detection of VEGF in
the culture supernatant of parental NIH3T3 cells, vector control (BN7),
and stable clones of vIL-6 transfectants (v6H, v6I, and v6O). (B)
Effects of anti-vIL-6 Ab (10 µg/mL) on VEGF detection in the culture
supernatant of v6O and BN7 cells. Data represent the mean (±SD) of
triplicates in one representative experiment of three performed.
|
|
We also looked for evidence of VEGF production in the mice inoculated
with vIL-6-producing clones. By immunohistochemistry, cytoplasmic and
membrane VEGF was detected in cells from tumors, spleens, and lymph
nodes of animals injected with vIL-6-expressing cells (representative
results shown in Fig 5A, C, and E). No VEGF was detected in mice injected with control cells (not shown). The
specificity of the reaction was confirmed by use of a control Ab (Fig
5B, D, and F). Based on these results, we conclude that vIL-6 can
stimulate the secretion of VEGF.
View larger version (172K):
[in this window]
[in a new window]
| Fig 5.
Detection of VEGF by immunohistochemical staining. (A and
B) Tumor (original magnification × 40); (C and D) lymph node
(original magnification × 200); and (E and F) spleen (original
magnification × 100) from mice with vIL-6-producing tumors. Sections
were stained with (A, C, and E) rabbit anti-VEGF Ab or (B, D, and F)
control rabbit IgG. Sections were reacted with diaminobenzidine
peroxidase substrate and counterstained with hematoxylin. Diffuse
staining of the tumor cells (A) and focal staining of lymph node (C)
and splenic white pulp area (E).
|
|
In additional experiments, we examined the relative contribution of
vIL-6 and VEGF to angiogenesis. First, we examined whether conditioned
medium from the vIL-6-expressing v6O clone that contains murine VEGF
(4.0 ng/mL) as well as vIL-6 (900 B9 U/mL) could promote the
proliferation of HUVECs. As shown in Fig
6A, this conditioned medium stimulated the proliferation of HUVECs
seeded at 2 or 4 × 103 cells/well. Control
conditioned media from parental NIH3T3 cells and vector-transfected BN7
cells displayed minimal effects (Fig 6A). To assess the relative
contribution of VEGF to HUVEC growth stimulation by v6O conditioned
medium, we looked at the effects of a neutralizing Ab directed at VEGF.
As shown in Fig 6B, anti-VEGF Ab reduced by 69.6% HUVEC proliferation
induced by v6O conditioned medium. By contrast, a neutralizing Ab
against vIL-6 was minimally inhibitory, and control IgG caused 15.1%
reduction of HUVEC proliferation. These results strongly suggest that
VEGF is critical to endothelial cell proliferation induced by vIL-6. To
assess further the role of VEGF as a mediator of angiogenesis by vIL-6,
we looked at the effects of anti-VEGF and anti-vIL-6 neutralizing Abs
on endothelial cell formation of tubelike structures, an essential step
to new blood vessel formation. When stimulated with VEGF or other
factors, HUVECs can form tubular structures resembling primordial
vessels.37 As expected, conditioned medium from v6O cells
that contains vIL-6 and VEGF promoted tube formation in the presence of
control IgG (Fig 6C). Anti-VEGF Ab prevented tube formation by v6O
conditioned medium. However, anti-vIL-6 Ab had minimal effect. Based
on the results of endothelial cell proliferation and tube formation
experiments, we conclude that vIL-6 indirectly stimulates angiogenesis
and that VEGF is a mediator of this process.
View larger version (48K):
[in this window]
[in a new window]
| Fig 6.
Contribution of VEGF to endothelial cell proliferation
and tube formation induced by vIL-6. (A) HUVECs (2 × 103
or 4 × 103 cells/well) were cultured for 72 hours with
conditioned medium (1:2 dilution) from NIH3T3 (), BN7 ( ), and v6O
() cells. The results represent the mean (±SD) of triplicate
cultures; shown is one representative experiment of three performed.
(B) HUVECs were cultured (2 × 103 cells/well) for 72 hours with conditioned medium from v6O cells (1:2 dilution) alone or in
conjunction with anti-VEGF Ab (2 µg/mL), anti-vIL-6 Ab (10 µg/mL),
or control IgG (2 µg/mL). The results represent the mean (±SD) of
triplicate cultures; shown is one representative experiment of three
performed. (C) HUVECs (1 × 104) were plated on
Matrigel-coated wells in conditioned medium from v6O cells (1:2
dilution) supplemented with control IgG (2 µg/mL), anti-VEGF Ab (2 µg/mL), or anti-vIL-6 Ab (10 µg/mL). Photographs depict the
microtubules after 24 hours of incubation (original magnification × 100).
|
|
| |
DISCUSSION |
The goal of this study was to gain information on the biological
activities of the viral cytokine vIL-6. Previous studies have shown
that vIL-6 is a product of an early lytic gene of KSHV that is
expressed in virus-infected cells that have undergone a switch from
latency to viral replication.7 Structurally, vIL-6 has
24.8% amino acid sequence identity to human IL-6,7-9 raising the possibility that KSHV may have captured the cellular IL-6
gene for its advantage. We know that vIL-6 is detected in some
KSHV-infected primary effusion lymphoma cells and in KSHV-infected tissues diagnosed with Castleman's disease.7,38,39 By
contrast, only 1% to 2% of cells in KSHV-infected Kaposi's sarcoma
lesions express vIL-6.7 Thus, vIL-6 was proposed to play a
role in the pathogenesis of primary effusion lymphomas and
KSHV-positive Castleman's disease. However, what role vIL-6 might play
in disease pathogenesis and KSHV survival in humans is unclear, mostly
because there is limited information on vIL-6 activities. It was
reported that vIL-6 can signal through gp130, like human IL-6 and other IL-6-related cytokines.27 It was also reported that vIL-6
can stimulate the proliferation of the murine hybridoma B9 cells and the human myeloma INA-6 cells that are dependent on
IL-6.7,9,10 However, vIL-6 has not been previously reported
to target cells other than those of B-cell lineage or to display
biological activities in vivo.
We show here that subcutaneous inoculation of NIH3T3 cells expressing
vIL-6 into nude mice is associated with the development of a syndrome
characterized by hepatosplenomegaly; increased hematopoiesis in the
myeloid, erythroid, and megakaryocytic lineages; and plasmacytosis in
spleen and lymph nodes. This syndrome was absent from mice inoculated
with vector control cells. Because we expressed vIL-6 in NIH3T3 cells
under the control of a papillomavirus-based vector that is known to
transform NIH3T3 cells,36 both vector-transfected and vIL-6
transfected cells were tumorigenic in athymic mice. However, tumors
from vIL-6 expressing NIH3T3 developed more rapidly and were more
vascular compared with tumors from control cells transfected with
vector alone. By immunohistochemistry, tumors, spleens, and lymph nodes
from mice injected with vIL-6-producing cells expressed VEGF that was
not detectable at these sites in control animals. Together, these
studies document that vIL-6 is a multifunctional cytokine.
Earlier experiments have examined the effects of cellular IL-6
expression in mice. In one study,40 mice reconstituted with bone marrow transduced with a retroviral vector coding for murine IL-6
developed, after 15 to 21 weeks, a syndrome characterized by anemia,
transient granulocytosis, hypoalbuminemia, and polyclonal hypergammaglobulinemia associated with marked splenomegaly and peripheral lymphadenopathy. Lymph nodes, spleen, liver, and lung displayed extensive plasma cell infiltration. In a similar
study,41 expression of murine IL-6 in bone marrow resulted
in the development after 4 weeks of a lymphoproliferative disease
associated with enhanced splenic myelopoiesis and marked neutrophil
infiltration of the lungs, liver, and sometimes lymph nodes.
Additionally, Epstein-Barr virus-infected lymphoblastoid cells
transfected with the human IL-6 gene frequently gave rise to
subcutaneous tumors in athymic mice, whereas controls did not,
indicating that human IL-6 can promote lymphoma
development.42 Furthermore, IL-6 transgenic mice of the
C57BL/6 origin showed massive plasmacytosis, and IL-6 transgenic mice
of the BALB/c strain developed monoclonal plasmacytomas that were
transplantable.30 Experiments in vivo and in vitro have
demonstrated that IL-6 can promote the expansion of murine hematopoietic progenitor cells by stimulating entry of resting cells
into the G1 phase of cell cycle.13,22 When cultured with IL-6, skeletal muscle and glioma cells were induced to express VEGF
mRNA.26 This result is consistent with earlier observations that IL-6 is physiologically expressed during the angiogenic response that accompanies placental folliculogenesis.21 Thus,
hepatosplenomegaly, enhanced hematopoiesis, plasmacytosis, enhanced
tumorigenesis, and induction of VEGF are biological effects
attributable to both cellular and vIL-6 in experimental murine models.
The precise relevance of the current results to the interaction between
vIL-6 and human cells remains to be fully explored and will require a
full characterization of vIL-6 receptor(s) and their relationship to
human and murine IL-6 receptors.
In KS, the lesions contain abundant human IL-6, but only 1% to 2% of
the cells have been reported to express vIL-6.7 One study
of primary effusion lymphoma reported large amounts of human IL-6 in
pleural effusions and in the tumor cells, including KS-1, BC-1, and
BC-2.43 High-level vIL-6 expression was noted in the primary effusion lymphoma BCP-1, where 65% of the tumor cells were
strongly positive for vIL-6.7 Constitutive vIL-6 expression was also reported in the primary effusion lymphoma BC-1
cells.36 Thus, in primary effusion lymphoma, human IL-6
and/or vIL-6 were expressed. Early studies of Castleman's disease,
before the discovery of KSHV, reported intense human IL-6 staining of
germinal centers within hyperplastic lymph nodes, and patients' sera
were found to contain abnormally elevated IL-6 levels.16 In
a recent study using immunohistochemistry, all KSHV-positive
Castleman's disease tissues had evidence of marked vIL-6
expression.39 Human IL-6 was also detected in at least some
of these tissues.39 Of interest, vIL-6-positive cells were
immunoblastic CD20 cells present among the mantle
zone lymphocytes or, more rarely, at the periphery of germinal centers,
whereas human IL-6-positive cells localized in the germinal centers
and more rarely in the paracortical areas.16,27 Thus,
KSHV-positive Castleman's disease tissues express vIL-6 sometimes
together with human IL-6, but the two cytokines are produced by
different cells within the affected tissue.
Expression of vIL-6 alone or in conjunction with cellular IL-6 in the
context of primary effusion lymphoma and Castleman's disease and the
similarities of biological activities of human and vIL-6 described in
this report strengthen the argument that these cytokines are critical
to disease pathogenesis. In primary effusion lymphoma, VEGF induced by
either cellular or vIL-6 could favor fluid accumulation in the body
cavities through its ability to promote vascular
permeability.44 Many of the features of Castleman's
disease, particularly the multicentric subtype, could be attributed to
viral or human IL-6, including lymphadenopathy with plasma cell
infiltration, hepatosplenomegaly, constitutional symptoms, and
hypergammaglobulinemia.38,45 In this disease, lymphoid
hyperplasia is often associated with evidence of excessive vascularization in the germinal centers that has been attributed to
local VEGF expression by nonlymphoid cells with the morphology of
fibroblasts.46
In addition to its ability to promote VEGF expression through vIL-6,
KSHV can promote VEGF expression through a virally encoded G-coupled
protein receptor and the chemokines viral inflammatory protein I and
II.37,47 Infection of human endothelial cells by KSHV
induced VEGF and other angiogenic cytokines.48 VEGF may not
be the sole angiogenic factor inducible by vIL-6. In our model system,
it is possible that vIL-6 induces other angiogenic factors besides
VEGF. However, even in the presence of other angiogenic cytokines, the
results of VEGF neutralization experiments provided evidence that VEGF
is a critical mediator of angiogenesis stimulation by vIL-6. VEGF plays
an essential role in vascularization, because VEGF withdrawal could
arrest immature blood vessel formation.49,50 Redundancy of
KSHV genes for VEGF induction suggests that neovascularization is
critical to virus survival. By ensuring an adequate blood supply to
KSHV-infected cells, the virus could favor their growth and spread.
When combined with KSHV's more direct cell growth-promoting properties, angiogenesis stimulation could represent an effective viral
strategy for spreading in the human species.
| |
ACKNOWLEDGMENT |
The authors thank Drs H. Karasuyama and S. Russell for BCMGSneo plasmid
vector; E. Mushinski for advice on immunohistochemical staining of
cytoplasmic Igs; P. Burd for designing oligoprimers vIL-6-5'-Bam
and vIL-6-3'-Hind; L. Yao and S. Pike for assistance with
endothelial cell growth assays; R. Nordan and G. Marti for help with
histological review; B. Cherney, Y. Lee, M. Ichino, E. Max, and J. Farber for critical advice on the preparation of MBP-vIL-6; and M. Potter for helpful discussion of the manuscript.
| |
FOOTNOTES |
Submitted November 23, 1998; accepted March 24, 1999.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Presented in part at the 40th Annual American Society of Hematology
Meeting, December 7, 1998 (Miami Beach, FL).
Address reprint requests to Yoshiyasu Aoki, MD, PhD, Center for
Biologics Evaluation and Research, Food and Drug Administration, Bldg
29A, Room 2D06 HFM-535, 8800 Rockville Pike, Bethesda, MD 20892;
e-mail: AOKI{at}CBER.FDA.GOV.
| |
REFERENCES |
1.
Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS:
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865, 1994[Abstract/Free Full Text]
2.
Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM:
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N Engl J Med
332:1186, 1995[Abstract/Free Full Text]
3.
Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, Babinet P, d'Agay MF, Clauvel JP, Raphael M, Degos L, Sigaux F:
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276, 1995[Abstract/Free Full Text]
4.
Boshoff C, Schulz TF, Kennedy MM, Graham AK, Fisher C, Thomas A, McGee JO, Weiss RA, O'Leary JJ:
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat Med
1:1274, 1995[Medline]
[Order article via Infotrieve]
5.
Nador RG, Cesarman E, Chadburn A, Dawson DB, Ansari MQ, Said J, Knowles DM:
Primary effusion lymphoma: A distinct clinicopathologic entity associated with the Kaposi's sarcoma-associated herpes virus.
Blood
88:645, 1996[Abstract/Free Full Text]
6.
Martin JN, Ganem DE, Osmond DH, Page-Shafer KA, Macrae D, Kedes DH:
Sexual transmission and the natural history of human herpesvirus 8 infection.
N Engl J Med
338:948, 1998[Abstract/Free Full Text]
7.
Moore PS, Boshoff C, Weiss RA, Chang Y:
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739, 1996[Abstract/Free Full Text]
8.
Neipel F, Albrecht JC, Ensser A, Huang YQ, Li JJ, Friedman-Kien AE, Fleckenstein B:
Human herpesvirus 8 encodes a homolog of interleukin-6.
J Virol
71:839, 1997[Abstract]
9.
Nicholas J, Ruvolo VR, Burns WH, Sandford G, Wan X, Ciufo D, Hendrickson SB, Guo HG, Hayward GS, Reitz MS:
Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6.
Nat Med
3:287, 1997[Medline]
[Order article via Infotrieve]
10.
Burger R, Neipel F, Fleckenstein B, Savino R, Ciliberto G, Kalden JR, Gramatzki M:
Human herpesvirus type 8 interleukin-6 homologue is functionally active on human myeloma cells.
Blood
91:1858, 1998[Abstract/Free Full Text]
11.
Tosato G, Seamon KB, Goldman ND, Sehgal PB, May LT, Washington GC, Jones KD, Pike SE:
Monocyte-derived human B-cell growth factor identified as interferon-beta 2 (BSF-2, IL-6).
Science
239:502, 1988[Abstract/Free Full Text]
12.
Tanner JE, Tosato G:
Regulation of B-cell growth and immunoglobulin gene transcription by interleukin-6.
Blood
79:452, 1992[Abstract/Free Full Text]
13.
Kishimoto T, Akira S, Narazaki M, Taga T:
Interleukin-6 family of cytokines and gp130.
Blood
86:1243, 1995[Free Full Text]
14.
Bataille R, Harousseau JL:
Multiple myeloma.
N Engl J Med
336:1657, 1997[Free Full Text]
15.
Jourdan M, Bataille R, Seguin J, Zhang XG, Chaptal PA, Klein B:
Constitutive production of interleukin-6 and immunologic features in cardiac myxomas.
Arthritis Rheum
33:398, 1990[Medline]
[Order article via Infotrieve]
16.
Yoshizaki K, Matsuda T, Nishimoto N, Kuritani T, Taeho L, Aozasa K, Nakahata T, Kawai H, Tagoh H, Komori T, Kishimoto S, Hirano T, Kishimoto T:
Pathogenic significance of interleukin-6 (IL-6/BSF-2) in Castleman's disease.
Blood
74:1360, 1989[Abstract/Free Full Text]
17.
Beck JT, Hsu SM, Wijdenes J, Bataille R, Klein B, Vesole D, Hayden K, Jagannath S, Barlogie B:
Brief report: Alleviation of systemic manifestations of Castleman's disease by monoclonal anti-interleukin-6 antibody.
N Engl J Med
330:602, 1994[Free Full Text]
18.
Miles SA, Rezai AR, Salazar-Gonzalez JF, Vander Meyden M, Stevens RH, Logan DM, Mitsuyasu RT, Taga T, Hirano T, Kishimoto T, Martinez-Maza O:
AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6.
Proc Natl Acad Sci USA
87:4068, 1990[Abstract/Free Full Text]
19.
Liu ZY, Ganju RK, Wang JF, Ona MA, Hatch WC, Zheng T, Avraham S, Gill P, Groopman JE:
Cytokine signaling through the novel tyrosine kinase RAFTK in Kaposi's sarcoma cells.
J Clin Invest
99:1798, 1997[Medline]
[Order article via Infotrieve]
20.
Nagpal S, Cai J, Zheng T, Patel S, Masood R, Lin GY, Friant S, Johnson A, Smith DL, Chandraratna RA, Gill PS:
Retinoid antagonism of NF-IL6: insight into the mechanism of antiproliferative effects of retinoids in Kaposi's sarcoma.
Mol Cell Biol
17:4159, 1997[Abstract]
21.
Motro B, Itin A, Sachs L, Keshet E:
Pattern of interleukin 6 gene expression in vivo suggests a role for this cytokine in angiogenesis.
Proc Natl Acad Sci USA
87:3092, 1990[Abstract/Free Full Text]
22.
Sui X, Tsuji K, Tanaka R, Tajima S, Muraoka K, Ebihara Y, Ikebuchi K, Yasukawa K, Taga T, Kishimoto T, Nakahata T:
gp130 and c-Kit signalings synergize for ex vivo expansion of human primitive hemopoietic progenitor cells.
Proc Natl Acad Sci USA
92:2859, 1995[Abstract/Free Full Text]
23.
Banu N, Wang JF, Deng B, Groopman JE, Avraham H:
Modulation of megakaryocytopoiesis by thrombopoietin: The c-Mpl ligand.
Blood
86:1331, 1995[Abstract/Free Full Text]
24.
Yaccoby S, Barlogie B, Epstein J:
Primary myeloma cells growing in SCID-hu mice: A model for studying the biology and treatment of myeloma and its manifestations.
Blood
92:2908, 1998[Abstract/Free Full Text]
25.
Mateo RB, Reichner JS, Albina JE:
Interleukin-6 activity in wounds.
Am J Physiol
266:R1840, 1994[Abstract/Free Full Text]
26.
Cohen T, Nahari D, Cerem LW, Neufeld G, Levi BZ:
Interleukin 6 induces the expression of vascular endothelial growth factor.
J Biol Chem
271:736, 1996[Abstract/Free Full Text]
27.
Molden J, Chang Y, You Y, Moore PS, Goldsmith MA:
A Kaposi's sarcoma-associated herpesvirus-encoded cytokine homolog (vIL-6) activates signaling through the shared gp130 receptor subunit.
J Biol Chem
272:19625, 1997[Abstract/Free Full Text]
28.
Karasuyama H, Kudo A, Melchers F:
The proteins encoded by the VpreB and lambda 5 pre-B cell-specific genes can associate with each other and with mu heavy chain.
J Exp Med
172:969, 1990[Abstract/Free Full Text]
29.
Jones K, Rivera C, Sgadari C, Franklin J, Max EE, Bhatia K, Tosato G:
Infection of human endothelial cells with Epstein-Barr virus.
J Exp Med
182:1213, 1995[Abstract/Free Full Text]
30.
Suematsu S, Matsusaka T, Matsuda T, Ohno S, Miyazaki J, Yamamura K, Hirano T, Kishimoto T:
Generation of plasmacytomas with the chromosomal translocation t(12;15) in interleukin 6 transgenic mice.
Proc Natl Acad Sci USA
89:232, 1992[Abstract/Free Full Text]
31.
Chen YT, Holcomb C, Moore HP:
Expression and localization of two low molecular weight GTP-binding proteins, Rab8 and Rab10, by epitope tag.
Proc Natl Acad Sci USA
90:6508, 1993[Abstract/Free Full Text]
32.
Ferrara N, Winer J, Burton T, Rowland A, Siegel M, Phillips HS, Terrell T, Keller GA, Levinson AD:
Expression of vascular endothelial growth factor does not promote transformation but confers a growth advantage in vivo to Chinese hamster ovary cells.
J Clin Invest
91:160, 1993
33.
Lattanzio G, Libert C, Aquilina M, Cappelletti M, Ciliberto G, Musiani P, Poli V:
Defective development of pristane-oil-induced plasmacytomas in interleukin-6-deficient BALB/c mice.
Am J Pathol
151:689, 1997[Abstract]
34.
Angiolillo AL, Sgadari C, Taub DD, Liao F, Farber JM, Maheshwari S, Kleinman HK, Reaman GH, Tosato G:
Human interferon-inducible protein 10 is a potent inhibitor of angiogenesis in vivo.
J Exp Med
182:155, 1995[Abstract/Free Full Text]
35.
Tani K, Ozawa K, Ogura H, Takahashi T, Okano A, Watari K, Matsudaira T, Tajika K, Karasuyama H, Nagata S, Asano S, Takaku F:
Implantation of fibroblasts transfected with human granulocyte colony-stimulating factor cDNA into mice as a model of cytokine-supplement gene therapy.
Blood
74:1274, 1989[Abstract/Free Full Text]
36.
Uemura N, Ozawa K, Tojo A, Takahashi K, Okano A, Karasuyama H, Tani K, Asano S:
Acquisition of interleukin-3 independence in FDC-P2 cells after transfection with the activated c-H-ras gene using a bovine papillomavirus-based plasmid vector.
Blood
80:3198, 1992[Abstract/Free Full Text]
37.
Boshoff C, Endo Y, Collins PD, Takeuchi Y, Reeves JD, Schweickart VL, Siani MA, Sasaki T, Williams TJ, Gray PW, Moore PS, Chang Y, Weiss RA:
Angiogenic and HIV-inhibitory functions of KSHV-encoded chemokines.
Science
278:290, 1997[Abstract/Free Full Text]
38.
Sarid R, Flore O, Bohenzky RA, Chang Y, Moore PS:
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J Virol
72:1005, 1998[Abstract/Free Full Text]
39.
Parravicini C, Corbellino M, Paulli M, Magrini U, Lazzarino M, Moore PS, Chang Y:
Expression of a virus-derived cytokine, KSHV vIL-6, in HIV-seronegative Castleman's disease.
Am J Pathol
151:1517, 1997[Abstract]
40.
Brandt SJ, Bodine DM, Dunbar CE, Nienhuis AW:
Dysregulated interleukin 6 expression produces a syndrome resembling Castleman's disease in mice.
J Clin Invest
86:592, 1990
41.
Hawley RG, Fong AZ, Burns BF, Hawley TS:
Transplantable myeloproliferative disease induced in mice by an interleukin 6 retrovirus.
J Exp Med
176:1149, 1992[Abstract/Free Full Text]
42.
Tanner J, Tosato G:
Impairment of natural killer functions by interleukin 6 increases lymphoblastoid cell tumorigenicity in athymic mice.
J Clin Invest
88:239, 1991
43.
Asou H, Said JW, Yang R, Munker R, Park DJ, Kamada N, Koeffler HP:
Mechanisms of growth control of Kaposi's sarcoma-associated herpes virus-associated primary effusion lymphoma cells.
Blood
91:2475, 1998[Abstract/Free Full Text]
44.
Dvorak HF, Brown LF, Detmar M, Dvorak AM:
Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis.
Am J Pathol
146:1029, 1995[Abstract]
45.
Peterson BA, Frizzera G:
Multicentric Castleman's disease.
Semin Oncol
20:636, 1993[Medline]
[Order article via Infotrieve]
46.
Foss HD, Araujo I, Demel G, Klotzbach H, Hummel M, Stein H:
Expression of vascular endothelial growth factor in lymphomas and Castleman's disease.
J Pathol
183:44, 1997[Medline]
[Order article via Infotrieve]
47.
Bais C, Santomasso B, Coso O, Arvanitakis L, Raaka EG, Gutkind JS, Asch AS, Cesarman E, Gershengorn MC, Mesri EA, Gerhengorn MC:
G-protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature
391:86, 1998[Medline]
[Order article via Infotrieve]
48.
Masood R, Flore O, Cai J, Zheng T, Yavrom S, McGarvey ME, Espina BM, Smith DL, Gill PS:
The VEGF family of proteins are autocrine growth and survival factors in AIDS-KS.
Blood
92:538a, 1998
49.
Yoshida S, Ono M, Shono T, Izumi H, Ishibashi T, Suzuki H, Kuwano M:
Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis.
Mol Cell Biol
17:4015, 1997[Abstract]
50.
Benjamin LE, Golijanin D, Itin A, Pode D, Keshet E:
Selective ablation of immature blood vessels in established human tumors follows vascular endothelial growth factor withdrawal.
J Clin Invest
103:159, 1999[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. L. Calabro, P. Gasperini, I. M. Di Gangi, S. Indraccolo, M. Barbierato, A. Amadori, and L. Chieco-Bianchi
Antineoplastic activity of lentiviral vectors expressing interferon-{alpha} in a preclinical model of primary effusion lymphoma
Blood,
May 7, 2009;
113(19):
4525 - 4533.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Carbone, E. Cesarman, M. Spina, A. Gloghini, and T. F. Schulz
HIV-associated lymphomas and gamma-herpesviruses
Blood,
February 5, 2009;
113(6):
1213 - 1224.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Chen, G. Sandford, and J. Nicholas
Intracellular Signaling Mechanisms and Activities of Human Herpesvirus 8 Interleukin-6
J. Virol.,
January 15, 2009;
83(2):
722 - 733.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Gasperini, S. Sakakibara, and G. Tosato
Contribution of viral and cellular cytokines to Kaposi's sarcoma-associated herpesvirus pathogenesis
J. Leukoc. Biol.,
October 1, 2008;
84(4):
994 - 1000.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. B. Choi and J. Nicholas
Autocrine and Paracrine Promotion of Cell Survival and Virus Replication by Human Herpesvirus 8 Chemokines
J. Virol.,
July 1, 2008;
82(13):
6501 - 6513.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. C. Shin, C.-H. Joo, M. U. Gack, H.-R. Lee, and J. U. Jung
Kaposi's Sarcoma-Associated Herpesvirus Viral IFN Regulatory Factor 3 Stabilizes Hypoxia-Inducible Factor-1{alpha} to Induce Vascular Endothelial Growth Factor Expression
Cancer Res.,
March 15, 2008;
68(6):
1751 - 1759.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-J. Zhang, R. S. Bonaparte, D. Patel, D. A. Stein, and P. L. Iversen
Blockade of viral interleukin-6 expression of Kaposi's sarcoma-associated herpesvirus
Mol. Cancer Ther.,
March 1, 2008;
7(3):
712 - 720.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Sivakumar, N. Sharma-Walia, H. Raghu, M. V. Veettil, S. Sadagopan, V. Bottero, L. Varga, R. Levine, and B. Chandran
Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained Levels of Vascular Endothelial Growth Factors A and C Early during In Vitro Infection of Human Microvascular Dermal Endothelial Cells: Biological Implications
J. Virol.,
February 15, 2008;
82(4):
1759 - 1776.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Sander, A. Konrad, M. Thurau, E. Wies, R. Leubert, E. Kremmer, H. Dinkel, T. Schulz, F. Neipel, and M. Sturzl
Intracellular Localization Map of Human Herpesvirus 8 Proteins
J. Virol.,
February 15, 2008;
82(4):
1908 - 1922.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M-Q Du, C M Bacon, and P G Isaacson
Kaposi sarcoma-associated herpesvirus/human herpesvirus 8 and lymphoproliferative disorders
J. Clin. Pathol.,
December 1, 2007;
60(12):
1350 - 1357.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. V. Popovic, R. Sandhoff, T. P. Sijmonsma, S. Kaden, R. Jennemann, E. Kiss, E. Tone, F. Autschbach, N. Platt, E. Malle, et al.
Sulfated Glycosphingolipid as Mediator of Phagocytosis: SM4s Enhances Apoptotic Cell Clearance and Modulates Macrophage Activity
J. Immunol.,
November 15, 2007;
179(10):
6770 - 6782.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. J. Vart, L. L. Nikitenko, D. Lagos, M. W.B. Trotter, M. Cannon, D. Bourboulia, F. Gratrix, Y. Takeuchi, and C. Boshoff
Kaposi's Sarcoma-Associated Herpesvirus-Encoded Interleukin-6 and G-Protein-Coupled Receptor Regulate Angiopoietin-2 Expression in Lymphatic Endothelial Cells
Cancer Res.,
May 1, 2007;
67(9):
4042 - 4051.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F.-C. Ye, D. J. Blackbourn, M. Mengel, J.-P. Xie, L.-W. Qian, W. Greene, I-T. Yeh, D. Graham, and S.-J. Gao
Kaposi's Sarcoma-Associated Herpesvirus Promotes Angiogenesis by Inducing Angiopoietin-2 Expression via AP-1 and Ets1
J. Virol.,
April 15, 2007;
81(8):
3980 - 3991.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-H. Sin, D. Roy, L. Wang, M. R. Staudt, F. D. Fakhari, D. D. Patel, D. Henry, W. J. Harrington Jr, B. A. Damania, and D. P. Dittmer
Rapamycin is efficacious against primary effusion lymphoma (PEL) cell lines in vivo by inhibiting autocrine signaling
Blood,
March 1, 2007;
109(5):
2165 - 2173.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. M. Brinkmann, M. Pietrek, O. Dittrich-Breiholz, M. Kracht, and T. F. Schulz
Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol.,
January 1, 2007;
81(1):
42 - 58.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C.-Y. Yang, T.-H. Kuo, and L.-P. Ting
Human Hepatitis B Viral e Antigen Interacts with Cellular Interleukin-1 Receptor Accessory Protein and Triggers Interleukin-1 Response
J. Biol. Chem.,
November 10, 2006;
281(45):
34525 - 34536.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Chen and J. Nicholas
Structural Requirements for gp80 Independence of Human Herpesvirus 8 Interleukin-6 (vIL-6) and Evidence for gp80 Stabilization of gp130 Signaling Complexes Induced by vIL-6
J. Virol.,
October 1, 2006;
80(19):
9811 - 9821.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kovaleva, I. Bussmeyer, B. Rabe, J. Grotzinger, E. Sudarman, J. Eichler, U. Conrad, S. Rose-John, and J. Scheller
Abrogation of Viral Interleukin-6 (vIL-6)-Induced Signaling by Intracellular Retention and Neutralization of vIL-6 with an Anti-vIL-6 Single-Chain Antibody Selected by Phage Display.
J. Virol.,
September 1, 2006;
80(17):
8510 - 8520.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. A. R. Rezaee, C. Cunningham, A. J. Davison, and D. J. Blackbourn
Kaposi's sarcoma-associated herpesvirus immune modulation: an overview
J. Gen. Virol.,
July 1, 2006;
87(7):
1781 - 1804.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. J. Dezube, S. E. Krown, J. Y. Lee, K. S. Bauer, and D. M. Aboulafia
Randomized Phase II Trial of Matrix Metalloproteinase Inhibitor COL-3 in AIDS-Related Kaposi's Sarcoma: An AIDS Malignancy Consortium Study
J. Clin. Oncol.,
March 20, 2006;
24(9):
1389 - 1394.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cannon, E. Cesarman, and C. Boshoff
KSHV G protein-coupled receptor inhibits lytic gene transcription in primary-effusion lymphoma cells via p21-mediated inhibition of Cdk2
Blood,
January 1, 2006;
107(1):
277 - 284.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. K. Hong, P. Kumar, L. Wang, B. Damania, M. L. Gulley, H.-J. Delecluse, P. J. Polverini, and S. C. Kenney
Epstein-Barr Virus Lytic Infection Is Required for Efficient Production of the Angiogenesis Factor Vascular Endothelial Growth Factor in Lymphoblastoid Cell Lines
J. Virol.,
November 15, 2005;
79(22):
13984 - 13992.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Montani, L. Achouh, A. G. Marcelin, J-P. Viard, O. Hermine, D. Canioni, O. Sitbon, G. Simonneau, and M. Humbert
Reversibility of pulmonary arterial hypertension in HIV/HHV8-associated Castleman's disease
Eur. Respir. J.,
November 1, 2005;
26(5):
969 - 972.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Dagna, F. Broccolo, C. T. Paties, M. Ferrarini, L. Sarmati, L. Praderio, M. G. Sabbadini, P. Lusso, and M. S. Malnati
A Relapsing Inflammatory Syndrome and Active Human Herpesvirus 8 Infection
N. Engl. J. Med.,
July 14, 2005;
353(2):
156 - 163.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. Akula, P. W. Ford, A. G. Whitman, K. E. Hamden, B. A. Bryan, P. P. Cook, and J. A. McCubrey
B-Raf-dependent expression of vascular endothelial growth factor-A in Kaposi sarcoma-associated herpesvirus-infected human B cells
Blood,
June 1, 2005;
105(11):
4516 - 4522.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Lu, J. Suen, C. Frias, R. Pfeiffer, M.-H. Tsai, E. Chuang, and S. L. Zeichner
Dissection of the Kaposi's Sarcoma-Associated Herpesvirus Gene Expression Program by Using the Viral DNA Replication Inhibitor Cidofovir
J. Virol.,
December 15, 2004;
78(24):
13637 - 13652.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. B. Meads and P. G. Medveczky
Kaposi's Sarcoma-associated Herpesvirus-encoded Viral Interleukin-6 Is Secreted and Modified Differently Than Human Interleukin-6: EVIDENCE FOR A UNIQUE AUTOCRINE SIGNALING MECHANISM
J. Biol. Chem.,
December 10, 2004;
279(50):
51793 - 51803.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Aoki and G. Tosato
HIV-1 Tat enhances Kaposi sarcoma-associated herpesvirus (KSHV) infectivity
Blood,
August 1, 2004;
104(3):
810 - 814.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. L. McClain, Y. Natkunam, and S. H. Swerdlow
Atypical Cellular Disorders
Hematology,
January 1, 2004;
2004(1):
283 - 296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Dourmishev, A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac
Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis
Microbiol. Mol. Biol. Rev.,
June 1, 2003;
67(2):
175 - 212.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Hernandez-Rodriguez, M. Segarra, C. Vilardell, M. Sanchez, A. Garcia-Martinez, M.-J. Esteban, J. M. Grau, A. Urbano-Marquez, D. Colomer, H. K. Kleinman, et al.
Elevated Production of Interleukin-6 Is Associated With a Lower Incidence of Disease-Related Ischemic Events in Patients With Giant-Cell Arteritis: Angiogenic Activity of Interleukin-6 as a Potential Protective Mechanism
Circulation,
May 20, 2003;
107(19):
2428 - 2434.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-M. Liu, F. Lawrence, M. Kovacevic, J. Bignon, E. Papadimitriou, J.-Y. Lallemand, P. Katsoris, P. Potier, Y. Fromes, and J. Wdzieczak-Bakala
The tetrapeptide AcSDKP, an inhibitor of primitive hematopoietic cell proliferation, induces angiogenesis in vitro and in vivo
Blood,
April 15, 2003;
101(8):
3014 - 3020.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Aoki, G. M. Feldman, and G. Tosato
Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma
Blood,
February 15, 2003;
101(4):
1535 - 1542.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Estep, M. K. Axthelm, and S. W. Wong
A G Protein-Coupled Receptor Encoded by Rhesus Rhadinovirus Is Similar to ORF74 of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol.,
February 1, 2003;
77(3):
1738 - 1746.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A. Volberding, K. R. Baker, and A. M. Levine
Human Immunodeficiency Virus Hematology
Hematology,
January 1, 2003;
2003(1):
294 - 313.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cannon, N. J. Philpott, and E. Cesarman
The Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Has Broad Signaling Effects in Primary Effusion Lymphoma Cells
J. Virol.,
December 6, 2002;
77(1):
57 - 67.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Chatterjee, J. Osborne, G. Bestetti, Y. Chang, and P. S. Moore
Viral IL-6-Induced Cell Proliferation and Immune Evasion of Interferon Activity
Science,
November 15, 2002;
298(5597):
1432 - 1435.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-S. Lee, M. Paulose-Murphy, Y.-H. Chung, M. Connlole, S. Zeichner, and J. U. Jung
Suppression of Tetradecanoyl Phorbol Acetate-Induced Lytic Reactivation of Kaposi's Sarcoma-Associated Herpesvirus by K1 Signal Transduction
J. Virol.,
October 25, 2002;
76(23):
12185 - 12199.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Deng, M. J. Song, J. T. Chu, and R. Sun
Transcriptional Regulation of the Interleukin-6 Gene of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus)
J. Virol.,
July 17, 2002;
76(16):
8252 - 8264.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. V. Moses, M. A. Jarvis, C. Raggo, Y. C. Bell, R. Ruhl, B. G. M. Luukkonen, D. J. Griffith, C. L. Wait, B. J. Druker, M. C. Heinrich, et al.
Kaposi's Sarcoma-Associated Herpesvirus-Induced Upregulation of the c-kit Proto-Oncogene, as Identified by Gene Expression Profiling, Is Essential for the Transformation of Endothelial Cells
J. Virol.,
July 17, 2002;
76(16):
8383 - 8399.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Curreli, F. Cerimele, S. Muralidhar, L. J. Rosenthal, E. Cesarman, A. E. Friedman-Kien, and O. Flore
Transcriptional Downregulation of ORF50/Rta by Methotrexate Inhibits the Switch of Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 from Latency to Lytic Replication
J. Virol.,
April 16, 2002;
76(10):
5208 - 5219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Oksenhendler, E. Boulanger, L. Galicier, M.-Q. Du, N. Dupin, T. C. Diss, R. Hamoudi, M.-T. Daniel, F. Agbalika, C. Boshoff, et al.
High incidence of Kaposi sarcoma-associated herpesvirus-related non-Hodgkin lymphoma in patients with HIV infection and multicentric Castleman disease
Blood,
April 1, 2002;
99(7):
2331 - 2336.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Gwack, S. Hwang, C. Lim, Y. S. Won, C. H. Lee, and J. Choe
Kaposi's Sarcoma-associated Herpesvirus Open Reading Frame 50 Stimulates the Transcriptional Activity of STAT3
J. Biol. Chem.,
February 15, 2002;
277(8):
6438 - 6442.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Masood, E. Cesarman, D. L. Smith, P. S. Gill, and O. Flore
Human Herpesvirus-8-Transformed Endothelial Cells Have Functionally Activated Vascular Endothelial Growth Factor/Vascular Endothelial Growth Factor Receptor
Am. J. Pathol.,
January 1, 2002;
160(1):
23 - 29.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Liu, Y. Okruzhnov, H. Li, and J. Nicholas
Human Herpesvirus 8 (HHV-8)-Encoded Cytokines Induce Expression of and Autocrine Signaling by Vascular Endothelial Growth Factor (VEGF) in HHV-8-Infected Primary-Effusion Lymphoma Cell Lines and Mediate VEGF-Independent Antiapoptotic Effects
J. Virol.,
November 15, 2001;
75(22):
10933 - 10940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Aoki, M. Narazaki, T. Kishimoto, and G. Tosato
Receptor engagement by viral interleukin-6 encoded by Kaposi sarcoma-associated herpesvirus
Blood,
November 15, 2001;
98(10):
3042 - 3049.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. D. Hillman, A. T. Peng, A. C. Gilliam, and S. C. Remick
Treatment of Kaposi Sarcoma With Oral Administration of Shark Cartilage in a Human Herpesvirus 8-Seropositive, Human Immunodeficiency Virus-Seronegative Homosexual Man
Arch Dermatol,
September 1, 2001;
137(9):
1149 - 1152.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Hobisch, R. Ramoner, D. Fuchs, S. Godoy-Tundidor, G. Bartsch, H. Klocker, and Z. Culig
Prostate Cancer Cells (LNCaP) Generated after Long-Term Interleukin 6 (IL-6) Treatment Express IL-6 and Acquire an IL-6 Partially Resistant Phenotype
Clin. Cancer Res.,
September 1, 2001;
7(9):
2941 - 2948.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Paulose-Murphy, N.-K. Ha, C. Xiang, Y. Chen, L. Gillim, R. Yarchoan, P. Meltzer, M. Bittner, J. Trent, and S. Zeichner
Transcription Program of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus)
J. Virol.,
May 15, 2001;
75(10):
4843 - 4853.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Y. Aoki, G. Tosato, T. W. Fonville, and S. Pittaluga
Serum viral interleukin-6 in AIDS-related multicentric Castleman disease
Blood,
April 15, 2001;
97(8):
2526 - 2527.
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Li, H. Wang, and J. Nicholas
Detection of Direct Binding of Human Herpesvirus 8-Encoded Interleukin-6 (vIL-6) to both gp130 and IL-6 Receptor (IL-6R) and Identification of Amino Acid Residues of vIL-6 Important for IL-6R-Dependent and -Independent Signaling
J. Virol.,
April 1, 2001;
75(7):
3325 - 3334.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M.-Q. Du, H. Liu, T. C. Diss, H. Ye, R. A. Hamoudi, N. Dupin, V. Meignin, E. Oksenhendler, C. Boshoff, and P. G. Isaacson
Kaposi sarcoma-associated herpesvirus infects monotypic (IgM{lambda}) but polyclonal naive B cells in Castleman disease and associated lymphoproliferative disorders
Blood,
April 1, 2001;
97(7):
2130 - 2136.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Aoki, R. Yarchoan, K. Wyvill, S.-i. Okamoto, R. F. Little, and G. Tosato
Detection of viral interleukin-6 in Kaposi sarcoma-associated herpesvirus-linked disorders
Blood,
April 1, 2001;
97(7):
2173 - 2176.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Montaner, A. Sodhi, S. Pece, E. A. Mesri, and J. S. Gutkind
The Kaposi's Sarcoma-associated Herpesvirus G Protein-coupled Receptor Promotes Endothelial Cell Survival through the Activation of Akt/Protein Kinase B
Cancer Res.,
March 1, 2001;
61(6):
2641 - 2648.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. J. Dezube
AIDS-Related Kaposi Sarcoma: The Role of Local Therapy for a Systemic Disease
Arch Dermatol,
December 1, 2000;
136(12):
1554 - 1556.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J Nicholas
Evolutionary aspects of oncogenic herpesviruses
Mol. Pathol.,
October 1, 2000;
53(5):
222 - 237.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
E. Oksenhendler, G. Carcelain, Y. Aoki, E. Boulanger, A. Maillard, J.-P. Clauvel, and F. Agbalika
High levels of human herpesvirus 8 viral load, human interleukin-6, interleukin-10, and C reactive protein correlate with exacerbation of multicentric Castleman disease in HIV-infected patients
Blood,
September 15, 2000;
96(6):
2069 - 2073.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Sodhi, S. Montaner, V. Patel, M. Zohar, C. Bais, E. A. Mesri, and J. S. Gutkind
The Kaposi's Sarcoma-associated Herpes Virus G Protein-coupled Receptor Up-Regulates Vascular Endothelial Growth Factor Expression and Secretion through Mitogen-activated Protein Kinase and p38 Pathways Acting on Hypoxia-inducible Factor 1{{alpha}}
Cancer Res.,
September 1, 2000;
60(17):
4873 - 4880.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Y. Aoki, R. Yarchoan, J. Braun, A. Iwamoto, and G. Tosato
Viral and cellular cytokines in AIDS-related malignant lymphomatous effusions
Blood,
August 15, 2000;
96(4):
1599 - 1601.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. R. Husain and R. K. Puri
Interleukin-13 fusion cytotoxin as a potent targeted agent for AIDS-Kaposi's sarcoma xenograft
Blood,
June 1, 2000;
95(11):
3506 - 3513.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-G. Judde, V. Lacoste, J. Briere, E. Kassa-Kelembho, E. Clyti, P. Couppie, C. Buchrieser, M. Tulliez, J. Morvan, and A. Gessain
Monoclonality or Oligoclonality of Human Herpesvirus 8 Terminal Repeat Sequences in Kaposi's Sarcoma and Other Diseases
J Natl Cancer Inst,
May 3, 2000;
92(9):
729 - 736.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Mullberg, T. Geib, T. Jostock, S. H. Hoischen, P. Vollmer, N. Voltz, D. Heinz, P. R. Galle, M. Klouche, and S. Rose-John
IL-6 Receptor Independent Stimulation of Human gp130 by Viral IL-6
J. Immunol.,
May 1, 2000;
164(9):
4672 - 4677.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Dankbar, T. Padro, R. Leo, B. Feldmann, M. Kropff, R. M. Mesters, H. Serve, W. E. Berdel, and J. Kienast
Vascular endothelial growth factor and interleukin-6 in paracrine tumor-stromal cell interactions in multiple myeloma
Blood,
April 15, 2000;
95(8):
2630 - 2636.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hideshima, D. Chauhan, G. Teoh, N. Raje, S. P. Treon, Y.-T. Tai, Y. Shima, and K. C. Anderson
Characterization of Signaling Cascades Triggered by Human Interleukin-6 versus Kaposi's Sarcoma-associated Herpes Virus-encoded Viral Interleukin 6
Clin. Cancer Res.,
March 1, 2000;
6(3):
1180 - 1189.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Y. Aoki and G. Tosato
Role of Vascular Endothelial Growth Factor/Vascular Permeability Factor in the Pathogenesis of Kaposi's Sarcoma-Associated Herpesvirus-Infected Primary Effusion Lymphomas
Blood,
December 15, 1999;
94(12):
4247 - 4254.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. D. Jones, Y. Aoki, Y. Chang, P. S. Moore, R. Yarchoan, and G. Tosato
Involvement of Interleukin-10 (IL-10) and Viral IL-6 in the Spontaneous Growth of Kaposi's Sarcoma Herpesvirus-Associated Infected Primary Effusion Lymphoma Cells
Blood,
October 15, 1999;
94(8):
2871 - 2879.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Mesri
Inflammatory Reactivation and Angiogenicity of Kaposi's Sarcoma-Associated Herpesvirus/HHV8: A Missing Link in the Pathogenesis of Acquired Immunodeficiency Syndrome-Associated Kaposi's Sarcoma
Blood,
June 15, 1999;
93(12):
4031 - 4033.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION