|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 12 (June 15), 1999:
pp. 4187-4195
Differentiation in Culture of Murine Primitive Lymphohematopoietic
Progenitors Toward T-Cell Lineage
By
Fumiya Hirayama,
Yuichi Aiba,
Kenji Ikebuchi,
Sadayoshi Sekiguchi, and
Makio Ogawa
From Hokkaido Red Cross Blood Center, Sapporo, Japan; and Veterans
Affairs Medical Center and Department of Medicine, Medical University
of South Carolina, Charleston, SC.
 |
ABSTRACT |
Earlier, we described a stromal cell-free two-step clonal culture
system in which murine primitive lymphohematopoietic progenitors produce myeloid and B-lymphoid lineage cells. In the same culture T-cell potential of the progenitors was maintained. We now report that,
in addition to myeloid and B-lymphoid cells, putative T-cell progenitors are also produced in culture. Lineage-negative
(Lin ) Ly-6A/E+ c-kit+ bone
marrow cells from 5-fluorouracil-treated mice were cultured in
methylcellulose in the presence of SF (Steel factor), interleukin (IL)-11, and IL-7, and the resulting primary colonies were picked and
pooled. When injected into severe combined immune deficiency (scid)
mice, the pooled cells reconstituted the T-cell compartment of the scid
mice earlier than freshly prepared primitive marrow cells. This
reconstitution activity of the pooled primary colony cells was enriched
in the Ly-6A/E+ and Fc RII/III /low cell
fractions. Reverse transcriptase-polymerase chain reaction (RT-PCR) and
DNA-PCR analyses showed that some of the primary colony cells are
differentiated sufficiently to express messenger RNA (mRNA) of T-cell
receptor (TCR) -chain and pre-TCR alpha (pT ) and, although not
frequently, to perform D -J rearrangement of the TCR gene.
Micromanipulation studies confirmed the clonal origin of myeloid
lineage cells and the cells positive for the T-cell-specific
transcripts and D-J rearrangement of TCR -chain. These results
suggested that, in the presence of SF, IL-11, and IL-7, primitive
lymphohematopoietic progenitors differentiate toward T-cell lineage in
addition to myeloid and B-cell lineages.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
ALTHOUGH T CELLS ARE derived from the
pluripotent hematopoietic stem cells, their development is different
from that of other blood cells. T cells differentiate primarily in the
thymus after prethymic T-cell progenitors migrate into the thymus,
whereas the entire development of other blood cells takes
place in the fetal liver or bone marrow. In the thymus, T-cell
progenitors begin rearrangement of the T-cell-receptor (TCR) genes at
the CD4 CD8 double-negative (DN)
cell stage, and pass through the CD4
CD8low stage into the CD4+ CD8+
double-positive (DP) TCR /low stage. In the DP cell
stage, the thymocytes whose TCR react strongly to self-major
histocompatability complex (MHC) antigens are deleted (negative
selection). The thymocytes whose TCR bind moderately to self-MHC
antigens will survive and acquire self-MHC-restriction (positive
selection). DP thymocytes then differentiate into TCRhigh
single positive (SP) CD4+ or CD8+ mature
thymocytes.1-3 A number of cytokines, such as interleukin (IL)-1~4, IL-6, IL-7, IL-9, IL-10, IL-12, steel factor (SF), flt3 ligand (FL), tumor necrosis factor (TNF ), transforming growth factor
(TGF) , and granulocyte-macrophage colony-stimulating factor
(GM-CSF), have been reported to support the proliferation of immature
thymocytes.4,5 Among them, crucial roles of
IL-7,6-14 SF,15,16 and FL15 in the
development of thymocytes have been shown by the in vivo injection of
neutralizing antibodies and by the use of spontaneous mutant mice or
gene-targeted mutant mice.
Compared with the intrathymic development, less is known about the
early stages of T-cell development. One example is the nature of
prethymic T-cell progenitors. Wu et al17 and Matsuzaki et
al18 enriched small-cell populations from murine thymocytes that have T-, B-, and natural killer (NK)-cell potentials but not
myeloid potentials. Their studies suggested the existence of common
lymphoid progenitors and support the model of early diversion of
myeloid from lymphoid lineages. In agreement with this, Akashi et
al19 recently identified T/B common lymphoid progenitors in
murine bone marrow. These results suggested that the diversion of
lymphoid from myeloid lineages takes place before seeding into the
thymus and that the common lymphoid progenitors commit to T-cell
lineage in the thymus. In contrast to these observations, however,
Rodewald et al20 identified in murine fetal blood committed T-cell progenitors that have neither B-cell nor myeloid potentials. This indicated that the commitment to T-cell lineage can occur before
progenitor seeding into the thymus. Their observations did not exclude
the possibility that common lymphoid progenitors or multipotential
progenitors migrate into the thymus. Indeed, in addition to the
committed T-cell progenitors, they also identified multipotential
progenitors in the fetal blood.
One of the reasons for our poor understanding of the early stages of
T-cell development is the lack of a culture assay that allows clonal
analysis of T-cell development from primitive hematopoietic progenitors. Such a culture would significantly facilitate our study of
the early stages of T-cell development. Earlier, we developed a
two-step clonal culture system that supports the differentiation along
the myeloid and B-cell lineages of murine bone marrow
progenitors.21 Subsequently we documented that the cells in
the primary colonies in this assay possess T-cell
potential.22 In the current study, we showed that, in the
presence of SF, IL-11, and IL-7, the lymphohematopoietic progenitors
differentiate along T-cell lineage into progenitors that express
messenger RNA (mRNA) of pre-TCR alpha (pT ) and TCR -chain, as
well as along myeloid and B-cell lineages.
 |
MATERIALS AND METHODS |
Growth factors.
Murine SF was provided by Immunex Corporation, Seattle, WA and Kirin
Brewery Co, Ltd, Tokyo, Japan. Human IL-7 was a gift from C. Faltynek
of Sterling Drug, Malvern, PA. Human IL-11 and erythropoietin (Epo)
were provided by the Genetics Institute, Cambridge, MA. Murine FL was a
gift from S. Lyman of Immunex Corp. All of the cytokines we used were
recombinant and purified, and their concentrations were as follows: SF,
100 ng/mL; IL-7, 5 ng/mL; IL-11, 50 ng/mL; FL, 1000 ng/mL; Epo, 2 units/mL.
Progenitor purification.
Bone marrow cells were harvested from 10- to 20-week old BDF1 mice
(Charles River, Raleigh, NC and Clea Japan, Inc, Tokyo, Japan) that had
been injected intravenously with 5-fluorouracil (5-FU, Adria
Laboratories, Columbus, OH) at 150 mg/kg (body weight) 2 days before.
The bone marrow cells were enriched for primitive progenitor cells by
using the technique we described previously.23 Briefly,
cells at densities ranging from 1.0631 to 1.0770 g/mL were harvested
with Nycodenz (Accurate Chemical & Scientific, Westbury, NY) density
centrifugation. The samples were then depleted of cells expressing
lineage-specific antigens by negative immunomagnetic bead selection
with Dynabeads M-450 sheep-antirat IgG (Dynal, Great Neck, NY). The
monoclonal antibodies (MoAbs) used were anti-B220 (14.8),24
anti-Mac-1 (M1/70),25 anti-Gr-1 (RB6-8C5),26
anti-CD4 (GK1.5),27 anti-CD8 (53-6.72),28 and
TER-119.29 The density-separated, lineage-negative
(Lin ) cells were then stained with fluorescein
isothiocyanate (FITC)-conjugated anti-Ly-6A/E Ab (D7),30
and biotin-conjugated anti-c-kit Ab (ACK4, a gift from S-I Nishikawa,
Kyoto, Japan31). The cells were then stained with
streptavidin-conjugated phycoerythrin (PE) (Jackson ImmunoResearch
Laboratories, West Grove, PA). Ly-6A/E+ c-kit+
cells were collected by sorting on a FACStarplus, FACS Vantage (Becton
Dickinson, San Jose, CA), or Epics Elite (Coulter KK, Tokyo, Japan)
cell sorter.
Clonal methylcellulose culture.
The methylcellulose culture was performed by using 35-mm suspension
culture dishes (Becton Dickinson Labware, Lincoln Park, NJ). Forty
enriched marrow cells were plated in the methylcellulose media
containing SF and IL-11 with or without IL-7. In some experiments, FL
was also added additionally. The culture media consisted of -MEM
(Flow Laboratories, Rockville, MD), 1.2% 1500-centipoise methylcellulose (Shinetsu Chemical, Tokyo, Japan), 25% fetal calf serum (FCS, Intergen, Purchase, NY and Hyclone, Logan, UT), 1% deionized fraction V bovine serum albumin (BSA, Sigma, St. Louis, MO),
and 0.1 mmol/L 2-ME (Sigma). Dishes were incubated at 37°C in a
humidified atmosphere flushed with 5% CO2 for 9 to 12 days.
In vivo transfer of enriched primitive progenitors and primary
colony cells.
Figure 1 gives a diagrammatic outline of
our experimental protocol. Four hundred resulting primary colonies were
individually picked, pooled, and washed. Ten percent of the pooled
cells (equivalent to 40 primary colonies) and 5,000 freshly prepared
enriched marrow cells were injected intravenously into C.B.-17 scid
mice (Ly-1.2, Taconic Farms, Germantown, NY and Clea Japan, Inc).
Fifteen, 20, and 60 days later, recipient mice were sacrificed and
thymocytes were stained with FITC-conjugated anti-Ly-1.1 Ab (clone:
H11-86.1, PharMingen, San Diego, CA,32), PE-conjugated
anti-CD8 antibody and biotin-conjugated anti-CD4 Ab followed by
streptavidin-Tri-Color (Caltag Laboratories, South San Francisco, CA).
The stained cells were analyzed for Ly-1.1+ donor-derived
cells using a FACStarplus, FACS Vantage, or Epics Elite. Based on
isotype control and control-noninjected mice, we defined recipient mice
as being reconstituted when donor-derived cells composed more than 1%
of thymocytes.
Enrichment of the pooled primary colony cells for T-cell
progenitors.
Approximately 100 resulting primary colonies were individually picked
and pooled during days 10 to 12 of culture. The cells were stained with
FITC-conjugated anti-Ly-6A/E Ab and PE-conjugated anti-Fc RII/III Ab
and sorted on the basis of the expression of Ly-6A/E and/or
Fc RII/III. Crude and sorted cells were then injected intravenously
into C.B.-17 scid mice based on the percentages of the cells in the
sorting windows. Three weeks after the cell transfer, thymocytes of
each recipient mouse were analyzed by flow cytometry for the expression
of Ly-1.1. In some experiments, pooled primary colony cells were
subjected to DNA and RNA extraction for DNA-polymerase chain reaction
(PCR) and reverse transcriptase (RT)-PCR analysis, respectively.
Cultured pre-B cells.
Cultured pre-B cells were obtained as we described
previously.21 Briefly, 40 enriched marrow cells were
cultured in the methylcellulose media containing SF, IL-11, and IL-7.
On day 10 of culture, resulting primary colonies were individually
picked, pooled, and recultured in the methylcellulose media containing SF and IL-7. Large compact unicentric colonies consisting of small round cells were harvested, and the cells were used as pre-B cells.
DNA isolation and PCR.
Genomic DNA was extracted by using an isolation kit, Micro-TurboGen
(Invitrogen, San Diego, CA) or QIAamp Blood Kit (Qiagen, Chatsworth,
CA) following the manufacturers' instructions. PCR was performed by
using 100 ng DNA, 360 ng/reaction of primers, and 1U Taq DNA polymerase
(GIBCO-BRL, Gaithersburg, MD) or 1U AmpliTaq Gold DNA
polymerase (Perkin Elmer, Foster City, CA). The sequences of primers
used to detect the D 2-J 2 rearrangement of the TCR gene were
sequences 5' of the D 2.1
(5'-GTAGGCACCTGTGGGGAAGAAACT-3') and 3' of the
J 2.6 (5'-TGAGAGCTGTCTCCTACTATCGATT-3').33 To examine the V -DJ TCR gene rearrangement, the D 2.1 primer was replaced with a mixture of V 6
(5'-GAAGGCTATGATGCGTCTCG-3') and V 8
(5'-TCCCTGATGGGTACAAGGCC-3') primers.34
RNA isolation and RT-PCR.
Total RNA was extracted with TRIzol reagent (GIBCO-BRL, Grand Island,
NY) according to the manufacturer's instructions. Complementary DNA
(cDNA) was prepared from total RNA (0.3 to 0.5 µg/reaction), by using
50 ng of random primers (GIBCO-BRL), 200 µmol/L of each deoxynucleotide 5'-triphosphate (Epicentre Technologies, Madison, WI and Takara Biomedicals, Tokyo, Japan), and M-MLV RT (GIBCO-BRL). The
oligonucleotide primers used to detect mRNA of constant region of TCR
-chain and pT were as follows: sense primer (TCR -chain): GTTTGAGCCATCAAAAGCAGA, antisense primer (TCR -chain):
AGGATCTCATAGAGGATGGT,35 sense primer (pT ):
CATGCTTCTCCACGAGTG, antisense primer (pT ): CTATGTCCAAATTCTGTGGGTG.36 In some experiments, the RT-PCR
products for pT were further amplified by nested PCR by using a
second set of primers; these primers were as follows: sense primer:
TGGTGGTTTGCCTGGTCCTCGATG, antisense primer: GGTCAGGAGCACATCGAGCAGAAG.
Southern blot analysis.
Both DNA-PCR and RT-PCR products were analyzed by Southern blot
analysis. Aliquots from each product were size-fractionated on a 1.5%
agarose gel, denatured in 0.5 mol/L NaOH, neutralized in 0.5 mol/L
Tris-HCl (pH 7.5), and blotted onto Hybond-N+ membranes (Amersham,
Arlington Heights, IL). Membranes were hybridized with digoxigenin
(DIG)-conjugated oligonucleotide probes. The probes used were as
follows: D 2-J 2 and V -DJ rearrangement:
TTTCCCTCCCGGAGATTCCCTAA,37 TCR -chain transcripts:
GCCTGAGCAGCCGCCTGA,35 and pT transcripts: CAGGTACTGTGGCTGAGCCTACTG.36 The conjugation of
oligonucleotide probes with DIG was performed using a DIG
oligonucleotide tailing kit (Boehringer Mannheim, Indianapolis IN). The
hybridization was visualized using a DIG luminescent detection kit
(Boehringer Mannheim).
T-cell potential of individual progenitors.
Enriched marrow cells were individually plated by micromanipulation
into methylcellulose media containing SF, IL-11, and IL-7. On day 9 of
the culture, the primary colonies were individually harvested.
One-tenth of each primary colony was replated in suspension culture
containing SF, IL-11, and Epo for examination of myeloid differentiation. After 5 days of incubation, the cells were centrifuged onto a slide for cytological examination with May-Grunwald Giemsa staining. The remainder of the cells were plated in suspension culture
containing SF, IL-11, and IL-7. On day 11 of culture, DNA and RNA were
extracted from the cells for study of rearrangement of TCR -chain
gene and mRNA expression of TCR -chain and pT .
 |
RESULTS |
Differences in the time course of T-cell reconstitution between freshly
prepared primitive progenitors and their progenies developing in
culture.
We previously showed that primary colonies developing in the presence
of SF and IL-11 from murine bone marrow progenitors have the potential
to reconstitute the T-cell compartments of scid mice on intravenous
injection.22 This observation suggested that the
differentiation of primitive hematopoietic progenitors along T-cell
lineage took place in culture. However, considering that stem cells can
be maintained in culture under similar conditions for 2 to 3 weeks,38,39 it is also possible that the transplanted stem
cells were responsible for the T-cell reconstitution. Therefore, to
determine whether or not the differentiation toward T-cell lineage
takes place in culture, we first compared the time course of T-cell
reconstitution of scid mice by 40 pooled primary colonies (1.5 × 106 cells on average) growing in the presence of SF and
IL-11 with the time course of T-cell reconstitution by freshly prepared
5,000 primitive progenitors. Because the plating efficiency of the
enriched marrow cells observed in cultures supported by SF and IL-11 is approximately 50%, 5,000 enriched marrow cells should give rise to
2,500 primary colonies, which is 65 times the number of the primary
colonies injected into the first group of mice. Representative analyses
are presented in Fig 2. It is evident that
both primary colonies and fresh primitive progenitors had potential to
reconstitute the thymus of scid mice. When primary colonies were
injected, donor-derived Ly-1.1+ cells appeared in the thymi
(1.9 × 106 Ly-1.1+ cells on average) of
all of the mice as early as on day 15 of the cell injection. Although
the majority of the donor-derived cells were
CD4+CD8+ DP cells, significant numbers of
CD4 CD8 DN cells were also
observed. On day 20 the thymi became approximately 10-times larger (1.6 ×107 Ly-1.1+ cells on average). Even on
day 60 donor-derived thymocytes (1.0 × 107
Ly-1.1+ cells on average) were still found. In contrast,
Ly-1.1+ donor-derived cells were absent on day 15 and 20, but appeared by day 60 in the thymi of the scid mice injected with
5,000 freshly prepared primitive progenitors. The fact that the primary
colony cells reconstituted the thymus earlier than the freshly prepared primitive progenitors suggested that differentiation toward T-cell lineage took place in culture in the presence of SF and IL-11. The
primary colonies growing in culture with IL-7 in addition to SF and
IL-11 also reconstituted the thymus earlier than freshly prepared
primitive progenitors (data not shown).

View larger version (28K):
[in this window]
[in a new window]
| Fig 2.
Three-color flow cytometric analysis of thymocytes of
C.B.-17 scid mice injected with freshly prepared primitive marrow
progenitors or pooled primary colonies. Five thousand enriched marrow
cells (left) or the equivalent of 40 pooled primary colonies (right)
were injected intravenously into scid mice. On days 15, 20, 25, and 60 after cell transfer, thymocytes were analyzed for Ly-1.1, CD4, and CD8.
The expression of Ly-1.1 on whole thymocytes and that of CD4 and CD8 on
Ly-1.1+ cells at each time is shown.
|
|
Enrichment for thymic reconstitution activity.
We next attempted to enrich the progenitors that reconstituted the
thymus of scid mice from the pooled primary colony cells. After testing
several cell surface markers including CD25, CD44, c-kit, Thy-1, and
IL-7 receptor, we found Ly-6A/E and Fc RII/III to be useful. A
summary of the results of 4 representative experiments is presented in
Table 1. Primary colonies supported by the
combination of SF and IL-11 with (experiments 3 and 4) or without
(experiments 1 and 2) the addition of IL-7 were sorted on the basis of
the expression of Ly-6A/E and Fc RII/III. FL was also added in
addition to IL-7 in experiment 4. Crude and sorted cells that were in
proportion to the percentages of the cells in the sorting windows were
injected into C.B.-17 scid mice. Representative dot-plots of pooled
primary colony cells, sorting windows, and dot-plots of sorted cells
are presented in Fig 3. In experiment 1, in
which culture was performed without IL-7, the percentages of the cells
in the Ly-6A/E , Ly-6A/E+,
Fc RII/III /low, and Fc RII/IIIhigh
windows were 80%, 12%, 8.4%, and 75%, respectively. Therefore, 6.7 × 105 crude, 5.3 × 105
Ly-6A/E , 8.4 × 104
Ly-6A/E+, 5.6 × 104
Fc RII/III /low, and 5.0 × 105
Fc RII/IIIhigh cells were injected into each of three
scid mice. In all of the mice injected with crude cells,
Ly-6A/E+ cells and Fc RII/III /low
cells, the thymi were reconstituted with Ly-1.1+
thymocytes, whereas no donor-derived cells were detected in the mice
receiving Ly-6A/E cells and
Fc RII/IIIhigh cells. The same results were obtained in
experiments 3 and 4 in which IL-7 was added. Approximately half of the
cultured cells were positive for Ly-6A/E in experiment 4 in which FL
was also added. Finally, experiment 2 showed that the reconstituting
cells were enriched in the Ly-6A/E+
Fc RII/III /low cell population.

View larger version (38K):
[in this window]
[in a new window]
| Fig 3.
Flow cytometric analyses of Ly-6A/E and Fc RII/III
expression by pooled primary colony cells. (A and H) Isotype control.
(B) Expression of Ly-6A/E and Fc RII/III by pooled primary colony
cells and sorting windows for Ly-6A/E and
Ly-6A/E+ cells. (C) Sorted Ly-6A/E cells.
(D) Sorted Ly-6A/E + cells. (E) Expression of Ly-6A/E and
Fc RII/III by pooled primary colony cells and sorting windows for
Fc RII/ III /low and
Fc RII/IIIhigh cells. (F) Sorted
Fc RII/III /low cells. (G) Sorted
Fc RII/IIIhigh cells. (I) Expression of Ly-6A/E and
Fc RII/III by pooled primary colony cells and sorting windows for
Ly-6A/E+ Fc RII/III /low cells and the
rest of the cells. (J and K) Sorted cells using the windows presented
in (I).
|
|
Rearrangement status of TCR -chain gene.
Using the enrichment method described above, we next examined the
degree to which the primitive hematopoietic progenitors can
differentiate toward T-cell lineage in culture. Because it has been
reported that IL-7 enhances the TCR -chain gene
rearrangement40,41 and block apoptosis of pro-T
cells,13,14 we used the cells cultured in the presence of
IL-7. Although TCR -chain gene rearrangement is generally believed
to start in DN stage in the thymus,42,43 recent reports
suggested that TCR -chain gene rearrangement could take place in
prothymic T-cell progenitors. For example, it has been reported that
the prethymic T-cell progenitors isolated from fetal murine
blood20 and Sca-1+ Lin
marrow cells from euthymic and athymic adult mice35 exhibit the D-J rearrangement of the TCR -chain gene. Therefore, we first focused on the TCR -chain gene rearrangement. DNA was extracted from
Ly-6A/E , Ly-6A/E+, Fc
RII/III /low, and Fc RII/IIIhigh
primary colony cells for the PCR analysis of the D-J and the V-DJ
rearrangement status of the TCR -chain gene as outlined in
Fig 4A. D 2-J 2 rearrangement was
observed in 2 of 10 analyses. The results of one of the two Southern
blot analyses are shown in Fig 4B and 4C. In the analysis of the
D 2-J 2 rearrangement, the genomic DNA from a control
monocyte/macrophage cell line (Raw 264.7)44 gave only a
1.8-kb germ line band, whereas thymocytes showed six additional
D 2-J 2 rearranged bands, ie, D 2-J 2.1~D 2-J 2.6, corresponding to rearranged D 2-J 2 genes using six J 2 segments. The crude cultured cells, Ly-6A/E cells, and
Fc RII/IIIhigh cells barely showed the D 2-J 2.6
band. In contrast, the Ly-6A/E+ cells gave rise to all six
D-J rearranged bands, D 2-J 2.1~D 2-J 2.6. The
Fc RII/III /low cells showed four bands,
D 2-J 2.3~D 2-J 2.6 (Fig 4B). In the remaining eight
analyses, D 2-J 2 rearrangement was not observed. We also examined
rearrangement of V 6 and V 8 segments to study V-DJ rearrangement.
However, none of the fractions of cultured cells showed the V -DJ 2
rearrangement in any analyses even after a long exposure (Fig 4B).
These results suggested that, although not frequently, primitive
hematopoietic progenitors can differentiate along T-cell lineage in
culture to the stage in which the D-J rearrangement, but not the the
V-DJ rearrangement of the TCR -chain gene is initiated. Although
there was a marked difference in signal intensity between the
Ly-6A/E+ and Fc RII/III /low cell
populations in the experiment presented in Fig 4B, such difference was
not observed in the other analysis. Infrequency of the cells possessing
D 2-J 2 rearrangement may have caused uneven distribution of the
cells to the two cell fractions in that experiment.


View larger version (85K):
[in this window]
[in a new window]
| Fig 4.
PCR analysis of the D -J and V -DJ
rearrangements of the TCR gene. (A) Schematic presentations of the
PCR-based analyses of -chain D-J (left) and V-DJ (right) gene
rearrangements. (B) and (C) Enriched primitive marrow progenitors were
cultured with SF, IL-11, and IL-7 in methylcellulose. On day 11 of
culture, resulting primary colonies were individually harvested,
pooled, and sorted on the basis of the expression of Ly-6A/E and
Fc RII/III. DNA was extracted from crude and sorted cells, control
monocyte/macrophage cell line (Raw 264.7) and thymocytes. One hundred
micrograms of DNA was PCR amplified for 25 cycles for (D -J , B) or
for 35 cycles (V -D J , C). Signals were visualized by using a
DIG-conjugated probe and a DIG luminescent detection kit. * Signals
were obtained after a short exposure.
|
|
mRNA transcription of TCR -chain and
pT .
Since TCR gene gives rise to unrearranged or sterile transcript before
the gene rearrangement starts,45 we next examined transcription of TCR -chain. We also studied the mRNA
expression of pT . pT expression has been reported to be
exquisitely T-cell-lineage specific and found in the precursors of
 T cells outside the thymus as well as in intrathymic sites in
both murine20,34,46 and human.47-49 Primary
colonies supported by SF, IL-11, and IL-7 were used. In all the three
experiments performed, primarily Ly-6A/E+ and
Fc RII/III /low cells expressed TCR -chain and
pT transcripts. A representative analysis is shown in
Fig 5. These results indicated that
primitive hematopoietic progenitors differentiate to progenitors in
which TCR -chain and pT are actively transcribed. Because V-DJ
rearrangement of the TCR -chain gene was not observed, as stated
earlier, it is likely that transcripts of TCR -chain are derived
from sterile transcription of unrearranged or partially rearranged TCR
-chain loci.

View larger version (51K):
[in this window]
[in a new window]
| Fig 5.
mRNA expression of pT and TCR -chain by
fractionated pooled primary colony cells. Total RNA was purified from a
monocyte/macrophage cell line (Raw 264.7), thymocytes, and crude and
fractionated pooled primary colony cells. Next, 0.3 µg to 0.5 µg of
RNA was subjected to reverse transcription. One-tenth of the cDNA was
then PCR-amplified for 45 cycles. Signals were visualized by using a
DIG-conjugated probe and a DIG luminescent detection kit.
|
|
T-cell transcripts of pre-B cells.
Considerable TCR gene rearrangement within B-cells have been noted in
transformed as well as nontransformed cells.50-53 We previously reported that, under similar culture conditions, murine lymphohematopoietic progenitors can give rise to B-cell progenitors, which further differentiate into pre-B cells on reculture in secondary culture containing SF and IL-7.21,53,55 Therefore, one may consider that the B-cell progenitors developed in culture may have
contributed the transcripts of TCR -chain and pT . To test this
possibility, we examined pre-B cells developed in culture in mRNA
expression of TCR -chain and pT . As shown in
Fig 6, pre-B cells did not show mRNA of TCR
-chain and pT , whereas primary colony cells, especially
Ly-6A/E+ cells did. This result suggested that the mRNA
expression of TCR -chain and pT are derived from putative T-cell
progenitors.

View larger version (38K):
[in this window]
[in a new window]
| Fig 6.
mRNA expression of pT and TCR -chain by cultured
pre-B cells. Fractionated pooled primary colony cells, Raw 264.7, pre-B
cells, and thymocytes were analyzed as to mRNA expression of pT and
TCR -chain.
|
|
Study of individual primitive progenitors.
To show unequivocally that primitive hematopoietic progenitors, but not
contaminating committed T-cell progenitors differentiate in culture to
the stage in which the D -J rearrangement and the expression of
T-cell transcripts start, we performed micromanipulation of the
progenitors. Eighty-six primary colonies developed from micromanipulated single progenitors in the presence of SF, IL-11, and
IL-7 yielded sufficient DNA for the subsequent PCR analysis. All
primary colonies showed differentiation into at least granulocyte and
macrophage lineages in the myeloid secondary culture. Although most of
the primary colonies showed D 2-J 2.6 rearrangement bands, we
assumed that only the primary colonies that showed
D 2-J 2.1~D 2-J 2.5 rearrangement bands are positive for DJ
rearrangement, because non-T-lineage control cells sometimes gave rise
to the D 2-J 2.6 band. According to this criterion, 4 (4.7%) of
the 86 primary colonies proved positive for D -J rearrangement.
The results of the Southern blot analysis of 10 individual primary
colonies are presented in Fig 7A. Sample 2 is an example showing D 2-J 2.4 and D 2-J 2.5 rearrangement
bands in addition to a distinct D 2-J 2.6 band. None of the
colonies showed V -DJ rearrangement (data not shown).


View larger version (77K):
[in this window]
[in a new window]
| Fig 7.
D -J TCR gene rearrangement and mRNA expression of
pT and TCR -chain by individual primary colonies. Genomic DNA and
total RNA were extracted from aliquots of each primary colony derived
from micromanipulated individual primitive marrow progenitors. (A) The
DNA of each primary colony was used for the PCR analysis of the
D -J rearrangement of the TCR gene. A Southern blot analysis of 10 representative primary colonies. (B) The RNA of each primary colony was
examined for the presence of pT and TCR -chain mRNA by RT-PCR.
Southern blot analyses of 17 primary colonies.
|
|
We also examined mRNA expression of TCR -chain and pT in a total
of 17 primary colonies that yielded sufficient RNA to perform RT-PCR.
The results of the Southern blot analysis of these primary colonies are
shown in Fig 7B. Of the 17 colonies, 4 (24%) showed transcript of TCR
-chain, but not that of pT , and 4 (24%) produced both. There was
no primary colony that showed only pT transcript. All 17 colonies
showed differentiation potentials in at least 2 myeloid lineages on
reculture in SF, IL-11, and Epo. These results confirmed that in the
presence of SF, IL-11 and IL-7 significant number of primitive
progenitors can differentiate along T-cell lineage in addition to
myeloid lineages. None of these 17 primary colonies showed D -J
rearrangement of TCR -chain (data not shown). It suggested that most
of transcripts of TCR -chain were sterile transcripts of
unrearranged TCR loci.
 |
DISCUSSION |
In this study, we showed that, in the presence of SF, IL-11, and IL-7,
murine primitive hematopoietic progenitors can differentiate to express
mRNA of TCR -chain and pT . These putative T-cell progenitors were
enriched in Ly-6A/E+ and
Fc RII/III /low cell populations, and in the same
cell fractions the accelerated thymic reconstitution activity was found
as well. Although not frequently, the differentiation progressed to
involve the D -J rearrangement but not the V -DJ
rearrangement of the TCR gene. D -J rearrangement suggested
activation of the rearrangement machinery. Indeed, RAG-1 mRNA was also
expressed by primary colony cells, particularly by the
Ly-6A/E+ and Fc RII/III /low cell
populations (data not shown). B-cell progenitors generated in culture
were also enriched in the same cell fractions and possibly express
RAG-1 (data not shown), however, it is not clear whether the putative
T-cell progenitors expressed RAG-1. We have used micromanipulation of single progenitor cells to show unequivocally that
the putative T-cell progenitors are derived from lymphohematopoietic progenitors. These results suggested the differentiation of
lymphohematopoietic progenitors to T-cell progenitors in culture.
However, sorting experiments showed that myeloid and B-lymphoid
progenitors were always coenriched with the putative T-cell progenitors
in the same cell fractions (data not shown). Therefore, we have no
direct evidence at this time for the differentiation of committed
T-cell progenitors that have T-cell, but not myeloid nor B-lymphoid
potential. In addition, It is also unknown whether the cells expressing
the T-cell transcripts reconstituted the thymus of scid mice. The
accelerated thymic reconstitution by cultured cells suggested, but did
not necessarily indicate that the reconstituting cells were already
committed to T-cell lineage. One possibility is that primitive
pluripotent progenitors like stem cells were responsible for the thymic
reconstitution. As we reported in the previous study,22
donor-derived thymocytes were observed even 4 months after the
injection of cultured cells. This long-term reconstitution suggests the
maintenance of stem cells in culture and supports this possibility.
However, they may not account for the accelerated thymic
reconstitution. Another possibility is that the reconstituting cells
had already differentiated toward T-cell lineage to some extent but not
committed to T-cell lineage yet. Further characterization of the
putative T-cell progenitors developed in culture remains to be
performed in future study.
Recently, investigators in a number of laboratories documented the
presence of committed T-cell progenitors outside the thymus. Rodewald
et al20 isolated Thy-1+ c-kitlow
CD3 committed T-cell progenitors from murine fetal
blood, some of which have expressed pT mRNA and have performed the
D -J but not the V -DJ rearrangement. Soloff et
al35 also observed the presence of germline transcripts and
partial D-J rearrangement of TCR -chain gene in adult murine bone
marrow. The T-cell progenitors presented in this paper may be analogous
to these committed T-cell progenitors. Bruno et al49
identified, in adult human peripheral blood, CD4+
CD3 CD14 committed T-cell
progenitor populations that express T-cell transcripts including pT ,
RAG-1, CD3 , CD3 , and CD3 and have initiated D-J rearrangement
of TCR -chain. Ktorza et al56 recently found a similar
population in human cord blood. These results and ours suggest that the
commitment to T-cell lineage can occur prethymically. However, it does
not exclude the possibility that stem cells or common lymphoid
progenitors migrate into the thymus and then perform final commitment
to the T-cell lineage.
We used SF, IL-11, and IL-7 to induce differentiation toward T-cell
lineage. It has been shown that IL-7 is an essential cytokine for the
proliferation and survival of early lymphoid progenitors including
immature thymocytes.6-12,57-63 Akashi et al13
and Maraskovsky et al14 recently reported that IL-7 blocks
apoptosis of pro-T cells. In agreement with this, recent preliminary
single-cell culture experiments showed that the removal of IL-7 from
the culture reduced the expression of mRNA of TCR -chain and pT .
It has also been reported that IL-7 could support the
D -J ,41 V -DJ ,43 and
V -J 64 rearrangements of the TCR genes. We do not know at this time whether or not IL-7 is required for the D -J
rearrangement because of the low efficiency of D -J rearrangement
in culture. We have reported earlier that the two cytokines SF and
IL-11 synergistically support the early proliferation of primitive
hematopoietic progenitors and their differentiation toward myeloid
lineages in both human65 and murine66 systems
as well as toward B-cell lineage in a murine system.21 We
also reported that SF, IL-11, and IL-7 can support the development of
natural killer (NK) cell progenitors from murine lymphohematopoietic
progenitors.67 Thus, primitive lymphohematopoietic progenitors can differentiate into all lymphohematopoietic lineages, including myeloid, B-lymphoid, and NK cell lineages in the presence of
SF, IL-11, and IL-7, and in this report we have shown that differentiation toward T-cell lineage also takes place in culture. This
culture system will be useful in delineating the mechanisms regulating
commitment of common lymphoid progenitors and characterization of the
cytokines specific for individual lymphoid lineages.
 |
FOOTNOTES |
Submitted June 3, 1998; accepted February 17, 1999.
Supported by National Institutes of Health Grants No. DK32294 and
DK48714, Office of Research and Development, Medical Research Service,
Department of Veterans Affairs, and contributions from Kirin Brewery
Co, Ltd, Japan.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Fumiya Hirayama, MD, Hokkaido Red Cross
Blood Center, Yamanote 2-2, Nishi-ku, Sapporo 063-0002, Japan.
 |
REFERENCES |
1.
von Boehmer H:
Positive selection of lymphocytes.
Cell
76:219, 1994[Medline]
[Order article via Infotrieve]
2.
Fowlkes BJ, Schweighoffer E:
Positive selection of T cells.
Curr Opin Immunol
7:188, 1995[Medline]
[Order article via Infotrieve]
3.
Sprent J, Webb SR:
Intrathymic and extrathymic clonal deletion of T cells.
Curr Opin Immunol
7:196, 1995[Medline]
[Order article via Infotrieve]
4.
Carding SR, Hayday AC, Bottomly K:
Cytokines in T-cell development.
Immunol Today
12:239, 1991[Medline]
[Order article via Infotrieve]
5.
Zlotnik A, Moore TA:
Cytokine production and requirements during T-cell development.
Curr Opin Immunol
7:206, 1995[Medline]
[Order article via Infotrieve]
6.
Grabstein KH, Waldschmidt TJ, Finkelman FD, Hess BW, Alpert AR, Boiani NE, Namen AE, Morrissey PJ:
Inhibition of murine B and T lymphopoiesis in vivo by an anti-interleukin 7 monoclonal antibody.
J Exp Med
178:257, 1993[Abstract/Free Full Text]
7.
von Freeden-Jeffry U, Vieira P, Lucian LA, McNeil T, Burdach SEG, Murray R:
Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine.
J Exp Med
181:1519, 1995[Abstract/Free Full Text]
8.
Sodo T, Nishikawa S, Ohno N, Akiyama N, Tamakoshi M, Yoshida H, Nishikawa S-I:
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc Natl Acad Sci USA
90:9125, 1993[Abstract/Free Full Text]
9.
Peschon JJ, Morrissey PJ, Grabstein KH, Ramsdell FJ, Maraskovsky E, Gliniak BC, Park LS, Ziegler SF, Williams DE, Ware CB, Meyer JD, Davison BL:
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
J Exp Med
180:1955, 1994[Abstract/Free Full Text]
10.
He Y-W, Levy RB, Malek TR:
Blockage of T- and B-lymphocyte development by antibody to the c subunit of the receptors for interleukins 2,4, and 7.
Proc Natl Acad Sci USA
92:5689, 1995[Abstract/Free Full Text]
11.
DiSanto JP, Muller W, Guy-Grand D, Fischer A, Rajewsky K:
Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor chain.
Proc Natl Acad Sci USA
92:377, 1995[Abstract/Free Full Text]
|