SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Feng, S. Articles by Kroll, M. H. Search for Related Content PubMed PubMed Citation Articles by Feng, S. Articles by Kroll, M. H. Related Collections Hemostasis, Thrombosis, and Vascular Biology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 93 No. 12 (June 15), 1999: pp. 4256-4263 The Glycoprotein Ib/IX Complex Regulates Cell Proliferation By Shuju Feng, Nicolaos Christodoulides, and Michael H. Kroll From the VA Medical Center, Baylor College of Medicine and Rice University, Houston, TX.     ABSTRACT TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES The glycoprotein (Gp) Ib/IX complex contains three transmembranous leucine-rich repeat polypeptides (GpIb, GpIb, and GpIX) that form the platelet von Willebrand factor (vWF) receptor. GpIb/IX functions to effect platelet adhesion, activation, and aggregation under conditions of high shear stress. GpIb/IX is expressed late in the ontogeny of megakaryocytes, the precursor cell that releases platelets when it reaches its terminal stage of differentiation. Because signal pathways can be reused at different stages of development by integration with different effector pathways and because cellular adhesion through other receptor families often modulates cell growth, the hypothesis that GpIb/IX regulates cell growth was investigated. The surface expression of recombinant GpIb decreases the proliferation of transduced CHO cells. GpIb causes growth arrest in the G1 phase of the cell cycle associated with the induction of the cyclin-dependent kinase inhibitor p21. G1 arrest induced by recombinant GpIb in heterologous cells requires signaling through the 14-3-3 binding domain of GpIb and is partially dependent on its engagement by the extracellular ligand vWF. Growth arrest induced by the expression of recombinant GpIb/IX is followed by apoptosis of the transduced cells. The endogenous expression of GpIb in human hematopoietic cells is associated with decreased proliferation. These results suggest that the expression of the GpIb/IX complex regulates megakaryocyte growth. © 1999 by The American Society of Hematology.     INTRODUCTION TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES CELL GROWTH (proliferation and differentiation) involves reciprocal communications between a cell and its environment. Two extracellular substances that influence cell growth are soluble growth factors and insoluble matrix proteins. The essential growth response modulated by these environmental stimuli is mitosis. Growth factors and the extracellular matrix modulate entry into the mitosis phase of the cell cycle through signal pathways that are sometimes redundant, complementary, synergistic, or even antagonistic. Such precise modulation is required for normal development, and abnormal modulation results in the pathogenesis of many acquired diseases, such as cancer or atherosclerosis.1 There is abundant evidence that the extracellular matrix modulates cell proliferation through the integrin family of cell surface proteins coupled by adapter proteins and protein kinases to the cellular restriction point transition apparatus. The restriction point occurs about 1 to 2 hours before S phase of the cell cycle. The restriction point is when a cell becomes programmed for autonomous entry into mitosis, independent of all mitogens and refractory to all antiproliferative stimuli. Cell surface integrins binding to extracellular matrix proteins activate the transcription of D cyclins, and newly synthesized cyclin D (particularly D1) activate the cyclin-dependent kinases (cdk) cdk 4 and cdk 6, which phosphorylate the retinoblastoma protein (Rb) and related protein (p107). The phosphorylation of Rb and p107 releases the transcription factor E2F, which activates a variety of growth-regulating genes, including cyclin A, irreversibly driving the cell into S phase followed by mitosis.2 A variety of cyclin-dependent kinase inhibitors (CDKIs) counterbalance the proliferative effects of the cyclin/cdk interactions. The most important of these may be p21, a 21,000-Dalton universal cdk inhibitor that is the effector of p53-mediated growth arrest.3 P53 also signals a pathway leading to apoptosis, although the route of this signal pathway bifurcation and the precise mechanism by which apoptosis-promoting target genes are activated remain obscure.4 The glycoprotein (Gp) Ib/IX complex contains three transmembranous leucine-rich repeat polypeptides (GpIb, GpIb, and GpIX) that form the platelet von Willebrand factor (vWF) receptor.5 GpIb/IX functions to effect platelet adhesion, activation, and aggregation under conditions of high shear stress.6 GpIb/IX is expressed late in the ontogeny of megakaryocytes, the precursor cells that release platelets when they reach their terminal stage of differentiation. Although there are recent data relating to transcriptional effectors of megakaryocyte differentiation,7,8 growth factor control of megakaryocytopoiesis,9 and nuclear events associated with the final phases of megakaryocyte maturation leading to platelet production,10,11 there is little or no published information about adhesion receptor function in megakaryocytopoiesis. Because signal pathways may be functionally conserved in cells at different stages of development and because GpIb/IX binding to vWF triggers platelet activation, the hypothesis that GpIb/IX regulates megakaryocytopoiesis was developed. To begin to investigate this hypothesis, the effect of GpIb/IX on the growth of cultured cells was examined.     MATERIALS AND METHODS TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Cell lines and culture conditions.   CHO/IX cells (CHO cells expressing GpIb and GpIX ) were a gift from Dr J.A. López and Dr J.F. Dong (Baylor College of Medicine and Veterans Affairs Medical Center, Houston, TX). The cells were grown in -minimum essential medium (MEM; Life Technologies Inc, Grand Island, NY) containing 5% fetal bovine serum (FBS; Life Technologies Inc), 500 µg/mL G418 (Sigma, St Louis, MO), 80 µmol/L methotrexate (Sigma), and an antibiotic-antimycotic (Life Technologies Inc). The human hematopoietic DAMI cell line12 was purchased from the ATCC (Rockville, MD; ATCC.CRL-9792, batch no. F-10415). DAMI cells were grown in 10% FBS. All cells were maintained in an atmosphere of 5% CO2 and 95% humidity at 37°C. Transfections of recombinant GpIb.   The full-length human GpIb cDNA (from 42 to 2,420 bp; obtained from Dr J.A. López) was cloned into pBluescript SK vector (Stratagene, La Jolla, CA) at its EcoRI insertion site and then subcloned into the mammalian expression vector pcDNA3.1/Zeo (Invitrogen Co, San Diego, CA) at BamHI and Xho I sites. A truncated GpIb (amino acid residues Met1-Leu540) was generated by ligation of two fragments of GpIb cDNA in the SK vector from BamHI to Xba I and Xba I to Pst I sides and then cloned into pcDNA3.1/Zeo expression vector at BamHI and Xho I sites. A second truncated GpIb (amino acid residues Met1-Gly594) was constructed by making a fragment of wild-type GpIb in pBluescriptSK with an excision from its HindIII to its Sma I restriction site. This fragment was ligated to a HindIII plus Sma I-digested product of wild-type GpIb cDNA after amplification by polymerase chain reaction (PCR) using primers spanning codons 547 through 595 (5'ACAGTGCCCCGGGCCTGGCTGCTC3' and 5'CAGGTCCTGACCTCGAGCCTGACTCAG3', respectively). A cDNA for GpIb deleted of its actin-binding domain (Gln541-Leu589) was constructed by ligating three fragments of GpIb cDNA in pBluescript SK. The first fragment was wild-type GpIb with an excision from its HindIII to its Xba I restriction sites. The second was wild-type GpIb with an excision from its Xba I to its Pst I restriction site. The third fragment was generated by PCR amplification of wild-type GpIb using primers that span codon 587 (5' TCAGCTCTGCTGCAGGGTCGTGGTCAG3') with a sequence for the 3' untranslated region of the cDNA (5'ATGCAGCATCTCGAGCTTTGTCTTGTC3'). After ligation, the mutant GpIb species were cloned into pcDNA3.1/Zeo at HindIII and Xho I sites. In all cases, the integrity of the mutant cDNA was verified by sequence analysis. The ecdysone-inducible GpIb (In) gene expression plasmid was constructed by cloning GpIb cDNA from the SK vector into the ecdysone-inducible mammalian expression vector pIND (Invitrogen) at BamHI and Xho I sites. CHO/IX cells (5 × 105) in 25-cm2 culture flasks were washed twice with phosphate-buffered saline (PBS) and maintained in 1.5 mL of MEM serum-free medium.12 A mixture of 15 µL lipofectAMINE (Life Technologies, Inc) with 5 µg of plasmid DNA (full-length GpIb, truncated GpIb, or control empty vector) was kept at room temperature for 15 minutes in 100 µL PBS before being added to each flask. The transfection mixtures were incubated at 37°C for 10 hours. After transfection, cells were selected in MEM supplemented with 10% FBS, 500 µg/mL Zeocin (Invitrogen), 500 µg/mL G418, and 80 µmol/L methotrexate. For inducible gene expression, CHOIX cells were cotransfected with plasmids pVgRXR (Invitrogen) and pIND- and then selected in the same medium as Zeo- cells. Flow cytometry and cell cloning.   The expression of the GpIb complex on the cell surface was analyzed by flow cytometry. Stable transfected CHO cells were washed with PBS, harvested with 1:5,000 EDTA (Life Technologies, Inc), and incubated with 1 µg/mL fluorescein isothiocyanate (FITC)-conjugated AN51 (DAKO, Carpinteria, CA), a monoclonal antibody to GpIb, or SZ1, a monoclonal antibody against GpIX (provided by Dr J.A. López). For wild-type GpIb and truncated GpIb, samples were washed twice with PBS, resuspended in 0.5 mL of PBS, and directly analyzed for emission at 520 nm in a Becton Dickinson FACStar flow cytometer (Becton Dickinson, San Jose, CA) after stimulation with an argon ion laser at a wavelength of 488 nm. For GpIX, the samples were immunostained with a second antibody (a goat antimouse antibody conjugated with FITC), washed twice with PBS, and then analyzed by flow cytometry. For inducible GpIb, transfected CHO-In//IX cells were grown in medium containing 1 µmol/L muristerone for 24 to 96 hours at 37°C before analysis.13 Muristerone has no direct effect on the growth of CHO cell. Cells with the highest expression level of GpIb, truncated GpIb and GpIX, were isolated with DYNABEADS M-450 rat antimouse IgG2a (Dynal, Inc, Lake Success, NY). These cells were incubated with 5 µg/mL AN51 or SZ1 for 1 hour at 4°C, washed twice with PBS, and then incubated with 4 × 107 beads. The mixture was incubated for 1 hour at 4°C with gentle rotation before the beads were collected by a magnetic separation. The beads were washed twice with PBS and the cells were detached by adding 2% EDTA at 37°C for 30 minutes. Cell lines with comparable expression of GpIb were cloned by limiting dilution selection. DAMI cells expressing GpIb were first isolated by affinity purification with solid-phase vWF. From this pool, cells demonstrating increased surface expression were selected by repeated rounds of fluorescence-activated cell sorting with the anti-GpIb antibody AN51. Western blot analyses.   The expression of GpIb, mutant GpIb, and induced GpIb and the cell cycle regulatory proteins p21 (WAF1/Cip1), cyclin D1, and cyclin E was analyzed by Western blot. Cell lysis buffer was added to washed cells (50 mmol/L Tris-HCl, pH 7.4; 1% Triton-X 100; 0.25% sodium deoxycholate; 150 mmol/L NaCl; 1 mmol/L EGTA; 1 mmol/L phenylmethylsulfonyl fluoride [PMSF]; 1 µg/mL aprotonin, leupeptin, and pepstatin; 1 mmol/L Na3VO4; and 1 mmol/L NaF). The protein mass in each lysate sample was measured using a BCA Protein Assay Kit from Pierce (Rockford, IL). One microgram of total protein in lysis buffer was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF), and blotted with either WM23 (a mouse monoclonal antibody to GpIb; a gift from Dr M.C. Berndt, Baker Medical Research Institute, Prahran, Victoria, Australia) or M-20, H-295, or C-19 (affinity-purified rabbit polyclonal anti-cyclin E, anti-cyclin D1, and anti-p21 antibodies, respectively; all from Santa Cruz Biotechnology, Inc, Santa Cruz, CA). Proteins were detected by the ECL system (Amersham, Arlington Heights, IL). In vitro growth assay.   The growth rate of transfected CHO cells was measured by three different assays. First, cell numbers were measured in the continuous presence of 5% FBS. Cells were grown in 6-well plates containing 5% FBS, trypsinized, and counted with a hemacytometer at 0, 1, 2, 3, and 4 days after plating. Second, DNA synthesis was measured after the cells were growth arrested in serum-free medium for 24 hours. Five thousand cells per well were grown on 24-well plates containing 5% FBS at 37°C. 5-Bromo-2'-deoxyuridine (BrdU; Boehringer Mannheim Co, Indianapolis, IN) was added at 10 µmol/L after 16 hours of serum repletion. After 4 hours of incubation with BrdU, the cells were fixed and stained with an anti-BrdU antibody. BrdU incorporation was measured by the Cell Proliferation BrdU Colorimetric Kit (Boehringer Mannheim). Third, DNA content and ploidy were measured by propidium iodide staining. Growth-arrested cells were grown in 6-well plates containing 5% FBS for 20 hours at 37°C. Cells were fixed in 70% ethanol at 4°C for 30 minutes, washed twice with PBS, and incubated in PBS containing 200 µg/mL DNAase-free RNAase A (Boehringer Mannheim) for 30 minutes at 37°C. Propidium iodide (50 µg/mL; Boehringer Mannheim) was then added to the cell suspension and fluorescence was analyzed by flow cytometry. For CHO-In//IX cell growth measurements, experiments were performed in the continuous presence of 5% FBS. Control growth conditions were defined in the uninduced cells, and the effect of GpIb on growth was determined in CHO-In//IX cells at times after the induction of GpIb by adding 1 µmol/L muristerone to the medium plus FBS. To determine the effect of vWF on cell growth, incubation plates were coated with 20 µg/mL purified vWF (a gift of Nancy Turner, Rice University, Houston, TX). To eliminate any potential influence of bovine vWF in the FBS, CHO cells were maintained in MEM supplemented with CD CHO (serum-free growth factors designed for CHO cells; Life Technologies Inc, Gaithersburg, MD). Apoptosis was measured using flow cytometry to identify surface phosphatidylserine by its binding to phycoerythrin-conjugated annexin V (Pharmingen, San Diego, CA). Data analysis.   All bar graphs present the mean values with the standard errors of the means. P values were calculated by the Student's t-test.     RESULTS TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Cells expressing GpIb are selected against during routine passage.   During the course of studies on the recombinant GpIb/IX complex, poor cell surface expression was observed in a variety of stably transfected cell lines. To investigate the basis for this observation, CHO cells transduced with the cDNAs for GpIb and GpIX were transfected with the cDNA for GpIb inserted into pcDNA3.1 vector. Excellent expression of GpIb was identified after selection with Zeocin, G418, and methotrexate and separation with immunomagnetic beads (Fig 1, passage 1). This decreased progressively with each cell passage to the point that, after the tenth passage, no expression was detectable (Fig 1, passage 10). Similar decreases over time in the expression of GpIb were observed with other cell lines (Jurkat and L2H; data not shown). View larger version (22K): [in this window] [in a new window]   Fig 1. Cells expressing GpIb are selected against during routine passage. Expression of GpIb (reported by flow cytometry fluorescence with FITC-conjugated anti-GpIb antibody AN51) was identified immediately after antibiotic and immunomagnetic bead selection (passage 1), but this decreased progressively with each cell passage to the point that, after the tenth passage, no expression was detectable (passage 10). Cell number is decreased after passage of CHO cells expressing the GpIb//IX complex.   To determine if the decrease in cell surface expression of GpIb is due to a decline in protein expression in cells proliferating normally or to a decrease in the proliferation of cells expressing GpIb normally, CHO//IX cells were selected as described above and isolated with immunomagnetic beads. Single cells were cloned by limiting dilution. The quantity of GpIb expressed in each cloned cell line was checked by flow cytometry. Figure 2A shows that GpIb expressed on the cell surface is increased from vector (V) to low (L) to high (H) expressing cell clones. Three cell lines with high expression of GpIb and three cell lines with low expression of GpIb were selected for analysis of immunoreactive GpIb by immunoblotting whole cell lysates with the monoclonal antibody WM23 (Fig 2B). These cells were cultured on a vWF substrate and the cell number was counted 4 days after passage. Figure 2C demonstrates that the cell number is decreased in proportion to the quantity of GpIb expressed by that cell line. View larger version (29K): [in this window] [in a new window]   Fig 2. Cell number is decreased after passage of CHO cells expressing GpIb. Single cells were cloned by limiting dilution and the quantity of GpIb expressed in each cloned cell line was checked by flow cytometry as in Fig 1. (A) shows the stable expression of GpIb in vector (V//IX), low (//IX-L), and high (//IX-H) expressing cloned cell lines. Three cell lines with high expression of GpIb and three cell lines with low expression of GpIb, as defined by immunoblot analysis of total GpIb (B), were cultured on a vWF substrate and the cell number was counted 4 days after passage. (C) demonstrates that the cell number is decreased in proportion to the quantity of GpIb expressed by that cell line. (**P < .0001 in comparison with V//IX cells; n = 3.) The inhibitory effect of the GpIb//IX complex on cell growth is specifically dependent on the surface expression of GpIb and is mediated by its cytoplasmic domain.   To corroborate the observed effects of stable expression of GpIb on cell growth, cell number was measured on day 4 after the induced expression of GpIb with muristerone (M) in CHO In//IX cells grown in serum on plates coated with vWF.12 Figure 3 shows that, 4 days after the induction of GpIb with muristerone (In//IX + M in upper part of Fig 3A), the In//IX + M CHO cells are reduced in number (lower part of Fig 3B). To explore further the specificity of GpIb in mediating this effect, cell number was measured 4 days after replating in CHO cells transduced with GpIb truncated at amino acid 540, which eliminates its actin binding protein and 14-3-3 adapter protein interactions.14,15 These interactions are theorized to mediate GpIb signaling, although there is currently no direct evidence for this. Figure 3A shows that truncated GpIb (T//IX) is expressed on the surface of transduced cells at levels comparable to the wild-type GpIb//IX shown in Fig 2. Figure 3B shows that the truncation of the cytoplasmic tail of GpIb completely reverses the growth-inhibitory effect of the wild-type GpIb//IX complex. To confirm that the growth-inhibitory effect of GpIb is due to its surface expression and not to a nonspecific toxic effect of high-level cytoplasmic expression of a recombinant protein, CHO cells were transiently transfected with pcDNA3.1/Zeo without and with an insert for GpIb. Cell number was measured after 3 days of growth in culture medium and 2 days after selection in the antibiotic Zeocin (500 µg/mL). Under these conditions, the majority of the translated protein is not surface expressed, but rather is degraded and secreted after processing in the golgi.5 The number of cells was the same 3 and 5 days after transfection with pcDNA3.1/Zeo regardless of whether it carried an insert for GpIb (data not shown). View larger version (28K): [in this window] [in a new window]   Fig 3. The inhibitory effect of GpIb on cell growth is specifically dependent on the expression of GpIb and is mediated by its cytoplasmic domain. Expression of GpIb with muristerone (M) was induced in CHO In//IX cells grown on vWF. Four days after the induction of GpIb with muristerone (upper part of [A]), the In//IX CHO cells are reduced in number (lower part of [B]). Cell number was also measured 4 days after replating in CHO cells transduced with a truncated GpIb (at aa 540, which eliminates its actin binding protein and 14-3-3 adapter protein interactions). The mutant GpIb is expressed on the cell surface at levels comparable to the wild-type (A), but this truncation eliminates the growth-inhibitory effect of wild-type GpIb. (**P < .0001 compared with V//IX; *P < .001 compared with V//IX; n = 3.) GpIb-mediated growth arrest is partially dependent on extracellular vWF.   To determine the extent to which the GpIb//IX complex regulates CHO cell growth in a ligand-dependent manner, cell number was measured in cells in which serum is replaced by serum-free growth factors. Ristocetin (1.5 mg/mL; which promotes vWF binding to GpIb in static conditions) was added to the serum-free medium, and cells were grown in either the absence or presence of vWF coating the culture dish (20 µg/mL). Figure 4 shows that there was approximately 50% inhibition of the number of CHO//IX cells 4 days after replating when they were grown on vWF. In the absence of vWF, a decrease in cell number by approximately 35% was observed. Using CHOIn//IX cells treated continuously for 4 days with muristerone, there was an approximately 25% reduction in cell number when the cells were grown on vWF and an approximately 15% reduction in cell number when they were grown in plastic dishes without vWF. Ristocetin alone had no effect on cell growth. View larger version (12K): [in this window] [in a new window]   Fig 4. GpIb-mediated growth arrest is partially dependent on extracellular vWF. The relative number of CHO//IX cells growing in serum-free medium 4 days after replating or serum-free CHO In//IX cells after 4 days of continuous treatments with muristerone is smallest when they are grown on vWF. Ristocetin (15 µg/mL) was added to every culture well. In the absence of vWF, a significant decrease in cell number is still observed in CHO cells expressing GpIb. (**P < .0001 compared with V//IX cells growing in serum-free medium; *P < .001 compared with V//IX cells growing in serum-free medium; n = 3.) The expression of the GpIb//IX complex causes p21-dependent G1 growth arrest.   To begin to identify the mechanism by which the GpIb complex decreases cell proliferation, CHO //IX cells were synchronized to enter the cell cycle by serum deprivation for 24 hours, followed by serum repletion for 20 hours, at which time BrdU incorporation and DNA contentwere determined. The same assays were performed in CHO In//IX cells growing in serum and treated with muristerone for 20 hours. Figure 5A shows that the expression of GpIb inhibits BrdU incorporation when transduced cells are grown on vWF and serum depleted/repleted, or induced cells are treated with muristerone (M). Figure 5 also shows that cells expressing truncated GpIb (at amino acid 540) have normal BrdU uptake after serum-repletion. Figure 5B shows that serum-repleted GpIb-expressing cells are arrested in G1 (represented by the decreased width and amplitude of the second 4N DNA peak) and that this G1 arrest is eliminated in cells transduced with the truncated cDNA for GpIb. Figure 5C shows that growth arrest is associated with increased immunoreactive p21, which is not observed in cells that are stable transfectants of the truncated GpIb//IX complex. At the time that GpIb-dependent G1 arrest is observed, there are no changes in the quantity of immunoreactive cyclins D and E (data not shown). View larger version (24K): [in this window] [in a new window]   Fig 5. The expression of GpIb causes p21-dependent G1 growth arrest. CHO //IX cells growing on vWF were serum deprived for 24 hours and then serum repleted for 20 hours, at which time BrdU incorporation and DNA content were determined. Identical measurements were made in CHO In//IX treated with muristerone. (A) shows that serum repletion of stable transfectants or the induced expression of GpIb inhibits BrdU incorporation and that this is reversed by the truncation of GpIb at amino acid 540 of the cytoplasmic domain. (B) shows that these cells are arrested in G1 and that G1 arrest is eliminated in cells transduced with the truncated cDNA for GpIb. (C) shows associated levels of immunoreactive p21 (n = 2). (**P < .0001 compared with V//IX; *P < .001 compared with V//IX; n = 3.) GpIb's growth-inhibitory effect maps to its 14-3-3 interaction domain.   To begin to identify the specific intracellular switch that signals GpIb-induced CHO cell growth arrest, two additional GpIb mutations were expressed in CHO/IX cells. The first mutation eliminated the 16 C-terminal amino acids (610 through 595) of GpIb, a region reported to represent the binding site for 14-3-3.15 The second mutation created a deletion of amino acids 541 through 589, eliminating the actin binding domain,16 but preserving the 14-3-3 binding domain of GpIb. Figure 6A shows that expression of mutant GpIb with the C-terminal truncation (594//IX) is associated with proliferation comparable to control (empty vector-transfected) CHO cells. In contrast, expression of mutant GpIb with the actin-binding domain deletion (del//IX) results in decreased proliferation comparable to that observed in CHO cells transduced with wild-type GpIb//IX. Figure 6B shows that the expression of del//IX, but not 594//IX, is associated with G1 growth arrest. View larger version (20K): [in this window] [in a new window]   Fig 6. GpIb's growth-inhibitory effect maps to its 14-3-3 interaction domain. In (A), cell number was measured 4 days after replating. Truncation of 16 C-terminal amino acids of GpIb (594//IX), a region reported to represent the binding site for 14-3-3, restores cell number to control (vector) levels. A second mutation eliminating the actin binding domain, but preserving the terminal 14-3-3 binding domain of GpIb (del//IX), shows decreased cell number comparable to CHO//IX cells. In (B), propidium-labeled cells were analyzed for DNA content. CHO cells expressing 594//IX enter S-phase normally, but those expressing del//IX are arrested in G1 (n = 3). GpIb-mediated growth arrest is followed by apoptosis.   Integrin adhesion receptors are involved in regulating proliferation and programmed cell death,17 and these two responses may be coupled together by p53, which activates both the cyclin-dependent kinase inhibitor p21 and the apoptosis-promoting genetic machinery.4 To examine for apoptosis in CHO//IX cells whose growth is arrested in G1, annexin V binding was measured by flow cytometry 24 and 48 hours after serum repletion. At both time points, there was an increase in the number of GpIb//IX-expressing CHO cells undergoing apoptosis. Figure 7 shows that the 594//IX truncation, but not the actin-binding domain deletion (del//IX), decreases the apoptosis of CHO cells 48 hours after serum-repletion to control levels (vector//IX). View larger version (18K): [in this window] [in a new window]   Fig 7. GpIb-mediated growth arrest is followed by apoptosis. The Y-axis is the mean fluorescence of FITC-conjugated Annexin V (which binds to phosphatidylserine exposed during apoptosis) and the X-axis is a log scale of cell number. Flow cytometry for Annexin V-binding cells was performed 48 hours after serum repletion. The population of CHO cells expressing //IX shows increased annexin V binding in comparison to control cells (vector//IX). This is reversed by expressing a mutant complex with a truncation of its 14-3-3 interaction domain (594//IX). A mutant with a deleted actin binding protein domain (del//IX) continues to show an increased number of apoptotic cells 48 hours after serum-repletion (n = 2). The endogenous GpIb//IX complex regulates the proliferation of human DAMI cells.   Under routine culture conditions, DAMI cells express very little detectable GpIb//IX. However, immunofluorescent examinations do show rare DAMI cells that stain relatively brightly for GpIb (data not shown). To develop a system for analyzing the potential significance of endogenous GpIb//IX in megakaryocyte biology, DAMI cells expressing GpIb were isolated. These cells were affinity-purified with solid-phase vWF and then selected by several rounds of fluorescence-activated cell sorting with the anti-GpIb antibody AN51. The sorted cells stain almost 10 times brighter than unsorted cells (Fig 8A). The inset in Fig 8A shows that the expression of GpIb is associated with decreased proliferation of DAMI cells 4 days after replating. View larger version (21K): [in this window] [in a new window]   Fig 8. Endogenous GpIb regulates the growth of hematopoietic cells. DAMI cells expressing GpIb were first isolated by affinity purification with solid-phase vWF and then selected by repeated rounds of fluorescence-activated cell sorting with the anti-GpIb antibody AN51. After selection, a population of cells designated DAMI GpIb (+) stains brighter with FITC-conjugated AN51. The inset shows that, when cells are counted 4 days after replating, DAMI GpIb (+) cell number is significantly decreased compared with DAMI GpIb () cells. (**P < .0001 compared with DAMI cells not expressing GpIb; n = 3.)     DISCUSSION TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES GpIb is a lineage-restricted receptor for vWF. It is expressed late in the development of megakaryocytes, and it is fairly densely packed (up to 30,000 molecules per cell) on the surface of platelets released from fully mature megakaryocytes.5 It is also expressed on the surface of some human vascular endothelial cells stimulated by inflammatory cytokines.18 The best-described function for this protein is mediating platelet adhesion to the subendothelial extracellular matrix. Platelet adhesion develops when the extracellular globular domain of GpIb binds to vWF. vWF may be an insoluble constituent of the subendothelial matrix (thereby effecting direct adhesion of platelets) or it may be soluble in plasma (thereby effecting adhesion indirectly by bridging platelets to extracellular collagen).6,19 Platelet GpIb also mediates homotypic platelet cohesion (aggregation) and is associated with platelet signaling, including stimulatory calcium and protein kinase responses.20-22 The GpIb/IX complex is expressed late in the ontogeny of megakaryocytes. For example, when CD34(+)/CD41(+) human bone marrow cells are first isolated, less than 20% demonstrate surface expression of GpIb, but after 4 days of growth in a medium containing thrombopoietin, approximately 90% of the cells express GpIb.23 This expression coincides with increasing polyploidization of these progenitor cells associated with p21-dependent cell cycle arrest.10 These cellular changes appear to precede terminal megakaryocyte differentiation, resulting in cellular apoptosis associated with platelet production.24,25 The genetic program that regulates the final phase of megakaryocyte maturation appears to be activated independent of exogenous growth factors.11 Experiments presented in this report demonstrate that recombinant GpIb decreases the proliferation of CHO cells and that the decreased proliferation is associated with the induction of the cyclin-dependent kinase inhibitor p21 and G1 cell cycle arrest. G1 arrest induced by recombinant GpIb in transduced CHO cells requires signaling through the 14-3-3 interaction domain of GpIb and is partially dependent on extracellular vWF. G1 cell cycle arrest is followed by cellular apoptosis. Taken together, the data suggest that the expression of GpIb during the maturation of hematopoietic stem cells into megakaryocytes may be an important growth-regulating event. Megakaryocytopoiesis requires a convergence of multiple factors that function in a time- and dose-dependent manner to drive a multilineage program towards a single lineage commitment. The expression of GpIb during the later stage of megakaryocytopoiesis may be one factor, of a combination of many, that regulates cell growth by slowing cell proliferation. Such a hypothesis is consistent with clinical observations of humans with congenital deficiencies of platelet GpIb. Patients with this bleeding disorder (Bernard-Soulier syndrome) have thrombocytopenia, with the majority of circulating platelets enlarged and dysfunctional.26,27 Some recent investigations of the bone marrow from patients with Bernard-Soulier syndrome provide ambiguous data about the possible function of the GpIb/IX complex in regulating megakaryocytopoiesis. For example, Hourdillé et al28 and Nurden and Nurden29 demonstrate abnormal morphology of such megakaryocytes and suggest that this represents qualitatively abnormal maturation, whereas Tomer et al30 observed a normal number of megakaryocytes with normal morphology. Further studies should help to determine if human progenitor cells require GpIb expression to complete normal maturation into megakaryocytes capable of producing platelets.     ACKNOWLEDGMENT The authors thank Drs Michael Berndt, Bruce Ewenstein, José López, Andrew Schafer, and Sandy Shattil for helpful discussions.     FOOTNOTES Submitted November 30, 1998; accepted February 8, 1999. Supported by the Research Service of the Department of Veterans Affairs and the National Heart, Lung and Blood Institute (HL 18584). This work was performed by M.H.K. during the tenure of an Established Investigator Award from the American Heart Association. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact. Address reprint requests to Michael H. Kroll, MD, Section of Hematology-Oncology (111H), VA Medical Center, 2002 Holcombe Blvd, Houston, TX 77030; e-mail: mkroll{at}bcm.tmc.edu.     REFERENCES TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES 1. Assoian R: Anchorage-dependent cell cycle progression. J Cell Biol 136:1, 1997[Free Full Text] 2. Dynlacht BD: Regulation of transcription by proteins that control the cell cycle. Nature 389:149, 1997[Medline] [Order article via Infotrieve] 3. Peter M, Herskowitz I: Joining the complex: Cyclin-dependent kinase inhibitory proteins & the cell cycle. Cell 79:181, 1994[Medline] [Order article via Infotrieve] 4. Evan G, Littlewood T: A matter of life and cell death. Science 281:1317, 1998[Abstract/Free Full Text] 5. López JA: The platelet glycoprotein Ib-IX complex. Blood Coagul Fibrinolysis 5:97, 1994[Medline] [Order article via Infotrieve] 6. Kroll MH, Hellums JD, McIntire LV, Schafer AI, Moake JL: Platelets and shear stress. Blood 88:1525, 1996[Free Full Text] 7. Shivdsani RA, Orkin SH: The transcriptional control of hematopoiesis. Blood 87:4025, 1996[Free Full Text] 8. Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH: FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell 90:109, 1997[Medline] [Order article via Infotrieve] 9. Kaushansky K: Thrombopoietin: The primary regulator of platelet production. Blood 86:419, 1995[Free Full Text] 10. Kikuchi J, Furukawa Y, Iwase S, Terui Y, Nakamura M, Kitagawa S, Kitagawa M, Komatsu N, Miura Y: Polyploidization and functional maturation are two distinct processes during megakaryocytic differentiation: Involvement of cyclin-dependent kinase inhibitor p21 in polyploidization. Blood 89:3980, 1997[Abstract/Free Full Text] 11. Zauli G, Vitale M, Falcieri E, Gibellini D, Bassini A, Celeghini C, Columbaro M, Capitani S: In vitro senescence & apoptotic cell death of human megakaryocytes. Blood 90:2234, 1997[Abstract/Free Full Text] 12. Greenberg SM, Rosenthal DS, Greeley TA, Tantravahi R, Handin RI: Characterization of a new megakaryocytic cell line: The Dami cell. Blood 72:1968, 1988[Abstract/Free Full Text] 13. No D, Yao T-P, Evans RM: Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proc Natl Acad Sci USA 93:3346, 1996[Abstract/Free Full Text] 14. Myer SC, Sanan DA, Fox JEB: Role of actin-binding protein in insertion of adhesion receptors into the membrane. J Biol Chem 273:3013, 1998[Abstract/Free Full Text] 15. Du X, Fox J, Pei S: Identification of a binding sequence for the 14-3-3 protein within the cytoplasmic domain of the adhesion receptor, platelet glycoprotein Ib. J Biol Chem 271:7362, 1996[Abstract/Free Full Text] 16. Andrews RK, Fox JB: Identification of a region in the cytoplasmic domain of the platelet GpIb/IX complex that binds to purified actin-binding protein. J Biol Chem 267:18605, 1992[Abstract/Free Full Text] 17. Clark EA, Brugge JS: Integrins and signal transduction pathways: The road taken. Science 268:233, 1995[Abstract/Free Full Text] 18. Konkle BA, Shapiro SS, Asch AS, Nachman RL: Cytokine-enhanced expression of glycoprotein Ib in human endothelium. J Biol Chem 265:19833, 1990[Abstract/Free Full Text] 19. Savage B, Saldivar E, Ruggeri ZM: Initiation of platelet adhesion by arrest onto fibrinogen or translocation on von Willebrand factor. Cell 84:289, 1996[Medline] [Order article via Infotrieve] 20. Chow T, Hellums JD, Moake JL, Kroll MH: Shear stress-induced von Willebrand factor binding to platelet glycoprotein Ib initiates calcium influx associated with aggregation. Blood 80:113, 1992[Abstract/Free Full Text] 21. Kroll MH, Hellums JD, Guo Z, Durante W, Razdan K, Hrbolich JK, Schafer AI: Protein kinase C is activated in platelets subjected to pathological shear stress. J Biol Chem 268:3520, 1993[Abstract/Free Full Text] 22. Razdan K, Hellums JD, Kroll MH: Shear-stress-induced von Willebrand factor binding to platelets causes the activation of tyrosine kinase(s). Biochem J 302:681, 1994 23. Dolzhanskiy A, Basch RS, Karpatkin S: The development of human megakaryocytes: III. Development of mature megakaryocytes from highly purified committed progenitors in synthetic culture media & inhibition of thrombopoietin-induced polyploidization by interleukin-3. Blood 89:426, 1997[Abstract/Free Full Text] 24. Choi ES, Nichol JL, Hokom MM, Hornkohl AC, Hunt P: Platelets generated in vitro from proplatelet-displaying human megakaryocytes are functional. Blood 85:402, 1995[Abstract/Free Full Text] 25. Debili N, Cramer E, Wendling F, Vainchenker W: In vitro effects of Mpl ligand on human hemopoietic progenitor cells, in Kuter DJ, Hunt P, Sheridan W, Zucker-Franklin D (eds): Thrombopoiesis and Thrombopoietins. Totowa, NJ, Humana, 1997, p 217. 26. Newman PJ, Poncz M: Inherited disorders of platelets, in Scriver CR, Beaudet AL, Sly WS, Valle D (eds): The Metabolic and Molecular Bases of Inherited Disease, Vol III. New York, NY, McGraw-Hill, 1995, p 3335. 27. López JA, Andrews RK, Afshar-Kharghan V, Berndt MC: Bernard-Soulier syndrome. Blood 91:4397, 1998[Free Full Text] 28. Hourdillé P, Pico M, Jandrot-Perrus M, Lacaze D, Lozano M, Nurden AT: Studies on the megakaryocytes of a patient with Bernard-Soulier syndrome. Br J Haematol 76:521, 1990[Medline] [Order article via Infotrieve] 29. Nurden P, Nurden A: Giant platelets, megakaryocytes and the expression of the glycoprotein Ib/IX complex. CR Acad Sci Paris 319:717, 1996 30. Tomer A, Scharf RE, McMillan R, Ruggeri ZM, Harker LA: Bernard-Soulier syndrome: Quantitative characterization of megakaryocytes and platelets by flow cytometric and platelet kinetic measurements. Eur J Haematol 52:193, 1994[Medline] [Order article via Infotrieve] © 1999 by The American Society of Hematology.   0006-4971/99/9312-0035$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: Y. Li, J. Lu, and E. V. Prochownik Modularity of the Oncoprotein-like Properties of Platelet Glycoprotein Ib{alpha} J. Biol. Chem., January 16, 2009; 284(3): 1410 - 1418. [Abstract] [Full Text] [PDF] Y. Li, J. Lu, and E. V. Prochownik c-Myc-mediated genomic instability proceeds via a megakaryocytic endomitosis pathway involving Gp1b{alpha} PNAS, February 27, 2007; 104(9): 3490 - 3495. [Abstract] [Full Text] [PDF] T. Kanaji, S. Russell, J. Cunningham, K. Izuhara, J. E. B. Fox, and J. Ware Megakaryocyte proliferation and ploidy regulated by the cytoplasmic tail of glycoprotein Ib{alpha} Blood, November 15, 2004; 104(10): 3161 - 3168. [Abstract] [Full Text] [PDF] C.-H. Chung, W.-B. Wu, and T.-F. Huang Aggretin, a snake venom-derived endothelial integrin {alpha}2{beta}1 agonist, induces angiogenesis via expression of vascular endothelial growth factor Blood, March 15, 2004; 103(6): 2105 - 2113. [Abstract] [Full Text] [PDF] M. Eisbacher, L. M. Khachigian, T. H. Khin, M. L. Holmes, and B. H. Chong Inducible Expression of the Megakarocyte-specific Gene Glycoprotein IX Is Mediated through an Ets Binding Site and Involves Upstream Activation of Extracellular Signal-regulated Kinase Cell Growth Differ., August 1, 2001; 12(8): 435 - 445. [Abstract] [Full Text] [PDF] S. Feng, N. Christodoulides, J. C. Resendiz, M. C. Berndt, and M. H. Kroll Cytoplasmic domains of GpIbalpha and GpIbbeta regulate 14-3-3zeta binding to GpIb/IX/V Blood, January 15, 2000; 95(2): 551 - 557. [Abstract] [Full Text] [PDF] C.-H. Yeh, W.-C. Wang, T.-T. Hsieh, and T.-F. Huang Agkistin, a Snake Venom-derived Glycoprotein Ib Antagonist, Disrupts von Willebrand Factor-Endothelial Cell Interaction and Inhibits Angiogenesis J. Biol. Chem., June 16, 2000; 275(25): 18615 - 18618. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Feng, S. Articles by Kroll, M. H. Search for Related Content PubMed PubMed Citation Articles by Feng, S. Articles by Kroll, M. H. Related Collections Hemostasis, Thrombosis, and Vascular Biology Social Bookmarking                   What's this?

	Copyright © 1999 by American Society of Hematology         Online ISSN: 1528-0020