|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 12 (June 15), 1999:
pp. 4264-4276
Physical Interaction Between Retinoic Acid Receptor and Sp1:
Mechanism for Induction of Urokinase by Retinoic Acid
By
Yasuhiro Suzuki,
Jun Shimada,
Koichi Shudo,
Masatoshi Matsumura,
Massimo P. Crippa, and
Soichi Kojima
From the Laboratory of Molecular Cell Sciences, Tsukuba Life Science
Center, The Institute of Physical and Chemical Research (RIKEN),
Tsukuba, Ibaraki, Japan; the Institute of Applied Biochemistry,
University of Tsukuba, Tennoudai, Tsukuba, Ibaraki, Japan; the Faculty
of Pharmaceutical Sciences, University of Tokyo, Tokyo, Japan; and the
Laboratory of Molecular Genetics, DIBIT-H. S. Raffaele, Milano, Italy.
 |
ABSTRACT |
Induction of urokinase plasminogen activator (uPA) by retinoic acid
(RA) is the initial event preceding certain subsequent biological
changes in vascular endothelial cells. We investigated the molecular
mechanism by which RA stimulates the expression of uPA, which lacks a
canonical RA receptor (RAR)-responsive element, in bovine and human
aortic endothelial cells. Upon stimulation with RA, mRNA levels of
RAR and transiently increased in parallel with the induction of
uPA, and this increase was inhibited by cycloheximide. Results of
transient transfection of RAR/RXR cDNAs and experiments using specific
agonists and antagonists suggested that uPA induction is dependent upon
RAR (initially, RAR ) with the help of RXR . Deletion analysis of
the uPA promoter suggested that RAR/RXR acts on GC box region within
the uPA promoter. This was further supported by inhibition of Sp1
binding to this region. Coimmunoprecipitation studies, glutathione
S-transferase pull-down experiment, and mammalian two-hybrid
assays suggested a physical interaction between RAR/RXR and Sp1.
Furthermore, gel shift studies showed that the binding of Sp1 to the
uPA GC box is significantly potentiated in the presence of RARs/RXRs.
Finally, Sp1 and RAR/RXR synergistically enhanced the transactivation
activity of the uPA promoter. These results suggest that (1) RA induces
RARs mainly via RAR and that (2) RAR/RXR physically and functionally
interact with Sp1, resulting in a potentiation of uPA transcription.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
RETINOL (VITAMIN A) and its derivatives
(retinoids) exert profound effects on the regulation of cell growth and
differentiation, mainly through two families of nuclear receptors, the
retinoic acid (RA) receptors (RARs) and the retinoid X receptors
(RXRs).1,2 These receptors are ligand-dependent
transcription factors that bind to cis-acting DNA sequences,
called RAR-responsive elements (RAREs) and RXR-responsive elements
(RXREs), located in the promoter region of their target
genes.1-3 The RAR and RXR gene families are each composed
of three subtypes, named , , and . Expression of RARs
increases in an autocrine manner immediately after stimulation with RA,
because these receptors contain typical RARE sequences.1-3 RARs bind to the RARE in response to both all-trans-RA (atRA) and 9-cis-RA (9cRA), whereas RXRs bind and activate
transcription in response to only 9cRA. To recognize an RARE, RARs
usually must form a heterodimer with RXRs under physiological
condition.1,2 Recent studies have indicated that RARs/RXRs,
upon binding to ligands, promote transcription through interaction with
coactivators such as SRC-1, GRIP1, p/CIP, and p300/CBP after
dissociation from corepressors such as NCoR and SMRT.4-7
However, not all RA-inducible genes contain RARE sequence(s) within
their promoter.
In many cell types, RA enhances the production of plasminogen activator
(PA), an enzyme responsible for the conversion of plasminogen to
plasmin.8,9 There are two immunologically distinct PAs,
urokinase PA (uPA) and tissue PA (tPA). uPA is thought to be related to
tissue remodeling and metastasis, whereas tPA has high affinity for
fibrin and mainly participates in vascular thrombolysis.8,9
In bovine aortic endothelial cells (BAECs) and rat liver stellate
cells, RA enhances cellular fibrinolytic levels through rapid
stimulation of the expression of uPA and related genes, resulting in
the induction of active transforming growth factor-
(TGF- ), that subsequently mediates some of the actions
of RA in these cells.10-15
These sequential changes, induced in BAECs by RA, are initiated by
upregulation of the transcription of the uPA gene, which does not
contain a canonical RARE sequence. In the present study, we
investigated the molecular mechanism of this initial event and found
that (1) RA induces RARs expression initially via RAR and that (2)
RARs/RXRs directly interact with Sp1, culminating in the augmented
binding of Sp1 to the uPA GC box and in the enhanced transcription of
the uPA gene in endothelial cells.
 |
MATERIALS AND METHODS |
Materials.
Actinomycin D, cycloheximide, atRA, and 9cRA were purchased from Sigma
Chemical Co (St Louis, MO). Mithramycin was obtained from Calbiochem
(La Jolla, CA). The RAR -selective retinoid (Am580), pan-RAR-selective retinoid (Ch55), and RAR -selective antagonist (LE135) were synthesized and characterized as described
previously.16-18 The RAR -selective retinoid (CD2019) and
RAR -selective retinoid (CD666) were kindly provided by Dr S. Michel
(CIRD/GALDERMA, Sophia Antipolis, France).19,20 The
RXR -selective retinoid (Ro25-7386), pan-RXR-selective retinoid
(Ro47-5944), and RAR -selective antagonist (Ro41-5253) were generous
gifts from Dr M. Klaus (F. Hoffmann-La Roche, Basel,
Switzerland).21-23 Retinoids were diluted in ethanol and
serially diluted into culture medium to yield a final ethanol concentration of 0.5%. Human Sp1 was obtained from Promega (Madison, WI). RARs-glutathione S-transferase (GST) and
RXRs-GST fusion proteins were purified from Escherichia coli
BL21 transformed with the pGEX-6P (Pharmacia Biotech, Uppsala,
Sweden) vector containing inserted human RAR and murine
RXR cDNAs, respectively. Briefly, after induction by 2 mmol/L isopropyl
-D-thiogalactopyranoside (IPTG) for 4 hours, the cells were
disrupted by sonication and the fusion proteins were purified using
glutathione-Sepharose (Pharmacia) from cell homogenates. The
glutathione used to elute the proteins was removed from protein
fractions by dialysis before using them for the gel shift assays or
immunoprecipitation studies. cDNAs for human RARs and murine RXRs were
generous gifts from Dr P. Chambon (INSERM, University Louis Pasteur,
Strasbourg, France).24-27
Treatment of cells with retinoids.
BAECs were isolated and grown in minimal essential medium ( MEM)
containing 10% newborn calf serum (Hyclone Laboratories, Logan, UT).
Human aortic endothelial cells were purchased from Kurabo Biomedical
Business (Osaka, Japan) and maintained in attached Humedia-EG2 medium.
After the cells were grown to confluence, the cultures were rinsed with
phosphate-buffered saline (PBS), pH 7.4, and incubated in either
serum-free MEM containing 0.1% bovine serum albumin ( MEM-BSA) or
Humedia-EG2 medium containing 50 µmol/L L-ascorbic acid (Sigma),
respectively, plus either 0.5% ethanol or various concentrations of
retinoids. At the indicated time, the medium was aspirated, the
cultures were washed with PBS, and (1) lysed with guanidium
isothiocyanate solution and stored at 80°C until isolation
of RNA, (2) lysed with 0.5% Triton X-100 in 0.1 mol/L Tris-HCl, pH
8.1, and stored at 20°C until assay of cellular PA levels,
or (3) lysed with 0.6% NP-40 solution and stored at 80°C
until the preparation of nuclear extracts.
Isolation of RNA and Northern blot analysis.
Total RNA was extracted from the cells using the acid guanidinium
isothiocyanate-phenol-chloroform extraction method.28 Each
RNA (20 µg) was separated through 1% agarose-formaldehyde gel
electrophoresis and transferred to the Biodyne A nylon membranes (Pall
Biosupport, Port Washington, NY) according to the
published protocols.29 Membranes were hybridized with cDNA
probes for either human RAR , RAR , or RAR ; mouse RXR ,
RXR , or RXR ; or bovine uPA (a gift from Dr Wolf-Dieter
Schleuning, Research Laboratories of Schering AG, Berlin,
Germany)14 and were rehybridized with a probe for chicken
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The cDNA probes were
labeled with [ -32P]dCTP (Du Pont, Wilmington,
DE) via random priming using the kit (Boehringer Mannheim,
Mannheim, Germany). After hybridization for 1 hour at
68°C using QuickHyb reagent (Stratagene, La Jolla, CA), blots were washed twice with 2× SSC, 0.1%
sodium dodecyl sulfate (SDS) at room temperature for 15 minutes. The
final wash was performed with 0.1× SSC, 0.1% SDS at 65°C for
30 minutes. For rehybridizations, blots were washed twice in 0.1×
SSC, 0.1% SDS at 97°C for 15 minutes and stripped. Autoradiography
was performed using a Fujix BAS 2,000 Bio-imaging analyzer (Fuji
Photo-Film, Tokyo, Japan). Each band was scanned, and the signal
intensity was normalized to that obtained with GAPDH.
Assay of cellular PA activity.
The levels of cellular PA activity were measured using the chromogenic
substrate S-2403, as described previously,11 and expressed
as urokinase units per milligram of protein in the sample. Protein
concentration was measured by BCA (Pierce, Rockford, IL) assay using
BSA as the standard.
Transient transfection and luciferase assay.
BAECs were seeded and grown in 35-mm dishes using phenol-red free
MEM supplemented with 10% newborn calf serum until approximately 70% confluence on the day of the transfection. The cultures were rinsed with PBS and the cells were cotransfected using Lipofectamine Plus reagent (GIBCO BRL Life Technologies, Inc, Rockville, MD) in 1 mL
of serum-free medium containing a reporter plasmid plus RAR and/or RXR
expressing vectors (250 ng each/dish), along with pRL-CMV
(Renilla luciferase, 100 ng/dish; Promega) as an internal standard to normalize transfection efficiency. Total DNA transfected was always adjusted to 1.225 µg/dish with empty pSG5 vector. After 4 hours of incubation, the cultures were overlaid with an additional 1 mL
of medium containing 20% newborn calf serum and further incubated for
24 hours. The cells were then washed with PBS and treated or untreated
with 1 µmol/L atRA or 9cRA for an additional 12 hours in serum-free
medium. Thereafter, cell lysates were prepared by scraping cells into
120 µL of lysis buffer, and the luciferase activity of each cell
lysate was measured using the Dual-Luciferase Reporter Assay System
(Promega). Changes in firefly luciferase activity were calculated and
plotted after normalization with changes in Renilla luciferase
activity in the same sample. The uPA promoter-luciferase expressing
vector, pGL2-2350, contains the human uPA promoter ( 2345 to
+32)30 cloned into the Kpn I/Bgl II site of
pGL2-Basic (Promega). Its deletion mutant, pGL2-GC, containing the
first 65 bp and GC box and TATA box region ( 2345 to 2280
and 91 to +32, respectively) was constructed by digestion of
pGL2-2350 with Tth111I and Blp I, followed by blunting
and religation. Another deletion mutant, pGL2- GC, which contains uPA
promoter devoid of the GC box region, was constructed by ligation of
the pGL2 vector containing the TATA box ( 28 to +32) with the uPA
promoter fragment deficient in the GC and TATA boxes ( 2345 to
71). The TATA box-containing vector was prepared by digestion of
pGL2-GC with Apa I, blunt-ending of the DNA, and successive digestion with Kpn I. The uPA promoter fragment deficient in
the GC and TATA boxes was the Kpn I-fragment of a polymerase
chain reaction (PCR) product that used pGL2-2350 as template. The
following primers were used to generate this product: sense primer
(based on the vector sequence located upstream of the cloning site in pGL2 vector), CTTCCCTTCCTTTCTCG CCAC; and antisense primer (based on a
gene-specific sequence corresponding to 71 to 91 of the uPA promoter), TCCCCTGTCTTGCAGCGCTCA. The DR5-luciferase reporter plasmid, pGL3-DR5, was constructed by insertion of DR5 globin promoter
fragment (a gift from Dr S. Kato, Tokyo University, Tokyo, Japan)31 into the Kpn I/Bgl II site of
pGL3-Basic (Promega). Sp1-Gal4 expressing vector, which contains Sp1
fused with DNA binding domain of yeast Gal4 protein, and its reporter
plasmid Gal4-UAS fused to luciferase, were kindly supplied from Dr S.L. Friedman (Mount Sinai Medical Center, New York,
NY).32,33 The Sp1 expression vector,
pCIneo-Sp1, was constructed as follows. Human Sp1 cDNA, obtained from
pSp1-778C (a gift from Dr J.T. Kadonaga, UCSD, San Diego,
CA),34 was subcloned first into Not
I/HindIII site of pPROEX-HTb vector (GIBCO BRL), then into
Spe I/HindII site of pBluescript SK II (+)
(Stratagene), and finally into the Xba I/Acc I site of
pCIneo mammalian expression vector (Promega).
Preparation of nuclear extracts and gel shift assay.
Nuclear extracts were prepared in the following manner. Cells were
detached from dishes, washed with Tris-buffered saline, and resuspended
in ice-cold 10 mmol/L HEPES, pH 7.9, containing 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L dithiothreitol, and 0.5 mmol/L
phenylmethylsulfonyl fluoride. After being incubated on ice for 15 minutes, cells were ruptured in the presence of 0.6% Nonidet NP-40,
and the nuclear fraction was collected by centrifugation at
15,000g for 30 seconds at 4°C. Nuclei were lysed by
shearing through a 27-gauge needle in ice-cold 50 mmol/L Tris-HCl, pH
8, containing 150 mmol/L NaCl, 5 mmol/L
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS;
Sigma), and the Complete protease inhibitor cocktail (Boehringer Mannheim), and nuclear extracts were obtained as supernatants after
centrifugation at 105,000g for 1 hour at 4°C. The protein concentrations were determined by BCA assays. Oligonucleotides corresponding to uPA GC box ( 63 to 32), its mutant
(sequences presented in Fig 4B), and consensus GC box
(ATTCGATCGGGGCGGGGCGAGC; Santa Cruz Biotechnology, Santa Cruz,
CA) were synthesized, double-stranded, and end-labeled
with [ -32P]ATP by T4 polynucleotide kinase using the
kit from Boehringer Mannheim. For binding reactions, either 1 µg of
nuclear proteins or 10 to 20 ng of purified Sp1 (Promega) were
preincubated with or without 200 ng of purified RAR-GST and/or RXR-GST
for 15 minutes on ice in the absence and presence of unlabeled
oligonucleotides, and then 40 fmol of labeled oligonucleotide (10,000 µCi/mol) was added in the presence of 1 µg of dI-dC (Pharmacia) in
20 to 40 µL of binding buffer (20 mmol/L HEPES, pH 7.4, containing 1 mmol/L MgCl2, 10 µmol/L ZnSO4, 20 mmol/L KCl,
and 8% glycerol). The reaction mixture was incubated for 15 minutes on
ice and separated on a 4% polyacrylamide gel at 4°C. The gel was
dried and exposed on films for a Fujix BAS 2,000 Bio-imaging analyzer
(Fuji Photo-Film).
Immunoprecipitation and Western blotting.
After a preincubation of 100 ng of Sp1 with 200 ng of each of
RARs-and/or RXRs-GST proteins in PBS or in nuclear extract for 2 hours
on ice, samples were combined with either anti-RAR antibody, M-454
(final concentration, 10 µg/mL; Santa Cruz Biotechnology), which
uniformly recognizes three subtypes of RARs, or anti-RXR antibody,
N 197 (final concentration, 10 µg/mL; Santa Cruz Biotechnology), which uniformly recognizes three subtypes of RXRs, and were incubated for 2 hours at 4°C or overnight on a rotating mixer. Protein
A-Sepharose beads (Pharmacia) were then added and the samples were
incubated for another 2 hours at the same temperature. The beads were
then washed three times with PBS containing 0.05% Tween 20, and
immunoprecipitated proteins were eluted into 4× reducing sample
buffer for SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and
subjected to electrophoresis. Western blotting was performed using
rabbit polyclonal anti-Sp1 antibody, PEP2 (final concentration, 1 µg/mL; Santa Cruz Biotechnology) as described
previously,11 except that peroxidase-conjugated protein A
(1/2,000 dilution; Sigma) was used instead of peroxidase-conjugated second antibody. Protein bands were visualized using the Amersham ECL
system (Amersham, Buckinghamshire, UK).
GST fusion protein interaction assay.
The [35S]methionine-radiolabeled Sp1 protein was prepared
by in vitro translation reaction using the TNT T7 system (Promega) according to the manufacturer's instructions. GST fusion proteins were
mixed with glutathione-Sepharose 4B beads (Pharmacia) for 2 hours at
4°C in binding buffer (50 mmol/L Tris-HCl, pH 7.6, containing 50 mmol/L NaCl, 0.02% Tween 20, 0.02% BSA, and the Complete protease
inhibitor cocktail). The glutathione beads, preincubated with
RAR -GST, were washed three times with binding buffer and further
incubated for 30 minutes at 4°C with
[35S]methionine-radiolabeled Sp1 present in 15 µL of
the reaction mixture after in vitro translation reaction, in a final
volume of 300 µL with the binding buffer. After washing five times
with the washing buffer (50 mmol/L Tris-HCl, pH 7.6, containing 150 mmol/L NaCl, 0.02% Tween 20, and the Complete protease inhibitor cocktail), the bound proteins were eluted into 4× reducing sample buffer for SDS-PAGE and subjected to electrophoresis followed by fluorography.
Statistics.
Each number in the figures represents the average ± SD (n = 3).
 |
RESULTS |
Induction of uPA through RAR.
To analyze the molecular mechanism underlying the RA regulation of uPA
transcription in endothelial cells, we first investigated whether RARs
and/or RXRs might be involved. As seen in
Fig 1A, upon stimulation with atRA, the
expression of RAR increased significantly along with a strong and
transient induction of RAR , consistent with previous findings in
other cell types.1,3,10,35 Although RAR decreased until
9 hours, the sum of the three RAR isoforms increased. In contrast, such
a distinctive increase was not observed for RXRs, of which RXR was
the major species. The induction of uPA concurred with the increase of
RAR and RAR , whereas this induction did not occur when protein
synthesis was inhibited by cycloheximide (Fig 1B). RA stimulation did
not alter the degradation rate of uPA mRNA after actinomycin D
treatment, suggesting that RA did not significantly stabilize uPA mRNA
(Fig 1C). A similar induction of uPA and RAR was observed in human
aortic endothelial cells (Fig 1D). These results imply that
the induction of uPA mRNA by RA is due to upregulation of uPA gene
expression, which is dependent on new protein synthesis, and might be
promoted by RARs, initially in particular by RAR . To address the
role of RARs, we examined the effect of subtype-specific agonists and antagonists (Fig 2). The agonists and
antagonists used here have different receptor selectivities and can
bind to and transactivate either RARs or RXRs or one of receptor
subtypes (eg, , , or ).16-23 Agonists
capable of binding to and activating RAR enhanced cellular PA levels
almost identically (Fig 2A, panels a through d), whereas RAR - or
RAR -selective agonists showed a much weaker effect (Fig 2A, panels e
and f, respectively). RXR-selective agonists administered alone were
not effective (Fig 2A, panels g and h) and weakly inhibited uPA
induction when combined with atRA (Fig 2A, panel i). The enhancement of
cellular PA levels by atRA, Ch55, and Am580 was abolished by both the
RAR - and RAR -selective antagonists (Fig 2B). The specificities of
the agonists and antagonists to discriminate RARs and RXRs from each
other are strict, whereas those to discriminate each receptor subtype
are relatively low (ie, 10-to 100-fold specific). So, these data
suggest the involvement of RARs in uPA induction. To confirm the
involvement of RARs in uPA transcription, transfection studies were
performed with the uPA promoter-luciferase and RARs and/or RXRs
expressing vectors (Fig 3A). Luciferase
activity was enhanced 1.2-fold after treatment with atRA (sample 2). A
significant increase (~3-fold) was induced when cells were
cotransfected with either RAR or RXR (samples 3 and 5,
respectively). Their effects were dose-dependent, and a similar effect
was obtained with other isoforms (data not shown). Cotransfection with
RAR plus RXR gave the largest increase (~9-fold; sample 7).
Interestingly, these enhancing effects were not dependent on the
presence of ligands (samples 4, 6, 8, and 9), although ligand
dependence was observed in a parallel experiment in which DR5-luciferase was used as reporter (Fig 3B). Collectively, the above-noted results suggest that RA causes induction of RAR as well
as RAR in endothelial cells, which leads to enhanced uPA transcription with the help of RXRs.




View larger version (194K):
[in this window]
[in a new window]
| Fig 1.
Induction of uPA and RARs by RA in endothelial cells. (A)
Cell lysates were prepared from confluent BAEC cultures after the
cultures had been incubated in MEM-BSA with 1 µmol/L atRA for
varying lengths of time. Total RNA was isolated from cell lysates, and
the changes in uPA mRNA levels as well as RARs and RXRs mRNA levels
were assessed by Northern blotting as described in Materials and
Methods. (B) After BAECs were treated for the indicated times with 1 µmol/L atRA in the absence or presence of 6 µg/mL cycloheximide
(CHX), changes in uPA mRNA levels were determined by Northern blotting.
(C) After exposure to either vehicle or 1 µmol/L atRA for 12 hours,
BAECs were treated for the indicated times with 1 µg/mL actinomycin
D. The rate of disappearance of uPA mRNA was determined by Northern
blotting. Because mRNA for GAPDH also decreased along with incubation
with actinomycin D, we presented ethidium bromide-labeled 28S RNA as
internal. (D) Northern analyses were performed using total RNA isolated
from human aortic endothelial cells treated with 1 µmol/L atRA for 12 hours.
|
|


View larger version (62K):
[in this window]
[in a new window]
| Fig 2.
Induction of uPA in BAECs by RAR-activating retinoids.
Cellular PA levels were determined using a chromogenic substrate,
S2403, after treatment of BAECs for 12 hours in MEM-BSA either with
(A) various concentrations of atRA (panel a), 9cRA (panel b), Ch55
(panel c), Am580 (panel d), CD2019 (panel e), CD666 (panel f),
Ro47-5944 (panel g), and Ro25-7386 (panel h) or with a combination of
various concentrations of atRA and 0.1 µmol/L Ro47-5944 (panel i) or
(B) with 10 8 mol/L atRA (sample 2), Ch55 (sample 3), and
Am580 (sample 4) in the absence or presence of 10 5 mol/L
Ro41-5253 ( ) or LE135 ( ). The specificity and characterization of
each compound are described under Materials and Methods. Data are
expressed as urokinase (UK) units (U) per milligram of protein in the
sample. Each point represents the average ± SD (n = 3).
|
|

View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Enhancement of uPA promoter transactivation activity by
RAR and RXR . BAECs were cotransfected with UK promoter-luciferase
(0.4 µg/dish; A) or DR5-luciferase (0.4 µg/dish; B) plus RAR
and/or RXR expressing vectors (250 ng each/dish), along with pRL-CMV
(Renilla luciferase, 100 ng/dish) as described in Materials and
Methods. Total DNA transfected was adjusted to 1.225 µg/dish with
pSG5. The next day of transfection, the cells were treated or untreated
with 1 µmol/L atRA or 9cRA for 12 hours. Luciferase activity of each
cell was measured using the Dual-Luciferase Reporter Assay System, and
changes in firefly luciferase activity were calculated and plotted
after normalization to Renilla luciferase activity. Sample 1, reporter only; sample 2, atRA; sample 3, RAR ; sample 4, RAR + atRA; sample 5, RXR ; sample 6, RXR + 9cRA; sample 7, RAR and
RXR ; sample 8, RAR and RXR + atRA; sample 9, RAR and
RXR + 9cRA. Each number represents the average ± SD (n = 3). Each similar experiment was repeated three times and
representative results are shown here.
|
|
Involvement of Sp1 in RA induction of uPA.
Computer analyses have shown that the uPA promoter used for the
reporter assays does not contain any hitherto known RAREs, suggesting
that RARs and or RXRs must transactivate the uPA promoter by a unique
mechanism such as the interaction between RARs/RXRs and other
transcription factors. Recently, Safe et al have reported that estrogen
receptor, another member of the nuclear hormone receptor super family,
physically interacts with the ubiquitous transcription factor Sp1 and
regulates the transactivation of its target genes.36,37 We
noticed that promoters of RA-inducible genes, including uPA, uPA
receptor, and transglutaminase, contain GC boxes,30,38,39
the cognate binding motif for Sp1.40 Therefore, we
hypothesized that RARs/RXRs might also physically interact with Sp1 and
regulate transactivation of uPA promoter. To explore this idea, we
first examined whether Sp1 might be involved in the enhancing effect of
RAR/RXR on uPA promoter transactivation. We used three different uPA
promoter-luciferase constructs, including wild-type uPA promoter
(pUK-Luc) or its mutants, either containing only GC and TATA boxes (pUK
GC-Luc) or deficient in GC boxes (pUK GC-Luc). As shown in
Fig 4A, the basal activities of pUK GC-Luc (sample 4) and pUK GC-Luc (sample 7) were, respectively, 93% and
27% of that of the wild-type pUK-Luc (sample 1), indicating the
importance of GC box region for driving basal transactivation of uPA
gene, as already reported previously.30 Transfection with
RAR /RXR uniformly enhanced the transactivation of these three
constructs, suggesting a potential existence of RAR/RXR responsible
element(s) in both GC box and out-of-GC box regions within the uPA
promoter. However, the majority of enhancing effects by RAR/RXR on
pUK-Luc was reproduced in pUK GC-Luc (samples 5 and 6), implying that
Sp1 might be involved in RA induction of uPA. We, therefore, examined
this possibility by modifying Sp1 function in two ways. First, we found
that the Sp1 decoy, a 32-mer oligonucleotide, the sequence of which was
derived from the uPA GC box, dose-dependently reduced the induction of
uPA levels (Fig 4B, curve b), whereas an oligonucleotide containing the
mutated Sp1 site had no effect (Fig 4B, curve a). The action of the Sp1 decoy was specific. It did not block the binding of other transcription factors, including RAR, and did not influence cell viability (data not
shown). A similar suppression was obtained when cells were treated with
mithramycin (Fig 4C, curve b), a specific inhibitor of the binding of
Sp1 to the GC box (Fig 4D).41-43 The concentration of
mithramycin used under the current experimental condition was not toxic
to the cells, and the specificity of mithramycin has been ensured in
the previous report.41,43 Collectively, these results
suggest that RA induction of uPA is dependent on Sp1 in addition to
RARs/RXRs.




View larger version (74K):
[in this window]
[in a new window]
| Fig 4.
Involvement of Sp1 in RA induction of uPA. (A) Promoter
assay. Transfection study was performed as described before using
wild-type pUK-luciferase (pUK-Luc, samples 1 through 3), pUK GC
box-luciferase (pUK GC-Luc, samples 4 through 6), and pUK-luciferase
deficient in GC box (pUK GC-Luc, samples 7 through 9). Data are
expressed as the relative luciferase activity compared with the
activity of pUK-Luc cotransfected with empty pSG5 and untreated with
9cRA (sample 1). Samples 1, 4, and 7, reporter only; samples 2, 5, and
8, RAR and RXR ; samples 3, 6, and 9, RAR and RXR + 9cRA.
(B) Transcription factor decoy experiments. After BAECs were
transfected with various amounts of Sp1 decoy or its mutant, whose
sequences are presented above the illustration, the cultures were
incubated either with vehicle or with 1 µmol/L atRA for 12 hours,
cell lysates were prepared, and cellular PA levels were determined.
Curves a and b, RA-treated cells; curves c and d, unstimulated cells.
Curves a and d, mutant oligo; curves b and c, Sp1 decoy. (C) Cellular
PA levels were determined after treatment of BAEC cultures with various
concentrations of atRA for 12 hours in the absence (curve a) or
presence (curve b) of 10 nmol/L mithramycin. For (A) through (C), the
results are presented by the average ± SD (n = 3). Each similar
experiment was repeated three times and representative results are
shown here. (D) After treatment of BAECs with 1 µmol/L atRA for 12 hours in the absence (lane 1) or presence (lane 2) of 10 nmol/L
mithramycin, nuclear extracts were prepared and Sp1 binding to uPA GC
box was determined by gel shift assays as described in Materials and
Methods.
|
|
Physical interaction between RARs/RXRs and Sp1.
We next explored whether RARs/RXRs and Sp1 would interact physically.
Figure 5A shows the results of
immunoprecipitation studies. Sp1 was coprecipitated with either
anti-RAR or RXR antibody, only in the presence of RAR (lane 4) or
RXR (lane 5), but not in their absence (lanes 6 and 7), suggesting a
physical interaction between RAR /RXR and Sp1. The physical
interaction was also observed for 35S-labeled Sp1 in
reticulocyte lysates incubated with RAR -GST (Fig 5B) as well as for
Sp1 incubated with RAR/RXR present in BAEC nuclear extracts (Fig 5C).
The physical interaction between RAR/RXR and Sp1 was further supported
by the results of the mammalian two-hybrid assays (Fig 5D).
Transactivation by Sp1 of Gal4-UAS-luciferase was potentiated by
cotransfection with RAR and/or RXR (samples 3, 5, and 7),
suggesting a direct interaction between RAR /RXR with Sp1 in vivo.
Again, in this assay, obvious ligand dependence was not observed for
RAR (sample 4). However, RXR alone or RAR /RXR showed some
ligand dependence (samples 6, 8, and 9). Similar results were obtained
for other subtypes of RARs/RXRs (data not shown).




View larger version (101K):
[in this window]
[in a new window]
| Fig 5.
Physical interaction between RAR /RXR and Sp1. (A)
After the mixture of Sp1 plus either RAR or RXR was incubated,
respectively, with anti-RAR or RXR antibody at 4°C for 2 hours,
proteins were precipitated with protein A-Sepharose, eluted, and
analyzed by Western blotting with anti-Sp1 antibody. Lanes 1 through 3, pure proteins; lane 1, Sp1; lane 2, RAR ; lane 3, RXR . Lanes 4 through 7, proteins precipitated with anti-RAR or RXR antibody; lane 4, Sp1 preincubated together with RAR and precipitated with anti-RAR
antibody; lane 5, Sp1 preincubated together with RXR and
precipitated with anti-RXR antibody; lane 6, Sp1 incubated with
anti-RAR antibody without RAR ; lane 7, Sp1 incubated with anti-RXR
antibody without RXR . (B) 35S-labeled Sp1 protein
generated by in vitro translation reaction was incubated with GST or
RAR -GST immobilized on glutathione-Sepharose beads. After extensive
washings, the bound proteins were eluted and subjected to SDS-PAGE
followed by autoradiography. Lane 1 input (0.5 µL of the total
reaction mixture); lane 2, proteins bound to GST; lane 3, proteins
bound to RAR -GST. (C) After the mixture of Sp1 and RAR /RXR was
incubated with nonimmune antibody or anti-RXR antibody in BAEC nuclear
extracts at 4°C overnight, proteins were precipitated with protein
A-Sepharose, eluted, and analyzed by Western blotting with anti-Sp1
antibody. Lane 1, pure Sp1; lane 2, proteins precipitated with
nonimmune (NI) antibody; lane 3, proteins precipitated with anti-RXR
antibody. (D) BAECs were cotransfected with a combination of Sp1-Gal4
expressing vector (0.125 µg/dish) and Gal4-UAS-luciferase (0.5 µg/dish), plus RAR and/or RXR expressing vectors (250 ng
each/dish), along with pRL-CMV (100 ng/dish; Promega) as described
before. The day after transfection, the cells were treated or untreated
with 1 µmol/L atRA or 9cRA for 12 hours. Luciferase activity of each
cell was measured, and relative changes in firefly luciferase activity
were plotted after normalization to Renilla luciferase
activity. Sample 1, reporter only; sample 2, atRA; sample 3, RAR ;
sample 4, RAR + atRA; sample 5, RXR ; sample 6, RXR + 9cRA;
sample 7, RAR and RXR ; sample 8, RAR and RXR + atRA;
sample 9, RAR and RXR + 9cRA. Each number represents the
average ± SD (n = 3). A similar experiment was repeated three times
and representative results are shown here.
|
|
Using gel shift assays, we next examined whether the direct interaction
between RAR/RXR and Sp1 affected the ability of Sp1 to bind to DNA. We
tested the effect of RAR on the binding of various amounts of Sp1 to
both the uPA GC box and consensus GC box. As shown in
Fig 6A, RAR
potentiated the binding of Sp1 to both GC box sequences. The binding of
Sp1 to these GC boxes was dose-dependent and drew a sigmoid curve, and
RAR functioned to shift this curve toward lower concentration range.
Namely, when the basal Sp1 (DNA binding) activity was low, the
potentiating effect became large, whereas when the basal activity was
high, the potentiating effect was small. A similar potentiating effect was obtained with RXR administered either alone or in combination with RAR (Fig 6B, lanes 7 and 9). RAR and RXR either alone or
in combination did not bind to the uPA GC box (Fig 6B, lanes 4, 6, and
8), suggesting that RAR/RXR binding to DNA is not required for exertion
of synergism. The potentiating effect of RAR /RXR on Sp1 binding
was not influenced by adding atRA or 9cRA (Fig 6C, lanes 5 or 6). No
RAR-Sp1 or RXR-Sp1 complex was detected, as judged from supershift
experiments (Fig 6C, lanes 8 through 11). The detected band was
supershifted with anti-Sp1 antibody (lane 8) but not with anti-RAR
antibody and/or anti-RXR antibody (lanes 9 through 11), suggesting that
the increased band detected does not contain RAR /RXR . We cannot
explain this reason, but predict that probably affinity between RAR/RXR
and Sp1 might be relatively weak compared with the interaction between
RAR and RXR,1,2,44,45 as observed for association between
RAR/RXR and coactivator or corepressor.4-7 Hence, although
Sp1 bound to increased numbers of radiolabeled uPA GC box after
physical interaction with RAR and/or RXR , RAR-Sp1 and RXR-Sp1
associations could be disrupted during electrophoresis. In fact, when
we performed the immunoprecipitation from the mixture containing RAR,
Sp1, and radiolabeled uPA GC box oligonucleotide, we succeeded in
detecting specific radioactivity in anti-RAR antibody-precipitated
fraction. This radioactivity represents a specific binding of Sp1 to
uPA GC box, suggesting that RAR, Sp1, and radiolabeled uPA GC box may
form complexes in solution. The potentiating effect on Sp1 binding was
not observed when BSA was used instead of RARs/RXRs (data not shown).
We observed a similar result when comparing the binding of endogenous
Sp1 present in the nuclear extract of control versus RARs transfected
cells (data not shown). Collectively, these results suggest that
physical interaction between RARs/RXRs and Sp1 may potentiate Sp1
binding to the uPA GC box and enhance uPA transcription. Finally, we
confirmed this potentiation by a cotransfection experiment. When
transcriptional activity of the uPA promoter was enhanced about
fivefold by transfection of either Sp1 or RAR /RXR alone,
cotransfection of these resulted in a 17-fold increase in activity.



View larger version (143K):
[in this window]
[in a new window]
| Fig 6.
Potentiation of Sp1 binding to uPA GC box by RAR
and/or RXR . (A) After Sp1 (10 to 20 ng) was preincubated in the
absence or presence of RAR -GST (200 ng), the reaction mixture was
incubated with 32P-labeled uPA GC box or consensus GC box,
and thereafter protein-DNA complexes were separated by a 4%
polyacrylamide gel electrophoresis and visualized on an image analyzer.
Odd numbers, Sp1 alone; even numbers, Sp1 plus RAR . (B) Gel shift
analyses were performed as before using both RAR -GST and RXR -GST.
Lane 1, Sp1 (10 ng) alone; lane 2, GST alone; lane 3, Sp1 plus GST;
lane 4, RAR alone; lane 5, Sp1 plus RAR ; lane 6, RXR alone;
lane 7, Sp1 plus RXR ; lane 8, RAR and RXR ; lane 9, Sp1 plus
RAR /RXR . (C) Control experiments. Lane 1, control (Sp1 [10 ng]
plus RAR /RXR ); lane 2, + 20-fold excess of unlabeled
oligonucleotide (cold); lane 3, + 50-fold excess of unlabeled
oligonucleotide (cold); lane 4, + 0.5% ethanol (vehicle); lane 5, + 1 µmol/L atRA; lane 6, + 1 µmol/L 9cRA; lane 7, + nonimmune (NI) antibody (IgG); lane 8, + anti-Sp1 IgG; lane 9, + anti-RAR IgG; lane 10, + anti-RXR IgG; lane 11, + both anti-RAR IgG
and anti-RXR IgG. The final concentration of each antibody was 80 µg/mL.
|
|
 |
DISCUSSION |
First, we demonstrated that RARs potentiate transactivation of the uPA
gene, which lacks a canonical RARE, with help of RXRs. Interestingly,
this effect appeared to be ligand-independent, suggesting a novel
underlying mechanism. In support of this idea, we next demonstrated
that RARs/RXRs directly interact with Sp1 and enhance transactivation
of the uPA promoter, at least in part, by potentiating the binding of
Sp1 to the uPA GC box. The result shown in Fig 6A suggests that the
effect of RAR/RXR we found is a more general effect on Sp1-mediated
transcription. The result shown in Fig 3A is thought to reflect the
synergism between endogenous Sp1 and transfected RARs/RXRs. We cannot
explain the discrepancy in ligand dependency among different
experimental settings, eg, reporter assays (Figs 3A and 4A; apparent
independence), two-hybrid assays (Fig 5D; partial dependence), and gel
shift assays (Fig 6C; apparent independence). If the
ligand-independence of the RAR/RXR-Sp1 effect is genuine, then the
question arises as to which factor is responsible for the RA-dependency
in uPA induction by RA. One likely answer is that at the very least RA
is needed to increase RARs in the cells, although there are many other
possibilities. RAR/RXR may act predominantly to strengthen the weak Sp1
binding. Alternatively, RAR/RXR may act both increasing Sp1 binding and enhancing the transcription of Sp1. We predict that effects on DNA
binding may be ligand independent, whereas effects on transactivation may be ligand dependent.
We demonstrated that RAR /RXR enhanced the transactivation of the
wild-type uPA promoter-luciferase construct approximately sixfold (Fig
4A) and that of Gal4-UAS-luciferase construct about 25- to 30-fold in
the mammalian two-hybrid system (Fig 5D). This difference can be
explained as follows. As can be seen in Fig 6A, the binding of Sp1 to
the GC box is dose-dependent and draws a sigmoid curve, and RAR/RXR
function to shift this curve toward lower concentration range. Namely,
when the basal Sp1 (DNA binding) activity is low, the potentiating
effect becomes large, whereas when the basal activity is high, the
potentiating effect is small. A similar theory can be said for reporter
assays. The basal activity of the Gal4-UAS-luciferase is
low, because, theoretically, only Gal4 fusion protein is able to
transactivate this reporter gene. In contrast, the full-length uPA
promoter-luciferase is transactivated to some extent by endogenous Sp1
as well as other transcription factors. Therefore, the potentiating
effect of RAR/RXR is more dominant in the former assays compared with
the latter assays.
The three subtypes of RARs seem to share equivalent ability in terms of
interacting with and potentiating Sp1. Therefore, the dominant function
of each subtype may be determined by the nature of the subtype
expressed at a particular time. Under the present conditions,
endothelial cells expressed RAR and RAR initially, whereas the
expression of RAR and RAR was dramatically increased upon
stimulation. The results showing that the expression of RAR and
RAR increased and that specific antagonists of these factors blocked
the induction of uPA indicate the participation of RAR and RAR ,
but fail to elucidate a role for RAR . Although the contribution of
RAR appeared to be minimal, judging by the results obtained using
the RAR -selective agonist (Fig 2A, panel f), our data do not rule
out the involvement of RAR in this system, especially after 12 hours, when the expression of RAR and RAR started to decrease, in
contrast to the expression of RAR , which started to increase (Fig
1A). Complementary expression of RAR and RAR has been reported in
the developing mouse embryo.46-48 A similar argument can be
raised about the role of RXRs. Although the expression of RXR /
did not change as observed for RAR / (Fig 1A) and RXR-selective
retinoids were ineffective in enhancing uPA expression by BAECs
(Fig 2A, panels g through i), RXRs themselves were capable of
interacting with (Fig 5) and potentiating Sp1 binding (Fig 6) and
stimulating uPA transactivation (Fig 3), both alone and in combination
with RARs. This discrepancy could be explained partly because
RXR-selective retinoids were unable to induce RARs nor RXRs in BAEC
cultures (data not shown). The involvement of RAR and RXR / in
our system could be verified by examining the effect of an RAR or
RXR / -specific antagonist, if such molecules could be obtained.
Recently, Piedrafita and Pfahl49 reported that specific
degradation of Sp1 occurs in apoptic T cells after treatment with a
relatively high concentration of RAR -specific retinoids, whereas RA
showed no significant effect. Because we used RA on endothelial cells,
our system is different.
The functional interaction between RARs/RXRs and Sp1 has previously
been described for the RA induction of the retinol-binding protein
gene.50 However, in this case, RARs and Sp1 bind to the
RARE and GC box, respectively, and function synergistically. On the
other hand, a physical interaction between Sp1 and other members of the
nuclear receptor family has been reported.36,37,51,52 The
current study provides an initial evidence that RARs/RXRs also
physically and functionally interact with Sp1 and enhance its binding
affinity for target DNA without any need for binding of RARs/RXRs to
RARE. Although we found that RAR/RXR-Sp1 interaction occurs in a tube
in the absence of ligands, we cannot exclude the possibility that
physiological interaction was dependent on a low concentration of RA
that we may not have been able to eliminate from the serum
(<10 10 mol/L). It is also possible that endogenous
RARs/RXRs require ligand to keep corepressors away and to associate
with Sp1, whereas large numbers of exogenously transfected RARs/RXRs
might be free from limited numbers of corepressors and therefore might
not require a ligand.
Several important issues remain unresolved: (1) It might be possible
that RAR/RXR-Sp1 interaction not only potentiates Sp1-mediated transcription, but also allows RAR/RXR to drive transcription by
enabling binding to the GC box via Sp1. Figure 5D demonstrates RAR
and RXR enhancement of the transcriptional activity of a chimeric
transcription factor, Sp1-Gal4, suggesting that RAR/RXR alter the
transactivation domain of Sp1 and/or bind to Sp1-activation domain and
confer their transactivation activity. (2) We predict that RARs may act
as allosteric effectors that change the conformation of Sp1. Thus, it
will be important to determine the nature of the change in Sp1
structure induced by binding to RARs/RXRs that is responsible for
increased binding to GC box. (3) It will also be important to elucidate
whether other nuclear factors, including corepressors and coactivators,
modulate the RAR/RXR-Sp1 interaction. (4) Finally, because functional
repression of gene expression through interaction between RAR and AP-1,
NF-IL6, or Myb has been reported,53-55 one may ask whether
the RAR/RXR-Sp1 interaction affects other transcription factors shown
to be important for basal as well as induced transcription from the uPA
gene, such as Egr-1, PEA3, NF- B, CREB, UEF1-4, and
AP-1.56-59 We are now trying to map the binding site(s) in
both RAR and Sp1 molecules as the first step towards answering these questions.
 |
ACKNOWLEDGMENT |
The authors thank F. Blasi and S.L. Friedman for helpful advice and
critical reading of the manuscript; S. Michel, M. Klaus, W.-D.
Schleuning, J.T. Kadonaga, S. Kato, and P. Chambon for reagents and
constructs; and C. Iijima, M. Yoshizawa, and S. Hayashi for technical assistance.
 |
FOOTNOTES |
Submitted September 15, 1998; accepted February 8, 1999.
Supported partly by Grant-in-Aids from the Ministry of Education,
Science, Sports and Culture (10780395), Grant-in-Aids from Tokyo
Biochemical Research Foundation, Grants for "Biodesign Research Program" and "Multibioprobe Research Program" from RIKEN, and The Sumitomo Foundation.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Soichi Kojima, PhD, Laboratory of Molecular
Cell Sciences, Tsukuba Life Science Center, The Institute of Physical
and Chemical Research (RIKEN), Koyadai, Tsukuba, Ibaraki 305-0074, Japan; e-mail: kojima{at}rtc.riken.go.jp.
 |
REFERENCES |
1.
Chambon P:
A decade of molecular biology of retinoic acid receptors.
FASEB J
10:940, 1996[Abstract]
2.
Mangelsdorf DJ, Evans RM:
The RXR heterodimers and orphan receptors.
Cell
83:841, 1995[Medline]
[Order article via Infotrieve]
3.
Sucov HM, Murakami KK, Evans RM:
Characterization of an autoregulated response element in the mouse retinoic acid receptor type gene.
Proc Natl Acad Sci USA
87:5392, 1990[Abstract/Free Full Text]
4.
Chen JD, Evans RM:
A transcriptional co-repressor that interacts with nuclear hormone receptors.
Nature
377:454, 1995[Medline]
[Order article via Infotrieve]
5.
Lin RJ, Nagy L, Inoue S, Shao W, Miller WH Jr, Evans RM:
Role of the histone deacetylase complex in acute promyelocytic leukaemia.
Nature
391:811, 1998[Medline]
[Order article via Infotrieve]
6.
Oñate SA, Tsai SY, Tsai M-J, O'Malley BW:
Sequence and characterization of a coactivator for the steroid hormone receptor superfamily.
Science
270:1354, 1995[Abstract/Free Full Text]
7.
Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG:
The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function.
Nature
387:677, 1997[Medline]
[Order article via Infotrieve]
8.
Bachmann F:
The plasminogen-plasmin enzyme system, in
Colman RW,
Hirsh J,
Marder VJ,
Salzman EW
(eds):
Hemostasis and Thrombosis: Basic Principles and Clinical Practice (ed 3). Philadelphia, PA, Lippincott, 1994, p 1592.
9.
Hajjar KA, Nachman RL:
The human endothelial cell plasmin-generating system, in
Colman RW,
Hirsh J,
Marder VJ,
Salzman EW
(eds):
Hemostasis and Thrombosis: Basic Principles and Clinical Practice (ed 3). Philadelphia, PA, Lippincott, 1994, p 823.
10.
Imai S, Okuno M, Moriwaki H, Muto Y, Murakami K, Shudo K, Suzuki Y, Kojima S:
9,13-di-cis-retinoic acid induces the production of tPA and activation of latent TGF- via RAR in a human liver stellate cell line, LI90.
FEBS Lett
411:102, 1997[Medline]
[Order article via Infotrieve]
11.
Kojima S, Inui T, Muramatsu H, Suzuki Y, Kadomatsu K, Yoshizawa M, Hirose S, Kimura T, Sakakibara S, Muramatsu T:
Dimerization of midkine by tissue transglutaminase and its functional implication.
J Biol Chem
272:9410, 1997[Abstract/Free Full Text]
12.
Kojima S, Muramatsu H, Amanuma H, Muramatsu T:
Midkine enhances fibrinolytic activity of bovine endothelial cells.
J Biol Chem
270:9590, 1995[Abstract/Free Full Text]
13.
Kojima S, Nara K, Rifkin DB:
Requirement for transglutaminase in the activation of latent transforming growth factor- in bovine endothelial cells.
J Cell Biol
121:439, 1993[Abstract/Free Full Text]
14.
Krätzschmar J, Haendler B, Kojima S, Rifkin DB, Schleuning W-D:
Bovine urokinase-type plasminogen activator and its receptor: Cloning and induction by retinoic acid.
Gene
125:177, 1993[Medline]
[Order article via Infotrieve]
15.
Okuno M, Moriwaki H, Imai S, Muto Y, Kawada N, Suzuki Y, Kojima S:
Retinoids exacerbate rat liver fibrosis by inducing the activation of latent TGF- in liver stellate cells.
Hepatology
26:913, 1997[Medline]
[Order article via Infotrieve]
16.
Kagechika H, Kawachi E, Hashimoto Y, Himi T, Shudo K:
Retinobenzoic acids. 1. Structure-activity relationships of aromatic amides with retinoidal activity.
J Med Chem
31:2182, 1988[Medline]
[Order article via Infotrieve]
17.
Kagechika H, Himi T, Namikawa K, Kawachi E, Hashimoto Y, Shudo K:
Retinobenzoic acids. 3. Structure-activity relationships of retinoidal azobenzene-4-carboxylic acids and stilbene-4-carboxylic acids.
J Med Chem
32:1098, 1989[Medline]
[Order article via Infotrieve]
18.
Eyrolles L, Kagechika H, Kawachi E, Fukasawa H, Iijima T, Matsushima Y, Hashimoto Y, Shudo K:
Retinobenzoic acids. 6. Retinoid antagonists with a heterocyclic ring.
J Med Chem
37:1508, 1994[Medline]
[Order article via Infotrieve]
19.
Gianni' M, Zanotta S, Terao M, Garattini S, Garattini E:
Effects of synthetic retinoids and retinoic acid isomers on the expression of alkaline phosphatase in F9 teratocarcinoma cells.
Biochem Biophys Res Commun
196:252, 1993[Medline]
[Order article via Infotrieve]
20.
Bernard BA, Bernardon J-M, Delescluse C, Martin B, Lenoir M-C, Maignan J, Charpentier B, Pilgrim WR, Reichert U, Shroot B:
Identification of synthetic retinoids with selectivity for human nuclear retinoic acid receptor .
Biochem Biophys Res Commun
186:977, 1992[Medline]
[Order article via Infotrieve]
21.
Rusten LS, Dybedal I, Blomhoff HK, Blomhoff R, Smeland EB, Jacobsen SEW:
The RAR-RXR as well as the RXR-RXR pathway is involved in signaling growth inhibition of human CD34+ erythroid progenitor cells.
Blood
87:1728, 1996[Abstract/Free Full Text]
22.
Kanatani Y, Makishima M, Asahi K, Sakurai A, Takahashi N, Motoyoshi K, Nagata N, Honma Y:
Differanisole A, a novel antitumor antibiotic, enhances growth inhibition and differentiation of human myeloid leukemia cells induced by 9-cis retinoic acid.
Biochim Biophys Acta
1359:71, 1997[Medline]
[Order article via Infotrieve]
23.
Apfel C, Bauer F, Crettaz M, Forni L, Kamber M, Kaufmann F, Lemotte P, Pirson W, Klaus M:
A retinoic acid receptor antagonist selectively counteracts retinoic acid effects.
Proc Natl Acad Sci USA
89:7129, 1992[Abstract/Free Full Text]
24.
Benbrook D, Lernhardt E, Pfahl M:
A new retinoic acid receptor identified from a hepatocellular carcinoma.
Nature
333:669, 1988[Medline]
[Order article via Infotrieve]
25.
Brand N, Petkovich M, Krust A, Chambon P, de Thé H, Marchio A, Tiollais P, Dejean A:
Identification of a second human retinoic acid receptor.
Nature
332:850, 1988[Medline]
[Order article via Infotrieve]
26.
Krust A, Kastner P, Petkovich M, Zelent A, Chambon P:
A third human retinoic acid receptor, hRAR- .
Proc Natl Acad Sci USA
86:5310, 1989[Abstract/Free Full Text]
27.
Leid M, Kastner P, Lyons R, Nakshatri H, Saunders M, Zacharewski T, Chen J-Y, Staub A, Garnier J-M, Mader S, Chambon P:
Purification, cloning, and RXR identity of the Hela cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently.
Cell
68:377, 1992[Medline]
[Order article via Infotrieve]
28.
Chomczynski P, Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
29.
Sambrook J, Fritsch EF, Maniatis T:
Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989.
30.
Verde P, Boast S, Franzè A, Robbiati F, Blasi F:
An upstream enhancer and a negative element in the 5' flanking region of the human urokinase plasminogen activator gene.
Nucleic Acids Res
16:10699, 1988[Abstract/Free Full Text]
31.
Kato S, Sasaki H, Suzawa M, Masushige S, Tora L, Chambon P, Gronemeyer H:
Widely spaced, directly repeated PuGGTCA elements act as promiscuous enhancers for different classes of nuclear receptors.
Mol Cell Biol
15:5858, 1995[Abstract]
32.
Gill G, Pascal E, Tseng ZH, Tjian R:
A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation.
Proc Natl Acad Sci USA
91:192, 1994[Abstract/Free Full Text]
33.
Nagy L, Tontonoz P, Alvarez JGA, Chen H, Evans RM:
Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR .
Cell
93:229, 1998[Medline]
[Order article via Infotrieve]
34.
Kadonaga JT, Courey AJ, Ladika J, Tjian R:
Distinct regions of Sp1 modulate DNA binding and transcriptional activation.
Science
242:1566, 1988[Abstract/Free Full Text]
35.
Dey A, Minucci S, Ozato K:
Ligand-dependent occupancy of the retinoic acid receptor 2 promoter in vivo.
Mol Cell Biol
14:8191, 1994[Abstract/Free Full Text]
36.
Duan R, Porter W, Safe S:
Estrogen-induced c-fos protooncogene expression in MCF-7 human breast cancer cells: Role of estrogen receptor Sp1 complex formation.
Endocrinology
139:1981, 1998[Abstract/Free Full Text]
37.
Sun G, Porter W, Safe S:
Estrogen-induced retinoic acid receptor 1 gene expression: role of estrogen receptor-Sp1 complex.
Mol Endocrinol
12:882, 1998[Abstract/Free Full Text]
38.
Soravia E, Grebe A, De Luca P, Helin K, Suh TT, Degen JL, Blasi F:
A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene.
Blood
86:624, 1995[Abstract/Free Full Text]
39.
Lu S, Saydak M, Gentile V, Stein JP, Davies PJA:
Isolation and characterization of the human tissue transglutaminase gene promoter.
J Biol Chem
270:9748, 1995[Abstract/Free Full Text]
40.
Dynan WS, Tjian R:
Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II.
Cell
32:669, 1983[Medline]
[Order article via Infotrieve]
41.
Greenwel P, Inagaki Y, Hu W, Walsh M, Ramirez F:
Sp1 is required for the early response of 2(I) collagen to transforming growth factor- 1.
J Biol Chem
272:19738, 1997[Abstract/Free Full Text]
42.
Carpenter ML, Marks JN, Fox KR:
DNA-sequence binding preference of the GC-selective ligand mithramycin. Deoxyribonuclease-I/deoxyribonuclease-II and hydroxy-radical footprinting at CCCG, CCGC, CGGC, GCCC and GGGG flanked by (AT)n and An·Tn.
Eur J Biochem
215:561, 1993[Medline]
[Order article via Infotrieve]
43.
Nehls MC, Brenner DA, Gruss H-J, Dierbach H, Mertelsmann R, Herrmann F:
Mithramycin selectively inhibits collagen- 1(I) gene expression in human fibroblast.
J Clin Invest
92:2916, 1993
44.
Rastinejad F, Perlmann T, Evans RM, Sigler PB:
Structural determinants of nuclear receptor assembly on DNA direct repeats.
Nature
375:203, 1995[Medline]
[Order article via Infotrieve]
45.
Renaud J-P, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D:
Crystal structure of the RAR- ligand-binding domain bound to all-trans retinoic acid.
Nature
378:681, 1995[Medline]
[Order article via Infotrieve]
46.
Dolle P, Ruberte E, Leroy P, Morris-Kay G, Chambon P:
Retinoic acid receptors and cellular retinoid binding proteins. I. A systematic study of their differential pattern of transcription during mouse organogenesis.
Development
110:1133, 1990[Abstract/Free Full Text]
47.
Ruberte E, Dolle P, Chambon P, Morris-Kay G:
Retinoic acid receptors and cellular retinoid binding proteins. II. Their differential pattern of transcription during early morphogenesis in mouse embryos.
Development
111:45, 1991[Abstract]
48.
Ruberte E, Friederich V, Chambon P, Morris-Kay G:
Retinoic acid receptors and cellular retinoid binding proteins. III. Their differential transcript distribution during mouse nervous system development.
Development
118:267, 1993[Abstract]
49.
Piedrafita FJ, Pfahl M:
Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.
Mol Cell Biol
17:6348, 1997[Abstract]
50.
Panariello L, Quadro L, Trematerra S, Colantuoni V:
Identification of a novel retinoic acid response element in the promoter region of the retinol-binding protein gene.
J Biol Chem
271:25524, 1996[Abstract/Free Full Text]
51.
Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB:
Progesterone regulates transcription of the p21WAF1 cyclin-dependent kinase inhibitor gene through Sp1 and CBP/p300.
J Biol Chem
273:10696, 1998[Abstract/Free Full Text]
52.
Rohr O, Aunis D, Schaeffer E:
COUP-TF and Sp1 interact and cooperate in the transcriptional activation of the human immunodeficiency virus type 1 long terminal repeat in human microglial cells.
J Biol Chem
272:31149, 1997[Abstract/Free Full Text]
53.
Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S-C, Heyman RA, Rose DW, Glass CK, Rosenfeld MG:
A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors.
Cell
85:403, 1996[Medline]
[Order article via Infotrieve]
54.
Nagpal S, Cai J, Zheng T, Patel S, Masood R, Lin GY, Friant S, Johnson A, Smith DL, Chandraratna RAS, Gill PS:
Retinoid antago-nism of NF-IL6: Insight into the mechanism of antiproliferative effects of retinoids in Kaposi's sarcoma.
Mol Cell Biol
17:4159, 1997[Abstract]
55.
Pfitzner E, Kirfel J, Becker P, Rolke A, Schüle R:
Physical interaction between retinoic acid receptor and the oncoprotein Myb inhibits retinoic acid-dependent transactivation.
Proc Natl Acad Sci USA
95:5539, 1998[Abstract/Free Full Text]
56.
Khachigian LM, Lindner V, Williams AJ, Collins T:
Egr-1-induced endothelial gene expression: A common theme in vascular injury.
Science
271:1427, 1996[Abstract]
57.
Berthelsen J, Vandekerkhove J, Blasi F:
Purification and characterization of UEF3, a novel factor involved in the regulation of the urokinase and other AP-1 controlled promoters.
J Biol Chem
271:3822, 1996[Abstract/Free Full Text]
58.
De Cesare D, Palazzolo M, Blasi F:
Functional characterization of COM, a DNA region required for cooperation between AP-1 sites in urokinase gene transcription.
Oncogene
13:2551, 1996[Medline]
[Order article via Infotrieve]
59.
De Cesare D, Palazzolo M, Berthelsen J, Blasi F:
Characterization of UEF-4, a DNA-binding protein required for transcriptional synergism between two AP-1 sites in the human urokinase enhancer.
J Biol Chem
272:23921, 1997[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. B. Wu, K. Chen, X.-M. Ou, and J. C. Shih
Retinoic Acid Activates Monoamine Oxidase B Promoter in Human Neuronal Cells
J. Biol. Chem.,
June 19, 2009;
284(25):
16723 - 16735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Islam, S. Puri, M. Rodova, B. S. Magenheimer, R. L. Maser, and J. P. Calvet
Retinoic acid-dependent activation of the polycystic kidney disease-1 (PKD1) promoter
Am J Physiol Renal Physiol,
December 1, 2008;
295(6):
F1845 - F1854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Cheng, P. Yin, Q. Xue, B. Yilmaz, M. I. Dawson, and S. E. Bulun
Retinoic Acid (RA) Regulates 17{beta}-Hydroxysteroid Dehydrogenase Type 2 Expression in Endometrium: Interaction of RA Receptors with Specificity Protein (SP) 1/SP3 for Estradiol Metabolism
J. Clin. Endocrinol. Metab.,
May 1, 2008;
93(5):
1915 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. van Wageningen, M. C. Breems-de Ridder, J. Nigten, G. Nikoloski, C. A. J. Erpelinck-Verschueren, B. Lowenberg, T. de Witte, D. G. Tenen, B. A. van der Reijden, and J. H. Jansen
Gene transactivation without direct DNA binding defines a novel gain-of-function for PML-RAR{alpha}
Blood,
February 1, 2008;
111(3):
1634 - 1643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Epping, L. Wang, J. A. Plumb, M. Lieb, H. Gronemeyer, R. Brown, and R. Bernards
A functional genetic screen identifies retinoic acid signaling as a target of histone deacetylase inhibitors
PNAS,
November 6, 2007;
104(45):
17777 - 17782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. P. Ong, Z. He, L. Kriazhev, X. Shan, R. G. E. Palfree, and A. Bateman
Regulation of progranulin expression in myeloid cells
Am J Physiol Regulatory Integrative Comp Physiol,
December 1, 2006;
291(6):
R1602 - R1612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-R. Shiou, P. K. Datta, P. Dhawan, B. K. Law, J. M. Yingling, D. A. Dixon, and R. D. Beauchamp
Smad4-dependent Regulation of Urokinase Plasminogen Activator Secretion and RNA Stability Associated with Invasiveness by Autocrine and Paracrine Transforming Growth Factor-beta
J. Biol. Chem.,
November 10, 2006;
281(45):
33971 - 33981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yokoyama, K. Takeda, and S. Shibahara
Functional Difference of the SOX10 Mutant Proteins Responsible for the Phenotypic Variability in Auditory-Pigmentary Disorders
J. Biochem.,
October 1, 2006;
140(4):
491 - 499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Passeri, A. Marcucci, G. Rizzo, M. Billi, M. Panigada, L. Leonardi, F. Tirone, and F. Grignani
Btg2 enhances retinoic Acid-induced differentiation by modulating histone h4 methylation and acetylation.
Mol. Cell. Biol.,
July 1, 2006;
26(13):
5023 - 5032.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Higgins, S. Liu, M. Abdelrahim, K. Yoon, K. Vanderlaag, W. Porter, R. P. Metz, and S. Safe
Vascular Endothelial Growth Factor Receptor-2 Expression Is Induced by 17{beta}-Estradiol in ZR-75 Breast Cancer Cells by Estrogen Receptor {alpha}/Sp Proteins
Endocrinology,
July 1, 2006;
147(7):
3285 - 3295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Monslow, J. D. Williams, D. J. Fraser, D. R. Michael, P. Foka, A. P. Kift-Morgan, D. D. Luo, C. A. Fielding, K. J. Craig, N. Topley, et al.
Sp1 and Sp3 Mediate Constitutive Transcription of the Human Hyaluronan Synthase 2 Gene
J. Biol. Chem.,
June 30, 2006;
281(26):
18043 - 18050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Qi and M. Ratnam
Synergistic Induction of Folate Receptor {beta} by All-Trans Retinoic Acid and Histone Deacetylase Inhibitors in Acute Myelogenous Leukemia Cells: Mechanism and Utility in Enhancing Selective Growth Inhibition by Antifolates
Cancer Res.,
June 1, 2006;
66(11):
5875 - 5882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Resendes and A. G. Rosmarin
GA-Binding Protein and p300 Are Essential Components of a Retinoic Acid-Induced Enhanceosome in Myeloid Cells
Mol. Cell. Biol.,
April 15, 2006;
26(8):
3060 - 3070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tabe, M. Konopleva, R. Contractor, M. Munsell, W. D. Schober, L. Jin, Y. Tsutsumi-Ishii, I. Nagaoka, J. Igari, and M. Andreeff
Up-regulation of MDR1 and induction of doxorubicin resistance by histone deacetylase inhibitor depsipeptide (FK228) and ATRA in acute promyelocytic leukemia cells
Blood,
February 15, 2006;
107(4):
1546 - 1554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kim, R. Barhoumi, R. Burghardt, and S. Safe
Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer
Mol. Endocrinol.,
April 1, 2005;
19(4):
843 - 854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Wolf, R. L. Medcalf, and C. Jern
The t-PA -7351C>T enhancer polymorphism decreases Sp1 and Sp3 protein binding affinity and transcriptional responsiveness to retinoic acid
Blood,
February 1, 2005;
105(3):
1060 - 1067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sassa, Y. Hata, L. P. Aiello, Y. Taniguchi, K. Kohno, and T. Ishibashi
Bifunctional Properties of Peroxisome Proliferator-Activated Receptor {gamma}1 in KDR Gene Regulation Mediated via Interaction With Both Sp1 and Sp3
Diabetes,
May 1, 2004;
53(5):
1222 - 1229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Abrams, J. Xu, C. Nativelle-Serpentini, S. Dabirshahsahebi, and M. B. Rogers
An Evolutionary and Molecular Analysis of Bmp2 Expression
J. Biol. Chem.,
April 16, 2004;
279(16):
15916 - 15928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Petrescu, H. R. Payne, A. Boedecker, H. Chao, R. Hertz, J. Bar-Tana, F. Schroeder, and A. B. Kier
Physical and Functional Interaction of Acyl-CoA-binding Protein with Hepatocyte Nuclear Factor-4{alpha}
J. Biol. Chem.,
December 19, 2003;
278(51):
51813 - 51824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Peng, H. He, J. Hay, and W. T. Ruyechan
Interaction between the Varicella Zoster Virus IE62 Major Transactivator and Cellular Transcription Factor Sp1
J. Biol. Chem.,
September 26, 2003;
278(39):
38068 - 38075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Matsushima-Nishiwaki, M. Okuno, Y. Takano, S. Kojima, S. L. Friedman, and H. Moriwaki
Molecular mechanism for growth suppression of human hepatocellular carcinoma cells by acyclic retinoid
Carcinogenesis,
August 1, 2003;
24(8):
1353 - 1359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hao, H. Qi, and M. Ratnam
Modulation of the folate receptor type {beta} gene by coordinate actions of retinoic acid receptors at activator Sp1/ets and repressor AP-1 sites
Blood,
June 1, 2003;
101(11):
4551 - 4560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. French, C. S. Malone, R. R. Shen, M. Renard, S. E. Henson, M. D. Miner, R. Wall, and M. A. Teitell
Sp1 Transactivation of the TCL1 Oncogene
J. Biol. Chem.,
January 3, 2003;
278(2):
948 - 955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. S. Bush, M. St. Coeur, K. K. Resendes, and A. G. Rosmarin
GA-binding protein (GABP) and Sp1 are required, along with retinoid receptors, to mediate retinoic acid responsiveness of CD18 (beta 2 leukocyte integrin): a novel mechanism of transcriptional regulation in myeloid cells
Blood,
January 1, 2003;
101(1):
311 - 317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Botella, T. Sanchez-Elsner, F. Sanz-Rodriguez, S. Kojima, J. Shimada, M. Guerrero-Esteo, M. P. Cooreman, V. Ratziu, C. Langa, C. P. H. Vary, et al.
Transcriptional activation of endoglin and transforming growth factor-beta signaling components by cooperative interaction between Sp1 and KLF6: their potential role in the response to vascular injury
Blood,
December 1, 2002;
100(12):
4001 - 4010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Abdelrahim, I. Samudio, R. Smith III, R. Burghardt, and S. Safe
Small Inhibitory RNA Duplexes for Sp1 mRNA Block Basal and Estrogen-induced Gene Expression and Cell Cycle Progression in MCF-7 Breast Cancer Cells
J. Biol. Chem.,
August 2, 2002;
277(32):
28815 - 28822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Akiyama, T. Tanaka, T. Maeno, H. Kanai, Y. Kimura, S. Kishi, and M. Kurabayashi
Induction of VEGF Gene Expression by Retinoic Acid through Sp1-Binding Sites in Retinoblastoma Y79 Cells
Invest. Ophthalmol. Vis. Sci.,
May 1, 2002;
43(5):
1367 - 1374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sugawara, A. Uruno, M. Kudo, Y. Ikeda, K. Sato, Y. Taniyama, S. Ito, and K. Takeuchi
Transcription Suppression of Thromboxane Receptor Gene by Peroxisome Proliferator-activated Receptor-gamma via an Interaction with Sp1 in Vascular Smooth Muscle Cells
J. Biol. Chem.,
March 15, 2002;
277(12):
9676 - 9683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Maeno, T. Tanaka, Y. Sando, T. Suga, Y. Maeno, J. Nakagawa, T. Hosono, M. Sato, H. Akiyama, S. Kishi, et al.
Stimulation of Vascular Endothelial Growth Factor Gene Transcription by all trans Retinoic Acid through Sp1 and Sp3 Sites in Human Bronchioloalveolar Carcinoma Cells
Am. J. Respir. Cell Mol. Biol.,
February 1, 2002;
26(2):
246 - 253.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Shimada, Y. Suzuki, S.-J. Kim, P.-C. Wang, M. Matsumura, and S. Kojima
Transactivation via RAR/RXR-Sp1 Interaction: Characterization of Binding Between Sp1 and GC Box Motif
Mol. Endocrinol.,
October 1, 2001;
15(10):
1677 - 1692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Matsushima-Nishiwaki, M. Okuno, S. Adachi, T. Sano, K. Akita, H. Moriwaki, S. L. Friedman, and S. Kojima
Phosphorylation of Retinoid X Receptor {alpha} at Serine 260 Impairs Its Metabolism and Function in Human Hepatocellular Carcinoma
Cancer Res.,
October 1, 2001;
61(20):
7675 - 7682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gaetano, A. Catalano, B. Illi, A. Felici, S. Minucci, R. Palumbo, F. Facchiano, A. Mangoni, S. Mancarella, J. Muhlhauser, et al.
Retinoids Induce Fibroblast Growth Factor-2 Production in Endothelial Cells via Retinoic Acid Receptor {{alpha}} Activation and Stimulate Angiogenesis In Vitro and In Vivo
Circ. Res.,
March 2, 2001;
88
(4):
e38 - e47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Samudio, C. Vyhlidal, F. Wang, M. Stoner, I. Chen, M. Kladde, R. Barhoumi, R. Burghardt, and S. Safe
Transcriptional Activation of Deoxyribonucleic Acid Polymerase {{alpha}} Gene Expression in MCF-7 Cells by 17{{beta}}-Estradiol
Endocrinology,
March 1, 2001;
142(3):
1000 - 1008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kojima, S. Hayashi, K. Shimokado, Y. Suzuki, J. Shimada, M. P. Crippa, and S. L. Friedman
Transcriptional activation of urokinase by the Kruppel-like factor Zf9/COPEB activates latent TGF-beta 1 in vascular endothelial cells
Blood,
February 15, 2000;
95(4):
1309 - 1316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Stoner, F. Wang, M. Wormke, T. Nguyen, I. Samudio, C. Vyhlidal, D. Marme, G. Finkenzeller, and S. Safe
Inhibition of Vascular Endothelial Growth Factor Expression in HEC1A Endometrial Cancer Cells through Interactions of Estrogen Receptor alpha and Sp3 Proteins
J. Biol. Chem.,
July 21, 2000;
275(30):
22769 - 22779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Horie, H. Ishii, F. Matsumoto, M. Kusano, K. Kizaki, J. Matsuda, and M. Kazama
Acceleration of Thrombomodulin Gene Transcription by Retinoic Acid. RETINOIC ACID RECEPTORS AND Sp1 REGULATE THE PROMOTER ACTIVITY THROUGH INTERACTIONS WITH TWO DIFFERENT SEQUENCES IN THE 5'-FLANKING REGION OF HUMAN GENE
J. Biol. Chem.,
January 19, 2001;
276(4):
2440 - 2450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Castro-Rivera, I. Samudio, and S. Safe
Estrogen Regulation of Cyclin D1 Gene Expression in ZR-75 Breast Cancer Cells Involves Multiple Enhancer Elements
J. Biol. Chem.,
August 10, 2001;
276(33):
30853 - 30861.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|