|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 12 (June 15), 1999:
pp. 4284-4292
Identification of Vascular Endothelial Growth Factor (VEGF) Receptor-2
(Flk-1) Promoter/Enhancer Sequences Sufficient for Angioblast
and Endothelial Cell-Specific Transcription in Transgenic Mice
By
Andreas Kappel,
Volker Rönicke,
Annette Damert,
Ingo Flamme,
Werner Risau, and
Georg Breier
From the Max-Planck-Institute for Physiological and Clinical
Research, Bad Nauheim, Germany; the Zentrum für molekulare
Medizin, Köln, Germany.
 |
ABSTRACT |
The vascular endothelial growth factor (VEGF) receptor-2 (Flk-1) is
the first endothelial receptor tyrosine kinase to be expressed in
angioblast precursors, and its function is essential for the differentiation of endothelial cells and hematopoietic precursors. We
have identified cis-acting regulatory elements of the murine Flk-1 gene that mediate endothelium-specific expression of a
LacZ reporter gene in transgenic mice. Sequences within the
5'-flanking region of the Flk-1 gene, in combination with
sequences located in the first intron, specifically targeted transgene
expression to angioblasts and endothelial cells of transgenic mice. The
intronic regulatory sequences functioned as an autonomous
endothelium-specific enhancer. Sequences of the 5'-flanking
region contributed to a strong, uniform, and reproducible transgene
expression and were stimulated by the transcription factor HIF-2 .
The Flk-1 gene regulatory elements described in this study
should allow the elucidation of the molecular mechanisms involved in
endothelial cell differentiation and angiogenesis.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE CARDIOVASCULAR SYSTEM IS THE first
functional organ system to be formed in the vertebrate embryo.
Endothelial cells, which constitute the inner lining of all blood
vessels, differentiate from mesodermal precursor cells, or angioblasts,
shortly after gastrulation.1,2 The close association of
angioblasts and hematopoietic precursor cells at this developmental
stage is thought to reflect their origin from a putative common
precursor cell, the hemangioblast. In a process termed vasculogenesis,
angioblasts aggregate to form a primitive vascular plexus, and
differentiate into endothelial cells. The primitive vascular plexus is
then further refined by angiogenesis and remodeling.
Angiogenic growth factors of the vascular endothelial growth factor
(VEGF) family and their cognate endothelial receptors, Flt-1 (VEGF
receptor-1), Flk-1/KDR (VEGF receptor-2), and Flt-4 (VEGF receptor-3)
function as signaling molecules during vascular development.3 Gene targeting experiments have shown that
these molecules have an essential function in embryonic vascular
development.4 VEGF and the VEGF receptors represent the
first endothelial cell-specific signal transduction pathway known to be
activated during vascular development.5-8 In particular,
Flk-1 appears to play a pivotal role in endothelial cell
differentiation and vasculogenesis. Flk-1 is the first endothelial
receptor known to be expressed in the primitive
mesoderm,9,10 and mice that are homozygously defective for
Flk-1 completely lack mature endothelial cells and blood
vessels.6,11 Moreover, hematopoiesis is defective in the
Flk-1 / mice, indicating that Flk-1
function is also essential for the differentiation of hematopoietic
precursors. This is consistent with the hypothesis that Flk-1
is a marker for the hemangioblast.12 Collectively, these
data provide evidence that Flk-1 gene activation is a principal event leading to the emergence of the hemangioblastic lineage and the
differentiation of endothelial and hematopoietic cells. During later
stages of embryonic development Flk-1 is highly expressed on
endothelial cells,9,13 but is downregulated in most
hematopoietic cells.14 In the adult, Flk-1
expression is not detectable in most vascular beds. The strong
induction of Flk-1 expression in tumoral endothelial cells is
involved in the neovascularization of various human or experimental
tumors.15,16 Thus, the understanding of Flk-1 gene
regulation represents a key step in the understanding of the mechanisms
involved in endothelial lineage differentiation and angiogenesis in
development and disease. The identification of the cis-acting
elements in the Flk-1 gene that are responsible for its unique
expression profile provides a valuable tool for the identification of
upstream factors that control the establishment of the hemangioblastic lineage.
We have previously isolated genomic clones that encompass the promoter
region of the murine Flk-1 gene, and have performed a
functional analysis of the Flk-1 promoter in
vitro.17 We17 and others18 showed
that Flk-1 5'-flanking sequences confer endothelium-specific expression in transfected endothelial cells. The
significance of these cis-acting elements for the developmental expression of the Flk-1 gene in vivo remained unclear. In this report, we have characterized the murine Flk-1 regulatory
sequences in transgenic mice. Despite their activity in cultured
endothelial cells, 5'-flanking sequences alone could not target
expression of a LacZ reporter gene to the endothelium of mouse embryos.
However, in combination with sequences from the first intron of the
Flk-1 gene, the Flk-1 promoter could specifically drive
reporter gene expression in endothelial cells. The transgene expression
pattern closely resembled that of the endogenous Flk-1 gene
throughout development. The intron sequences conferred
endothelium-specific gene expression also to the heterologous herpes
simplex virus-thymidine kinase (tk) promoter and fulfilled all
the criteria of an autonomous tissue-specific enhancer. The Flk-1
promoter sequences were essential for a strong and reproducible
transgene expression, and were stimulated by HIF-2 , a basic
helix-loop-helix/PAS domain transcription factor that is prominently
expressed in the vasculature of embryonic mice.19-21
 |
MATERIALS AND METHODS |
DNA sequence analysis.
Restriction fragments of a 12 kb region of the Flk-1 gene
ranging from 6.5 kbp to +5.5 kbp relative to the transcription initiation site were subcloned into the pBluescriptII vector
(Stratagene, La Jolla, CA). The nucleotide sequence was
determined on both strands by using the deoxynucleotide chain
termination method on an Applied Biosystems 373 automated sequencer.
The nucleotide sequence of the Flk-1 intron enhancer is
deposited in the Genbank database (accession number AF061804). The
search for potential transcription factor binding sites was performed
with the MatInspector software (GBF, Braunschweig,
Germany).22
Plasmid construction and transient transfection.
The LacZ reporter vector was generated by inserting the LacZ cassette
into the HindIII and BamHI restriction sites of the pGL2-basic plasmid (Promega, Madison, WI), thereby
exchanging the luciferase gene against the LacZ cassette. The LacZ
cassette was derived from the p actinSDKLacZ plasmid (a gift from
Janet Rossant, Samuel-Lunenfeld-Research Institute, Toronto, Canada). Flk-1 promoter fragments were amplified by the polymerase chain reaction (PCR) as described17 and inserted into the
KpnI and HindIII sites of pGL-2. The 4.1
kbp/+299 bp fragment was generated by inserting a Flk-1
promoter fragment ranging from 4.1 kbp to 1.9 kbp into
the HindIII and EcoRI sites of the pGL2-Basic plasmid that already contained the Flk-1 promoter region from
1.9 kbp to +299 bp, and subsequently exchanging the luciferase
gene against the LacZ cassette. The 640 bp/+299 bp promoter
fragment was amplified as described17 using the forward
primer Flk-640. Flk-640:
5'-GGGGTACCTTCTGGACCGACCCAGCCAGG-3'.
Flk-1 intron fragments were amplified by PCR as
described.17 PCR products were digested with BamHI
and XhoI or BamHI and SalI and inserted into
the BamHI and SalI restriction sites downstream of the
LacZ cassette in the modified pGL2-Basic vector that already contained
the Flk-1 promoter fragment. A recombinant lambda phage clone,
P1617 served as a template for PCR amplification. The following primers were used: 5'-In1fw:
5'-AGGGATCCACTCTTTAGTAGTAAGGCG-3', 5'-In1rev:
5'-ACCTCGAGACTTGGATGGCAC-3', 3'-In1fw:
5'-GGGCTATAATTGGTGCCATCC-3', 3'-In1rev:
5'-GGATGGAGAAAATCGCCAGGC-3', In2fw:
5'-GTGTGCATTGTTTATGGAAGGG-3', In2rev:
5'-CATAGACATAAACAGTGGAGGC-3'. The 510 bp intron fragment located between nucleotides +3437 and +3947 was a
SwaI/BamHI fragment derived from recombinant phage
P1617 and was inserted by blunt-end cloning to the blunted
BamHI site of the modified pGL-2.
Bovine aortic endothelial (BAE) cells, NIH 3T3 cells, and A293 cells
were cultured in Dulbecco's modified Eagle's medium
(DMEM)+ supplemented with 10% fetal calf serum. Transient
transfections were performed as described17 using 6 µg
-galactosidase reporter vector driven by Flk-1 sequences and
1µg of cytomegalovirus (CMV) promoter-driven luciferase vector in
each experiment. Reporter gene assays were performed as
described.17 The -galactosidase activity of each extract
was normalized to the respective luciferase activity.
Mouse HIF-1 and HIF-2 complementary DNA (cDNA) clones were
isolated from a mouse brain capillary cDNA library23 using standard techniques, and further amplified by PCR as
described20 using primer pairs HIF1fw/rev and HIF2 fw/rev.
The sequence encoding the FLAG epitope (Eastman-Kodak,
Rochester, NY) was included in the reverse oligonucleotide primer. The
following primers were used: HIF1fw:
5'-GGGAATTCACCATGAGTTCTGAACGTCGAAAAG-3', HIF1rev: 5'-AAGCGGCCGCTCATTTATCGTCATCGTCCTTGTA
ATCGTTAACTTGATCCAAAGCTCTG-3', HIF2fw:
5'-GGGATCCGACAATGACAGCTGACAAGGAG-3', HIF2rev:
5'-AAGCGGCCGCTCATTTATCGTCATCGTCCTTGTAATGGTGGCCTGGTCCA GAGCTC-3'. HIF-1 and HIF-2 expression plasmids were
constructed by inserting the cDNAs into the EcoRI and
NotI sites of pcDNA3 (Invitrogen, Carlsbad, CA).
For cotransfection assays, A293 cells were split 1:2 into 35-mm dishes
and transfected 18-hours later with 4 µg of DNA (2 µg of
Flk-1 promoter-driven luciferase plasmid, 1 µg of CMV
promoter-driven -galactosidase expression plasmid, and 1 µg of the
HIF-1 or HIF-2 expression plasmids, or pBluescript SKII and
pcDNA3 plasmids as a control) using a transfection kit (MBS,
Stratagene). After 20 hours, reporter gene activity was measured using
the Dual Light Kit (Tropix, Bedford, MA). The luciferase activity of
each extract was normalized to the respective -galactosidase activity. Endogenous background levels of both enzyme activities were
determined using extracts from mock-transfected cells and were
subtracted. The normalized luciferase activity of the control transfection was arbitrarily set to 1. Each value represents the average of at least six experiments.
Generation and analysis of transgenic mice.
Transgenic mice were generated by microinjection of fertilized mouse
oocytes as described.24 Fertilized oocytes were isolated from superovulated C57BL/6 × C3H/He F1 mice, microinjected, and reimplanted into pseudopregnant females of the same hybrid-mouse strain. Mouse embryos were analyzed by whole mount LacZ staining for
transgene expression as described.25 Genomic DNA was
prepared from unstained embryos or yolk sacs, and genotyping was
performed by PCR analysis as described25 using the primer
pair LacZP1/LacZP2. LacZP1: 5'-ATCCTCTGCATGGTCAGGTC-3';
LacZP2: 5'-CGTGGCCTGATTCATTCC-3'. For histological
analysis, embryos were embedded in paraffin, and 10 µm sections were
prepared and counterstained with neutral red.
Cryostat sectioning and LacZ staining of organs from postnatal mice
were performed as described.26 Immunofluorescence detection of platelet endothelial cell adhesion molecule-1 (PECAM-1)
was performed as described27 using a CY3-conjugated Goat
antirat IgG secondary antibody (Jackson Immuno Research Laboratories
Inc, West Grove, PA) as recommended by the manufacturer.
 |
RESULTS |
Functional analysis of the Flk-1 promoter in transgenic mouse embryos.
We have previously characterized promoter fragments from the murine
Flk-1 gene that confer endothelium-specific expression to the
firefly luciferase reporter gene in transfected BAE
cells.17 Although the Flk-1 promoter sequences
extending to 4.1 kbp had the highest cell-type specificity of
all fragments tested in vitro, a stronger promoter activity was
observed with shorter promoter fragments.17 To investigate
whether the Flk-1 gene regulatory regions identified in vitro
are also functional in vivo, we generated transgenic mouse embryos
carrying a transgene that consists of the LacZ reporter gene under the
control of different Flk-1 promoter fragments. Analysis of
transgenic embryos was performed at day 10.5 of embryonic development
(E10.5). A weak vascular transgene expression was observed in 1 out of
31 transgenic embryos tested that contained a promoter fragment
spanning the Flk-1 gene from 1.9 kbp to +299 bp relative
to the transcription initiation site (Table
1). No endothelium-specific expression was observed with longer
( 4.1 kbp/+299 bp) or shorter fragments ( 640 bp/+299 bp) (Table 1). Therefore, none of the various Flk-1 promoter
fragments mediated a reproducible endothelium-specific reporter gene
expression in vivo. From these data we concluded that additional
sequences of the Flk-1 gene are required to confer the
endogenous expression pattern.
Identification of endothelium-specific regulatory elements in the
first intron of the Flk-1 gene in vitro.
Many tissue-specific gene regulatory elements are located within
intronic sequences. To examine whether the first or the second intron
of the Flk-1 gene contains sequences that might be able to
supplement the function of the Flk-1 promoter in a
cell-type-specific manner, we performed reporter gene analysis in
transfected cells. Several subfragments of the first two introns
(5'-In1, 3'-In1, In2; shown in
Fig 1A) were included in -galactosidase
reporter gene constructs together with a 4.4 kbp Flk-1 promoter
fragment ( 4.1 kbp/+299 bp), and transient transfection was
performed in BAE and NIH 3T3 cells. For both cell types, the promoter
activity of the reporter gene construct that contained the 5'
region of the first intron (5'-In1) fragment was arbitrarily set
to 100 relative light units (RLU). The substitution of this intronic fragment with the 3' region of the first intron (3'-In1), a
2.3 kbp XhoI/BamHI fragment (+1677 bp/+3947 bp),
induced a twofold increase in promoter activity in BAE cells, but not
in NIH 3T3 cells (Fig 1B). The second intron (In2), in contrast, did
not alter the expression levels significantly (Fig 1B). These results indicate that a positive-acting endothelium-specific element is located
in the 2.3 kbp XhoI/BamHI fragment of the first
Flk-1 intron.

View larger version (16K):
[in this window]
[in a new window]
| Fig 1.
Partial structure and functional analysis of the mouse
Flk-1 locus. (A) Restriction enzyme map of the region
encompassing the first three exons (represented by shaded boxes).
Subfragments containing parts of intron 1 or intron 2 are indicated.
Abbreviations for restriction enzymes are: B, BamHI, Xh,
XhoI, Sl, SalI. (B) -galactosidase reporter
gene assays of various constructs after transient transfection of BAE
cells. The intron fragments were tested in combination with a 4.4 kbp
Flk-1 promoter fragment spanning the region from 4.1 kbp to
+299 bp of the Flk-1 gene. NIH 3T3 cells were used as a
reference for nonendothelial cells. Values significantly above
(P < .003, Student's t-test) 100 RLU are marked with
an asterisk.
|
|
Endothelium-specific expression mediated by Flk-1 regulatory
sequences in vivo.
When the 2.3 kbp XhoI/BamHI fragment of the first
intron (3'-In1; +1677 bp/+3947 bp; see above) was tested in
combination with the Flk-1 promoter fragment ( 640
bp/+299 bp), a reproducible vascular LacZ expression in transgenic
E10.5 mouse embryos was observed (Table 1), for example in blood
vessels of the head region, in intersomitic vessels, the dorsal aorta,
and in the heart anlage (Fig 2A).
Sectioning of these embryos confirmed that the -galactosidase
expression was confined to vascular endothelium (data not shown). The
intron fragment could also direct endothelium-specific LacZ expression
when used in an inverted orientation in the reporter construct
( 640 bp/+299 bp//+3947 bp/+1677 bp, Table 1).

View larger version (104K):
[in this window]
[in a new window]
| Fig 2.
Reporter gene analysis of Flk-1 gene regulatory
elements in transgenic mouse embryos. The LacZ reporter gene was fused
to regulatory elements derived from the mouse Flk-1 gene and
tested for -galactosidase expression in transgenic mouse embryos.
(A) E10.5 transgenic mouse embryo expressing LacZ under the control of
a 939bp promoter fragment in combination with a 2.3 kbp
XhoI/BamHI fragment of the first intron spanning the
region from +1677 bp to +3947 bp of the Flk-1 gene. Most if
not all developing vascular structures show -galactosidase
expression, for example the endocardium of the heart, the dorsal aorta,
intersomitic vessels or vessels of the developing brain. (B) E11.5
embryo of the transgenic mouse line 2603 that was established with the
same construct. (C) E11.5 Flk-1/LacZ knock-in embryo in which
the LacZ gene is expressed from the endogenous Flk-1 locus
shows a highly similar staining. However, -galactosidase expression
was absent in small blood vessels of the yolk sac. (D to F) Paraffin
sections of the embryo from (B) show -galactosidase expression in
the paired dorsal aortae (D), a venous vessel connected with the heart
(E), and capillaries invading the neural tube (F). (G) LacZ staining of
a 15 µm cryostat section of a P5 transgenic mouse (Line 2603) kidney.
(H) Adjacent section of G, immunolabeled with anti-PECAM1 antibody. The
LacZ expression in G colocalizes with PECAM1 expression in H. (I)
-galactosidase expression in a transgenic embryo containing the
tk promoter in combination with the 2.3 kbp
XhoI/BamHI fragment of the Flk-1 first intron.
(J) -galactosidase expression in a transgenic embryo containing a
construct with Flk-1 promoter sequences ( 640 bp/+299 bp)
in combination with a 510 bp fragment of the first intron (+3437 bp
to +3947 bp) of the Flk-1 gene. Bars, 100 µm (D to H).
|
|
Transgenic mouse lines were generated with this reporter gene construct
( 640 bp/+299 bp//+1677 bp/+3947 bp) containing the Flk-1
regulatory sequences. Three independent lines were obtained that showed
a uniform vascular expression of the reporter gene in the embryo proper
and the yolk sac at E11.5, as assessed by whole-mount LacZ staining.
One of these lines (2603) was analyzed further (Fig 2B). Sectioning of
-galactosidase-stained E11.5 transgenic embryos showed that
reporter gene expression was confined to the endothelium of blood
vessels, eg, in the dorsal aorta (Fig 2D), in venous vessels (Fig 2E),
in the perineural vascular plexus, and in capillary sprouts invading
the neural tube (Fig 2F). The LacZ expression in this line
colocalized with the expression of the endothelial marker PECAM1, as
confirmed by the parallel immunofluorescence staining with an
anti-PECAM1 antibody of adjacent sections (Fig 2G,H). The LacZ staining
pattern of these embryos was also compared with heterozygous
Flk-1 mutant mouse embryos that express the LacZ gene from the
endogenous Flk-1 locus.6 The LacZ staining pattern
of transgenic embryos and the knock-in embryos at E11.5 were
indistinguishable (Fig 2B,C). These observations showed that the intron
sequences in combination with the Flk-1 promoter confer an
endothelium-specific expression pattern that closely resembles the
expression pattern of the endogenous Flk-1
gene.13,28
The first intron of the Flk-1 gene contains an autonomous
endothelium-specific enhancer.
To further assess the function of the first Flk-1 intron in
endothelium-specific gene expression, we investigated whether the
intron sequences can confer endothelium-specific expression to the
heterologous tk promoter. This promoter has no intrinsic endothelial cell specificity.26 A LacZ reporter gene
construct was generated that contained the tk promoter, in
combination with the 2.3 kbp XhoI/BamHI fragment of the
first intron (+1677 bp/+3947 bp). Transgenic mouse embryos generated
with this construct showed vascular reporter gene expression (Fig 2I).
Based on microscopic inspection of whole mount-stained embryos, the
-galactosidase staining observed in these embryos was weaker than in
embryos expressing LacZ under the control of the 640 bp/+299 bp
Flk-1 promoter in combination with the intron fragment (Fig
2A,B). Moreover, the frequency of transgenic mouse embryos expressing
this transgene was significantly reduced, when compared with constructs
containing the 640 bp/+299 bp Flk-1 promoter in
combination with the intron fragment (Table 1). This indicates that the
tk promoter lacks positive-acting elements that are present
within the Flk-1 promoter. The Flk-1 intron fragment
alone, in contrast to the Flk-1 promoter, can reproducibly
target reporter gene expression to the endothelium and acts as an
autonomous endothelium-specific enhancer.
To further characterize the minimal intron sequences that are required
for endothelium-specific expression, we analyzed whether shorter intron
fragments were also active in combination with the 939 bp promoter
region of the Flk-1 gene ( 640 bp/+299 bp). By deletion
analysis, the intron enhancer was localized to a 510 bp fragment (+3437
bp/+3947 bp) that is located immediately upstream of the second exon.
This fragment was sufficient to drive endothelium-specific LacZ
expression in transgenic mouse embryos when tested in combination with
the Flk-1 promoter (Fig 2J, Table 1). The DNA sequence of this
fragment (Fig 3) contains potential binding
sites for the GATA and Ets transcription factors, and for Scl/Tal-1,
all of which have been proposed to play a role in
angiogenesis.29-33

View larger version (34K):
[in this window]
[in a new window]
| Fig 3.
Nucleotide sequence of the Flk-1 intron enhancer
and putative transcription factor binding sites. Sequences matching
known transcription factor binding sites are underlined. This sequence
is deposited in the GeneBank database (accession number AF061804).
|
|
Flk-1 regulatory sequences target endothelium-specific transgene
expression throughout development.
To test whether the regulatory sequences of the Flk-1 promoter
and enhancer identified can reproduce the endogenous Flk-1 expression pattern throughout development, the LacZ expression pattern
of the transgenic mouse line 2603 (Fig 2B) was further analyzed at
various stages of embryonic development, at postnatal day 5 (P5) and in
the adult (P120). The earliest stage during which transgene expression
was examined by whole-mount LacZ staining was at E7.8
(Fig 4A). The analysis of sections of these
embryos confirmed that the transgene was expressed in angioblasts of
the allantois and the yolk sac (Fig 4B,C). Moreover, transgene
expression was restricted to the vascular endothelium at all stages of
embryonic development examined (E7.8 to E14.5, data not shown).

View larger version (133K):
[in this window]
[in a new window]
| Fig 4.
Analysis of transgene expression during early development
and in newborn mice in the transgenic mouse line 2603. (A) Frontal view
on a whole-mount -galactosidase-stained E7.8 embryo. The arrow
indicates transgene expression in the extraembryonic mesoderm. (B and
C) Paraffin sections from the embryo shown in A show transgene
expression in endothelial cells of the allantois (B) and the yolk sac
(C). (D to H) LacZ staining of spleen (D), kidney (E), lung (F), liver
(G), and thymus (H) from a P5 transgenic mouse. (EM) extraembryonic
mesoderm. Bars, 25 µm (C), 100 µm (B,D,E,F,G,H).
|
|
LacZ staining was detected in vessels of the spleen, kidney, thymus,
liver, and lung from P5 animals (Fig 4D to H). However, LacZ expression
was downregulated in most vascular beds of adult animals, except for
the spleen (data not shown). These results further support the
conclusion that the identified Flk-1 regulatory sequences are
sufficient to reproduce most properties of the endogenous Flk-1 expression.
The 5'-UTR of Flk-1 is required for expression in the yolk sac
vasculature.
In Flk-1/LacZ knock-in embryos, the LacZ gene is under
control of all endogenous regulatory elements except for the regions from bp +137 to bp +299 in the 5'-UTR and approximately the first 600 bp of the first intron.6 In this study we have shown
that these intron sequences are not required to generate the strong and
uniform endothelial-specific reporter gene expression (Fig 2B and Table
1). The uniform vascular LacZ expression in the transgenic yolk sacs
(Fig 5A, B) was absent in small vessels of the yolk sacs of the Flk-1/LacZ knock-in embryos (Fig 5C), in which only large yolk sac vessels were stained. This indicates that the
region from bp +137 to bp +299 of the Flk-1 5'-UTR is required for uniform Flk-1 expression in yolk sac vessels. To verify this hypothesis, we further analyzed the effect of this deletion
in transgenic mice. Deletion of the 5'-UTR sequences from bp +137
to bp +299 in the transgene construct analyzed in Fig 5A resulted in a
diminished and incomplete LacZ expression in the yolk sacs of all five
transgenic mouse lines tested (Fig 5D), and in a reduced frequency of
transgenic embryos expressing LacZ (Table 1, construct
640/+137//3' Intron+1677/+3947). Replacement of the entire
Flk-1 promoter including the 5'-UTR by the tk
promoter in the transgenic construct also nearly abolished LacZ
expression in the yolk sac (data not shown), and led to a reduced
expression frequency in transgenic embryos (Table 1). Thus, the
5'-UTR might be involved in specifying Flk-1 expression
in a subset of endothelial cells in the yolk sac.

View larger version (118K):
[in this window]
[in a new window]
| Fig 5.
The 5'-UTR is required for expression of the
Flk-1 gene in the yolk sac vasculature. Transgenic mouse
embryos that carry a Flk-1 promoter and 5'-UTR ( 640
bp/+299 bp)/enhancer (+1677 bp/+3947 bp) reporter gene construct
show a uniform vascular expression in the yolk sac vasculature (A and
B). In contrast, the yolk sac of Flk-1/LacZ knock-in embryos
that lack part of the 5'-UTR (+137 bp to +299 bp) shows
expression only in large collecting vessels that connect with the
embryo, but not in the smaller vessels (C). Transgenic yolk sacs that
carry a Flk-1 promoter ( 640 bp/+137 bp) / enhancer
(+1677 bp/+3947 bp) reporter gene construct show a diminished and
incomplete vascular LacZ expression (D) when compared with the
construct containing the complete 5'-UTR. (A and B) Bar, 500 µm.
|
|
The Flk-1 promoter is activated by HIF-2 .
As shown above, the Flk-1 promoter ( 640 bp/+299 bp)
contains positive-acting regulatory sequences required for a strong and reproducible reporter gene transcription in transgenic mice. This suggests that transcription factors that are specifically expressed in
endothelial cells activate the Flk-1 promoter in a
cell-type-specific manner.
The basic helix-loop-helix PAS-domain transcription factor, HIF-2
(also known as HLF, HRF, or EPAS1), is prominently expressed in
endothelial cells during mouse embryonic development19-21
and is thus a candidate regulator of Flk-1 expression. To
determine if HIF-2 might be involved in the regulation of
Flk-1 gene expression, we cotransfected A293 cells with a
luciferase reporter gene construct containing Flk-1 promoter
sequences ( 640 bp to +299 bp) and an eukaryotic expression
vector that contained the mouse HIF-2 cDNA. In comparison to cells
transfected with the luciferase reporter construct alone,
cotransfection of the HIF-2 construct increased reporter gene
activity approximately 15-fold (Fig 6). In
contrast, HIF-1 , a close relative of HIF-2 that stimulates the
hypoxia-induced transcription of the VEGF gene, failed to
stimulate the reporter construct (Fig 6).

View larger version (29K):
[in this window]
[in a new window]
| Fig 6.
HIF-2 stimulates Flk-1 gene expression. A293
cells were cotransfected with a reporter gene construct containing
Flk-1 promoter sequences from 640 bp to +299 bp and with
expression vectors encoding the murine HIF-1 or HIF-2 cDNAs,
respectively. Relative promoter activities were determined as described
in the Materials and Methods section. The promoter activity of the
control transfection was arbitrarily set to 1.
|
|
 |
DISCUSSION |
The murine Flk-1 receptor is crucial for the differentiation of the
hemangioblastic lineage and during embryonic vascular development.1,2,6 Moreover, Flk-1 plays a central role in
the regulation of neovascularization in a wide variety of
tumors.34,35 To elucidate the basis of its endothelial
expression, we have isolated and characterized regulatory sequences of
the murine Flk-1 gene that confer endothelium-specific reporter
gene expression in transgenic mouse embryos. Transgene expression
driven by these sequences was strong, specific, and highly
reproducible. Most importantly, we have shown that the isolated
sequences were active in early-stage vascular development and may thus
represent a clue towards the identification of the molecular mechanisms
involved in hemangioblast differentiation and vasculogenesis. Moreover, transgene expression persisted until shortly after birth and was downregulated in adult animals, as it was described for the endogenous Flk-1 gene.13,28
The endothelium-specific expression in transgenic mouse embryos was
mediated by a 939 bp fragment of the promoter region only in
combination with a fragment of the first intron. 5'-flanking fragments up to 5.5 kbp alone were not sufficient to confer a reproducible endothelium-specific transgene expression. Reproducible endothelium-specific expression was therefore dependent on sequences from the first intron. These sequences also activated the heterologous tk promoter specifically in endothelial cells in vivo, and were active in an orientation-independent manner. Thus, they fulfill the
criteria for an autonomous tissue-specific enhancer.
The endothelium-specific enhancer sequences were contained in a 510 bp
intron fragment. Up to now, we have not observed endothelium-specific expression with shorter fragments, suggesting that multiple regulatory elements are clustered in this region. Several potential binding sites
for transcription factors could be identified therein, including consensus binding sites for c-ets1, PEA3 (an Ets-like transcription factor), GATA transcription factors, and Scl/Tal-1. The c-ets1 transcription factor was proposed to be involved in the early differentiation of endothelial cells from their
precursors,33 and c-ets1 is expressed in endothelial cells
during tumor vascularization and other forms of angiogenesis in
humans.32 Transcription factors of the GATA family are
involved in the transcription of genes that are expressed in the
hematopoietic and endothelial lineages, such as von Willebrand
factor,36 and Scl/Tal-1 has recently been implicated in the
regulation of Flk-1 expression in zebrafish.29 However, no direct effect of Scl/Tal-1 on Flk-1 expression has been observed so far in mice, although Scl-null mice have vascular defects.30
Recently, analyses of the regulatory elements of other
endothelium-specific genes such as von Willebrand factor,37
c-ets-1,38 or the endothelial receptors
Tie139 and Tie225,26 have been reported. The most uniform vascular expression pattern reported was
conferred by regulatory elements of the Tie2 gene. As it is the
case for Flk-1, the first intron of the Tie2 gene also
contains an autonomous endothelium-specific enhancer with potential
binding sites of the Ets and GATA families.26 A major
difference between the structural organization of the regulatory
elements of the Flk-1 gene and the Tie2 gene is,
however, that the Tie2 promoter by itself is active in certain
embryonic blood vessels.25 Further studies will show
whether common mechanisms are involved in the regulation of various
endothelium-specific genes.
Analysis of Flk-1/LacZ knock-in mouse embryos that express the
LacZ gene from the endogenous Flk-1 locus has previously shown that the LacZ reporter gene is expressed ubiquitously in the developing vasculature of E7.5 embryos.6 However, we have found that a fragment of the 5'-UTR that is deleted in the knock-in construct is required for reporter gene expression in the yolk sac vasculature during later stages of embryonic development. In addition, deletion of
this sequence between nucleotides +136 and +299 of the Flk-1 5'-UTR in the transgenic construct reduced the expression
frequency of the reporter gene. Based on transient transfection
analyses in BAE cells, this sequence has been shown to contain a
positive-acting, endothelial cell-specific element.17
Currently, we are investigating if proteins that specifically bind to
the 5'-UTR are involved in endothelial-specific transcription.
The Flk-1 promoter appears to contain additional
positive-acting regulatory sequences that are required for a strong and
reproducible endothelium-specific expression in the embryo proper. This
assumption is supported by the observation that the heterologous tk
promoter, when combined with the intron enhancer, showed
significantly lower reporter gene expression levels and a reduced
expression frequency in transgenic mouse embryos, when compared with
the Flk-1 promoter. A positive activity of the Flk-1
promoter sequences has already been suggested by our previous studies
in transfected BAE cells.17 Based on the stimulation of
Flk-1 promoter activity in vitro and its endothelial expression, it seems likely that HIF-2 regulates the Flk-1
promoter in vivo. The involvement of HIF-2 in the regulation of
Flk-1 expression further emphasizes the role of basic
helix-loop-helix/PAS-domain transcription factors in the regulation of
components of the VEGF signal transduction system and of vascular
development. In particular, this has been shown in mouse embryos
lacking functional genes for HIF-1 40 or
ARNT41 that show defects in vascular development, perhaps
due to reduced VEGF expression levels. HIF-2 is expressed most
prominently in the endothelium of several developing organs, for
example in the brain.20 It seems therefore likely that
HIF-2 is involved in the regulation of Flk-1 expression in
blood vessels that coexpress both HIF-2 and Flk-1.
Interestingly, HIF-2 is also expressed in tissues that
express the Flk-1 receptor ligand, VEGF, and has been shown to
stimulate VEGF expression.19 Taken together, these
observations support our hypothesis that HIF-2 is both an intrinsic
and extrinsic regulator of blood vessel growth and
function,20 by stimulating both receptor and ligand expression.
Among the endothelial receptor tyrosine kinases identified thus far,
Flk-1 is the only receptor whose function is required for the
determination of the endothelial lineage. Therefore, the Flk-1
gene represents the ideal candidate for studying the transcriptional regulatory mechanisms that are active during the emergence of the
endothelial lineage. The observation that the isolated regulatory elements of the Flk-1 gene are active in early-stage vascular development is of great importance for this objective. Knowledge of the
Flk-1 gene regulatory sequences is also of great potential relevance for the therapy of certain angiogenesis-dependent diseases, including cancer. Therefore, the study of the regulatory elements involved in the upregulation of Flk-1 expression in the tumor endothelium is particularly relevant for unraveling the mechanisms of
tumor angiogenesis. The analysis of Flk-1 gene regulatory
elements active in the tumor vasculature will provide a clue to the
signaling pathways that could be targeted for antiangiogenic tumor
therapy. Finally, the Flk-1 gene regulatory elements will be
useful for targeting expression of genes to the vasculature, and the
use of the Flk-1 gene regulatory elements in combination with
the Cre/loxP system may provide a powerful tool for specifically
inactivating genes in the developing vasculature or in tumor endothelium.
 |
ACKNOWLEDGMENT |
We thank Dr Janet Rossant for kindly providing the Flk-1/LacZ
knock-in mice and the gift of plasmid DNA; Gunnar Teichmann, Michael
Walker, and Dr Felix Müller-Holtkamp for generating transgenic mice; Silvia Hennig, Stefanie Pebler, Marie von Reutern, and Carola Wild for DNA sequence analysis; Thorsten Schlaeger for helpful discussions and gift of plasmid DNA; and Dr Christopher Mitchell and Dr
Simon Bamforth for carefully reading this manuscript and helpful suggestions.
 |
FOOTNOTES |
In memoriam Werner Risau (1953-1998).
Submitted October 15, 1998; accepted February 17, 1999.
A.K. and V.R. have contributed equally to this work.
Supported in part by the SFB 397.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Georg Breier, PhD, Max-Planck-Institute for
Physiological and Clinical Research, Parkstrasse 1, D-61231 Bad
Nauheim, Germany; e-mail: g.breier{at}kerckhoff.mpg.de.
 |
REFERENCES |
1.
Risau W, Flamme I:
Vasculogenesis.
Annu Rev Cell Dev Biol
11:73, 1995[Medline]
[Order article via Infotrieve]
2.
Risau W:
Mechanisms of angiogenesis.
Nature
386:671, 1997[Medline]
[Order article via Infotrieve]
3.
Mustonen T, Alitalo K:
Endothelial receptor tyrosine kinases involved in angiogenesis.
J Cell Biol
129:895, 1995[Free Full Text]
4.
Breier G, Damert A, Plate KH, Risau W:
Angiogenesis in embryos and ischemic diseases.
Thromb Haemost
78:678, 1997[Medline]
[Order article via Infotrieve]
5.
Fong GH, Rossant J, Gertsenstein M, Breitman ML:
Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium.
Nature
376:66, 1995[Medline]
[Order article via Infotrieve]
6.
Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC:
Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice.
Nature
376:62, 1995[Medline]
[Order article via Infotrieve]
7.
Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, Fahrig M, Vandenhoeck A, Harpal K, Eberhardt C, Declercq C, Pawling J, Moons L, Collen D, Risau W, Nagy A:
Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele.
Nature
380:435, 1996[Medline]
[Order article via Infotrieve]
8.
Ferrara N, Carvermoore K, Chen H, Dowd M, Lu L, Oshea KS, Powellbraxton L, Hillan KJ, Moore MW:
Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene.
Nature
380:439, 1996[Medline]
[Order article via Infotrieve]
9.
Yamaguchi TP, Dumont D, Conlon RA, Breitman ML, Rossant J:
Flk-1, an Flt-related receptor tyrosine kinase is an early marker for endothelial cell precursors.
Development
118:489, 1993[Abstract]
10.
Kataoka H, Takakura N, Nishikawa S, Tsuchida K, Kodama H, Kunisada T, Risau W, Kita T, Nishikawa SI:
Expressions of PDGF receptor alpha, c-Kit and Flk1 genes clustering in mouse chromosome 5 define distinct subsets of nascent mesodermal cells.
Dev Growth Differ
39:729, 1997[Medline]
[Order article via Infotrieve]
11.
Shalaby F, Ho J, Stanford WL, Fischer KD, Schuh AC, Schwartz L, Bernstein A, Rossant J:
A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis.
Cell
89:981, 1997[Medline]
[Order article via Infotrieve]
12.
Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G:
A common precursor for hematopoietic and endothelial cells.
Development
125:725, 1998[Abstract]
13.
Millauer B, Wizigmann-Voos S, Schnürch H, Martinez R, Moller NP, Risau W, Ullrich A:
High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis.
Cell
72:835, 1993[Medline]
[Order article via Infotrieve]
14.
Kabrun N, Buhring HJ, Choi K, Ullrich A, Risau W, Keller G:
Flk-1 expression defines a population of early embryonic hematopoietic precursors.
Development
124:2039, 1997[Abstract]
15.
Millauer B, Shawver LK, Plate KH, Risau W, Ullrich A:
Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant.
Nature
367:576, 1994[Medline]
[Order article via Infotrieve]
16.
Millauer B, Longhi MP, Plate KH, Shawver LK, Risau W, Ullrich A, Strawn LM:
Dominant-negative inhibition of Flk-1 suppresses the growth of many tumor types in vivo.
Cancer Res
56:1615, 1996[Abstract/Free Full Text]
17.
Rönicke V, Risau W, Breier G:
Characterization of the endothelium-specific murine vascular endothelial growth factor receptor-2 (Flk-1) promoter.
Circ Res
79:277, 1996[Abstract/Free Full Text]
18.
Patterson C, Parrella MA, Hsieh CM, Yoshizumi M, Lee ME, Haber E:
Cloning and functional analysis of the promoter for Kdr/Flk-1, a receptor for vascular endothelial growth factor.
J Biol Chem
270:23111, 1995[Abstract/Free Full Text]
19.
Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, Fujii-Kuriyama Y:
A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1 alpha regulates the VEGF expression and is potentially involved in lung and vascular development.
Proc Natl Acad Sci USA
94:4273, 1997[Abstract/Free Full Text]
20.
Flamme I, Frohlich T, von Reutern M, Kappel A, Damert A, Risau W:
HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-inducible factor-1 alpha and developmentally expressed in blood vessels.
Mech Develop
63:51, 1997[Medline]
[Order article via Infotrieve]
21.
Tian H, McKnight SL, Russell DW:
Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells.
Genes Dev
11:72, 1997[Abstract/Free Full Text]
22.
Quandt K, Frech K, Karas H, Wingender E, Werner T:
MatInd and MatInspector: New fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucl Acids Res
23:4878, 1995[Abstract/Free Full Text]
23.
Schnürch H, Risau W:
Expression of tie-2, a member of a novel family of receptor tyrosine kinases, in the endothelial cell lineage.
Development
119:957, 1993[Abstract/Free Full Text]
24.
Hogan B, Beddington R, Costantini F, Lacy E:
Manipulating the Mouse Embryo: A Laboratory Manual. (ed 2). New York, NY, Cold Spring Harbor Laboratory, 1994.
25.
Schlaeger TM, Qin Y, Fujiwara Y, Magram J, Sato TN:
Vascular endothelial cell lineage-specific promoter in transgenic mice.
Development
121:1089, 1995[Abstract]
26.
Schlaeger TM, Bartunkova S, Lawitts JA, Teichmann G, Risau W, Deutsch U, Sato TN:
Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice.
Proc Natl Acad Sci USA
94:3058, 1997[Abstract/Free Full Text]
27.
Vecchi A, Garlanda C, Lampugnani MG, Resnati M, Matteucci C, Stoppacciaro A, Schnurch H, Risau W, Ruco L, Mantovani A, Dejana E:
Monoclonal antibodies specific for endothelial cells of mouse blood vessels. Their application in the identification of adult and embryonic endothelium.
Eur J Cell Biol
63:247, 1994[Medline]
[Order article via Infotrieve]
28.
Kremer C, Breier G, Risau W, Plate KH:
Up-regulation of flk-1/vascular endothelial growth factor receptor 2 by its ligand in a cerebral slice culture system.
Cancer Res
57:3852, 1997[Abstract/Free Full Text]
29.
Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, Zon LI:
Scl/tal 1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish.
Genes Dev
12:621, 1998[Abstract/Free Full Text]
30.
Visvader JE, Fujiwara Y, Orkin SH:
Unsuspected role for the t cell leukemia protein scl/tal 1 in vascular development.
Genes Dev
12:473, 1998[Abstract/Free Full Text]
31.
Elefanty AG, Robb L, Birner R, Begley CG:
Hematopoietic-specific genes are not induced during in vitro differentiation of Scl-Null embryonic stem cells.
Blood
90:1435, 1997[Abstract/Free Full Text]
32.
Wernert N, Raes MB, Lassalle P, Dehouck MP, Gosselin B, Vandenbunder B, Stehelin D:
c-ets1 proto-oncogene is a transcription factor expressed in endothelial cells during tumor vascularization and other forms of angiogenesis in humans.
Am J Pathol
140:119, 1992[Abstract]
33.
Pardanaud L, Dieterlen-Lievre F:
Expression of C-ETS1 in early chick embryo mesoderm: Relationship to the hemangioblastic lineage.
Cell Adhes Comm
1:151, 1993[Medline]
[Order article via Infotrieve]
34.
Plate KH, Breier G, Risau W:
Molecular mechanisms of developmental and tumor angiogenesis.
Brain Pathol
4:207, 1994[Medline]
[Order article via Infotrieve]
35.
Ferrara N, Bunting S:
Vascular endothelial growth factor, a specific regulator of angiogenesis.
Curr Opin Nephrol Hypertens
5:35-44, 1996[Medline]
[Order article via Infotrieve]
36.
Jahroudi N, Lynch DC:
Endothelial-cell-specific regulation of von Willebrand factor gene expression.
Mol Cell Biol
14:999, 1994[Abstract/Free Full Text]
37.
Aird WC, Jahroudi N, Weiler-Guettler H, Rayburn HB, Rosenberg RD:
Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.
Proc Natl Acad Sci USA
92:4567, 1995[Abstract/Free Full Text]
38.
Jorcyk CL, Garrett LJ, Maroulakou IG, Watson DK, Green JE:
Multiple regulatory regions control the expression of Ets-1 in the developing mouse: Vascular expression conferred by intron I.
Cell Mol Biol (Noisy-le-grand)
43:211, 1997[Medline]
[Order article via Infotrieve]
39.
Korhonen J, Lahtinen I, Halmekyto M, Alhonen L, Janne J, Dumont D, Alitalo K:
Endothelial-specific gene expression directed by the tie gene promoter in vivo.
Blood
86:1828, 1995[Abstract/Free Full Text]
40.
Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY, Semenza GL:
Cellular and developmental control of O2 homeostasis by hypoxia inducible factor 1 alpha.
Genes Dev
12:149, 1998[Abstract/Free Full Text]
41.
Maltepe E, Schmidt JV, Baunoch D, Bradfield CA, Simon MC:
Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT.
Nature
386:403, 1997[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. M. Meadows, M. C. Salanga, and P. A. Krieg
Kruppel-like factor 2 cooperates with the ETS family protein ERG to activate Flk1 expression during vascular development
Development,
April 1, 2009;
136(7):
1115 - 1125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Xu and M. Komatsu
Promoter Cloning and Characterization of the Anti-vascular Proliferation Gene, R-ras: ROLE OF ETS- AND SP-BINDING MOTIFS
J. Biol. Chem.,
January 30, 2009;
284(5):
2706 - 2718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yamashita, O. Ohneda, A. Sakiyama, F. Iwata, K. Ohneda, and Y. Fujii-Kuriyama
The microenvironment for erythropoiesis is regulated by HIF-2{alpha} through VCAM-1 in endothelial cells
Blood,
August 15, 2008;
112(4):
1482 - 1492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ahlbrecht, J. Schmitz, U. Seay, C. Schwarz, R. Mittnacht-Kraus, A. Gaumann, R. V. Haberberger, S. Herold, G. Breier, F. Grimminger, et al.
Spatiotemporal Expression of flk-1 in Pulmonary Epithelial Cells during Lung Development
Am. J. Respir. Cell Mol. Biol.,
August 1, 2008;
39(2):
163 - 170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Kleinschmidt, M. Nassiri, M. S. Stitt, K. Wasserloos, S. C. Watkins, B. R. Pitt, and N. Jahroudi
Sequences in Intron 51 of the von Willebrand Factor Gene Target Promoter Activation to a Subset of Lung Endothelial Cells in Transgenic Mice
J. Biol. Chem.,
February 1, 2008;
283(5):
2741 - 2750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Chen, K. Uchida, A. Endler, and F. Shibasaki
Mammalian Tumor Suppressor Int6 Specifically Targets Hypoxia Inducible Factor 2{alpha} for Degradation by Hypoxia- and pVHL-independent Regulation
J. Biol. Chem.,
April 27, 2007;
282(17):
12707 - 12716.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. R. Mollica, J. T. B. Crawley, K. Liu, J. B. Rance, P. N. Cockerill, G. A. Follows, J.-R. Landry, D. J. Wells, and D. A. Lane
Role of a 5'-enhancer in the transcriptional regulation of the human endothelial cell protein C receptor gene
Blood,
August 15, 2006;
108(4):
1251 - 1259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Licht, F. Muller-Holtkamp, I. Flamme, and G. Breier
Inhibition of hypoxia-inducible factor activity in endothelial cells disrupts embryonic cardiovascular development
Blood,
January 15, 2006;
107(2):
584 - 590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ema, S. Takahashi, and J. Rossant
Deletion of the selection cassette, but not cis-acting elements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal progenitors
Blood,
January 1, 2006;
107(1):
111 - 117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hirai, I. M Samokhvalov, T. Fujimoto, S. Nishikawa, J. Imanishi, and S.-I. Nishikawa
Involvement of Runx1 in the down-regulation of fetal liver kinase-1 expression during transition of endothelial cells to hematopoietic cells
Blood,
September 15, 2005;
106(6):
1948 - 1955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hisatsune, K. Matsumura, M. Ogawa, A. Uemura, N. Kondo, J. K. Yamashita, H. Katsuta, S. Nishikawa, T. Chiba, and S.-I. Nishikawa
High level of endothelial cell-specific gene expression by a combination of the 5' flanking region and the 5' half of the first intron of the VE-cadherin gene
Blood,
June 15, 2005;
105(12):
4657 - 4663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-J. Duan, Y. Zhang-Benoit, and G.-H. Fong
Endothelium-Intrinsic Requirement for Hif-2{alpha} During Vascular Development
Circulation,
May 3, 2005;
111(17):
2227 - 2232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Eguchi, M. Eguchi-Ishimae, A. Green, T. Enver, and M. Greaves
Directing oncogenic fusion genes into stem cells via an SCL enhancer
PNAS,
January 25, 2005;
102(4):
1133 - 1138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shi, B. Reitmaier, J. Regenbogen, R. M. Slowey, S. R. Opalenik, E. Wolf, A. Goppelt, and J. M. Davidson
CARP, a Cardiac Ankyrin Repeat Protein, Is Up-Regulated during Wound Healing and Induces Angiogenesis in Experimental Granulation Tissue
Am. J. Pathol.,
January 1, 2005;
166(1):
303 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Freeburg and D. R. Abrahamson
Divergent Expression Patterns for Hypoxia-Inducible Factor-1{beta} and Aryl Hydrocarbon Receptor Nuclear Transporter-2 in Developing Kidney
J. Am. Soc. Nephrol.,
October 1, 2004;
15(10):
2569 - 2578.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hegen, S. Koidl, K. Weindel, D. Marme, H. G. Augustin, and U. Fiedler
Expression of Angiopoietin-2 in Endothelial Cells Is Controlled by Positive and Negative Regulatory Promoter Elements
Arterioscler Thromb Vasc Biol,
October 1, 2004;
24(10):
1803 - 1809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Takeda, K. Maemura, Y. Imai, T. Harada, D. Kawanami, T. Nojiri, I. Manabe, and R. Nagai
Endothelial PAS Domain Protein 1 Gene Promotes Angiogenesis Through the Transactivation of Both Vascular Endothelial Growth Factor and Its Receptor, Flt-1
Circ. Res.,
July 23, 2004;
95(2):
146 - 153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Hopfl, O. Ogunshola, and M. Gassmann
HIFs and tumors--causes and consequences
Am J Physiol Regulatory Integrative Comp Physiol,
April 1, 2004;
286(4):
R608 - R623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nakamura, S. Esnault, T. Maeda, E. A. B. Kelly, J. S. Malter, and N. N. Jarjour
Ets-1 Regulates TNF-{alpha}-Induced Matrix Metalloproteinase-9 and Tenascin Expression in Primary Bronchial Fibroblasts
J. Immunol.,
February 1, 2004;
172(3):
1945 - 1952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Zhang, Z. Fang, P. R. Contag, A. F. Purchio, and D. B. West
Tracking angiogenesis induced by skin wounding and contact hypersensitivity using a Vegfr2-luciferase transgenic mouse
Blood,
January 15, 2004;
103(2):
617 - 626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Coulet, S. Nadaud, M. Agrapart, and F. Soubrier
Identification of Hypoxia-response Element in the Human Endothelial Nitric-oxide Synthase Gene Promoter
J. Biol. Chem.,
November 21, 2003;
278(47):
46230 - 46240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Freeburg and D. R. Abrahamson
Hypoxia-Inducible Factors and Kidney Vascular Development
J. Am. Soc. Nephrol.,
November 1, 2003;
14(11):
2723 - 2730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ishida, R. K. Kundu, E. Yang, K.-i. Hirata, Y.-D. Ho, and T. Quertermous
Targeted Disruption of Endothelial Cell-selective Adhesion Molecule Inhibits Angiogenic Processes in Vitro and in Vivo
J. Biol. Chem.,
September 5, 2003;
278(36):
34598 - 34604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, M. Moser, V. L. Bautch, and C. Patterson
HoxB5 Is an Upstream Transcriptional Switch for Differentiation of the Vascular Endothelium from Precursor Cells
Mol. Cell. Biol.,
August 15, 2003;
23(16):
5680 - 5691.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Rance, G. A. Follows, P. N. Cockerill, C. Bonifer, D. A. Lane, and R. E. Simmonds
Regulation of the human endothelial cell protein C receptor gene promoter by multiple Sp1 binding sites
Blood,
June 1, 2003;
101(11):
4393 - 4401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Freeburg, B. Robert, P. L. St. John, and D. R. Abrahamson
Podocyte Expression of Hypoxia-Inducible Factor (HIF)-1 and HIF-2 during Glomerular Development
J. Am. Soc. Nephrol.,
April 1, 2003;
14(4):
927 - 938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Elvert, A. Kappel, R. Heidenreich, U. Englmeier, S. Lanz, T. Acker, M. Rauter, K. Plate, M. Sieweke, G. Breier, et al.
Cooperative Interaction of Hypoxia-inducible Factor-2alpha (HIF-2alpha ) and Ets-1 in the Transcriptional Activation of Vascular Endothelial Growth Factor Receptor-2 (Flk-1)
J. Biol. Chem.,
February 21, 2003;
278(9):
7520 - 7530.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hirai, M. Ogawa, N. Suzuki, M. Yamamoto, G. Breier, O. Mazda, J. Imanishi, and S.-I. Nishikawa
Hemogenic and nonhemogenic endothelium can be distinguished by the activity of fetal liver kinase (Flk)-1 promoter/enhancer during mouse embryogenesis
Blood,
February 1, 2003;
101(3):
886 - 893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. ILJIN, T. V. PETROVA, T. VEIKKOLA, V. KUMAR, M. POUTANEN, and K. ALITALO
A fluorescent Tie1 reporter allows monitoring of vascular development and endothelial cell isolation from transgenic mouse embryos
FASEB J,
November 1, 2002;
16(13):
1764 - 1774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Favier, P.-F. Plouin, P. Corvol, and J.-M. Gasc
Angiogenesis and Vascular Architecture in Pheochromocytomas : Distinctive Traits in Malignant Tumors
Am. J. Pathol.,
October 1, 2002;
161(4):
1235 - 1246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Hadri, A. Ozog, F. Soncin, and A.-M. Lompre
Basal Transcription of the Mouse Sarco(endo)plasmic Reticulum Ca2+-ATPase Type 3 Gene in Endothelial Cells Is Controlled by Ets-1 and Sp1
J. Biol. Chem.,
September 20, 2002;
277(39):
36471 - 36478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. D. Lang, A. Kappel, and G. J. Goodall
Hypoxia-inducible Factor-1alpha mRNA Contains an Internal Ribosome Entry Site That Allows Efficient Translation during Normoxia and Hypoxia
Mol. Biol. Cell,
May 1, 2002;
13(5):
1792 - 1801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-i. Minehata, Y.-s. Mukouyama, T. Sekiguchi, T. Hara, and A. Miyajima
Macrophage colony stimulating factor modulates the development of hematopoiesis by stimulating the differentiation of endothelial cells in the AGM region
Blood,
April 1, 2002;
99(7):
2360 - 2368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. McLeod, M. Taomoto, J. Cao, Z. Zhu, L. Witte, and G. A. Lutty
Localization of VEGF Receptor-2 (KDR/Flk-1) and Effects of Blocking It in Oxygen-Induced Retinopathy
Invest. Ophthalmol. Vis. Sci.,
February 1, 2002;
43(2):
474 - 482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Onita, P. G. Ji, J. W. Xuan, H. Sakai, H. Kanetake, P. H. Maxwell, G.-H. Fong, M. Y Gabril, M. Moussa, and J. L. Chin
Hypoxia-induced, Perinecrotic Expression of Endothelial Per-ARNT-Sim Domain Protein-1/Hypoxia-inducible Factor-2{alpha} Correlates with Tumor Progression, Vascularization, and Focal Macrophage Infiltration in Bladder Cancer
Clin. Cancer Res.,
February 1, 2002;
8(2):
471 - 480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Brusselmans, F. Bono, P. Maxwell, Y. Dor, M. Dewerchin, D. Collen, J.-M. Herbert, and P. Carmeliet
Hypoxia-inducible Factor-2alpha (HIF-2alpha ) Is Involved in the Apoptotic Response to Hypoglycemia but Not to Hypoxia
J. Biol. Chem.,
October 12, 2001;
276(42):
39192 - 39196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Rowntree, G. Vassaux, T. L. McDowell, S. Howe, A. McGuigan, M. Phylactides, C. Huxley, and A. Harris
An element in intron 1 of the CFTR gene augments intestinal expression in vivo
Hum. Mol. Genet.,
July 1, 2001;
10(14):
1455 - 1464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. ILJIN, M. J. KARKKAINEN, E. C. LAWRENCE, M. A. KIMAK, M. UUTELA, J. TAIPALE KATRI PAJUSOLA LEENA ALHONEN, M. HALMEKYTO, D. N. FINEGOLD, R. E. FERRELL, and K. ALITALO
VEGFR3 gene structure, regulatory region, and sequence polymorphisms
FASEB J,
April 1, 2001;
15(6):
1028 - 1036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Huss, C. F. Hanrahan, R. J. Barrios, J. W. Simons, and N. M. Greenberg
Angiogenesis and Prostate Cancer: Identification of A Molecular Progression Switch
Cancer Res.,
March 1, 2001;
61(6):
2736 - 2743.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Heidenreich, A. Kappel, and G. Breier
Tumor Endothelium-specific Transgene Expression Directed by Vascular Endothelial Growth Factor Receptor-2 (Flk-1) Promoter/Enhancer Sequences1,2
Cancer Res.,
November 1, 2000;
60(21):
6142 - 6147.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Kappel, T. M. Schlaeger, I. Flamme, S. H. Orkin, W. Risau, and G. Breier
Role of SCL/Tal-1, GATA, and Ets transcription factor binding sites for the regulation of Flk-1 expression during murine vascular development
Blood,
November 1, 2000;
96(9):
3078 - 3085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Peng, L. Zhang, L. Drysdale, and G.-H. Fong
The transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role in vascular remodeling
PNAS,
June 30, 2000;
(2000)
140087397.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. J. H. Marti, M. Bernaudin, A. Bellail, H. Schoch, M. Euler, E. Petit, and W. Risau
Hypoxia-Induced Vascular Endothelial Growth Factor Expression Precedes Neovascularization after Cerebral Ischemia
Am. J. Pathol.,
March 1, 2000;
156(3):
965 - 976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lando, I. Pongratz, L. Poellinger, and M. L. Whitelaw
A Redox Mechanism Controls Differential DNA Binding Activities of Hypoxia-inducible Factor (HIF) 1alpha and the HIF-like Factor
J. Biol. Chem.,
February 18, 2000;
275(7):
4618 - 4627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Veikkola, M. Karkkainen, L. Claesson-Welsh, and K. Alitalo
Regulation of Angiogenesis via Vascular Endothelial Growth Factor Receptors
Cancer Res.,
January 1, 2000;
60(2):
203 - 212.
[Full Text]
|
 |
|

|
 |

|
 |
 
F. M. Faraci and C. D. Sigmund
Vascular Biology in Genetically Altered Mice : Smaller Vessels, Bigger Insight
Circ. Res.,
December 3, 1999;
85(12):
1214 - 1225.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Minami, R. D. Rosenberg, and W. C. Aird
Transforming Growth Factor-beta 1-mediated Inhibition of the flk-1/KDR Gene Is Mediated by a 5'-Untranslated Region Palindromic GATA Site
J. Biol. Chem.,
February 9, 2001;
276(7):
5395 - 5402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Peng, L. Zhang, L. Drysdale, and G.-H. Fong
The transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role in vascular remodeling
PNAS,
July 18, 2000;
97(15):
8386 - 8391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. V. Kalinichenko, Y. Zhou, B. Shin, D. B. Stolz, S. C. Watkins, J. A. Whitsett, and R. H. Costa
Wild-type levels of the mouse Forkhead Box f1 gene are essential for lung repair
Am J Physiol Lung Cell Mol Physiol,
June 1, 2002;
282(6):
L1253 - L1265.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|