|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 12 (June 15), 1999:
pp. 4354-4364
Fusion of the ets Transcription Factor TEL to Jak2 Results in
Constitutive Jak-Stat Signaling
By
Jen M.-Y. Ho,
Bryan K. Beattie,
Jeremy A. Squire,
David A. Frank, and
Dwayne L. Barber
From the Division of Cellular and Molecular Biology, Ontario Cancer
Institute, Toronto, Ontario, Canada; the Department of Laboratory
Medicine and Pathobiology, Toronto Hospital, Toronto, Ontario, Canada;
the Departments of Medical Biophysics and Laboratory Medicine and
Pathobiology, University of Toronto, Toronto, Ontario, Canada; and the
Dana-Farber Cancer Institute, Boston, MA.
 |
ABSTRACT |
To study constitutive Janus kinase signaling, chimeric
proteins were generated between the pointed domain of the ets
transcription factor TEL and the cytosolic tyrosine kinase Jak2. The
effects of these proteins on interleukin-3 (IL-3)-dependent
proliferation of the hematopoietic cell line, Ba/F3, were studied.
Fusion of TEL to the functional kinase (JH1) domain of Jak2 resulted in conversion of Ba/F3 cells to factor-independence. Importantly, fusion
of TEL to the Jak2 pseudokinase (JH2) domain or a kinase-inactive Jak2
JH1 domain had no effect on IL-3-dependent proliferation of Ba/F3
cells. Active TEL-Jak2 constructs (consisting of either Jak2 JH1 or
Jak2 JH2+JH1 domain fusions) were constitutively
tyrosine-phosphorylated but did not affect phosphorylation of
endogeneous Jak1, Jak2, or Jak3. TEL-Jak2 activation resulted in the
constitutive tyrosine phosphorylation of Stat1, Stat3, and Stat5 as
determined by detection of phosphorylation using activation-specific
antibodies and by binding of each protein to a preferential GAS
sequence in electrophoretic mobility shift assays. Elucidation of
signaling events downstream of TEL-Jak2 activation may provide insight
into the mechanism of leukemogenesis mediated by this oncogenic fusion protein.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE Jak-Stat SIGNALING pathway plays a
critical role in hematopoiesis. Many constituents of this pathway are
essential for normal hematopoietic development, including
Jak1,1 Jak2,2,3 Jak3,4-7
Stat3,8 Stat4,9,10 Stat5,11 and
Stat6.10,12 Because arrested differentiation may contribute
to leukemias, the role of this signaling pathway in leukemogenesis is
of considerable interest.
Constitutive tyrosine phosphorylation of Jak2 and Stat5 have been
identified in cell lines derived from acute myelogenous leukemia
(AML),13,14 acute lymphoblastic leukemia
(ALL),14,15 chronic myelogeneous leukemia
(CML),14 and Burkitt's lymphoma14 patients.
However, because many of these cell lines were isolated from relapsed
patients, it is difficult to assess if the activation of the individual
Jak and Stat molecules is a primary or secondary event. The direct
involvement of Janus kinases in leukemogenesis was illustrated
by the discovery of an activating mutation within the JH2 domain of the
Drosophila Janus kinase homolog, hopscotch.16 A
glutamate to lysine substitution at amino acid 695 causes an overproliferation of Drosophila plasmatocytes, resulting in a lethal phenotype.16 Introduction of a corresponding
mutation within Jak2 produced an enzyme with increased catalytic
activity, but when overexpressed in Ba/F3 cells offered no
proliferative advantage.16
Activated tyrosine kinases have been shown to participate in
leukemogenesis. In CML, the Bcr-abl fusion protein generated by a
t(9;22) translocation mediates its biological effects through deregulated tyrosine kinase activity.17 The ets
transcription factor TEL has been shown to undergo translocation to two
different tyrosine kinases, abl18,19 and
PDGF-R ,20 which results in constitutive activation of
each kinase. We were interested in generating a constitutively active
Jak to directly address its functional effect in hematopoietic cells.
We reasoned that fusion of the helix-loop-helix domain of TEL to Jak2
may generate an active Jak molecule.
In this study, we have generated several TEL-Jak2 fusion proteins and
have examined their functional properties by expression in the
hematopoietic cell line, Ba/F3. Fusion of TEL to constructs expressing
either the kinase (JH1) domain or the kinase and pseudokinase (JH2+JH1)
domains of Jak2 results in constitutive activation. In addition, active
TEL-Jak2 tyrosine phosphorylates the downstream transcription factors
Stat1, Stat3, and Stat5. During the course of this research, 3 patients
have been described that express TEL-JAK2 [t(9;12)(p24;p13)]
translocations.21,22 This study characterizes the Jak-Stat
activation profile mediated by TEL-Jak2 translocation.
| |
MATERIALS AND METHODS |
Generation of TEL-Jak2 constructs.
The regions encompassing nt 1-462 of TEL, nt 1627-2535 of
Jak2 (Jak2 JH2), nt 1627-3391 of Jak2 (Jak2 JH2+JH1), and
nt 2536-3391 of Jak2 (Jak2 JH1 and KI-Jak2 JH1) were generated
by polymerase chain reaction (PCR) using Vent Polymerase (New England
Biolabs, Beverly, MA). A Kpn I site was incorporated into the
forward TEL primer, a BamHI site was incorporated into
the reverse TEL primer and each forward Jak2 primer,
and an EcoRI site was added to each reverse Jak2
primer. The templates for PCR corresponded to TEL, TEL- PNT (TEL constructs were supplied by Dr D.G.
Gilliland, Boston, MA), murine Jak2, or a
kinase-inactive form of murine Jak2 (KI-Jak2) kindly provided
by Dr D. Wojchowski (University Park, PA).23 PCR products were subcloned into pCR-Script (Stratagene, La Jolla, CA).
TEL-Jak2 chimeras were generated by digestion with Kpn
I-BamHI (TEL) or BamHI-EcoRI
(Jak2) and subcloned into the mammalian expression vector
pcDNA3 (Invitrogen, Carlsbad, CA) digested with
Kpn I-EcoRI.
TEL-Jak2 constructs were tagged by the addition of an
HA3-His6 epitope that was added by PCR overlap
extension. One fragment corresponding to the
HA3-His6 epitope and a second fragment
corresponding to nt 1-462 of TEL were generated. Overlap
extension was performed, and the resulting product was subcloned into
pcDNA3-TEL-Jak2 digested with HindIII and
Eco47III. The sequence of all constructs was confirmed by
sequencing both strands.
Antibodies.
A pan-specific Jak antibody was raised against the Jak2 JH1 domain, as
previously described.24 Peptide-specific antibodies to
Jak1, Jak2, and Jak3 were obtained from Upstate Biochemical Inc (Lake
Placid, NY). Activation-specific Stat1,25
Stat3,26 and Stat527 antibodies were raised to
a phosphopeptide corresponding to the conserved site of tyrosine
phosphorylation of each protein. A Stat1 polyclonal antibody was
generously provided by Dr David Levy (New York , NY), Stat1 and Stat3
monoclonal antibodies were obtained from Transduction Laboratories
(Lexington, KY), a polyclonal Stat3 antibody was purchased from Zymed
Laboratories (San Francisco, CA), and a peptide-specific Stat5 antibody
was generously provided by Dr James Ihle (Memphis, TN).
COS cell expression.
COS-7 cells were transfected using the diethyl aminoethyl
(DEAE)-dextran, chloroquine method.16 Cells
were incubated for 3.5 hours in DEAE-dextran-chloroquine with 5 µg of
each TEL-Jak2 construct. Cells were then incubated in
phosphate-buffered saline (PBS)-10% dimethyl sulfoxide for 2 minutes,
washed once in PBS, and incubated in Dulbecco's modified Eagle's
medium for 72 hours before harvest. The plates were washed once in a
solution containing 10 mmol/L HEPES, Hank's Balanced Salts, 10 mmol/L
Na2P2O7, 10 mmol/L NaF, 1 mmol/L
Na3VO4, and 5 mmol/L EDTA. Lysates were then prepared in a buffer containing 50 mmol/L TrisHCl (pH 8.0), 150 mmol/L
NaCl, 1% Triton X-100, 10 mmol/L
Na2P2O7, 10 mmol/L NaF, 10 mmol/L
EDTA, 1 mmol/L Na3VO4, 1 µmol/L
phenylmethylsulfonyl fluoride (PMSF), 1 µg/mL aprotinin, 1 µg/mL
leupeptin, and 2 µg/mL pepstatin A (buffer A). Fifty micrograms of
lysate was resolved via sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to nitrocellulose. Tyrosine
phosphorylation was detected by incubating the membrane with the
monoclonal antiphosphotyrosine antibody, 4G10 (generously provided by
Dr Brian Druker, Portland, OR), followed by horseradish peroxidase
(HRP)-sheep antimouse IgG. Immunoreactive proteins were
detected by enhanced chemiluminescence (ECL).
Expression of TEL-Jak2 in Ba/F3 cells.
Various TEL-Jak2 constructs were electroporated into the interleukin-3
(IL-3)-dependent cell line, Ba/F3. Populations of G418-resistant cells
were isolated and individual subclones were isolated via limiting dilution.
To analyze the growth properties of each TEL-Jak2 construct, various
Ba/F3 TEL-Jak2 subclones were washed three times in PBS and resuspended
in RPMI complete medium. Cells were incubated at 5 × 104 cells/mL in the absence or presence of 100 pg/mL IL-3.
The number of viable cells was enumerated during each day by trypan
blue exclusion.
The expression of each TEL-Jak2 construct was confirmed by performing
metabolic labeling and immunoprecipitation using a pan-specific Jak
antibody. Cells were incubated in the presence of
35S-cys/35S-met for 2 hours. After lysis and
preimmune clearance overnight, 5 µL of pan Jak or 2 µL of a
peptide-specific Jak2 antibody was added for 1 hour, followed by 30 µL of protein A-Sepharose. After washing, bound proteins were
resolved via SDS-PAGE. The gel was fixed in glacial acetic acid,
incubated in 50% (wt/vol) 2,5-diphenyloxazole prepared in glacial
acetic acid, and dried, and labeled proteins were analyzed by
PhosphorImager detection (Molecular Dynamics, Sunnyvale, CA).
Analysis of tyrosine phosphorylation.
Ba/F3 TEL-Jak2 subclones were depleted of cytokine for 4 hours and then
stimulated in the presence or absence of 100 ng/mL IL-3 for 5 minutes.
Lysates were prepared in buffer A.
For the analysis of TEL-Jak2 and endogeneous Jak kinase
phosphorylation, 2 mg of lysate was incubated with the appropriate antibody and immune complexes were captured on protein A-Sepharose. Bound proteins were resolved via SDS-PAGE and transferred to
nitrocellulose. After blocking, the membrane was incubated with a
monoclonal antiphosphotyrosine antibody, 4G10. After washing, the
membrane was incubated with HRP-sheep antimouse IgG. The membrane was
washed extensively for 30 minutes and tyrosine-phosphorylated proteins
were detected by ECL.
For analysis of Stat tyrosine phosphorylation, 100 µg of each lysate
was resolved via SDS-PAGE and transferred to nitrocellulose. The
membrane was blocked and then incubated with the appropriate activation-specific Stat antibody, followed by HRP-protein A and ECL
detection. Each membrane was then stripped and reprobed with the
appropriate Stat antibody.
Electrophoretic mobility shift assays (EMSAs).
Nuclear extracts were prepared from Ba/F3 TEL-Jak2 subclones stimulated
in the presence or absence of 100 ng/mL IL-3. Cell pellets were
resuspended in 1.0 mL of buffer B (10 mmol/L HEPES [pH 7.9], 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.5 mmol/L dithiothreitol [DTT], 1 mmol/L PMSF, 5 µg of aprotinin per milliliter, 5 µg of leupeptin per milliliter, and 5 µg of pepstatin A per milliliter) and
allowed to swell on ice for 10 minutes. Cells were then vortexed for 10 seconds and centrifuged at 10,000g for 10 seconds, and the
supernatant was discarded. The pellet was washed once in buffer B and
then nuclear proteins were resuspended in an appropriate volume of
buffer C (20 mmol/L HEPES [pH 7.9], 25% glycerol, 420 mmol/L NaCl,
1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5 mmol/L DTT, 1 mmol/L
PMSF, 5 µg of aprotinin per milliliter, 5 µg of leupeptin per
milliliter, and 5 µg of pepstatin A per milliliter).
Gel shift experiments were performed with a double-stranded
32P-labeled oligonucleotide derived from the -casein
promoter (AGATTTCTAGGAATTCAAATC)28 or from the IRF-1
promoter (CTGATTTCCCCGAAATGAC).29 Two micrograms of nuclear
extract was mixed with 0.25 ng of the 32P-labeled
oligonucleotide in 20 µL of binding buffer [13 mmol/L HEPES (pH
7.9), 65 mmol/L NaCl, 1 mmol/L DTT, 0.15 mmol/L EDTA, 8% glycerol, 50 µg of poly (dI-dC) per milliliter] for 20 minutes at 4°C. For
competition experiments, a 50-fold excess of either the unlabeled
-casein or IRF-1 oligonucleotide (specific) or an oligonucleotide
derived from the DUB-1 promoter (nonspecific)30 was added
to the binding reaction. For supershifting experiments, a
peptide-specific Stat1 (Dr David Levy), Stat3 (Zymed), or a Stat5
antibody (Dr James Ihle) was added at the completion of the binding
reaction and incubated for an additional 20 minutes at 4°C.
| |
RESULTS |
Generation of TEL-Jak2 constructs.
To assess the activity of TEL-Jak2 fusion proteins, five chimeric
constructs were prepared. Fusions were generated between the exon 4 breakpoint of TEL at amino acid 154 to various regions of Jak2.
Chimeric TEL-Jak2 proteins were generated to the functional kinase
(JH1) domain of Jak2 (TEL-Jak2 JH1), the pseudokinase (JH2) and kinase
(JH1) domain (TEL-Jak2 JH2+JH1), and the pseudokinase domain (TEL-Jak2
JH2). To test for the involvement of the helix-loop-helix or
pointed31 domain (conserved in a subset of ets proteins
including TEL) in Jak2 activation, a construct was created that deletes amino acids 65-116 of TEL (TELPNT-TEL-Jak2 JH1).32 TEL
was also fused to a kinase-inactive form of Jak2 (TEL-Jak2-KI-Jak2). Subsequently, the constructs were epitope tagged at the amino terminus
with HA3HIS6 (HA) (see Materials and Methods
for further details).
The TEL-Jak2 constructs (Fig 1) were first
expressed in COS cells and tyrosine phosphorylation was analyzed to
determine kinase activation (Fig 2).
HA-TEL-Jak2 JH1 (lane 1) and HA-TEL-Jak2 JH2+JH1 (lane 4) were both
tyrosine-phosphorylated. However, the HA-TEL-Jak2 JH2 fusion protein
was not tyrosine-phosphorylated (lane 3), indicating that fusion of TEL
to the Jak2 pseudokinase domain did not result in an active kinase.
Similarly, a fusion protein consisting of TEL and a kinase-inactive
version of Jak2 was not tyrosine-phosphorylated (lane 5). The pointed
domain of TEL is also required for TEL-Jak2 activation, because
HA-TELPNT-Jak2 JH1 was not tyrosine-phosphorylated in this
experiment (lane 2).
View larger version (19K):
[in this window]
[in a new window]
| Fig 1.
TEL-Jak2 constructs. The various TEL-Jak2 constructs that
were used in this study. TEL-Jak2 JH1 corresponds to TEL (amino acids
1-154) fused to the JH1 domain of Jak2 (amino acids 846-1129). The
TEL PNT construct fuses TEL deleted in amino acids (65-116) to the
Jak2 JH1 domain (amino acids 846-1129). TEL-Jak2 JH2 encompasses a
fusion of TEL (1-154) to amino acids 543-845 of Jak2. The TEL-Jak2
JH2+JH1 construct fuses TEL (1-154) to amino acids 543-1129 of Jak2.
TEL-KI-Jak2 JH1 fuses TEL (1-154) to a kinase-inactive form of Jak2
(amino acids 846-1129). All constructs were epitope tagged at the amino
terminus with HA3His6 (HA). For additional
details, please refer to Materials and Methods.
|
|
View larger version (29K):
[in this window]
[in a new window]
| Fig 2.
TEL-Jak2 JH1 and TEL-Jak2 JH2+JH1 are constitutively
tyrosine-phosphorylated in COS cells. COS cells were transfected with
the constructs as indicated. Fifty micrograms of lysate was resolved
via SDS-PAGE and transferred to nitrocellulose. The membrane was
incubated with a monoclonal antiphosphotyrosine antibody followed by
HRP-sheep antimouse IgG. The position of each tyrosine-phosphorylated
protein and molecular weight standards are indicated.
|
|
Expression of TEL-Jak2 JH1 results in conversion of Ba/F3 cells to
factor independence.
To determine the biological activity of these fusion proteins, TEL-Jak2
constructs were expressed in the IL-3-dependent murine cell line,
Ba/F3. Individual G418-resistant subclones were isolated by limiting
dilution and the level of expression was examined by metabolic labeling
(Fig 3). Labeled lysates were either
immunoprecipitated with an anti-Jak2 JH2 domain antibody (HA-TEL-Jak2
JH2) or an anti-Jak2 JH1 domain antibody (remaining constructs) and,
after SDS-PAGE, proteins were visualized by fluorography. The expected molecular weights for each of the fusion proteins are HA-TEL-Jak2 JH1
(56 kD), HA-TEL-Jak2 JH2 (55 kD), HA-TEL-Jak2 JH2+JH1 (95 kD), and
HA-TEL-KI-Jak2 JH1 (56 kD). Because of tyrosine phosphorylation, HA-TEL-Jak2 JH1 and HA-TEL-Jak2 JH2+JH1 migrated at a slightly higher
molecular weight. Subclones that had similar expression levels were
selected for the remaining studies.
View larger version (53K):
[in this window]
[in a new window]
| Fig 3.
Expression of TEL-Jak2 fusion proteins in Ba/F3 cells.
Ba/F3 (lanes 1 and 6), Ba/F3-HA-TEL-Jak2 JH1 subclone 36 (lane 2),
Ba/F3-HA-TEL-Jak2 JH2+JH1 subclone 23 (lane 3), Ba/F3-HA-TEL-KI-Jak2
JH1 subclone 11 (lane 4), and Ba/F3-HA-TEL-Jak2 JH2 subclone 4 (lane 5)
were metabolically labeled with
35S-cys/35S-met. Immunoprecipitations were
conducted with Jak2 antibodies that recognized the Jak2 JH1 domain (pan
Jak, lanes 1 through 4) or Jak2 JH2 domain (Jak2, lanes 5 and 6).
Immunoreactive species were analyzed via PhosphorImager detection.
|
|
Because the HA-TEL-Jak2 JH1 construct was constitutively
tyrosine-phosphorylated in COS cells, we were interested in determining if this construct offered a proliferative advantage when expressed in
the Ba/F3 cell line. A proliferation assay was performed by monitoring
the numbers of cells accumulated over a 4-day period when
Ba/F3-TEL-Jak2 subclones were incubated in the presence or absence of
IL-3 (Fig 4). HA-TEL-Jak2 JH1 subclone
cells grew in the absence of IL-3 during the period of this experiment.
As expected, the expression of HA-TEL-Jak2 JH2 had no effect on
IL-3-dependent growth, and this cell line was incapable of
proliferation in the absence of exogenous cytokine. Importantly, Ba/F3
cells expressing HA-TEL-KI-Jak2 JH1 did not display factor-independent
growth in RPMI complete medium and there was no alteration in
IL-3-dependent growth when compared with untransfected Ba/F3 cells
(data not shown). This indicates that a kinase-inactive TEL-Jak2 fusion protein does not interfere with the IL-3-dependent activation of
endogeneous Jak1 or Jak2. Ba/F3 cells expressing untagged versions of
the identical TEL-Jak2 constructs were tested in the same assay and
showed identical growth properties. As a result, HA-tagged constructs
were used in the remainder of the study.
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
TEL-Jak2 JH1 transforms Ba/F3 cells to
factor-independence. Ba/F3 cells (5 × 104 cells)
expressing various TEL-Jak2 constructs were incubated in the presence
or absence of 100 pg/mL IL-3 for 4 days. Viable cells were enumerated
by Trypan blue exclusion. ( ) Ba/F3, no IL-3; ( ) Ba/F3, plus IL-3;
( ) Ba/F3-HA-TEL-Jak2 JH1 subclone 36, no IL-3; ( )
Ba/F3-HA-TEL-Jak2 JH1 subclone 36, plus IL-3; () Ba/F3-HA-TEL-Jak2
JH2 subclone 4, no IL-3; ( ) Ba/F3-HA-TEL-KI-Jak2 subclone 11, no
IL-3. The IL-3-dependent growth of Ba/F3-TEL-Jak2 JH2 and
Ba/F3-TEL-KI-Jak2 JH1 was exactly similar to that of Ba/F3 cells and
has been omitted for clarity.
|
|
Activated TEL-Jak2 constructs are constitutively
tyrosine-phosphorylated in Ba/F3 cells.
Once it was determined that activated TEL-Jak2 constructs resulted in
IL-3-independent proliferation in Ba/F3 cells, tyrosine phosphorylation of the chimeric proteins was examined
(Fig 5). Individual Ba/F3 subclones
expressing each TEL-Jak2 construct were incubated in the presence or
absence of IL-3 and the tyrosine phosphorylation of each construct was
analyzed. Two subclones of Ba/F3-HA-TEL-Jak2 JH1 cells displayed
constitutive tyrosine phosphorylation of a 56-kD protein (lanes 4 and
5). Similarly, Ba/F3-HA-TEL-Jak2 JH2+JH1 subclones expressed a 95-kD
protein that was constitutively tyrosine-phosphorylated (lanes 9 and
11). As observed in the COS cell experiments, the HA-TEL-Jak2 JH2
(lanes 7 and 8) and HA-TEL-KI-Jak2 JH1 (lanes 13 and 14) chimeras were not tyrosine-phosphorylated when expressed in Ba/F3 cells. Whereas IL-3
activated the tyrosine phosphorylation of Jak2 in all cell lines, IL-3
did not stimulate the tyrosine phosphorylation of HA-TEL-Jak2 JH2 (lane
8) or HA-TEL-KI-Jak2 JH1 (lane 14), indicating that the IL-3 receptor
does not couple to TEL-Jak2 in Ba/F3 cells.
View larger version (46K):
[in this window]
[in a new window]
| Fig 5.
TEL-Jak2 fusion proteins are constitutively
tyrosine-phosphorylated in Ba/F3 cells. Ba/F3 (lanes 1, 2, 15, and 16),
Ba/F3 HA-TEL-Jak2 JH1 subclone 18 (lanes 3, 4, 17, and 18), Ba/F3
HA-TEL-Jak2 JH1 subclone 36 (lanes 5 and 6), Ba/F3 HA-TEL-Jak2 JH2
subclone 4 (lanes 7 and 8), Ba/F3 HA-TEL-Jak2 JH2+JH1 subclone 23 (lanes 9 and 10), Ba/F3 HA-TEL-Jak2 JH2+JH1 subclone 31 (lanes 11 and
12), and Ba/F3 HA-TEL-KI-Jak2 subclone 11 (lanes 13 and 14) cells were
depleted of cytokine and stimulated in the presence or absence of IL-3.
Lysates were immunoprecipitated with an antibody that recognizes the
Jak2 JH1 domain (pan Jak, lanes 1 through 6 and 9 through 14) or the
Jak2 JH2 domain (Jak2, lanes 7 and 8) and tyrosine-phosphorylated
proteins were detected by immunoblotting with a monoclonal
antiphosphotyrosine antibody. Lysate controls are shown in lanes 15 through 18. The mobility of tyrosine-phosphorylated Jak2, HA-TEL-Jak2
JH1, and HA-TEL-Jak2 JH2+JH1 are indicated.
|
|
TEL-Jak2 tyrosine phosphorylation does not activate tyrosine kinase
activity of endogenous Janus kinases.
Because expression of HA-TEL-Jak2 JH1 in Ba/F3 cells resulted in
factor-independent proliferation and constitutive tyrosine phosphorylation of the resulting fusion protein, we were interested in
determining whether the HA-TEL-Jak2 chimeras could activate the
tyrosine phosphorylation of the endogenous Jak kinases. Ba/F3 or Ba/F3
HA-TEL-Jak2 JH1 cells were incubated in the absence or presence of IL-3
and the tyrosine phosphorylation of Jak1 and Jak2 was assessed
(Fig 6A). IL-3 stimulation resulted in the
tyrosine phosphorylation of Jak1 (lane 4) and Jak2 (lane 6) in Ba/F3
cells. Despite constitutive tyrosine phosphorylation of HA-TEL-Jak2 JH1 in the absence of IL-3 stimulation (lanes 7 and 11), no tyrosine phosphorylation of Jak1 or Jak2 was observed using a pan-Jak antibody (lane 7), a Jak1 antibody (lane 9), or a Jak2 antibody (lane 11). Ba/F3, Ba/F3 HA-TEL-Jak2 JH1, and CTLL cells were examined for Jak3
activation (Fig 6B). IL-2 activates the tyrosine phosphorylation of
Jak3 in CTLL cells (lane 6), as previously reported.24,33 However, no constitutive activation of Jak3 was observed in HA-TEL-Jak2 JH1 cells in the absence of IL-3 stimulation (lane 3). Thus, the HA-TEL-Jak2 JH1 protein does not activate endogenous Jak1, Jak2, or
Jak3. Furthermore, no Jak kinases are observed to be
tyrosine-phosphorylated in the pan-Jak immunoprecipitation (Fig 6A,
lane 7). This antibody specifically recognizes the JH1 domain of all
mammalian Jak kinases, including Tyk2.24 Therefore, we
believe that fusion of TEL to Jak2 results in constitutive activation,
independent of endogenous JAK tyrosine kinase activity.
View larger version (36K):
[in this window]
[in a new window]
| Fig 6.
TEL-Jak2 expression does not activate tyrosine
phosphorylation of Jak1, Jak2, or Jak3. (A) Ba/F3 (lanes 1 through 6)
or Ba/F3 HA-TEL-Jak2 JH1 subclone 36 (lanes 7 through 12) cells were
depleted of cytokine and stimulated in the presence or absence of IL-3.
Immunoprecipitations were performed with a pan-specific Jak antibody, a
Jak1 antibody, or a Jak2 antibody. Tyrosine-phosphorylated proteins
were detected by immunoblotting with a monoclonal antiphosphotyrosine
antibody. The migration of endogenous Jak proteins and TEL-Jak2 JH1 and
molecular weight standards are indicated. (B) Ba/F3 (lanes 1 and 2) or
Ba/F3 HA-TEL-Jak2 JH1 subclone 36 (lanes 3 and 4) or CTLL (lanes 5 and
6) cells were depleted of cytokine and stimulated in the presence or
absence of IL-3 (lanes 1 through 4) or IL-2 (lanes 5 and 6).
Immunoprecipitations were performed with a Jak3 antibody.
Tyrosine-phosphorylated proteins were detected as described above.
|
|
Activation of TEL-Jak2 results in constitutive tyrosine
phosphorylation of Stat5.
Constitutive tyrosine phosphorylation of Janus kinases and,
subsequently, Stat transcription factors has been documented in cell
lines isolated from CML,14 AML,14,34
ALL,14,15 and Burkitt's lymphoma patients.14
Many cytokines, including IL-2,35,36 IL-3,37,38
IL-5,38 granulocyte-macrophage colony-stimulating factor
(GM-CSF),38,39 erythropoietin (EPO),35,39-42
Prolactin,28 and growth hormone,39 activate the
tyrosine phosphorylation of Stat5. Thus, we were interested in
determining whether activated TEL-Jak2 fusion proteins could
phosphorylate Stat proteins. Because of the important role of Stat5 in
cytokine signaling, we first examined Stat5.
The status of Stat5 tyrosine phosphorylation was tested using an
activation-specific Stat5 antibody that selectively recognizes Stat5
tyrosine-phosphorylated at position 694 (Fig 7). Stimulation of Ba/F3 cells with
IL-3 resulted in a rapid tyrosine phosphorylation of Stat5 (lane 2)
when compared with unstimulated cells (lane 1). Isolated subclones of
Ba/F3 HA-TEL-Jak2 JH1 (lanes 3 and 5) and Ba/F3 HA-TEL-Jak2 JH2+JH1
(lanes 9 and 11) demonstrated constitutive tyrosine phosphorylation of
Stat5. As observed above, HA-TEL-Jak2 JH2 or HA-TEL-KI-Jak2 JH1 were
not tyrosine-phosphorylated and failed to activate the tyrosine
phosphorylation of Stat5 under resting conditions. Stripping and
reprobing the membrane with an antibody that recognized Stat5A and B
showed that equal amounts of protein were expressed in each cell line
(Fig 7, lower panel).
View larger version (29K):
[in this window]
[in a new window]
| Fig 7.
Stat5 is constitutively tyrosine-phosphorylated in Ba/F3
cells expressing activated TEL-Jak2. Ba/F3 (lanes 1 and 2), Ba/F3
HA-TEL-Jak2 JH1 subclone 18 (lanes 3 and 4), Ba/F3 HA-TEL-Jak2 JH1
subclone 36 (lanes 5 and 6), Ba/F3 HA-TEL-Jak2 JH2 subclone 4 (lanes 7 and 8), Ba/F3 HA-TEL-Jak2 JH2+JH1 subclone 23 (lanes 9 and 10), Ba/F3
HA-TEL-Jak2 JH2+JH1 subclone 31 (lanes 11 and 12), and Ba/F3
HA-TEL-KI-Jak2 subclone 11 (lanes 13 and 14) cells were depleted of
cytokine and stimulated in the presence or absence of IL-3. One hundred
micrograms of lysate was resolved via SDS-PAGE and transferred to a
nitrocellulose membrane. Tyrosine-phosphorylated Stat5 was detected
using an activation-specific Stat5 antibody. The membrane was stripped
and reprobed with a peptide-specific Stat5 antibody.
|
|
To confirm that the tyrosine phosphorylation of Stat5 was associated
with an increase in DNA binding, EMSAs were performed (Fig 8). Nuclear extracts were prepared
from the cell lines described in Figs 5 and 7. The ability of Stat5 to
bind to a consensus 32P-labeled oligonucleotide from
-casein gene was examined. In the absence of IL-3 stimulation of
parental cells, no protein-DNA complex was observed (lane 1). When the
cells were stimulated with IL-3 for 5 minutes, a complex was observed
(lane 2). This complex could be competed with an excess of unlabeled
-casein oligonucleotide (lane 3), but was not affected by the
addition of an excess of a nonspecific oligonucleotide (lane 4). This
DNA-protein complex contained Stat5 as a peptide-specific Stat5
antibody could supershift this complex (lane 5). Nuclear
extracts prepared from Ba/F3 HA-TEL-Jak2 JH1 and Ba/F3 HA-TEL-Jak2
JH2+JH1 cells possessed constitutive Stat5 DNA binding activity (lanes
6 and 13). The specificity of this Stat5 complex was demonstrated in an
identical manner by the inhibition of protein-DNA binding by specific
(lanes 7 and 14) but not by nonspecific (lanes 8 and 15)
oligonucleotide competitors and by the supershifting of the complex by
a peptide-specific Stat5 antibody (lanes 9 and 16). Stat5 binding was
only IL-3-inducible in Ba/F3 cells expressing HA-TEL-Jak2 JH2 (lane
12) or HA-TEL-KI-Jak2 JH1 (lane 19). Therefore, Stat5 is activated
basally only in the presence of an activated TEL-Jak2 chimera.
View larger version (81K):
[in this window]
[in a new window]
| Fig 8.
Stat5 DNA binding is constitutively activated in TEL-Jak2
transformed Ba/F3 cells. Nuclear extracts were prepared from Ba/F3
(lanes 1 through 5), Ba/F3 HA-TEL-Jak2 JH1 subclone 36 (lanes 6 through
10), Ba/F3 HA-TEL-Jak2 JH2 subclone 4 (lanes 11 and 12), Ba/F3
HA-TEL-Jak2 JH2+JH1 subclone 23 (lanes 13 through 17), and Ba/F3
HA-TEL-KI-Jak2 subclone 11 (lanes 18 and 19) cells stimulated in the
presence (+) or absence ( ) of IL-3. EMSAs were performed as
described in Materials and Methods. Complexes were resolved on a 5%
native polyacrylamide gel. The specificity of DNA binding was
determined by the addition of unlabeled -casein oligonucleotide (S)
or a nonspecific oligonucleotide from the DUB-1 promoter (N) and by
incubation with a peptide-specific Stat5 antibody. Complexes were
analyzed via PhosphorImager detection.
|
|
Given the potential importance of other Stat proteins in cell
proliferation, we also tested for the ability of HA-TEL-Jak2 JH1 to
constitutively tyrosine-phosphorylate Stat1, Stat3, Stat5, and Stat6
using a panel of activation-specific antibodies
(Fig 9). Lysates were prepared from Ba/F3
HA-TEL-Jak2 JH1 and untransfected Ba/F3 cells after stimulation with
IL-3. Tyrosine-phosphorylated Stat proteins were detected with each
respective activation-specific antibody. Constitutive tyrosine
phosphorylation of both Stat1 and Stat5 was detected using the
activation-specific Stat1 antibody (lane 3), which cross-reacts with
phosphorylated Stat5.25 Similarly, Stat3 was
constitutively tyrosine-phosphorylated in the absence of IL-3
stimulation in Ba/F3 cells expressing HA-TEL-Jak2 JH1 (lane 7).
However, there are low levels of basal Stat3 tyrosine phosphorylation
in unstimulated Ba/F3 cells (lane 5). As demonstrated previously, Stat5
is constitutively tyrosine-phosphorylated in Ba/F3 cells expressing
HA-TEL-Jak2 JH1 (lane 11). We observed no constitutive tyrosine
phosphorylation of Stat6 in Ba/F3-HA-TEL-Jak2 JH1 cells (data not
shown). Stripping and reprobing each membrane with an antibody that
recognized either total Stat1, Stat3, or Stat5, respectively, confirmed
equal loading in each lane (Fig 9, lower panels). We have performed
similar experiments with peptide-specific antibodies to Stat1, Stat3,
and Stat5 and have shown that, after detection with 4G10
immunoblotting, HA-TEL-Jak2 JH1 constitutively tyrosine-phosphorylates
Stat1, Stat3, and Stat5 (data not shown). Thus, multiple Stats become
tyrosine-phosphorylated in cells expressing activated TEL-Jak2 fusion
proteins.
View larger version (20K):
[in this window]
[in a new window]
| Fig 9.
TEL-Jak2 JH1 expression results in constitutive tyrosine
phosphorylation of Stat1, Stat3, and Stat5. Ba/F3 (lanes 1, 2, 5, 6, 9, and 10) and Ba/F3 HA-TEL-Jak2 JH1 subclone 36 cells (lanes 3, 4, 7, 8, 11, and 12) were depleted of cytokine and stimulated in the presence or
absence of IL-3. One hundred micrograms of lysate was resolved via
SDS-PAGE and transferred to a nitrocellulose membrane.
Tyrosine-phosphorylated Stat proteins were detected using an
activation-specific Stat1 antibody (lanes 1 through 4, upper panel),
activation-specific Stat3 antibody (lanes 5 through 8, upper panel), or
an activation-specific Stat5 antibody (lanes 9 through 12, upper
panel). The membrane was stripped and reprobed with peptide-specific
antibodies that recognized Stat1 (lanes 1 through 4, lower panel),
Stat3 (lanes 5 through 8, lower panel), or Stat5 (lanes 9 through 12, lower panel).
|
|
To further investigate the specificity of TEL-Jak2-mediated Stat1 and
Stat3 activation, EMSA experiments were performed using 32P-labeled IRF-1 as a probe
(Fig 10). Ba/F3 cells respond to
interferon- (IFN-) and assemble an SIF complex (lane 2) that can
be supershifted with Stat1 (lane 5), Stat3 (lane 6), but not Stat5
(lane 7) antibodies. Ba/F3-HA-TEL-Jak2 JH1 cells also activate an SIF
complex (lane 8) in the absence of IFN- stimulation, which can be
supershifted by peptide-specific Stat1 (lane 11) and Stat3 (lane 12)
antibodies. The IFN--inducible complex is indicated in lane 14. In
sum, the experiments presented in Figs 7 through 10 indicate that
HA-Tel-Jak2 JH1 activates Stat1, Stat3, and Stat5.
View larger version (82K):
[in this window]
[in a new window]
| Fig 10.
Stat1 and Stat3 DNA binding is constitutively activated
in TEL-Jak2 transformed Ba/F3 cells. Nuclear extracts were prepared
from Ba/F3 (lanes 1 through 7) and Ba/F3 HA-TEL-Jak2 JH1 subclone 36 (lanes 8 through 14) cells stimulated in the presence (+) or absence
() of IFN- . EMSAs were performed as described in Materials and
Methods using a 32P-labeled oligonucleotide from the IRF-1
promoter. Complexes were resolved on a 5% native polyacrylamide gel.
The specificity of DNA binding was determined by the addition of
unlabeled IRF-1 oligonucleotide (S) or a nonspecific oligonucleotide
from the DUB-1 promoter (N) and by incubation with peptide-specific
Stat1 (S1), Stat3 (S3), or Stat5 (S5) antibodies. Complexes were
analyzed via PhosphorImager detection.
|
|
| |
DISCUSSION |
It has now been documented that the pointed domain of TEL acts as a
dimerization interface that is capable of activating several tyrosine
kinases, including PDGF-R,20,32,43 ABL,19
ARG,44 TRKC,45,46 STK-1,47 and
JAK2.21,22,48 In this study, fusion of TEL to Jak2
generated a constitutively activated tyrosine kinase that converted
IL-3-dependent Ba/F3 cells to factor independence. In addition, active
TEL-Jak2 products were tyrosine-phosphorylated and resulted in the
constitutive activation of Stat1, Stat3, and Stat5.
Fusion of the TEL-pointed domain to either the Jak2 JH1 or Jak2 JH2+JH1
domains was sufficient to cause constitutive tyrosine phosphorylation
of each chimeric protein. A TEL-Jak2 JH2 fusion was not active,
confirming that the Jak2 JH2 domain does not possess catalytic
activity. Importantly, a TEL-KI-Jak2 JH1 domain construct was not
tyrosine-phosphorylated and did not inhibit IL-3-dependent tyrosine
phosphorylation of endogenous Jak2.
Expression of TEL-Jak2 in the hematopoietic cell line Ba/F3 resulted in
constitutive tyrosine phosphorylation of the fusion protein in the
absence of IL-3. We failed to observe TEL-Jak2-dependent phosphorylation of the IL-3 R c (data not shown) or
endogeneous Jak149 or Jak2,49,50 which are
known to be activated in an IL-3-dependent manner. We failed to
observe activation of Jak3 by TEL-Jak2, and no antibodies are available
that immunoprecipitate murine Tyk2. However, no Jak activation was
observed in immunoprecipitations using a pan-Jak antibody, a reagent
that recognizes all murine Jak proteins.24 Other studies
have shown that Stat proteins, including Stat5, can be activated in a
receptor-independent fashion, suggesting that the tyrosine kinase or
kinase-specific substrate can recruit Stat5.41,51 Published
studies have shown that the binding specificity for docking of Stat5 is
pYXXL/V41,52,53 and the TEL-Jak2 JH1 sequence contains at
least six putative Stat5 docking sites. In addition, we have also
observed that TEL-Jak2 JH1 mediates constitutive Stat1 and Stat3
tyrosine phosphorylation. The TEL-Jak2 JH1 sequence contains one Stat1
binding site (pYXXQ)54 and two putative Stat3 binding sites
(pYXXP).55,56 Therefore, TEL-Jak2 JH1 could potentially
directly recruit and activate Stat1, Stat3, and Stat5. The significance
of Stat activation awaits the elucidation of target genes specific to
TEL-Jak2-mediated transformation.
Other studies have reported that Stat5 tyrosine phosphorylation and DNA
binding activity is also observed downstream of
Bcr-abl.57-61 This suggests that Stat5 activation may be
implicated in Bcr-Abl-mediated leukemogenesis. Interestingly, a
constitutively active Stat5 molecule was recently identified that, when
overexpressed in Ba/F3 cells, resulted in factor-independent
proliferation.62 In addition, among other phenotypes, the
Stat5A/B gene-targetted mice demonstrate a profound inability to
modulate a T-cell response.11 It is possible that
constitutive Stat5 activation leads to inappropriate activation of an
IL-2 target gene. The crucial role of Stat5 in leukemogenesis may be
best evaluated by expressing activated tyrosine kinases into a
Stat5-deficient background to determine if the lack of Stat5 expression
affects the latency of leukemogenic oncogenes such as BCR-ABL or
TEL-JAK2.
Patients harbouring TEL translocations to activated tyrosine kinases,
including TEL-PDGF-R,20 TEL-ABL,18,19 and
TEL-JAK2,21,22 have been reported. Unlike TEL-AML1
translocations, which constitute 20% to 30% of pediatric ALL
cases,63,64 fusion of TEL to activated tyrosine kinases
appears to be a rather infrequent event. We have examined a cytogenetic
database consisting of 10,350 patients that have been observed at
several Toronto hospitals since 1986 and have discovered no evidence
for additional TEL-JAK2 [t(9;12)(p24;p13)] translocations.
These studies were initiated to develop a model to examine constitutive
Jak2 activation. During the course of this research, two groups have
demonstrated that TEL-Jak2 chromosomal translocations do
occur.21,22 To date, 3 patients have been described: 2 with pediatric ALL who express TEL-JAK2 fusions21,22 and a third patient with atypical CML or CMML who has a compound translocation resulting in the fusion of one allele of TEL to EVI165 and
the other allele forming a TEL-JAK2 fusion.21 In the former
case, the two translocations generate a fusion protein containing the JH1 domain, whereas in the latter case, a chimeric product fuses the
JH2 and JH1 domains of Jak2 to TEL. In this study, we have generated
two activated fusion proteins: TEL-Jak2 JH1 (which is missing the TEL
exon 5 sequence and 33 amino acids from one of the observed ALL
products) and TEL-Jak2 JH2+JH1 (which is missing 37 amino acids from
the CMML translocation). The constructs described in this study express
exons 1-4 of TEL. Both TEL-ABL18,19 and TEL-JAK221,22 translocations have been described with
either exons 1-4 or exons 1-5 of TEL. It is apparent that the TEL exon 5 sequence does not play a direct role in affecting transformation. Therefore, we feel confident that these fusions are representative of
two of the previously reported TEL-JAK2 fusions.
Targets of TEL-Jak2 other than the Stat proteins remain to be
identified. Recent studies have shown the critical importance of Jak2
in the development of the myeloid lineage.2 Interestingly, Stat5 does not appear to be essential for the development of these hematopoietic lineages.11 This suggests that Jak2 is
required for the activation of other Stats or unique transcription,
cell cycle, or apoptotic targets necessary to promote differentiation of myeloid cells. Thus, deregulated Jak2 activity may result in the
inappropriate or prolonged activation of these downstream targets.
Expression of TEL-Jak2 in a hematopoietic background such as Ba/F3
cells allows us to delineate between normal cytokine-regulated and
deregulated Jak2 signaling pathways.
| |
ACKNOWLEDGMENT |
The authors thank Gary Gilliland and Martin Carroll for ongoing
discussion and support and Mark Wong and Eleanor Fish for assistance
with EMSA experiments. We appreciate helpful comments on the manuscript
from Jane McGlade, Sonya Penfold, and members of the Barber laboratory.
| |
FOOTNOTES |
Submitted August 17, 1998; accepted February 9, 1999.
J.M.-Y.H. and B.K.B. contributed equally to this work.
Supported by Medical Research Council MT-13612, the Cancer Research
Society, Inc, and the University of Toronto Connaught New Staff
Matching Grant. D.L.B. is a Special Fellow of the Leukemia Society of America.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Dwayne L. Barber, PhD, Ontario Cancer
Institute, Division of Cellular and Molecular Biology, 610 University
Ave, Toronto, Ontario, M5G 2M9, Canada; e-mail:
dbarber{at}oci.utoronto.ca.
| |
REFERENCES |
1.
Rodig SJ, Meraz MA, White JM, Lampe PA, Riley JK, Arthur CD, King KL, Sheehan KC, Yin L, Pennica D, Johnson EM Jr, Schreiber RD:
Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses.
Cell
93:373, 1998[Medline]
[Order article via Infotrieve]
2.
Parganas E, Wang D, Stravopodis D, Topham DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G, Ihle JN:
Jak2 is essential for signaling through a variety of cytokine receptors.
Cell
93:385, 1998[Medline]
[Order article via Infotrieve]
3.
Neubauer H, Cumano A, Muller M, Wu H, Huffstadt U, Pfeffer K:
Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis.
Cell
93:397, 1998[Medline]
[Order article via Infotrieve]
4.
Nosaka T, van Deursen JM, Tripp RA, Thierfelder WE, Witthuhn BA, McMickle AP, Doherty PC, Grosveld GC, Ihle JN:
Defective lymphoid development in mice lacking Jak3.
Science
270:800, 1995[Abstract/Free Full Text]
5.
Park SY, Saijo K, Takahashi T, Osawa M, Arase H, Hirayama N, Miyake K, Nakauchi H, Shirasawa T, Saito T:
Developmental defects of lymphoid cells in Jak3 kinase-deficient mice.
Immunity
3:771, 1995[Medline]
[Order article via Infotrieve]
6.
Thomis DC, Gurniak CB, Tivol E, Sharpe AH, Berg LJ:
Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking Jak3.
Science
270:794, 1995[Abstract/Free Full Text]
7.
Saijo K, Park SY, Ishida Y, Arase H, Saito T:
Crucial role of Jak3 in negative selection of self-reactive T cells.
J Exp Med
185:351, 1997[Abstract/Free Full Text]
8.
Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S:
Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality.
Proc Natl Acad Sci USA
94:3801, 1997[Abstract/Free Full Text]
9.
Thierfelder WE, van Deursen JM, Yamamoto K, Tripp RA, Sarawar SR, Carson RT, Sangster MY, Vignali DA, Doherty PC, Grosveld GC, Ihle JN:
Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells.
Nature
382:171, 1996[Medline]
[Order article via Infotrieve]
10.
Kaplan MH, Sun YL, Hoey T, Grusby MJ:
Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice.
Nature
382:174, 1996[Medline]
[Order article via Infotrieve]
11.
Teglund S, McKay C, Schuetz E, Deursen JMV, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN:
Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses.
Cell
93:841, 1998[Medline]
[Order article via Infotrieve]
12.
Shimoda K, van Deursen J, Sangster MY, Sarawar SR, Carson RT, Tripp RA, Chu C, Quelle FW, Nosaka T, Vignali DA, Doherty PC, Grosveld G, Paul WE, Ihle JN:
Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene.
Nature
380:630, 1996[Medline]
[Order article via Infotrieve]
13.
Gouilleux-Gruart V, Gouilleux F, Desaint C, Claisse JF, Capiod JC, Delobel J, Weber-Nordt R, Dusanter-Fourt I, Dreyfus F, Groner B, Prin L:
STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients.
Blood
87:1692, 1996[Abstract/Free Full Text]
14.
Weber-Nordt RM, Egen C, Wehinger J, Ludwig W, Gouilleux-Gruart V, Mertelsmann R, Finke J:
Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines.
Blood
88:809, 1996[Abstract/Free Full Text]
15.
van der Plas DC, Smiers F, Pouwels K, Hoefsloot LH, Lowenberg B, Touw IP:
Interleukin-7 signaling in human B cell precursor acute lymphoblastic leukemia cells and murine BAF3 cells involves activation of STAT1 and STAT5 mediated via the interleukin-7 receptor alpha chain.
Leukemia
10:1317, 1996[Medline]
[Order article via Infotrieve]
16.
Luo H, Rose P, Barber D, Hanratty WP, Lee S, Roberts TM, D'Andrea AD, Dearolf CR:
Mutation in the Jak kinase JH2 domain hyperactivates Drosophila and mammalian Jak-Stat pathways.
Mol Cell Biol
17:1562, 1997[Abstract]
17.
Gotoh A, Broxmeyer HE:
The function of BCR/ABL and related proto-oncogenes.
Curr Opin Hematol
4:3, 1997[Medline]
[Order article via Infotrieve]
18.
Janssen JW, Ridge SA, Papadopoulos P, Cotter F, Ludwig WD, Fonatsch C, Rieder H, Ostertag W, Bartram CR, Wiedemann LM:
The fusion of TEL and ABL in human acute lymphoblastic leukaemia is a rare event.
Br J Haematol
90:222, 1995[Medline]
[Order article via Infotrieve]
19.
Golub TR, Goga A, Barker GF, Afar DE, McLaughlin J, Bohlander SK, Rowley JD, Witte ON, Gilliland DG:
Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia.
Mol Cell Biol
16:4107, 1996[Abstract]
20.
Golub TR, Barker GF, Lovett M, Gilliland DG:
Fusion of PDGF receptor to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation.
Cell
77:307, 1994[Medline]
[Order article via Infotrieve]
21.
Peeters P, Raynaud SD, Cools J, Wlodarska I, Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van den Berghe H, Marynen P:
Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia.
Blood
90:2535, 1997[Abstract/Free Full Text]
22.
Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT, Mauchauffe M, Berthou C, Lessard M, Berger R, Ghysdael J, Bernard OA:
A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia.
Science
278:1309, 1997[Abstract/Free Full Text]
23.
Zhuang H, Patel SV, He TC, Sonsteby SK, Niu Z, Wojchowski DM:
Inhibition of erythropoietin-induced mitogenesis by a kinase-deficient form of Jak2.
J Biol Chem
269:21411, 1994[Abstract/Free Full Text]
24.
Barber DL, D'Andrea AD:
Erythropoietin and interleukin-2 activate distinct JAK kinase family members.
Mol Cell Biol
14:6506, 1994[Abstract/Free Full Text]
25.
Frank DA, Robertson M, Bonni A, Ritz J, Greenberg ME:
IL-2 signaling onvolves the phosphorylation of novel Stat proteins.
Proc Natl Acad Sci USA
92:7779, 1995[Abstract/Free Full Text]
26.
Bonni A, Sun Y, Nadal-Vicens M, Bhatt A, Frank DA, Rozovsky I, Stahl N, Yancopoulos GD, Greenberg ME:
Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway.
Science
278:477, 1997[Abstract/Free Full Text]
27.
Gollob JA, Murhy EA, Mahajan S, Schnipper CP, Ritz J, Frank DA:
Altered IL-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1.
Blood
91:1341, 1998[Abstract/Free Full Text]
28.
Wakao H, Gouilleux F, Groner B:
Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response.
EMBO J
13:2182, 1994[Medline]
[Order article via Infotrieve]
29.
Pine R, Canova A, Schindler C:
Tyrosine phosphorylated p91 binds to a single element in the ISGF2/IRF-1 promoter to mediate induction by IFN alpha and IFN gamma, and is likely to autoregulate the p91 gene.
EMBO J
13:158, 1994[Medline]
[Order article via Infotrieve]
30.
Jaster R, Zhu Y, Pless M, Bhattacharya S, Mathey-Prevot B, D'Andrea AD:
JAK2 is required for induction of the murine DUB-1 gene.
Mol Cell Biol
17:3364, 1997[Abstract]
31.
Klambt C:
The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells.
Development
117:163, 1993[Abstract/Free Full Text]
32.
Carroll M, Tomasson MH, Barker GF, Golub TR, Gilliland DG:
The TEL/platelet-derived growth factor -receptor (PDGFR) fusion in chronic myelomonocytic leukemia is a transforming protein that self-associates and activates PDGFR kinase-dependent signaling pathways.
Proc Natl Acad Sci USA
93:14845, 1996[Abstract/Free Full Text]
33.
Witthuhn BA, Silvennoinen O, Miura O, Lai KS, Cwik C, Liu ET, Ihle JN:
Involvement of the Jak-3 Janus kinase in signalling by interleukins 2 and 4 in lymphoid and myeloid cells.
Nature
370:153, 1994[Medline]
[Order article via Infotrieve]
34.
Gouilleux-Gruart V, Gouilleux F, Desaint C, Claisse J-F, Capoid J-C, Delobel J, Weber-Nordt R, Dusanter-Fourt I, Dreyfus F, Groner B, Prin L:
STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients.
Blood
87:1692, 1996
35.
Wakao H, Harada N, Kitamura T, Mui AL, Miyajima A:
Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways.
EMBO J
14:2527, 1995[Medline]
[Order article via Infotrieve]
36.
Johnston JA, Bacon CM, Finbloom DS, Rees RC, Kaplan D, Shibuya K, Ortaldo JR, Gupta S, Chen YQ, Giri JD, O'Shea JJ:
Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15.
Proc Natl Acad Sci USA
92:8705, 1995[Abstract/Free Full Text]
37.
Azam M, Erdjument-Bromage H, Kreider BL, Xia M, Quelle F, Basu R, Saris C, Tempst P, Ihle JN, Schindler C:
Interleukin-3 signals through multiple isoforms of Stat5.
EMBO J
14:1402, 1995[Medline]
[Order article via Infotrieve]
38.
Mui AL, Wakao H, O'Farrell AM, Harada N, Miyajima A:
Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs.
EMBO J
14:1166, 1995[Medline]
[Order article via Infotrieve]
39.
Gouilleux F, Pallard C, Dusanter-Fourt I, Wakao H, Haldosen LA, Norstedt G, Levy D, Groner B:
Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-Stat5 DNA binding activity.
EMBO J
14:2005, 1995[Medline]
[Order article via Infotrieve]
40.
Damen JE, Wakao H, Miyajima A, Krosl J, Humphries RK, Cutler RL, Krystal G:
Tyrosine 343 in the erythropoietin receptor positively regulates erythropoietin-induced cell proliferation and Stat5 activation.
EMBO J
14:5557, 1995[Medline]
[Order article via Infotrieve]
41.
Klingmuller U, Bergelson S, Hsiao JG, Lodish HF:
Multiple tyrosine residues in the cytosolic domain of the erythropoietin receptor promote activation of STAT5.
Proc Natl Acad Sci USA
93:8324, 1996[Abstract/Free Full Text]
42.
Quelle FW, Wang D, Nosaka T, Thierfelder WE, Stravopodis D, Weinstein Y, Ihle JN:
Erythropoietin induces activation of Stat5 through association with specific tyrosines on the receptor that are not required for a mitogenic response.
Mol Cell Biol
16:1622, 1996[Abstract]
43.
Jousset C, Carron C, Boureux A, Quang CT, Oury C, Dusanter-Fourt I, Charon M, Levin J, Bernard O, Ghysdael J:
A domain of TEL conserved in a subset of ETS proteins defines a specific oligomerization interface essential to the mitogenic properties of the TEL-PDGFR oncoprotein.
EMBO J
16:69, 1997[Medline]
[Order article via Infotrieve]
44.
Sato Y, Iijima Y, Ito T, Oikawa T, Eguchi M, Eguchi-Ishimae M, Kamada N, Kishi K, Asano S, Sakaki Y:
A new partner gene of the ETV6/TEL, ARG (Abl related gene, or ABL2) cloned in a AML-M3 cell line with t(1;12)(q25;p13).
Blood
93:592a, 1998 (abstr, suppl 1)
45.
Knezevich SR, McFadden DE, Tao W, Lim JF, Sorensen PH:
A novel ETV6-NTRK3 gene fusion in congenital fibrosarcoma.
Nat Genet
18:184, 1998[Medline]
[Order article via Infotrieve]
46.
Eguchi M, Eguchi-Ishimae M, Tojo A, Morishita K, Suzuki K, Sato Y, Kudoh S, Tanaka K, Setoyama M, Nagamura F, Asano S, Kamada N:
Fusion of ETV6 to neutrophin-3 receptor TRKC in acute myeloid leukemia with t(12;15)(p13;q25).
Blood
93:1355, 1999[Abstract/Free Full Text]
47.
Tse KF, Civin C, Small D:
Constitutive activation of STK-1 tyrosine kinase by HLH domain of transcription factor TEL.
Blood
90:311a, 1997 (abstr, suppl 1)
48.
Schwaller J, Frantsve J, Aster J, Williams IR, Tomasson MH, Ross TS, Peeters P, Rompaey LV, Etten RAV, Ilaria R, Marynen P, Gilliland DG:
Transformation of hematopoietic cell lines to growth-factor independence and induction of a fatal myelo- and lymphoproliferative syndrome in mice by retrovirally transduced TEL/JAK2 fusion genes.
EMBO J
17:5321, 1998[Medline]
[Order article via Infotrieve]
49.
Shikama Y, Barber DL, D'Andrea AD, Sieff CA:
A constitutively activated chimeric cytokine receptor confers factor-independent growth in hematopoietic cell lines.
Blood
88:455, 1996[Abstract/Free Full Text]
50.
Silvennoinen O, Witthuhn BA, Quelle FW, Cleveland JL, Yi T, Ihle JN:
Structure of the murine Jak2 protein-tyrosine kinase and its role in interleukin 3 signal transduction.
Proc Natl Acad Sci USA
90:8429, 1993[Abstract/Free Full Text]
51.
DaSilva L, Rui H, Erwin RA, Howard OM, Kirken RA, Malabarba MG, Hackett RH, Larner AC, Farrar WL:
Prolactin recruits STAT1, STAT3 and STAT5 independent of conserved receptor tyrosines TYR402, TYR479, TYR515 and TYR580.
Mol Cell Endocrinol
117:131, 1996[Medline]
[Order article via Infotrieve]
52.
Ascherman DP, Migone TS, Friedmann MC, Leonard WJ:
Interleukin-2 (IL-2)-mediated induction of the IL-2 receptor alpha chain gene. Critical role of two functionally redundant tyrosine residues in the IL-2 receptor beta chain cytoplasmic domain and suggestion that these residues mediate more than Stat5 activation.
J Biol Chem
272:8704, 1997[Abstract/Free Full Text]
53.
Itoh T, Liu R, Yokota T, Arai KI, Watanabe S:
Definition of the role of tyrosine residues of the common beta subunit regulating multiple signaling pathways of granulocyte-macrophage colony-stimulating factor receptor.
Mol Cell Biol
18:742, 1998[Abstract/Free Full Text]
54.
Hemmann U, Gerhartz C, Heesel B, Sasse J, Kurapkat G, Grotzinger J, Wollmer A, Zhong Z, Darnell JE Jr, Graeve L, Heinrich PC, Horn F:
Differential activation of acute phase response factor/Stat3 and Stat1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. II. Src homology SH2 domains define the specificity of stat factor activation.
J Biol Chem
271:12999, 1996[Abstract/Free Full Text]
55.
Stahl N, Farruggella TJ, Boulton TG, Zhong Z, Darnell JE Jr, Yancopoulos GD:
Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors.
Science
267:1349, 1995[Abstract/Free Full Text]
56.
Gerhartz C, Heesel B, Sasse J, Hemmann U, Landgraf C, Schneider-Mergener J, Horn F, Heinrich PC, Graeve L:
Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation.
J Biol Chem
271:12991, 1996[Abstract/Free Full Text]
57.
Carlesso N, Frank DA, Griffin JD:
Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl.
J Exp Med
183:811, 1996[Abstract/Free Full Text]
58.
Shuai K, Halpern J, Hoeve JT, Rao X, Sawyers CL:
Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia.
Oncogene
13:247, 1996[Medline]
[Order article via Infotrieve]
59.
Frank DA, Varticovski L:
BCR/abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats.
Leukemia
10:1724, 1996[Medline]
[Order article via Infotrieve]
60.
Chai SK, Nichols GL, Rothman P:
Constitutive activation of JAKs and STATs in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients.
J Immunol
159:4720, 1997[Abstract]
61.
Klucher KM, Lopez DV, Daley GQ:
Secondary mutation maintains the transformed state in BaF3 cells with inducible BCR/ABL expression.
Blood
91:3927, 1998[Abstract/Free Full Text]
62.
Onishi M, Nosaka T, Misawa K, Mui AL-F, Gorman D, McMahon M, Miyajima A, Kitamura T:
Identification and characterization fo a constitutively active STAT5 mutant that promotes cell proliferation.
Mol Cell Biol
18:3871, 1998[Abstract/Free Full Text]
63.
Golub TR, Barker GF, Bohlander SK, Hiebert SW, Ward DC, Bray-Ward P, Morgan E, Raimondi SC, Rowley JD, Gilliland DG:
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92:4917, 1995[Abstract/Free Full Text]
64.
Golub TR, McLean T, Stegmaier K, Carroll M, Tomasson M, Gilliland DG:
The TEL gene and human leukemia.
Biochim Biophys Acta
1288:M7, 1996[Medline]
[Order article via Infotrieve]
65.
Peeters P, Wlodarska I, Baens M, Criel A, Selleslag D, Hagemeijer A, Van den Berghe H, Marynen P:
Fusion of ETV6 to MDS1/EVI1 as a result of t(3;12)(q26;p13) in myeloproliferative disorders.
Cancer Res
57:564, 1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D. W. Kim, H. K. Chung, K. C. Park, J. H. Hwang, Y. S. Jo, J. Chung, D. V. Kalvakolanu, N. Resta, and M. Shong
Tumor Suppressor LKB1 Inhibits Activation of Signal Transducer and Activator of Transcription 3 (STAT3) by Thyroid Oncogenic Tyrosine Kinase Rearranged in Transformation (RET)/Papillary Thyroid Carcinoma (PTC)
Mol. Endocrinol.,
December 1, 2007;
21(12):
3039 - 3049.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Kennedy, F. Barabe, B. J. Patterson, J. Bayani, J. A. Squire, D. L. Barber, and J. E. Dick
Expression of TEL-JAK2 in primary human hematopoietic cells drives erythropoietin-independent erythropoiesis and induces myelofibrosis in vivo
PNAS,
November 7, 2006;
103(45):
16930 - 16935.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. K. Lee, K. Man, R. T.P. Poon, C. M. Lo, A. P. Yuen, I. O. Ng, K. T. Ng, W. Leonard, and S. T. Fan
Signal Transducers and Activators of Transcription 5b Activation Enhances Hepatocellular Carcinoma Aggressiveness through Induction of Epithelial-Mesenchymal Transition.
Cancer Res.,
October 15, 2006;
66(20):
9948 - 9956.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Zhuang, Y. Qiu, S. J. Haque, and F. Dong
Tyrosine 729 of the G-CSF receptor controls the duration of receptor signaling: involvement of SOCS3 and SOCS1
J. Leukoc. Biol.,
October 1, 2005;
78(4):
1008 - 1015.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Moucadel and S. N. Constantinescu
Differential STAT5 Signaling by Ligand-dependent and Constitutively Active Cytokine Receptors
J. Biol. Chem.,
April 8, 2005;
280(14):
13364 - 13373.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Li, T. J. Ahonen, K. Alanen, J. Xie, M. J. LeBaron, T. G. Pretlow, E. L. Ealley, Y. Zhang, M. Nurmi, B. Singh, et al.
Activation of Signal Transducer and Activator of Transcription 5 in Human Prostate Cancer Is Associated with High Histological Grade
Cancer Res.,
July 15, 2004;
64(14):
4774 - 4782.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. O. Flowers, H. M. Johnson, M. G. Mujtaba, M. R. Ellis, S. M. I. Haider, and P. S. Subramaniam
Characterization of a Peptide Inhibitor of Janus Kinase 2 That Mimics Suppressor of Cytokine Signaling 1 Function
J. Immunol.,
June 15, 2004;
172(12):
7510 - 7518.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Guo, E. Mascareno, and M. A. Q. Siddiqui
Distinct Components of Janus Kinase/Signal Transducer and Activator of Transcription Signaling Pathway Mediate the Regulation of Systemic and Tissue Localized Renin-Angiotensin System
Mol. Endocrinol.,
April 1, 2004;
18(4):
1033 - 1041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Heath and N. C. P. Cross
Critical Role of STAT5 Activation in Transformation Mediated by ZNF198-FGFR1
J. Biol. Chem.,
February 20, 2004;
279(8):
6666 - 6673.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Benekli, M. R. Baer, H. Baumann, and M. Wetzler
Signal transducer and activator of transcription proteins in leukemias
Blood,
April 15, 2003;
101(8):
2940 - 2954.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M.-Y. Ho, M. H.-H. Nguyen, J. K. Dierov, K. M. Badger, B. K. Beattie, P. Tartaro, R. Haq, B. W. Zanke, M. P. Carroll, and D. L. Barber
TEL-JAK2 constitutively activates the extracellular signal-regulated kinase (ERK), stress-activated protein/Jun kinase (SAPK/JNK), and p38 signaling pathways
Blood,
July 30, 2002;
100(4):
1438 - 1448.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. G. Drachman, Y. Miyakawa, J. N. Luthi, D. D. Dahlen, A. Raney, A. E. Geddis, and K. Kaushansky
Studies with Chimeric Mpl/JAK2 Receptors Indicate That Both JAK2 and the Membrane-proximal Domain of Mpl Are Required for Cellular Proliferation
J. Biol. Chem.,
June 21, 2002;
277(26):
23544 - 23553.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. W. Sternberg, M. H. Tomasson, M. Carroll, D. P. Curley, G. Barker, M. Caprio, A. Wilbanks, A. Kazlauskas, and D. G. Gilliland
The TEL/PDGFbeta R fusion in chronic myelomonocytic leukemia signals through STAT5-dependent and STAT5-independent pathways
Blood,
December 1, 2001;
98(12):
3390 - 3397.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Frantsve, J. Schwaller, D. W. Sternberg, J. Kutok, and D. G. Gilliland
Socs-1 Inhibits TEL-JAK2-Mediated Transformation of Hematopoietic Cells through Inhibition of JAK2 Kinase Activity and Induction of Proteasome-Mediated Degradation
Mol. Cell. Biol.,
May 15, 2001;
21(10):
3547 - 3557.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
D. L. Barber, B. K. Beattie, J. M. Mason, M. H.-H. Nguyen, M. Yoakim, B. G. Neel, A. D. D'Andrea, and D. A. Frank
A common epitope is shared by activated signal transducer and activator of transcription-5 (STAT5) and the phosphorylated erythropoietin receptor: implications for the docking model of STAT activation
Blood,
April 15, 2001;
97(8):
2230 - 2237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J O'Shea, R. Visconti, T. P Cheng, and M. Gadina
Jaks and Stats as therapeutic targets
Ann Rheum Dis,
November 1, 2000;
59(90001):
i115 - 118.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Gesbert and J. D. Griffin
Bcr/Abl activates transcription of the Bcl-X gene through STAT5
Blood,
September 15, 2000;
96(6):
2269 - 2276.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Lacronique, A. Boureux, R. Monni, S. Dumon, M. Mauchauffe, P. Mayeux, F. Gouilleux, R. Berger, S. Gisselbrecht, J. Ghysdael, et al.
Transforming properties of chimeric TEL-JAK proteins in Ba/F3 cells
Blood,
March 15, 2000;
95(6):
2076 - 2083.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, I. Touw, and A. Yoshimura
The Jak-Stat pathway in normal and perturbed hematopoiesis
Blood,
January 1, 2000;
95(1):
19 - 29.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H.-H. Nguyen, J. M.-Y. Ho, B. K. Beattie, and D. L. Barber
TEL-JAK2 Mediates Constitutive Activation of the Phosphatidylinositol 3'-Kinase/Protein Kinase B Signaling Pathway
J. Biol. Chem.,
August 24, 2001;
276(35):
32704 - 32713.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
