|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 2 (January 15), 1999:
pp. 488-499
Enforced Expression of the GATA-2 Transcription Factor
Blocks Normal Hematopoiesis
By
Derek A. Persons,
James A. Allay,
Esther R. Allay,
Richard A. Ashmun,
Donald Orlic,
Stephen M. Jane,
John M. Cunningham, and
Arthur W. Nienhuis
From the Division of Experimental Hematology, Department of
Hematology/Oncology and the Department of Experimental Oncology, St
Jude Children's Research Hospital, Memphis, TN; and the Hematopoiesis
Section, Genetic and Molecular Biology Branch, National Human Genome
Research Institute, National Institutes of Health, Bethesda, MD.
 |
ABSTRACT |
The zinc finger transcription factor GATA-2 is highly expressed in
immature hematopoietic cells and declines with blood cell maturation.
To investigate its role in normal adult hematopoiesis, a
bicistronic retroviral vector encoding GATA-2 and the green fluorescent protein (GFP) was used to maintain the high levels of
GATA-2 that are normally present in primitive hematopoietic cells.
Coexpression of the GFP marker facilitated identification and
quantitation of vector-expressing cells. Bone marrow cells transduced
with the GATA-2 vector expressed GFP as judged by flow cytometry and
GATA-2 as assessed by immunoblot analysis. A 50% to 80% reduction in
hematopoietic progenitor-derived colony formation was observed with
GATA-2/GFP-transduced marrow, compared with marrow transduced with a
GFP-containing vector lacking the GATA-2 cDNA. Culture of purified
populations of GATA-2/GFP-expressing and nonexpressing cells confirmed
a specific ablation of the colony-forming ability of
GATA-2/GFP-expressing progenitor cells. Similarly, loss of spleen
colony-forming ability was observed for GATA-2/GFP-expressing bone
marrow cells. Despite enforced GATA-2 expression, marrow cells remained
viable and were negative in assays to evaluate apoptosis. Although
efficient transduction of primitive Sca-1+
Lin- cells was observed with the GATA-2/GFP vector,
GATA-2/GFP-expressing stem cells failed to substantially contribute to
the multilineage hematopoietic reconstitution of transplanted mice.
Additionally, mice transplanted with purified, GATA-2/GFP-expressing
cells showed post-transplant cytopenias and decreased numbers of total
and gene-modified bone marrow Sca-1+ Lin
cells. Although Sca-1+ Lin bone
marrow cells expressing the GATA-2/GFP vector were detected after transplantation, no appreciable expansion in their numbers occurred. In contrast, control GFP-expressing Sca-1+
Lin cells expanded at least 40-fold after
transplantation. Thus, enforced expression of GATA-2 in pluripotent
hematopoietic cells blocked both their amplification and
differentiation. There appears to be a critical dose-dependent effect
of GATA-2 on blood cell differentiation in that downregulation of
GATA-2 expression is necessary for stem cells to contribute to
hematopoiesis in vivo.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE MEMBERS OF THE GATA family of
DNA-binding transcriptional regulatory proteins have distinct tissue
distributions and developmentally regulated expression
patterns.1,2 These factors bind to a DNA consensus sequence
(T/A)GATA(A/G) using a highly conserved DNA binding domain
composed of amino- and carboxy-terminal zinc fingers.3,4
Three GATA family members have been identified as important regulators
of gene expression in hematopoietic cells. GATA-1, the first member of
the family to be isolated, is highly expressed in developing erythroid
cells, mast cells, and megakaryocytes5,6 and its expression
is required for primitive and definitive erythropoiesis.7,8 Loss of GATA-1 causes fatal embryonic anemia in mice due to a block in
erythroid maturation.9 GATA-2 is also expressed in early
erythroid cells, mast cells, and megakaryocytes,10-13 but particularly high levels of expression have been observed in enriched populations of pluripotent hematopoietic stem cells.14
Targeted disruption of the GATA-2 gene in mice causes lethality in
utero due to anemia resulting from an early hematopoietic defect,
implicating GATA-2 as being a key factor in the maintenance of stem
cell function.15 Similarly, in vitro analysis of
GATA-2-deficient embryonic stem cells suggests the necessity of GATA-2
for survival of early hematopoietic cells.16 GATA-3
expression is important during the onset of fetal liver hematopoiesis
and is required for the development of T lymphocytes.17,18
In primary liquid cultures enriched for erythroid precursor cells as
well as in developing human erythroid progenitors grown in growth
factor-supplemented methylcellulose, the quantitative GATA-1/GATA-2
balance appears important in erythroid
differentiation.10,19 In both systems, human erythroid
progenitors are characterized by high levels of both GATA-1 and GATA-2,
but on terminal differentiation GATA-2 levels are markedly lower
although further increases in GATA-1 gene expression are observed. In
other studies, ectopic expression of a conditionally active GATA-2
protein in transformed chicken erythroblasts and in primary
erythroblast clones blocked erythroid differentiation in
vitro.20 Consistent with these data, Orlic et
al14 observed extremely high levels of GATA-2 expression in
murine bone marrow cell fractions highly enriched for pluripotent
hematopoietic stem cells. Lower levels of GATA-2 expression were
present in the more mature cell subsets. Together, these data suggest
that GATA-2 acts preferentially on more primitive hematopoietic cells
and that downregulation of its expression may be necessary for
differentiation to occur in vivo.
Based on these studies, we constitutively expressed GATA-2 in human
CD34+ cell-derived erythroid bursts (BFU-E) in an attempt
to influence erythroid differentiation and globin gene switching.
Although no effect was noted on globin gene expression, erythroid
colonies expressing a retrovirally-transferred human GATA-2 cDNA were
consistently smaller in size than control colonies, without a
noticeable effect on maturation (D. Persons and A. Nienhuis,
unpublished observations). To further investigate these findings and to
study the role of GATA-2 in primitive hematopoietic cells in an adult
mouse model of normal hematopoiesis, a bicistronic retroviral vector
was used to obtain enforced expression of GATA-2 in murine bone marrow cells. In this vector, the GATA-2 cDNA was transcriptionally linked by
a viral internal ribosome entry site (ir) to the green fluorescent protein (GFP) gene. This configuration allows coordinate expression of
the GATA-2 and GFP proteins, the latter of which facilitates the facile
identification and precise quantitation of genetically modified cells
cultured in vitro and blood cells of all hematopoietic lineages in
vivo.21 Our experiments show that maintenance of the
normally high levels of GATA-2 expression present in hematopoietic progenitors and stem cells blocks both their differentiation and amplification, suggesting that regulation of GATA-2 expression is a
critical event in normal hematopoiesis.
 |
MATERIALS AND METHODS |
Cell lines and vector construction.
The ecotropic packaging cell line GP + E8622 was used for
the generation of helper-free recombinant retroviruses. GP + E86, 293T23, and NIH 3T3 cells were maintained in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated
fetal calf serum (FCS), 2 mmol/L glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a 5% CO2,
humidified atmosphere.
The neomycin coding cassette in MSCVNEO2.124 was initially
replaced with a DNA fragment containing an internal ribosome entry site
(ir) from the encephalomyocarditis virus25 linked to a cDNA
encoding a human dihydrofolate reductase (DHFR) variant containing a
leucine to tyrosine substitution in codon 22 (termed L22Y).21 After removal of the L22Y coding sequences, the
GFP cDNA from the EGFP-1 plasmid (Clontech Laboratories, Palo Alto, CA)
was placed 3 of the ir element. The human GATA-2
cDNA12 (kindly provided by Stuart Orkin, Howard Hughes
Medical Institute, Harvard University, Boston, MA) was cloned into the
translational position 5 of the ir element to generate the
plasmid GATA-2irGFP. To obtain a retroviral construct containing the
GATA-2 and GFP cDNAs with the translational positions reversed, the
L22Y coding sequences were removed from the plasmid MGirL22Y (which
contains the MSCV LTR driving a GFPirL22YDHFR cassette)21
and replaced with the GATA-2 cDNA coding sequence.
Generation of high titer, ecotropic virus producer cells.
Conditioned media containing high titer, amphotropic irGFP,
GATA-2irGFP, and GFPirGATA-2 vector particles were derived by cotransfection of 293T cells with the respective retroviral vector plasmids and a helper plasmid containing the required gag, pol, and env
retroviral genes driven by a Moloney leukemia virus LTR.26 This media was used to transduce GP + E86 viral packaging cells and
viral producer cells for each vector were derived as previously described.21 The viral titer of conditioned media from each of these producer populations was ~106 particles/mL as
assessed by transfer of the GFP marker to NIH 3T3 cells. These
virus-producing cells were shown to be free of replication competent
retrovirus by a previously described marker rescue assay.
21
Retroviral transduction of bone marrow cells.
Retroviral transduction of murine bone marrow cells was performed as
previously described.21 Briefly, bone marrow was harvested from 8- to 12-week-old female C57/Bl6 2 days after treatment with 150 mg/kg 5-fluoruracil (5-FU; Pharmacia, Kalimazoo, MI). Marrow cells were
stimulated for 48 hours with 20 ng/mL mouse IL-3, 50 ng/mL human IL-6,
and 50 ng/mL mouse stem cell factor (all obtained from R & D Systems,
Minneapolis, MN) in DMEM supplemented with 15% heat-inactivated FCS
(Hyclone, Logan, UT). Bone marrow cells were subsequently cocultured
with irradiated (1200 cGy) viral producer cells using the above culture
media supplemented with 6 µg/mL polybrene. Forty-eight hours later,
nonadherent bone marrow cells were gently rinsed off the viral producer
cell monolayers, pelleted, and resuspended in fresh culture medium with
the above cytokines. Cells were cultured for an additional 24 to 48 hours before analysis for expression of GFP as described below, plated into methylcellulose media, or used immediately for transplantation.
Immunoblot analysis.
Cells were lysed by boiling in Laemmli buffer and proteins
electrophoretically separated on 10% denaturing polyacrylamide gels.
Separated proteins were transferred to nitrocellulose membranes that
were probed using a mouse monoclonal antibody (MoAb), which we have
found detects human GATA-2 well but mouse GATA-2 poorly (sc-267; Santa
Cruz Biotechnology, Inc, Santa Cruz, CA). An ECL western
blotting analysis system (Amersham Life Science, Amersham, UK) was used
to develop immunoreactive signals.
Flow cytometric purification of GFP-expressing bone marrow cells.
Twenty-four hours after the completion of the viral transduction
procedure, bone marrow cells were depleted of red blood cells and
resuspended in phosphate-buffered saline (PBS) supplemented with 5%
FCS. GFP+ and GFP viable cells were
sorted on a Turbo sort-equipped FACStar Plus cell sorter (Becton
Dickinson, San Jose, CA). Alternatively, cells were stained for the
Sca-1 and lineage-specific markers, as described below, and
Sca-1+ lineage-marker negative (Lin )
cells that expressed the indicated GFP-containing retroviral vector
were obtained. Sorted populations were reanalyzed for GFP expression
and routinely showed purities ranging from 92% to 99%.
Reverse transcriptase-polymerase chain reaction (RT-PCR) assay.
Cellular RNA extraction, preparation of complementary DNA (cDNA), and
PCR amplification of cDNA was performed using mouse GATA-2 and beta-2
microglobulin ( -2m) primer pairs as previously described.14 The mouse GATA-2 primer pair used detected
both the endogenous mouse GATA-2 transcript and the retroviral GATA-2 transcript. In contrast, a retroviral-specific GATA-2 PCR primer pair
(5 : CTCTAGGCGCCGGAATTCGT; 3 : CCTGCGAGTC GAGGTGATTG) was designed that used a 5 primer located in the retroviral
backbone, just upstream of the GATA-2 cDNA sequence. To determine the
amount of input RNA for each sample that would result in a readout
within the linear response range of the assay, limiting dilution
aliquots of each RNA sample were assayed by RT-PCR for -2m levels.
Equivalent amounts of RNA, as assessed by the -2m signals of the
various samples, were then used in each subsequent RT-PCR assay.
In vitro clonogenic progenitor assays.
Unsorted and sorted bone marrow cell populations, in a volume not
exceeding 150 µL, were suspended in 3 mL methylcellulose culture
media (M3434; Stem Cell Technologies, Vancouver, British Columbia,
Canada). After thorough mixing, cells were plated into 35 mm dishes.
Cultures were incubated at 37°C in a 5% CO2,
humidified atmosphere and colonies enumerated after 7 to 10 days.
Cell-cycle phase distribution analysis and evaluation of apoptosis
in bone marrow cells.
Purified populations of bone marrow cells, as indicated, were analyzed
for cell-cycle phase distribution according to standard methods.27 The same cell populations were evaluated for the presence of apoptotic cells, as previously described.28,29 Specifically, flow cytometric analysis was used to detect fragmented DNA ends labeled by transfer of digoxygenin-conjugated dUTP in a
terminal-transferase catalyzed reaction (TUNEL) as a function of the
cellular DNA content of propidium iodide-stained nuclei.
Transplantation of retroviral vector-transduced bone marrow cells.
Transduced bone marrow cells were washed and resuspended in PBS
containing 2% FCS. Two to 5 × 106 cells were
transplanted by tail vein injection into lethally irradiated, congenic
HW80 recipient mice that differed in hemoglobin phenotype from the
donor mice. Beginning 4 weeks post-transplantation, peripheral blood
obtained by retroorbital sinus puncture was analyzed for expression of
GFP. In addition, complete hematology parameters including hematocrit,
platelet count, and total leukocyte counts were obtained by standard
methods. Leukocyte differentials were obtained by scoring Wright-Giemsa
stained blood films. Hemoglobin electrophoresis, to assess
hematopoietic reconstitution by donor marrow, was performed by standard
methods.30
Evaluation of GFP expression in bone marrow and peripheral blood
cells.
In vitro cultured bone marrow cells and bone marrow cells freshly
harvested from the hind limbs of animals were resuspended as single
cells, after red blood cell depletion, for analysis by flow cytometry
with a FACS Calibur (Becton Dickinson) using excitation at 488 nm and
fluorescence detection at 530 ± 15 nm (for GFP), or 585 ± 21 nm
(for phycoerythrin), or 670 nm or greater (for Red670). PI was added to
samples in some instances to allow identification and elimination of
dead cells from the analysis. Where indicated, bone marrow cells were
stained with a phycoerythrin-conjugated MoAb against the Sca-1 antigen
(PharMingen; San Diego, CA), in conjunction with staining using a
biotinylated antibody cocktail directed to a panel of blood lineage
markers (CD5, CD45R, CD11b, Gr-1, and TER119; Stem Cell Technologies,
Inc) followed by incubation with a streptavidin-linked Red670 secondary
reagent (Life Technologies, Gaithersburg, MD). The primitive fraction
of hematopoietic cells staining positive for the Sca-1 antigen and
negative for lineage markers (termed Sca-1+
Lin-)31 was delineated by electronic gating,
which was then used to determine the percentage of GFP+
cells in this subpopulation. Less than 1% of cells fell within this
gate when samples were stained with isotype-matched control antibodies.
Peripheral blood cells were analyzed for GFP expression as previously
described.21 Hematopoietic colonies were directly evaluated
for GFP expression by visualization using a standard fluorescence
microscope.
Statistics.
The Student's paired t-test was used to determine
statistically significant differences where indicated.
 |
RESULTS |
Bicistronic retroviral vectors express both GATA-2 and GFP in
retroviral producer cells and transduced murine bone marrow.
The murine stem cell virus (MSCV)-based retroviral vectors GATA-2irGFP
and GFPirGATA-2 contain the GATA-2 and GFP cDNAs (in either the first
or second translational position) linked by the encephalomyocarditis
virus internal ribosome entry site (ir)
(Fig 1A). GP + E86 retroviral producer
cells were generated, as described in Materials and Methods, for each
vector and a control vector, irGFP (Fig 1A), which lacked a coding
sequence in the first translational position. All three producer cell
populations efficiently expressed GFP as assessed by
fluorescence-activated cell sorting (FACS) analysis and direct
fluorescence microscopy (data not shown). The viral titers of
conditioned media from the three producer cell populations were
estimated to be approximately 106 infectious units/mL,
based on transfer of the GFP marker to NIH 3T3 cells. Southern blot
analysis of DNA from all three producer cell populations and from NIH
3T3 target cells transduced with each of the vectors confirmed the
presence and transmission of an intact, unrearranged proviral genomic
band of the correct molecular size (data not shown).

View larger version (12K):
[in this window]
[in a new window]

View larger version (21K):
[in this window]
[in a new window]

View larger version (50K):
[in this window]
[in a new window]
| Fig 1.
(A) Schematic of the MSCV-based irGFP, GATA-2irGFP, and
GFPirGATA-2 retroviral vectors. All contain the internal ribosome entry
site (ir) from the encephalomyocarditis virus that allows
cap-independent translation of the coding sequence 3 of the ir
element. (B) Flow cytometric analysis of GFP expression in bone marrow
cells 24 hours after transduction with the irGFP, GATA-2irGFP, and
GFPirGATA-2 retroviral vectors. The solid line in each panel indicates
the fluorescence profile of cells transduced with the indicated vector.
The broken line in each panel represents the fluorescence profile of
nontransduced bone marrow cells. In each case, the percentage of cells
expressing GFP is indicated. (C) Immunoblot analysis for GATA-2
expression in retroviral producer and transduced bone marrow cells.
Protein lysates of 2 × 106 viral producer cells for each
vector or 1 × 106 bone marrow cells transduced with the
indicated vectors were electrophoretically separated, blotted, and
probed with an anti-GATA-2 MoAb. The positive control lane represents
protein extracted from COS-7 cells transiently transfected with a
GATA-2 expression plasmid, whereas the lane marked negative contained
no protein.
|
|
As shown in Fig 1B, approximately 33% to 50% of the marrow cells were
positive for GFP expression after cocultivation with the respective
viral producer cells, with the GFPirGATA-2 vector showing slightly
higher GFP expression than the GATA-2irGFP and control irGFP vectors.
These results were reproducible over many experiments, with similar
transduction efficiencies observed. To assess expression of the GATA-2
protein, whole cell lysates from the control and GATA-2 viral producer
cells, as well as from lysates of bone marrow cells transduced with
each of the vectors, were examined for the presence of GATA-2 by
immunoblot analysis. Low, but readily detectable levels of an
immunoreactive band of the correct molecular size (~55 kD) were
present in the two GATA-2 retroviral producers, whereas much higher
levels on a per cell basis were observed in transduced bone marrow
cells (Fig 1C). The latter result is consistent with the previously
noted high level of expression directed by the MSCV LTR in
hematopoietic cells.32 Because the GATA-2irGFP vector gave
somewhat higher expression of GATA-2 than the GFPirGATA-2 vector, this
vector was used in subsequent experiments.
Bone marrow cells expressing the GATA-2irGFP vector showed no evidence
of toxicity, compared with cells expressing the control vector, either
during the 72-hour in vitro transduction culture period or at the time
of FACS analysis when cells were counterstained with propidium iodide
to identify dead cells. In three independent experiments, the
percentage of viable bone marrow cells present 24-hours after
completion of the transduction protocol with the GATA-2irGFP vector
ranged from 45% to 67%, which was not different from that observed
with the control GFP vector (range, 51% to 67%). In addition,
GATA-2irGFP-expressing viable cells outnumbered nonviable expressing
cells on average by a factor of seven to one (data from two
experiments).
Enforced GATA-2 expression blocks hematopoietic progenitor-derived
colony formation.
To evaluate the effect of enforced GATA-2 expression in primary
clonogenic hematopoietic progenitor cells, murine bone marrow cells
were transduced with either the GATA-2irGFP vector or the control irGFP
vector and cultured in methylcellulose media supplemented with
recombinant hematopoietic growth factors. The number of colonies was
markedly diminished (27% of control) in cultures of cells transduced
with the GATA-2irGFP vector in comparison to cultures of cells
transduced with the control irGFP vector
(Fig 2; Unsorted). In three separate
experiments, few (range, 3% to 13%) of the colonies that grew from
marrow transduced with the GATA-2irGFP vector expressed the GFP marker.
In contrast, a substantial proportion (range, 50% to 70%) of the
colonies derived from marrow transduced in parallel with the control
irGFP vector expressed GFP.

View larger version (14K):
[in this window]
[in a new window]
| Fig 2.
Hematopoietic progenitor-derived colony formation of
GATA-2irGFP- and control irGFP-expressing bone marrow cells. Unsorted
irGFP- and GATA-2irGFP-transduced cells (n = 3) and flow cytometric
sorted, GFP+ (POS) (n = 3) and GFP (NEG)
(n = 2) cells for each vector, as indicated, were cultured in
duplicate in semisolid media and colonies enumerated as described in
Materials and Methods. Data are expressed as the mean number (± standard error) of hematopoietic colonies per 104 cells.
The values within both the unsorted and sorted positive groups were
statistically significantly different (P < .03 and P < .02, respectively) from each other.
|
|
After transduction, GATA-2irGFP-expressing (Fig 2; Sorted Pos) and
nonexpressing (Fig 2; Sorted Neg) cell populations were isolated from
the same culture by flow cytometric cell sorting according to GFP
positivity. Purified cells expressing the GATA-2irGFP vector showed
near complete loss of progenitor-derived colony-forming ability
compared with purified cells expressing the control irGFP vector. In
contrast, purified GATA-2irGFP nonexpressing cells formed colonies in
numbers similar to both purified irGFP-expressing and nonexpressing
control cells. These data suggested that enforced GATA-2 expression
specifically blocked progenitor-derived colony formation.
To investigate the effects of enforced GATA-2 expression in the spleen
colony-forming cell (CFU-S), limiting numbers of purified bone marrow
cells expressing the GATA-2irGFP and control irGFP vectors were
transplanted into irradiated mice. Fourteen days later, animals were
killed and spleens examined for growth of clonogenic CFU-S. The spleens
from animals transplanted with bone marrow cells expressing the control
irGFP vector contained multiple, large macroscopic colonies typical of
CFU-S (Fig 3; top row). In contrast, the
spleen colonies from animals transplanted with cells expressing the
GATA-2irGFP vector were few in number; most were small and similar in
size to the endogenously-derived colonies present in irradiated mice
that received no transplanted cells (Fig 3; bottom row; data not
shown). Correspondingly, the mean weight of spleens from animals that
received cells expressing the control irGFP vector was significantly
greater than that of the spleens from animals transplanted with
GATA-2irGFP-expressing cells (Fig 3). Of the six larger macroscopic
colonies typical for CFU-S that were obtained from GATA-2irGFP spleens
and evaluated for vector expression, none were GFP+ as
determined by FACS. In contrast, the majority of CFU-S (15 of 20)
obtained from the control vector spleens were positive for GFP
expression.

View larger version (46K):
[in this window]
[in a new window]
| Fig 3.
Gross appearance of spleens obtained from mice 14 days
after transplantation with 3 × 104 purified bone marrow
cells expressing the GATA-2irGFP (bottom row) or control irGFP vectors
(top row). The mean splenic weight (mg) ± standard error for each
group is indicated at right and were statistically significantly
different (P < .04). The weight of the spleens from animals
transplanted with GATA-2irGFP-expressing cells did not differ from the
weight of spleens from animals that did not receive cells (148 ± 2; n
= 2).
|
|
Enforced expression of GATA-2 in bone marrow cells does not alter
cell-cycle distribution or induce apoptosis.
Possible explanations for the loss of the in vitro and spleen
colony-forming activity of GATA-2-expressing progenitor cells could be
the induction of altered cell-cycle progression or apoptosis in
maturing hematopoietic cells. To investigate these possibilities, GATA-2irGFP- and control irGFP-expressing bone marrow cells were obtained by flow cytometry after gene transfer. No difference was
observed in the cell-cycle phase distribution profile of bone marrow
cells expressing the GATA-2irGFP vector compared with cells expressing
the control irGFP vector or to nonexpressing cells derived from
cultures with either vector (data not shown). These same cell
populations, which are comprised of a spectrum of hematopoietic precursors and developing cells, were also evaluated for evidence of
apoptosis by a flow cytometry-based assay that detects fragmented DNA
ends (TUNEL). As shown in Fig 4,
GATA-2-expressing cells showed extremely low levels of apoptosis
(<1%), similar to levels observed in nonexpressing cells derived
from the same transduction culture and both GFP-expressing and
nonexpressing cells derived from the control irGFP vector transduction
culture. Therefore, the loss of progenitor function associated with
GATA-2 expression could not be attributed to a generalized effect on
the cell-cycle machinery or apoptotic pathways in hematopoietic cells.
Further evidence against these possibilities was the observation that
purified GATA-2irGFP-expressing bone marrow cells proliferated in
hematopoietic growth factor-supplemented liquid cultures while
maintaining high viability. In two separate experiments,
GATA-2irGFP-expressing cells from unfractionated bone marrow exhibited
a 2.5-fold to 4-fold expansion over 3 to 4 days.

View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
Flow cytometric analysis of fragmented DNA ends labeled
with fluoresceinated digoxygenin-conjugated dUTP in a terminal
transferase (TdT)-catalyzed reaction (TUNEL; abscissa) as a function of
cellular DNA content (ordinate). One-half of each sample was labeled in
the absence of TdT enzyme ( TdT) to determine the background level of
FITC fluorescence; the remaining half of the sample was labeled in the
presence of TdT (+TdT) to fluorescently tag fragmented DNA ends.
Cells to the right of the vertical line in the (+TdT) plots have free
DNA ends specifically labeled by TdT, indicating apoptotic cell death.
In this analysis, Jurkat cells treated for 6 hours with the toxic
chemotherapy drug VP-16 showed a substantial number of cells (35%)
undergoing apoptosis. In contrast, bone marrow cells cultured on naive
NIH 3T3 cells (Mock) had 4% apoptotic cells, whereas unsorted
GATA-2irGFP-transduced cells had 3% apoptotic cells (data not shown).
Both sorted GFP-expressing and nonexpressing cell populations for each
vector, as indicated, contained less than 1% apoptotic cells. Similar
results were obtained in another experiment.
|
|
Enforced, physiologic levels of GATA-2 expression in primitive cells
blocks their contribution to hematopoietic reconstitution in
transplanted mice.
To show retroviral vector expression in primitive hematopoietic cells,
GFP expression was evaluated in the Sca-1+,
Lin (CD5, CD45R, CD11b, Gr-1, and TER 119) primitive
cell fraction of bone marrow after gene transfer with the GATA-2irGFP
or control irGFP vector. Sca-1+ Lin
cells were efficiently transduced with, and expressed both vectors (Fig 5). In addition, there was no
difference in the percentage of Sca-1+
Lin cells present in the two transduced cell
populations despite vector expression for at least 24 hours (4.4% and
3.2% of gated viable cells were Sca-1+
Lin in the GATA-2irGFP and control irGFP-transduced
populations, respectively).

View larger version (62K):
[in this window]
[in a new window]
| Fig 5.
Flow cytometric analysis for GATA-2irGFP or control irGFP
vector expression in the Sca-1+ Lin
fraction of bone marrow cells. Twenty-four hours after completion of
the transduction period with the indicated vectors, bone marrow cells
were stained for expression of the Sca-1 and lineage-specific cell
surface markers as described in Materials and Methods. The
Sca-1+ Lin cell subset (lower right
quadrant of each dot plot) was gated on and GFP fluorescence in this
cell subset is shown in the histogram below each dot plot. The
percentages of GFP+ Sca-1+
Lin cells are indicated above each histogram. A separate
experiment yielded similar results.
|
|
To obtain an estimate of the level of enforced GATA-2 expression in
immature bone marrow cells, Sca-1+ Lin
cells expressing the GATA-2irGFP vector and the control irGFP vector
were purified by flow cytometry after retroviral transduction and RNA
was obtained for analysis using a previously described semiquantitative
RT-PCR assay.14 Levels of total GATA-2 RNA (Fig 6, top panel; endogenous plus
retroviral GATA-2) and retroviral transgene GATA-2 RNA (Fig 6, middle
panel), relative to the level of the constitutively expressed
-2 microglobulin RNA (Fig 6, bottom panel), were then
determined using equivalent amounts of input RNA predetermined to be in
the linear range of the assay. In agreement with previous
data,14 Fig 6 shows an abundant level of endogenous GATA-2
expression in several naive populations of hematopoietic cells enriched
for immature cells (FR25 Lin KitHI, FR35
Lin KitHI, and Sca-1+
Lin ). A similarly high level of endogenous GATA-2
RNA was observed in Sca-1+ Lin cells
expressing the control irGFP vector. The level of retroviral GATA-2 RNA
present in purified Sca-1+ Lin
GATA-2irGFP-expressing cells was comparable to the level of endogenous GATA-2 RNA observed in the other cell populations (Fig 6, middle and
top panels). Consistent with this, densitometric analysis showed that
the total level of GATA-2 RNA (Fig 6, top panel) present in the
GATA-2irGFP-expressing cells was approximately twofold that of the
other cell populations. Therefore, primitive cells expressing the
GATA-2irGFP vector should maintain physiologic high levels of GATA-2
due to the enforced expression of the transferred viral gene despite
any external signals that might downregulate endogenous GATA-2.

View larger version (70K):
[in this window]
[in a new window]
| Fig 6.
RT-PCR analysis of total GATA-2, retroviral GATA-2, and
-2m RNA levels in naive and transduced immature bone marrow cells.
RNAs from naive bone marrow cells fractionated by counterflow
centrifugal elutriation at a flow rate of 25 mL/minute (FR 25) or 35 mL/minute (FR35) and expressing high levels of c-kit
(KitHI) but lacking lineage-marker expression
(Lin-)14 and from cells expressing the Sca-1 antigen but
lacking lineage-marker expression were used as controls for high-level
endogenous GATA-2 expression. RNAs from Sca-1+
Lin cells expressing the GATA-2irGFP and control irGFP
vector, as indicated, were obtained as described in Materials and
Methods. RNA from a murine erythroleukemia cell line
expressing the GATA-2irGFP vector served as a positive control for the
retroviral GATA-2 RNA. Predetermined amounts of each sample RNA that
yielded approximately equal -2m signals (bottom panel) within the
linear range of the assay were used to assess the level of total GATA-2
RNA (top panel; endogenous plus retroviral) and retroviral GATA-2 RNA
(middle panel).
|
|
Lethally irradiated mice were transplanted with bone marrow cells
transduced with either the GATA-2irGFP vector or the control irGFP
vector to study the effect of enforced GATA-2 expression on
hematopoietic differentiation in vivo. Six and 12 weeks
post-transplantation, peripheral blood was obtained from the
transplanted mice for hematologic analysis and for analysis of vector
expression by FACS. All GATA-2irGFP transplanted mice (n = 10)
displayed normal complete blood counts and blood cell morphology (data
not shown). However, compared with control irGFP transplanted mice (n = 10) in which approximately 40% to 50% of erythrocytes (range, 38% to
41%), platelets (range, 38% to 45%), and leukocytes (range, 44% to
56%) expressed GFP at 6 weeks post-transplantation, much lower
percentages of GFP-expressing cells in all peripheral blood lineages
were observed in the mice transplanted with GATA-2irGFP-transduced
bone marrow cells. In this latter group, the highest mean percentages
of GFP+ cells were present in erythrocytes (12%; range,
7% to 14%) and platelets (6%; range, 0% to 15%), with leukocytes
showing an even lower frequency of vector-expressing cells (3%; range,
0% to 8%). In addition, the absolute levels of vector expression, as
judged by the mean fluorescence intensity of GFP+ cells,
were lower in GATA-2irGFP-expressing cells compared with control
irGFP-expressing peripheral blood cells (data not shown). At 12 weeks
post-transplantation, the frequencies of GATA-2irGFP-expressing peripheral blood cells in these mice had decreased even further, with
all lineages showing less than 5% positive cells
(Fig 7). In contrast, animals transplanted
with bone marrow cells transduced with the control irGFP vector
maintained steady levels (40% to 45%) of vector-expressing cells in
all lineages. Again, in the small percentage of GATA-2irGFP-expressing
cells observed, the level of GFP expression was low (data not shown).
Analysis of the hemoglobin phenotypes of transplanted animals (data not
shown), coupled with the above FACS data, confirmed that GATA-2irGFP
transplanted animals reconstituted hematopoiesis with donor stem cells
that did not express the vector.

View larger version (12K):
[in this window]
[in a new window]
| Fig 7.
Levels of vector-expressing peripheral blood cells in
animals 12 weeks after transplantation with GATA-2irGFP or control
irGFP vector transduced bone marrow cells. The percentages of red blood
cells (RBC), platelets (PLT), and leukocytes (WBC) expressing GFP in
the peripheral blood of 10 animals transplanted with the indicated
cells were determined by flow cytometry as described in Materials and
Methods. The data represent the mean ± standard error of the
percentage of GFP+ cells in each blood lineage for each
group. The percentages of GFP+ cells in each cell subset
in the two groups of animals were all statistically significantly
different (P < .0004 or less) from each other.
|
|
Lethally irradiated mice were also transplanted with purified
populations of bone marrow cells expressing the GATA-2irGFP vector or
the control irGFP vector. Analysis of the enriched cell populations
before transplantation showed purities of 92% and 95% for control
irGFP and GATA-2irGFP cells, respectively. There was a consistent delay
in the hematopoietic reconstitution of GATA-2irGFP transplanted animals
(n = 7), compared with animals transplanted with control irGFP cells (n = 5), which displayed normal blood counts at the 4-week time point.
Particularly notable was prolonged thrombocytopenia and leukopenia in
the GATA-2irGFP animals (data not shown). However, no deaths occurred
and by 10 weeks post-transplantation blood counts in GATA-2irGFP
animals had normalized. There were substantially lower percentages of GATA-2irGFP-expressing cells at 4, 6, and 10 weeks
post-transplantation compared with animals transplanted with control
cells that showed nearly complete marking of all peripheral blood
lineages (Fig 8). As noted earlier in the
mice transplanted with nonenriched GATA-2irGFP-transduced cells,
peripheral blood cells from mice transplanted with purified GATA-2irGFP
cells expressed the vector at a lower level than the peripheral blood
cells from mice transplanted with cells expressing the control GFP
vector (Fig 8). In fact, the level of GATA-2irGFP vector expression was
nearly one log lower, as judged by GFP fluorescence intensity, than
that observed in freshly transduced bone marrow cells (Fig 8 and Fig
1B). This suggested the presence of a threshold level of GATA-2
expression in primitive repopulating cells above which differentiation
into the different blood lineages was blocked. As observed in the mice transplanted with unsorted GATA-2irGFP-transduced cells, animals transplanted with purified GATA-2irGFP-expressing cells showed long-term (> 10 weeks) hematopoietic reconstitution almost
exclusively with nonexpressing donor cells as assessed by FACS and
hemoglobin phenotyping analysis (Fig 8 and data not shown).

View larger version (27K):
[in this window]
[in a new window]
| Fig 8.
Levels of GATA-2irGFP- or control-vector
irGFP-expressing cells in the peripheral blood of animals selectively
transplanted with vector-expressing bone marrow cells. Flow cytometric
histograms of GFP fluorescence are shown for the RBC, PLT, and WBC
subsets of peripheral blood from representative animals selectively
transplanted with control irGFP- or GATA-2irGFP-expressing bone marrow
cells. The top three panels represent analyses performed 4 weeks after
transplantation. The GATA-2irGFP 4 and GATA-2GFP 5 panels were obtained
at 6 and 10 weeks after transplantation, respectively. Two additional
transplanted GATA-2irGFP animals had less than 10% GFP+
cells in all blood lineages at the 10-week time point, whereas all
control GFP animals (n = 4) displayed at least 80%
GFP+ cells in all three lineages at all time points
analyzed. The GATA-2irGFP 1 animal shown above had the highest level of
vector-expressing cells in the cohort of six transplanted GATA-2irGFP
animals at the 4-week time point, with the other GATA-2irGFP animals
showing levels similar to or less than those of the GATA-2irGFP 3 animal.
|
|
GATA-2irGFP-expressing primitive cells are present in bone marrow
after transplantation but fail to appreciably expand.
To determine the fate of GATA-2-expressing primitive cells after
transplantation, mice transplanted with enriched cells expressing either the GATA-2irGFP vector (95% purity) or the control irGFP vector
(92% purity) were killed 5 to 7 weeks post-transplant and bone marrow
obtained. Compared with mice transplanted with control irGFP
vector-expressing cells (n = 3) that always showed at least 75% of cells in the primitive Sca-1+
Lin fraction positive for vector expression,
GATA-2irGFP-transplanted mice (n = 3) had much lower levels of
vector-expressing Sca-1+ Lin- cells
(Fig 9 and
Table 1). These data indicated that the
small fraction (5%) of transplanted marrow cells not expressing the GATA-2 vector greatly outcompeted the expressing cells (95%) in cell
amplification. Consistent with these data, the total numbers of
Sca-1+ Lin cells present in the hind
limb bones of animals transplanted with GATA-2irGFP cells were much
lower than those present in animals transplanted with cells expressing
the control irGFP vector (Table 1).

View larger version (49K):
[in this window]
[in a new window]
| Fig 9.
Levels of GATA-2irGFP- or control vector irGFP-expressing
Sca-1+ Lin cells in the bone marrow of
animals transplanted with vector-expressing cells. Bone marrow cells
were obtained 5 weeks after transplantation from animals transplanted
with cells expressing the GATA-2irGFP or control irGFP vector. Staining
for the Sca-1 and lineage marker antigens was performed as described in
the Materials and Methods. The Sca-1+ Lin
cell subset in the lower right quadrant was gated on and expression of
GFP fluorescence within this cell subset is shown in the histograms
below each plot. The percentage of GFP+
Sca-1+ Lin- cells is indicated above each
histogram. Analysis of a representative control irGFP vector animal is
shown.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Analysis of GATA-2irGFP and Control irGFP Vector
Expression in Bone Marrow Sca-1+ LIN Cells
of Transplanted Mice
|
|
Given the known inoculum of Sca-1+ Lin
vector-expressing cells and the bone marrow seeding efficiency of
hematopoietic cells,32 on the order of approximately 2000 to 3000 vector-expressing Sca-1+ Lin
cells were predicted to be present in the four hind limb bones of
animals immediately after transplantation. Five to 7 weeks later, the
four hind limb bones of animals that received cells expressing the
GATA-2irGFP vector contained on average only 2500 Sca+
Lin cells that were positive for vector expression
(Table 1). In contrast, animals that received bone marrow cells
expressing the control irGFP vector contained on average 124,000 Sca-1+ Lin cells that expressed GFP,
representing at least a 40-fold expansion (Table 1). In addition,
another GATA-2irGFP-transplanted animal displayed reconstitution with
nonexpressing cells and a repopulating clone(s) expressing an altered
provirus with rearranged GATA-2 sequences, as determined by Southern
blot analysis (data not shown). The delayed engraftment and prolonged
cytopenias initially observed in the GATA-2irGFP-transplanted mice are
consistent with these data and suggest profound defects in both the
proliferation and differentiation of primitive cells constitutively
expressing GATA-2.
 |
DISCUSSSION |
The requirement for GATA-2 is critical during embryonic hematopoiesis,
with loss of GATA-2 function causing fatal embryonic anemia due to a
deficiency of primitive hematopoietic cells.15 However,
defining the precise role of transcription factors like GATA-2 in
normal adult hematopoiesis is not feasible in the case of lethal gene
knock-out phenotypes. One approach to study the functional role of
hematopoietic transcription factors like GATA-2 during adult
hematopoiesis is through investigation of animals transplanted with
stem cells genetically-modified to achieve dysregulated expression of
the protein of interest. Using this strategy, our results show that
retroviral-mediated, enforced expression of the GATA-2 transcription
factor in a variety of primitive hematopoietic cells blocked their
amplification and differentiation. The presence of the linked,
coordinately expressed GFP marker in the GATA-2 vector facilitated the
identification of vector-expressing cells and their progeny. This
allowed the characteristics of GATA-2-expressing cells to be easily
ascertained using a variety of assays. Not only was abrogation of in
vitro and in vivo progenitor-derived colony formation observed, but the
hematopoietic reconstituting activity of pluripotent repopulating cells
was also significantly compromised by enforced GATA-2 expression. Using
enriched populations of GATA-2-expressing and nonexpressing cells,
these alterations in cell function were shown to not be associated with
generalized cell-cycle perturbations, activation of apoptotic pathways,
or coexpression of the GFP marker. Similarly, no evidence of
nonspecific cell toxicity was observed on enforced GATA-2 expression.
Furthermore, the effects observed are arguably attributable to the
specific action of GATA-2 because others have previously shown that the enforced expression of other normal and mutant transcription factors led to specific hematopoietic phenotypes.34,35
The data presented in this report are consistent with previous studies
suggesting the importance of downregulation of GATA-2 during blood cell
differentiation. This phenomenon has been observed in primary human
hematopoietic cell cultures, developing human BFU-E, and in human
erythroleukemic cell lines induced to
differentiate.10,19,36 Correspondingly, Briegel et
al20 reported that transformed chicken erythroblasts fail
to differentiate on activation of an ectopic, conditionally functional
GATA-2 protein. In our studies, enforced expression of GATA-2 in
primitive hematopoietic cells prevented clonogenic growth and
differentiation both in vitro and in vivo. More importantly,
GATA-2-expressing stem cells failed to substantially contribute to
hematopoiesis as evidenced by transplantation experiments using both
unfractionated and highly enriched populations of GATA-2-expressing cells. Our finding that the enforced GATA-2 viral RNA level was comparable to the endogenous GATA-2 levels in the Sca-1+
Lin immature cell population suggests a critical,
tight regulation of GATA-2 during normal hematopoiesis. Thus, in the
GATA-2-transduced immature cells, the overall level of GATA-2 remains
high despite normal downregulation of the endogenous gene that likely
occurs in response to signals triggering blood cell maturation.
Notably, the low level of GATA-2 vector expression in those peripheral blood cells that were positive for vector expression also supports the
likelihood of a strict dose-dependent effect of GATA-2 on blood cell
differentiation. In addition, the observed decay with time
post-transplantation in the numbers of blood cells with even low-level
GATA-2 vector expression (because long-term repopulating cells replace
short-term repopulating cells) suggests a gradient of sensitivity to
GATA-2 levels that reflects the level of maturity of the repopulating
cells active in hematopoiesis following transplantation.
In addition to their failure to differentiate in vivo,
GATA-2-expressing primitive cells failed to substantially expand. In both sets of transplantation experiments, the fraction of cells present
in the graft that did not express the GATA-2 vector markedly outcompeted the GATA-2-expressing cells in the reconstitution of
lethally irradiated mice (Fig 7 to 9 and Table 1). In agreement with
this, estimation of the total number of vector-expressing Sca-1+ Lin cells present in animals,
transplanted 5 to 7 weeks previously with purified populations of
vector-expressing cells, showed the persistence of GATA-2-expressing
primitive cells without substantial amplification. In contrast,
primitive cells expressing the control irGFP vector showed a large
expansion. The findings that enforced GATA-2 expression prevents stem
cell participation in hematopoiesis indicate that constitutively high
levels of GATA-2 have an overriding effect over other signals
triggering stem cell activation. These observations lead us to
hypothesize that the unusually high levels of GATA-2 normally present
in primitive cells may function to preserve a quiescent stem cell
population and that downregulation of GATA-2 expression during normal
hematopoiesis is required for amplification, differentiation, and
maturation of hematopoietic elements. These results extend previous
work showing that GATA-2 is crucial in maintaining the pool of early
hematopoietic cells.15,16 Potential regulators of GATA-2
levels, such as particular combinations or concentrations of multiple
cytokines and/or adhesion molecules, may control both
self-renewal divisions and the activation of quiescent stem cells to
participate in hematopoiesis through their ability to lower GATA-2
levels.
The powerful block in hematopoiesis observed on enforced GATA-2
expression raises important questions regarding potential mechanisms of
action. Our failure to observe a perturbation in the cell-cycle phase
distribution of GATA-2-expressing bone marrow cells favors the lack of
a nonspecific cell-cycle effect by GATA-2. However, a specific
perturbation of the cell-cycle machinery in hematopoietic progenitors
and stem cells cannot be ruled out because these cells comprised only a
very small fraction of the cultured bone marrow cells analyzed.
Although feasible, isolation of adequate numbers of primitive cells
expressing GATA-2 for direct analysis may not be informative due to
their normally relatively quiescent state.37-39 In this
regard, studies to directly measure cycling of Sca-1+
Lin GATA-2-expressing cells in vivo may be both
informative and preferable.
In summary, the experiments described here establish GATA-2 as an
important regulator of stem cell proliferation and differentiation in
normal adult hematopoiesis. The high level of expression of endogenous
GATA-2 in stem cells previously observed,14 together with
our data suggests that GATA-2 may act as one regulator of stem cell
quiescence. In turn, the regulation of GATA-2 expression in response to
a complex network of environmental signals may determine the dynamic
state of activation of particular stem cell clones and their
contribution to hematopoiesis. The delineation of GATA-2 target genes
and the molecular mechanisms underlying different GATA factor-specific
interactions with coactivators and particular target genes should yield
important insight into the biology of hematopoietic stem cells and the
process of hematopoiesis.
 |
ACKNOWLEDGMENT |
The authors thank Drs Richard Cross and Ann Marie Hamilton-Easton for
their expertise in flow cytometric purification and analysis and Laurie
J. Girard for expertise in the RT-PCR assay. We also wish to thank Jean
K. Johnson for her assistance in the preparation of this manuscript.
 |
FOOTNOTES |
Submitted May 13, 1998;
accepted September 10, 1998.
Supported in part by National Heart, Lung, and Blood
Institute Program Project Grant No. P01 HL 53749; Cancer
Center Support CORE Grant No. P30 CA 21765; and American Lebanese
Syrian Associated Charities (ALSAC, Memphis, TN).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address correspondence to Arthur W. Nienhuis, MD, Director, St Jude
Children's Research Hospital, 332 North Lauderdale Dr, Memphis, TN
38105.
 |
REFERENCES |
1.
Yamamoto M, Ko LJ, Leonard MW, Beug H, Orkin SH, Engel JD:
Activity and tissue-specific expression of the transcription factor NF-E1 multigene family.
Genes Dev
4:1650, 1990[Abstract/Free Full Text]
2.
Orkin SH:
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575, 1992[Free Full Text]
3.
Trainor CD, Omichinski JG, Vandergon TL, Gronenborn AM, Clore GM, Felsenfeld G:
A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction.
Mol Cell Biol
16:2238, 1996[Abstract/Free Full Text]
4.
Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH:
FOG, a multiple zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation.
Cell
90:109, 1997[Medline]
[Order article via Infotrieve]
5.
Evans T, Felsenfeld G:
The erythroid-specific transcription factor eryf1: A new finger protein.
Cell
58:877, 1989[Medline]
[Order article via Infotrieve]
6.
Tsai SF, Martin DI, Zon LI, D'Andrea AD, Wong GG, Orkin SH:
Cloning of cDNA for the major DNA binding protein of the erythroid lineage through expression in mammalian cells.
Nature
339:446, 1989[Medline]
[Order article via Infotrieve]
7.
Pevny L, Simon MC, Robertson E, Klein WH, Tsai S-F, D'Agati V, Orkin SH, Costantini F:
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1.
Nature
349:257, 1991[Medline]
[Order article via Infotrieve]
8.
Weiss MJ, Keller G, Orkin SH:
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells.
Genes Dev
8:1184, 1994[Abstract/Free Full Text]
9.
Fujiwara Y, Browne CP, Cunniff K, Goff SC, Orkin SH:
Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1.
Proc Natl Acad Sci USA
93:12355, 1996[Abstract/Free Full Text]
10.
Leonard M, Brice M, Engel JD, Papayannopoulou T:
Dynamics of GATA transcription factor expression during erythroid differentiation.
Blood
82:1071, 1993[Abstract/Free Full Text]
11.
Visvader JE, Adams JM:
Megakaryocytic differentiation induced in 416B myeloid cells by GATA-2 and GATA-3 transgenes or 5-azacytidine is tightly coupled to GATA-1 expression.
Blood
82:1493, 1993[Abstract/Free Full Text]
12.
Dorfman DM, Wilson DB, Bruns GAP, Orkin SH:
Human transcription factor GATA-2: Evidence for regulation of preproendothelin-1 gene expression in endothelial cells.
J Biol Chem
267:1279, 1992[Abstract/Free Full Text]
13.
Tomoko J, Hitoshi M, Zude X, Shintaro N, Masayuki Y, Yukihiko K:
Abundant expression of transcription factor GATA-2 in proliferating but not in differentiated mast cells in tissues of mice: Demonstration by in situ hybridization.
Blood
87:993, 1996[Abstract/Free Full Text]
14.
Orlic D, Anderson S, Biesecker LG, Sorrentino BP, Bodine DM:
Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.
Proc Natl Acad Sci USA
92:4601, 1995[Abstract/Free Full Text]
15.
Tsai F-Y, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt FW, Orkin SH:
An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
371:221, 1994[Medline]
[Order article via Infotrieve]
16.
Tsai F-Y, Orkin SH:
Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation.
Blood
89:3636, 1997[Abstract/Free Full Text]
17.
Pandolfi PP, Roth ME, Karis A, Leonard MW, Dzierzak E, Grosveld FG, Engel JD, Lindenbaum MH:
Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis.
Nat Genet
11:40, 1995[Medline]
[Order article via Infotrieve]
18.
Ting C-N, Olson MC, Barton KP, Leiden JM:
Transcription factor GATA-3 is required for development of the T-cell lineage.
Nature
384:474, 1996[Medline]
[Order article via Infotrieve]
19.
Cunningham JM, Jane SM:
Hemoglobin switching and fetal hemoglobin reactivation.
Semin Hematol
33:9, 1996[Medline]
[Order article via Infotrieve]
20.
Briegel K, Lim K-C, Plank C, Beug H, Engel JD, Zenke M:
Ectopic expression of a conditional GATA-2/estrogen receptor chimera arrests erythroid differentiation in a hormone-dependent manner.
Genes Dev
7:1097, 1993[Abstract/Free Full Text]
21.
Persons DA, Allay JA, Allay ER, Smeyne RJ, Ashmun RA, Sorrentino BP, Nienhuis AW:
Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo.
Blood
90:1777, 1997[Abstract/Free Full Text]
22.
Markowitz D, Goff S, Bank A:
A safe packaging line for gene transfer: Separating viral genes on two different plasmids.
J Virol
62:1120, 1998
23.
Dubridge RB, Tang P, Hsia HC, Phaik-Mooi L, Miller JH, Calos MP:
Analysis of mutation in human cells by using an Epstein Barr virus shuttle system.
Mol Cell Biol
7:379, 1987[Abstract/Free Full Text]
24.
Hawley RG, Lieu FHL, Fong AZC, Hawley TS:
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther
1:136, 1994[Medline]
[Order article via Infotrieve]
25.
Migita M, Medin JA, Pawliuk R, Jacobson S, Nagle JW, Anderson S, Amiri M, Humphries RK, Karlsson S:
Selection of transduced CD34+ progenitors and enzymatic correction of cells from Gaucher patients, with bicistronic vectors.
Proc Natl Acad Sci USA
92:12075, 1995[Abstract/Free Full Text]
26.
Persons DA, Mehaffey M, Kaleko M, Nienhuis AW, Vanin EF:
An improved method for generating retroviral producer clones for vectors lacking a selectable marker gene.
Blood Cells Mol Dis
24:167, 1998[Medline]
[Order article via Infotrieve]
27.
Krishan A:
Rapid flow cytometric analysis of mammalian cell cycle by propidium iodide staining.
J Cell Biol
66:188, 1975[Abstract/Free Full Text]
28.
Gorczya W, Gong J, Darzynkiewicz Z:
Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays.
Cancer Res
53:1945, 1993[Abstract/Free Full Text]
29.
Inaba T, Inukai T, Yoshihara T, Seyschab H, Ashmun RA, Canman CE, Laken SJ, Kastan MB, Look AT:
Reversal of apoptosis by the leukaemia-associated E2A-HLF chimaeric transcription factor.
Nature
382:541, 1996[Medline]
[Order article via Infotrieve]
30.
Whitney JB:
Simplified typing of mouse hemoglobins (Hbb) phenotypes using cystamine.
Biochem Genet
16:667, 1978[Medline]
[Order article via Infotrieve]
31.
Spangrude GJ, Heimfeld S, Weissman IL:
Purification and characterization of mouse hematopoietic stem cells.
Science
241:58, 1988[Abstract/Free Full Text]
32.
Hawley RG, Fong AZC, Burns BF, Hawley TS:
Transplantable myeloproliferative disease induced in mice by an interleukin 6 retrovirus.
J Exp Med
176:1149, 1992[Abstract/Free Full Text]
33.
van der Loo JCM, Ploemacher RE:
Marrow- and spleen-seeding efficiencies of all murine hematopoietic stem cell subsets are decreased by preincubation with hematopoietic growth factors.
Blood
85:2598, 1995[Abstract/Free Full Text]
34.
Farina SF, Girard LJ, Vanin EF, Nienhuis AW, Bodine DM:
Dysregulated expression of GATA-1 following retrovirus-mediated gene transfer into murine hematopoietic stem cells increases erythropoiesis.
Blood
86:4124, 1995[Abstract/Free Full Text]
35.
Hawley RG, Fong AZC, Lu M, Hawley TS:
The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors.
Oncogene
9:1, 1994[Medline]
[Order article via Infotrieve]
36.
Kamesaki H, Michaud GY, Irving SG, Suwabe N, Kamesaki S, Okuma M, Cossman J:
TPA-induced arrest of erythroid differentiation is coupled with downregulation of GATA-1 and upregulation of GATA-2 in an erythroid cell line SAM-1.
Blood
87:999, 1996[Abstract/Free Full Text]
37.
Hodgson GS, Bradley TR:
Properties of hematopoietic stem cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S cell?
Nature
281:381, 1979[Medline]
[Order article via Infotrieve]
38.
Lerner C, Harrison DE:
5-fluorouracil spares hematopoietic stem cells responsible for long-term repopulation.
Exp Hematol
18:114, 1990[Medline]
[Order article via Infotrieve]
39.
Bradford GB, Williams B, Rossi R, Bertoncello I:
Quiescence, cycling, and turnover in the primitive hematopoietic stem cell compartment.
Exp Hematol
15:445, 1997

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Z. Huang, L. C. Dore, Z. Li, S. H. Orkin, G. Feng, S. Lin, and J. D. Crispino
GATA-2 Reinforces Megakaryocyte Development in the Absence of GATA-1
Mol. Cell. Biol.,
September 15, 2009;
29(18):
5168 - 5180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yang, T. Kondo, C. S. Voorhorst, S. C. Nabinger, L. Ndong, F. Yin, E. M. Chan, M. Yu, O. Wurstlin, C. P. Kratz, et al.
Increased c-Jun Expression and Reduced GATA2 Expression Promote Aberrant Monocytic Differentiation Induced by Activating PTPN11 Mutants
Mol. Cell. Biol.,
August 15, 2009;
29(16):
4376 - 4393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Stankiewicz and J. D. Crispino
ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells
Blood,
April 2, 2009;
113(14):
3337 - 3347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Tipping, C. Pina, A. Castor, D. Hong, N. P. Rodrigues, L. Lazzari, G. E. May, S. E. W. Jacobsen, and T. Enver
High GATA-2 expression inhibits human hematopoietic stem and progenitor cell function by effects on cell cycle
Blood,
March 19, 2009;
113(12):
2661 - 2672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yu, J. Chen, Y. Xiong, F. J. Pixley, X.-M. Dai, Y.-G. Yeung, and E. R. Stanley
CSF-1 receptor structure/function in MacCsf1r-/- macrophages: regulation of proliferation, differentiation, and morphology
J. Leukoc. Biol.,
September 1, 2008;
84(3):
852 - 863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Metcalf, S. Glaser, S. Mifsud, L. Di Rago, and L. Robb
The preleukemic state of mice reconstituted with Mixl1-transduced marrow cells
PNAS,
December 11, 2007;
104(50):
20013 - 20018.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Koga, N. Yamaguchi, T. Abe, M. Minegishi, S. Tsuchiya, M. Yamamoto, and N. Minegishi
Cell-cycle-dependent oscillation of GATA2 expression in hematopoietic cells
Blood,
May 15, 2007;
109(10):
4200 - 4208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Dao and J. A. Nolta
Cytokine and integrin stimulation synergize to promote higher levels of GATA-2, c-myb, and CD34 protein in primary human hematopoietic progenitors from bone marrow
Blood,
March 15, 2007;
109(6):
2373 - 2379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, W.-M. Yu, H. Daino, H. E. Broxmeyer, B. J. Druker, and C.-K. Qu
SHP-2 phosphatase is required for hematopoietic cell transformation by Bcr-Abl
Blood,
January 15, 2007;
109(2):
778 - 785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Martowicz, J. A. Grass, and E. H. Bresnick
GATA-1-mediated Transcriptional Repression Yields Persistent Transcription Factor IIB-Chromatin Complexes
J. Biol. Chem.,
December 8, 2006;
281(49):
37345 - 37352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Glaser, D. Metcalf, L. Wu, A. H. Hart, L. DiRago, S. Mifsud, A. D'Amico, S. Dagger, C. Campo, A. C. Chan, et al.
Enforced expression of the homeobox gene Mixl1 impairs hematopoietic differentiation and results in acute myeloid leukemia
PNAS,
October 31, 2006;
103(44):
16460 - 16465.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Davicioni, F. Graf Finckenstein, V. Shahbazian, J. D. Buckley, T. J. Triche, and M. J. Anderson
Identification of a PAX-FKHR Gene Expression Signature that Defines Molecular Classes and Determines the Prognosis of Alveolar Rhabdomyosarcomas.
Cancer Res.,
July 15, 2006;
66(14):
6936 - 6946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. F. de Pooter, T. M. Schmitt, J. L. de la Pompa, Y. Fujiwara, S. H. Orkin, and J. C. Zuniga-Pflucker
Notch Signaling Requires GATA-2 to Inhibit Myelopoiesis from Embryonic Stem Cells and Primary Hemopoietic Progenitors
J. Immunol.,
May 1, 2006;
176(9):
5267 - 5275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-M. Yu, H. Daino, J. Chen, K. D. Bunting, and C.-K. Qu
Effects of a Leukemia-associated Gain-of-Function Mutation of SHP-2 Phosphatase on Interleukin-3 Signaling
J. Biol. Chem.,
March 3, 2006;
281(9):
5426 - 5434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kitajima, M. Tanaka, J. Zheng, H. Yen, A. Sato, D. Sugiyama, H. Umehara, E. Sakai, and T. Nakano
Redirecting differentiation of hematopoietic progenitors by a transcription factor, GATA-2
Blood,
March 1, 2006;
107(5):
1857 - 1863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yuan, W.-M. Yu, M. Xu, and C.-K. Qu
SHP-2 Phosphatase Regulates DNA Damage-induced Apoptosis and G2/M Arrest in Catalytically Dependent and Independent Manners, Respectively
J. Biol. Chem.,
December 30, 2005;
280(52):
42701 - 42706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Martin, D. C. Phillips, K. Szekely-Szucs, L. Elghazi, F. Desmots, and J. A. Houghton
Cyclooxygenase-2 Inhibition Sensitizes Human Colon Carcinoma Cells to TRAIL-Induced Apoptosis through Clustering of DR5 and Concentrating Death-Inducing Signaling Complex Components into Ceramide-Enriched Caveolae
Cancer Res.,
December 15, 2005;
65(24):
11447 - 11458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Tang, J. Zhu, W. Liu, K. Chin, J. Sun, L. Chen, J. A. Hanover, and G. P. Rodgers
The hydroxyurea-induced small GTP-binding protein SAR modulates {gamma}-globin gene expression in human erythroid cells
Blood,
November 1, 2005;
106(9):
3256 - 3263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sano, A. Tessitore, A. Ingrassia, and A. d'Azzo
Chemokine-induced recruitment of genetically modified bone marrow cells into the CNS of GM1-gangliosidosis mice corrects neuronal pathology
Blood,
October 1, 2005;
106(7):
2259 - 2268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Izeradjene, L. Douglas, D. M. Tillman, A. B. Delaney, and J. A. Houghton
Reactive Oxygen Species Regulate Caspase Activation in Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Resistant Human Colon Carcinoma Cell Lines
Cancer Res.,
August 15, 2005;
65(16):
7436 - 7445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oren, I. Torregroza, and T. Evans
An Oct-1 binding site mediates activation of the gata2 promoter by BMP signaling
Nucleic Acids Res.,
August 1, 2005;
33(13):
4357 - 4367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. P. Rodrigues, V. Janzen, R. Forkert, D. M. Dombkowski, A. S. Boyd, S. H. Orkin, T. Enver, P. Vyas, and D. T. Scadden
Haploinsufficiency of GATA-2 perturbs adult hematopoietic stem-cell homeostasis
Blood,
July 15, 2005;
106(2):
477 - 484.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Minegishi, N. Suzuki, Y. Kawatani, R. Shimizu, and M. Yamamoto
Rapid turnover of GATA-2 via ubiquitin-proteasome protein degradation pathway
Genes Cells,
July 1, 2005;
10(7):
693 - 704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Chitu, F. J. Pixley, F. Macaluso, D. R. Larson, J. Condeelis, Y.-G. Yeung, and E. R. Stanley
The PCH Family Member MAYP/PSTPIP2 Directly Regulates F-Actin Bundling and Enhances Filopodia Formation and Motility in Macrophages
Mol. Biol. Cell,
June 1, 2005;
16(6):
2947 - 2959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. J. Pixley, Y. Xiong, R. Y.-L. Yu, E. A. Sahai, E. R. Stanley, and B. H. Ye
BCL6 suppresses RhoA activity to alter macrophage morphology and motility
J. Cell Sci.,
May 1, 2005;
118(9):
1873 - 1883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ezoe, I. Matsumura, K. Gale, Y. Satoh, J. Ishikawa, M. Mizuki, S. Takahashi, N. Minegishi, K. Nakajima, M. Yamamoto, et al.
GATA Transcription Factors Inhibit Cytokine-dependent Growth and Survival of a Hematopoietic Cell Line through the Inhibition of STAT3 Activity
J. Biol. Chem.,
April 1, 2005;
280(13):
13163 - 13170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Y.-L. Yu, X. Wang, F. J. Pixley, J. J. Yu, A. L. Dent, H. E. Broxmeyer, E. R. Stanley, and B. H. Ye
BCL-6 negatively regulates macrophage proliferation by suppressing autocrine IL-6 production
Blood,
February 15, 2005;
105(4):
1777 - 1784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Martowicz, J. A. Grass, M. E. Boyer, H. Guend, and E. H. Bresnick
Dynamic GATA Factor Interplay at a Multicomponent Regulatory Region of the GATA-2 Locus
J. Biol. Chem.,
January 21, 2005;
280(3):
1724 - 1732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Nemeth, A. P. Cline, S. M. Anderson, L. J. Garrett-Beal, and D. M. Bodine
Hmgb3 deficiency deregulates proliferation and differentiation of common lymphoid and myeloid progenitors
Blood,
January 15, 2005;
105(2):
627 - 634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, X. Wang, R. Y.-L. Yu, B. B. Ding, J. J. Yu, X.-M. Dai, A. Naganuma, E. R. Stanley, and B. H. Ye
BCL-6 Negatively Regulates Expression of the NF-{kappa}B1 p105/p50 Subunit
J. Immunol.,
January 1, 2005;
174(1):
205 - 214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Izeradjene, L. Douglas, A. B. Delaney, and J. A. Houghton
Casein Kinase I Attenuates Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis by Regulating the Recruitment of Fas-Associated Death Domain and Procaspase-8 to the Death-Inducing Signaling Complex
Cancer Res.,
November 1, 2004;
64(21):
8036 - 8044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-W. Ling, K. Ottersbach, J. P. van Hamburg, A. Oziemlak, F.-Y. Tsai, S. H. Orkin, R. Ploemacher, R. W. Hendriks, and E. Dzierzak
GATA-2 Plays Two Functionally Distinct Roles during the Ontogeny of Hematopoietic Stem Cells
J. Exp. Med.,
October 4, 2004;
200(7):
871 - 882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Izeradjene, L. Douglas, A. Delaney, and J. A. Houghton
Influence of Casein Kinase II in Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis in Human Rhabdomyosarcoma Cells
Clin. Cancer Res.,
October 1, 2004;
10(19):
6650 - 6660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Elagib, M. Xiao, I. M. Hussaini, L. L. Delehanty, L. A. Palmer, F. K. Racke, M. J. Birrer, G. Shanmugasundaram, M. A. McDevitt, and A. N. Goldfarb
Jun Blockade of Erythropoiesis: Role for Repression of GATA-1 by HERP2
Mol. Cell. Biol.,
September 1, 2004;
24(17):
7779 - 7794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Dominici, C. Pritchard, J. E. Garlits, T. J. Hofmann, D. A. Persons, and E. M. Horwitz
Hematopoietic cells and osteoblasts are derived from a common marrow progenitor after bone marrow transplantation
PNAS,
August 10, 2004;
101(32):
11761 - 11766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuzuki, K. Kitajima, T. Nakano, A. Glasow, A. Zelent, and T. Enver
Cross Talk between Retinoic Acid Signaling and Transcription Factor GATA-2
Mol. Cell. Biol.,
August 1, 2004;
24(15):
6824 - 6836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Satoh, I. Matsumura, H. Tanaka, S. Ezoe, H. Sugahara, M. Mizuki, H. Shibayama, E. Ishiko, J. Ishiko, K. Nakajima, et al.
Roles for c-Myc in Self-renewal of Hematopoietic Stem Cells
J. Biol. Chem.,
June 11, 2004;
279(24):
24986 - 24993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuzuki, M. Seto, M. Greaves, and T. Enver
Modeling first-hit functions of the t(12;21) TEL-AML1 translocation in mice
PNAS,
June 1, 2004;
101(22):
8443 - 8448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hayakawa, M. Towatari, Y. Ozawa, A. Tomita, M. L. Privalsky, and H. Saito
Functional regulation of GATA-2 by acetylation
J. Leukoc. Biol.,
March 1, 2004;
75(3):
529 - 540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Geller, I. Petak, K. S. Szucs, K. Nagy, D. M. Tillman, and J. A. Houghton
Interferon-{gamma}-Induced Sensitization of Colon Carcinomas to ZD9331 Targets Caspases, Downstream of Fas, Independent of Mitochondrial Signaling and the Inhibitor of Apoptosis Survivin
Clin. Cancer Res.,
December 15, 2003;
9(17):
6504 - 6515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Tillman, K. Izeradjene, K. S. Szucs, L. Douglas, and J. A. Houghton
Rottlerin Sensitizes Colon Carcinoma Cells to Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis via Uncoupling of the Mitochondria Independent of Protein Kinase C
Cancer Res.,
August 15, 2003;
63(16):
5118 - 5125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Minegishi, N. Suzuki, T. Yokomizo, X. Pan, T. Fujimoto, S. Takahashi, T. Hara, A. Miyajima, S.-i. Nishikawa, and M. Yamamoto
Expression and domain-specific function of GATA-2 during differentiation of the hematopoietic precursor cells in midgestation mouse embryos
Blood,
August 1, 2003;
102(3):
896 - 905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Grass, M. E. Boyer, S. Pal, J. Wu, M. J. Weiss, and E. H. Bresnick
GATA-1-dependent transcriptional repression of GATA-2 via disruption of positive autoregulation and domain-wide chromatin remodeling
PNAS,
July 22, 2003;
100(15):
8811 - 8816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Persons, E. R. Allay, N. Sawai, P. W. Hargrove, T. P. Brent, H. Hanawa, A. W. Nienhuis, and B. P. Sorrentino
Successful treatment of murine {beta}-thalassemia using in vivo selection of genetically modified, drug-resistant hematopoietic stem cells
Blood,
July 15, 2003;
102(2):
506 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Torchia, S. Jaishankar, and S. J. Baker
Ewing Tumor Fusion Proteins Block the Differentiation of Pluripotent Marrow Stromal Cells
Cancer Res.,
July 1, 2003;
63(13):
3464 - 3468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Elagib, F. K. Racke, M. Mogass, R. Khetawat, L. L. Delehanty, and A. N. Goldfarb
RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation
Blood,
June 1, 2003;
101(11):
4333 - 4341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Neumeister, F. J. Pixley, Y. Xiong, H. Xie, K. Wu, A. Ashton, M. Cammer, A. Chan, M. Symons, E. R. Stanley, et al.
Cyclin D1 Governs Adhesion and Motility of Macrophages
Mol. Biol. Cell,
May 1, 2003;
14(5):
2005 - 2015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Schiedlmeier, H. Klump, E. Will, G. Arman-Kalcek, Z. Li, Z. Wang, A. Rimek, J. Friel, C. Baum, and W. Ostertag
High-level ectopic HOXB4 expression confers a profound in vivo competitive growth advantage on human cord blood CD34+ cells, but impairs lymphomyeloid differentiation
Blood,
March 1, 2003;
101(5):
1759 - 1768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ezoe, I. Matsumura, S. Nakata, K. Gale, K. Ishihara, N. Minegishi, T. Machii, T. Kitamura, M. Yamamoto, T. Enver, et al.
GATA-2/estrogen receptor chimera regulates cytokine-dependent growth of hematopoietic cells through accumulation of p21WAF1 and p27Kip1 proteins
Blood,
November 15, 2002;
100(10):
3512 - 3520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. W. Spurbeck, C. Y. C. Ng, T. S. Strom, E. F. Vanin, and A. M. Davidoff
Enforced expression of tissue inhibitor of matrix metalloproteinase-3 affects functional capillary morphogenesis and inhibits tumor growth in a murine tumor model
Blood,
October 16, 2002;
100(9):
3361 - 3368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Harju, K. J. McQueen, and K. R. Peterson
Chromatin Structure and Control of {beta}-Like Globin Gene Switching
Exp Biol Med,
October 1, 2002;
227(9):
683 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. S. Strom, X. Li, J. M. Cunningham, and A. W. Nienhuis
Correction of the murine Wiskott-Aldrich syndrome phenotype by hematopoietic stem cell transplantation
Blood,
May 29, 2002;
99(12):
4626 - 4628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Leimig, L. Mann, M. d. P. Martin, E. Bonten, D. Persons, J. Knowles, J. A. Allay, J. Cunningham, A. W. Nienhuis, R. Smeyne, et al.
Functional amelioration of murine galactosialidosis by genetically modified bone marrow hematopoietic progenitor cells
Blood,
May 1, 2002;
99(9):
3169 - 3178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuzuki and T. Enver
Interactions of GATA-2 with the promyelocytic leukemia zinc finger (PLZF) protein, its homologue FAZF, and the t(11;17)-generated PLZF-retinoic acid receptor alpha oncoprotein
Blood,
May 1, 2002;
99(9):
3404 - 3410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-M. Yu, T. S. Hawley, R. G. Hawley, and C.-K. Qu
Role of the docking protein Gab2 in beta 1-integrin signaling pathway-mediated hematopoietic cell adhesion and migration
Blood,
April 1, 2002;
99(7):
2351 - 2359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Taghon, M. De Smedt, F. Stolz, M. Cnockaert, J. Plum, and G. Leclercq
Enforced Expression of GATA-3 Severely Reduces Human Thymic Cellularity
J. Immunol.,
October 15, 2001;
167(8):
4468 - 4475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ozawa, M. Towatari, S. Tsuzuki, F. Hayakawa, T. Maeda, Y. Miyata, M. Tanimoto, and H. Saito
Histone deacetylase 3 associates with and represses the transcription factor GATA-2
Blood,
October 1, 2001;
98(7):
2116 - 2123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zeng, M. Masuko, L. Jin, T. Neff, K. G. Otto, and C. A. Blau
Receptor specificity in the self-renewal and differentiation of primary multipotential hemopoietic cells
Blood,
July 15, 2001;
98(2):
328 - 334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhu, C.-H. Kwon, P. W. Schlosshauer, L. H. Ellenson, and S. J. Baker
PTEN Induces G1 Cell Cycle Arrest and Decreases Cyclin D3 Levels in Endometrial Carcinoma Cells
Cancer Res.,
June 1, 2001;
61(11):
4569 - 4575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Coghill, S. Eccleston, V. Fox, L. Cerruti, C. Brown, J. Cunningham, S. Jane, and A. Perkins
Erythroid Kruppel-like factor (EKLF) coordinates erythroid cell proliferation and hemoglobinization in cell lines derived from EKLF null mice
Blood,
March 15, 2001;
97(6):
1861 - 1868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuzuki, M. Towatari, H. Saito, and T. Enver
Potentiation of GATA-2 Activity through Interactions with the Promyelocytic Leukemia Protein (PML) and the t(15;17)-Generated PML-Retinoic Acid Receptor alpha Oncoprotein
Mol. Cell. Biol.,
September 1, 2000;
20(17):
6276 - 6286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Emery, E. Yannaki, J. Tubb, and G. Stamatoyannopoulos
A chromatin insulator protects retrovirus vectors from chromosomal position effects
PNAS,
July 19, 2000;
(2000)
160159597.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. E. Deconinck, P. E. Mead, S. G. Tevosian, J. D. Crispino, S. G. Katz, L. I. Zon, and S. H. Orkin
FOG acts as a repressor of red blood cell development in Xenopus
Development,
May 15, 2000;
127(10):
2031 - 2040.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Heyworth, K. Gale, M. Dexter, G. May, and T. Enver
A GATA-2/estrogen receptor chimera functions as a ligand-dependent negative regulator of self-renewal
Genes & Dev.,
July 15, 1999;
13(14):
1847 - 1860.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. W. Emery, E. Yannaki, J. Tubb, and G. Stamatoyannopoulos
A chromatin insulator protects retrovirus vectors from chromosomal position effects
PNAS,
August 1, 2000;
97(16):
9150 - 9155.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|