|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 2 (January 15), 1999:
pp. 500-508
Positive and Negative Cis-Acting Elements Are Required for
Hematopoietic Expression of Zebrafish GATA-1
By
Anming Meng,
Hong Tang,
Baozheng Yuan,
Bruce A. Ong,
Qiaoming Long, and
Shuo Lin
From the Institute of Molecular Medicine and Genetics & Department of
Biochemistry and Molecular Biology, Medical College of Georgia,
Augusta, GA.
 |
ABSTRACT |
GATA-1 is a transcription factor required for development of
erythroid cells. The expression of GATA-1 is tightly restricted to the
hematopoietic lineage. Using transgene constructs containing zebrafish
GATA-1 genomic sequences and the green fluorescent protein (GFP)
reporter gene, we previously showed that a 5.6-kb enhancer/promoter fragment is sufficient to direct erythroid-specific expression of the
GFP. In this study, we used enhancer/promoter fragments containing
various deletion and point mutations to further characterize the
cis-acting elements controlling tissue-specific GATA-1 expression. We
report here the identification of distinct cis-acting elements that
cooperate to confer on GATA-1 its hematopoietic expression pattern. A
CACCC box, located 142 bp upstream of the translation start codon, is
critical for the initiation of GATA-1 expression. A distal double GATA
element is required for maintaining and enhancing the hematopoietic
expression of GATA-1. The erythroid-specific activity of the GATA-1
promoter is also enhanced by a 49-bp sequence element located 218 bp
upstream of the CACCC element and a CCAAT box adjacent to the double
GATA motif. Finally, the hematopoietic specificity of the GATA-1
promoter is secured by a negative cis-acting element that inhibits
expression in the notochord.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
EXPRESSION OF THE transcription factor
GATA-1 is restricted to hematopoietic cells, including erythroid
progenitors, erythrocytes, megakaryocytes, mast cells, and
eosinophils.1-3 Mouse embryonic stem cells with a disrupted
GATA-1 gene fail to give rise to mature red blood cells,4
indicating that GATA-1 is an essential regulator of the specification
of progenitor cells to an erythroid fate. Differentiation assays in
vitro have shown that murine GATA-1- embryonic stem cells
could differentiate into erythroid precursors, but undergo cell-cycle
arrest and death at the proerythroblast stage.5,6 This
suggests that GATA-1's function is to prevent apoptosis of erythroid
precursors.7 Selective loss of GATA-1 expression in
megakaryocytes of mutant mice resulted in a reduction in the number of
platelets and produced hyperproliferation of megakaryocytes, indicating
a role for GATA-1 in regulating these cell types.8
Given the importance of GATA-1 in specifying the erythroid lineage,
defining the mechanisms underlying its tissue-specific expression has
been a central issue in the blood field. Analyses of GATA-1 promoter
activity in vitro have shown that GATA motifs are required for high
levels of GATA-1 expression in erythroid cell lines.9-12
These data suggest that GATA-1 expression is maintained by an
autoregulatory mechanism during erythroid cell development. However,
these analyses fail to account for the molecular mechanisms that
control the initial expression of GATA-1. In addition, recent experiments have shown that expression of a lacZ reporter gene under the control of a GATA-1 promoter can be expressed in a mouse lacking the GATA-1 gene,13 suggesting that other GATA
factors may be involved in the regulation of GATA-1 expression.
GATA-1 was identified through the isolation of factors that bound to a
DNA sequence motif containing the core element WGATAR that is common to
virtually all promoters of genes that are expressed specifically in
erythroid cells.2,14 Similarly, the identification of
cis-acting sequence elements required for tissue-specific expression of
GATA-1 may lead to the isolation of upstream factors that regulate GATA-1 expression. The zebrafish model has several advantages for in
vivo identification of cis-acting elements required for enhancer/promoter activities. By microinjecting DNA constructs containing tissue-specific promoters ligated to the green fluorescent protein (GFP) reporter gene, one can continuously observe the dynamic
expression patterns of GFP in living transparent embryos.15 Because hundreds of embryos can be microinjected within a single day,
the transient expression of multiple constructs can be analyzed in a
short amount of time. In addition, germline transgenic fish can be
obtained from the microinjected embryos and used for further examination of stable expression patterns. Using this approach, we
previously showed that a 5.6-kb enhancer/promoter fragment of GATA-1 is
sufficient to direct erythroid-specific expression of the GFP in both
transient and stable germline transgenic zebrafish.16 In
this study, we further define the individual cis-acting elements required for hematopoietic expression of the GATA-1 gene. Our results
show that, in conjunction with the positive cis-elements, a negative
cis-element is used to repress nonspecific expression of the GATA-1
gene, thereby confining expression to hematopoietic cells.
| |
MATERIALS AND METHODS |
Generation of constructs.
Plasmid G1-GM2, which contains 5,552 bp of 5 flanking sequence
of the zebrafish GATA-1 gene linked to GM2, a modified
GFP,16 was used as our basal construct. For mapping the
distal control region, constructs 4967GM2, 4847GM2, 4776GM2, 4742GM2,
4683GM2, 4648GM2, 4623GM2, 4271GM2, 3590GM2, and 2564GM2 were generated by polymerase chain reaction (PCR) using SP6 primer specific for vector
sequences in combination with specific primers P4967, P4847, P4776,
P4742, P4683, P4648, P4623, P4271, P3590, and P2564, respectively. The
numbers included in the primer names refer to the positions of their
first 5 base in the GATA-1 genomic sequence; position +1 denotes
the translation start codon. Each specific primer consists of 22 to 30 nucleotides. Constructs 4648m1GM2, 4648m2GM2, and 4648m3GM2 were
generated by PCR using mutant primers P4648m1
(5-ACTCCAATCTAG GCTTCTTATCA-3), P4648m2
(5-ACTCCAATCTAGATAGCTTCTTCCCA-3), and P4648m3
(5-ACTC TCTAGATAGCTTCTTATCA-3), respectively.
Each mutant primer contains 2 to 3 altered bases (underlined). G1-GM2
was used as template in the above PCR reactions. PCR reactions were
performed using the Expand High Fidelity PCR System (Boehringer
Mannheim, Indianapolis, IN) for 25 cycles (94°C, 30 seconds; 55 to 65°C, 30 seconds; 68°C, 2 to 5 minutes). These PCR products were gel-purified and used directly for microinjections without subcloning.
To generate construct G1m-GM2, three DNA fragments (A-C) derived from
construct G1-GM2 were ligated together. Fragment A, containing the
distal region immediately upstream from the double GATA motif (see
Results), was amplified by PCR using a T7 primer and the specific
primer (5-TGGGGTACCTAGATTGGAGTGGGAGGTTGGG-3) and was
digested with SalI/KpnI. Fragment B, containing the
proximal region immediately downstream from the double GATA motif, was amplified by PCR using an SP6 primer and the specific primer
(5-TGGGGTACCACAGTTCAGCAGCAGCGCACA-3) and was digested
with KpnI/BamHI. Fragment C was produced by deleting the 5.6-kb promoter region from G1-GM2 by digesting with
SalI/BamHI. For microinjections, construct G1m-GM2 was
linearized with XhoI.
In XeX-GM2, the GM2 gene was driven by a 450-bp Xenopus
elongation factor (EF) 1 enhancer/promoter
sequence.17 The 150-bp enhancer was removed by
XhoI/SphI digestion to generate Xs-GM2. To generate
construct G1DE-Xs-GM2, a 2,589-bp XhoI/ClaI
(blunt-ended) fragment (from -2968 to -5552) containing the distal
positive control region of the zebrafish GATA-1 promoter was ligated to
Xs-GM2. Before microinjection, this construct was linearized with
XhoI. Linearized Xs-GM2 was used as control for microinjection.
To identify proximal regulatory elements, a series of deletion
constructs with varying sizes of the middle region of the zebrafish GATA-1 promoter was generated by PCR using G1-GM2 as template. These
constructs are DE139, DE168, DE191, DE259, DE367, DE421, DE468, DE501,
DE613, DE764, and DE1776, in which DE represents the -5552/-4256 distal
positive control region and the numbers represent the length of the
remaining proximal region (upstream from the translation start codon).
A pair of primers, RP and Pn, were used to generate each construct.
Primer RP (5-AT ATTGAGCGTACTGTAATAT-3) is
complementary to the sense strand, contains an EcoRI site
(underlined), and was used in all of the PCR reactions. The Pn primers
are complementary to the antisense strand and each one was used in a
specific PCR reaction. The PCR products were treated with 10 U Klenow
fragment of DNA polymerase at 37°C for 1 hour, purified by
electrophoresis, allowed to self-ligate, and used to transform
bacterial cells. The same strategy was used to generate constructs
DE168m1, DE168m2, and DE168m3, in which primers containing base
replacements were used in the PCR reactions. The three corresponding
mutant primers are P168m1
(5-CCAA AAGTACCCCAACCCCACCCAT-3), P168m2
(5-CCAAAAAAAAGTACCC CCCCACCCAT-3), and P168m3
(5-CCAAAAAAAAGTACCCCAACCCCCAT-3) (modified
bases are underlined). The promoter/GFP inserts of these constructs were amplified using primers P4967 and SP6 to remove the vector sequence and a 585-bp unnecessary 5 distal region of the
promoter. The PCR products were purified and directly used for
microinjection unless otherwise stated. These PCR reactions were
performed using the Expand High Fidelity PCR System (Boehringer
Mannheim) for 25 cycles (94°C, 30 seconds; 62°C, 30 seconds;
68°C, 3 minutes).
Microinjection of zebrafish embryos.
For microinjections, the digested DNA or PCR fragments were purified
using GENECLEAN III Kit (Bio 101 Inc, Vista, CA), and resuspended in 5 mmol/L Tris, 0.5 mmol/L EDTA, 0.1 mol/L KCl at a final
concentration of 50 µg/mL. Approximately 0.125%
tetramethyl-rhodamine dextran was included in the DNA preparation as a
microinjection control. Fertilized eggs from wild-type zebrafish were
dechorionated by pronase treatment and microinjected at 1-cell
stage.15 Each construct was microinjected
independently three to eight times to generate sufficient numbers of
surviving embryos for observation.
Fluorescent microscopic observation.
The microinjected embryos were examined for GFP expression at various
developmental stages under a fluorescein isothiocyanate (FITC) filter
on a Zeiss microscope (Germany). Live embryos were anesthetized using tricaine as described previously.15
Embryos were considered positive for GFP expression if they had more
than five GFP-positive cells in the early hematopoietic tissue, the intermediate cell mass (ICM), and later in the circulating blood. The
percentage of blood-specific, GFP-positive embryos after
microinjections was calculated to evaluate the GATA-1 promoter/enhancer
activities of the constructs. Data obtained from independent
microinjections with the same construct were pooled.
Transgenic fish expressing GFP were identified through fluorescent
microscopic observation. The microinjected founder fish were mated to
wild-type fish, and their progeny were observed for GFP expression. The
founder fish that produced GFP positive eggs were considered transgenic
and used to breed into homozygotes.
| |
RESULTS |
Positive erythroid-specific elements are present in the distal 5
flanking region.
We previously generated a construct, G1-GM2
(Fig 1A), by ligating a modified GFP gene
(GM2) to a 5.6 kb zebrafish GATA-1 genomic fragment upstream of the
translation start codon.16 Transgenic zebrafish carrying
the G1-GM2 transgene have GFP expression in hematopoietic progenitors
and erythrocytes. The expression pattern of GFP recapitulated that of
the GATA-1 gene as shown by RNA in situ hybridization,18
suggesting that the 5.6-kb putative GATA-1 promoter/enhancer contains
all of the regulatory elements necessary for GATA-1 expression in the
erythroid lineage. To facilitate the identification of regulatory
elements, we sequenced the entire 5.6 kb promoter/enhancer. Sequence
alignment analysis using computer software (DNA STAR,
Madison, WI) failed to show any highly conserved sequences between the
5 flanking region of the zebrafish GATA-1 gene and those of
mouse and human. A search of the transcription factor database using
MatInspector V2.119 showed hundreds of potential
transcription factor binding sites within this 5.6 kb sequence,
including four double GATA motifs, a type of GATA site that appears to
be important for expression of many erythroid-specific genes.9-12,20,21 To determine which potential transcription factor binding sites are functionally important, a systematic deletion
analysis was performed.
View larger version (25K):
[in this window]
[in a new window]
| Fig 1.
Identification of a distal control region by PCR
dissection of GATA-1 promoter. (A) A map of construct G1-GM2 is shown.
To generate deletion constructs, a specific primer (left
arrowhead) and SP6 primer (right arrowhead) were used
to amplify a portion of G1-GM2, as denoted by the broken line.
(B) The percentages of GFP-positive 48-hour embryos obtained after
microinjection of these constructs are shown, with the number of
embryos observed for each construct indicated in parentheses.
|
|
Four deletion constructs, 4967GM2, 4271GM2, 3590GM2, and 2564GM2,
containing the GM2 gene under the control of variable lengths of the
GATA-1 promoter/enhancer region were generated (Fig 1A) and used to
microinject zebrafish embryos. When the construct, 4967GM2, was
microinjected, approximately 60% of the microinjected embryos had GFP
expression in embryonic circulating blood cells at 48 hours
postfertilization. This result was similar to those obtained with the
original G1-GM2 construct (Fig 1B). However, in embryos microinjected
with constructs 4271GM2, 3590GM2, or 2564GM2, GFP-positive circulating
blood cells were nearly absent (Fig 1B). Because these three constructs
share a deletion of a 696-bp sequence extending from -4967 to -4271, we
concluded that this region contains positive control elements necessary
for the expression of zebrafish GATA-1 in early embryonic circulating blood cells.
To precisely map the 696-bp distal positive control region, we
generated six more constructs, 4847GM2, 4776GM2, 4742GM2, 4683GM2, 4648GM2, and 4623GM2 (Fig 1A), with progressive deletions in the 696-bp
sequence. After microinjection with construct 4623GM2, only seven of
the 707 observed embryos had a few circulating GFP-positive blood
cells. In contrast, microinjection with any of the other five
constructs resulted in approximately 50% of embryos expressing GFP in
circulating blood cells (Fig 1B). This suggests that a 26-bp sequence
from -4648 to -4623 positively regulates hematopoietic expression of
GATA-1 gene.
A double GATA motif in the distal positive control region is the key
regulatory element.
The 26-bp distal positive control region has a sequence of
ACT CTAGATAGCTTCTTATCA. A
search for potential transcription factor binding sites19
showed that this sequence contains two consensus GATA motifs (in bold)
and a CCAAT box element (underlined). The 5 GATA motif between
-4635 and -4638 is separated by 6 bp from an inverted 3 GATA
motif (TATC) between -4624 and -4627. Clusters of GATA motifs are found
in humans,10 mouse,10,12 and
chicken9,11 GATA-1 promoters and in other
erythroid-specific promoters20,21 and are believed to be
important regulatory elements. The CCAAT box element is present in the
regulatory regions of many genes and often upregulates gene
transcription.22-26 Therefore, deletions and mutations were
generated in the GATA and CCAAT elements to investigate their roles in
GATA-1 expression in embryonic blood cells.
A 14-bp fragment including the double GATA motifs and extending from
-4624 to -4637 was deleted from the construct G1-GM2 to generate a new
construct, G1m-GM2. A total of 250 embryos microinjected with G1m-GM2
were examined. The microinjected embryos lacked circulating GFP-positive blood cells at 48 hours postfertilization
(Fig 2), although GFP expression was
observed in some of the microinjected embryos before the 20 somite
stage (discussed below). This suggests that the double GATA motif is a
cis-acting element essential for the maintenance and enhancement of
GATA-1 expression in circulating blood cells.
View larger version (12K):
[in this window]
[in a new window]
| Fig 2.
Mutational analysis of the distal control elements. The
percentages of GFP-positive, 48-hour embryos obtained after
microinjection of deletion constructs are presented. The result
obtained with the 4648GM2 construct is shown again as a control.
Deletion of the double GATA motif within the distal control region
(construct G1m-GM2) completely abolished GFP expression in circulating
blood cells of microinjected embryos.
|
|
To address whether the two GATA motifs are equally important for GATA-1
expression in blood cells, two constructs containing mutations in each
GATA site were generated. Construct 4648m1GM2 had altered bases in the
5 GATA motif, while 4648m2GM2 contained mutations in the
3 inverted GATA motif. Of 136 embryos microinjected with the
construct 4648m2GM2, only one embryo contained circulating GFP-positive
blood cells. When construct 4648m1GM2 was microinjected, 26.7% of the
embryos had GFP expression in circulating blood cells, which was
approximately half the number seen using the parent construct 4648GM2
(Fig 2). These results indicate that the 5 GATA motif is less
important than the 3 inverted GATA motif in maintaining
erythroid-specific expression of GATA-1.
To determine if the CCAAT box was required for hematopoietic expression
of GATA-1, a mutation construct (4648m3GM2) with CGCCT instead of CCAAT
was generated. After microinjection with this construct, 25.4% of the
embryos had GFP expression in circulating blood cells. Furthermore, the
number of GFP-positive blood cells in the embryo was significantly less
than those of embryos microinjected with its parent construct, 4648GM2.
These results imply that the CCAAT motif has the ability to enhance the
hematopoietic expression of GATA-1.
Activity of distal positive control elements requires its own minimal
promoter.
To determine whether activity of the GATA-1 distal positive control
elements was context dependent, construct G1DE-Xs-GM2 was
generated by ligating a 2,589-bp region from -2968 to -5552 containing
the GATA-1 distal control elements (GATA-1 motifs and CCAAT box) to the
Xenopus elongation factor 1 minimal promoter
Xs-GM2.17 Microinjection of Xs-GM2 showed that GFP was
expressed in various tissues, including muscle, enveloping layer cells,
notochord, and melanocytes (data not shown). Of 283 embryos
microinjected with Xs-GM2, however, only two had GFP-expressing blood
cells. Similarly, only three of 408 embryos had circulating GFP-positive blood cells after microinjection with
G1DE-Xs-GM2. This result indicates that the distal control
elements of the GATA-1 requires its own proximal lineage-specific
cis-acting elements to exert full activity. As described below, a CACCC
box in the proximal region of the GATA-1 promoter is absolutely
required for hematopoietic transcription of GATA-1. The same element is not present in the Xenopus elongation factor 1 minimal
promoter, which may explain why the G1DE-Xs-GM2 was unable
to confer high-level expression of the reporter gene GFP in
hematopoietic tissues.
A proximal CACCC box is essential for the expression of GATA-1.
To identify potential cis-acting elements in the proximal region of
GATA-1 promoter, we generated a series of constructs that had the
distal positive control region, extending from -4256 to -5552, ligated
to variable lengths of its downstream sequence followed by the reporter
gene GM2 (Fig 3A). These constructs were used to microinject one-cell zebrafish embryos.
View larger version (22K):
[in this window]
[in a new window]
| Fig 3.
Identification of proximal cis-elements in GATA-1
promoter/enhancer region. (A) Parent construct DE1776 was generated by
deleting a sequence between -4257 and -1775 of the GATA-1 promoter from
plasmid G1-GM2. Other constructs were generated by deleting variable
lengths of sequence between the distal control region and translation
start codon. Deleted regions are indicated by the bold line. Primers
P4967 and SP6 (arrowheads) were used to amplify the region in each
construct required for microinjection (detailed in Materials and
Methods). (B) The percentages of GFP-positive 48-hour embryos obtained
after microinjection of these constructs are shown, with the number of
embryos observed for each construct indicated in parentheses.
|
|
When constructs retaining a proximal promoter region of at least 168 bp
(construct DE168) were microinjected, more than 10% of the embryos
showed GFP expression in circulating blood cells (Fig 3B). When the
retained proximal region was shortened to 139 bp (construct DE139), no
GFP-positive cells were seen in the microinjected embryos. This
suggested that the region between -168 to -139 contained important
regulatory elements for the hematopoietic expression of zebrafish
GATA-1. This 29-bp region has a sequence of
CCAAAAAAAAGTACCCCAACCCCACCCAT and is rich in purines at the
5 end and rich in pyrimidines at the 3 end. The
pyrimidine-rich region contains a potential CACCC box (in bold) that
has been shown to play a role in transcriptional regulation of many
erythroid genes.9,10,12,27-30 To address the potential role
of the CACCC box in the regulation of GATA-1 expression, base mutations
were introduced into the CACCC box and adjacent regions, using the
construct DE168 as a template (see Materials and Methods). Changes of
CAC to TTT in the CACCC box (construct DE168m3) completely eliminated
the expression of GFP in the circulating blood cells, whereas the other
two mutations outside the CACCC box (DE168m1 and DE168m2) did not
affect GFP expression (Fig 3B). This suggests that the CACCC box,
located from -146 to -142 in the GATA-1 locus, is absolutely necessary for GATA-1 expression in the hematopoietic lineage.
Initiation of GATA-1 expression requires the proximal CACCC box but
not the distal double GATA element.
The experiments described above show that both the distal double GATA
motif and the proximal CACCC motif are required for zebrafish GATA-1
expression in circulating blood cells of 48-hour embryos. As in
mouse,12,13,31 however, the question of which motif is
responsible for the initiation of GATA-1 expression is still
unresolved. In zebrafish, GATA-1 expression in hematopoietic progenitor
cells starts at approximately the one somite stage.16,18 Thus, an earlier observation of microinjected embryos should allow the
identification of cis-elements that play a role in the initiation of
GATA-1 expression. Embryos microinjected with the construct G1m-GM2,
which contained nearly the entire promoter/enhancer region except the
distal double GATA motif, did not show GFP expression in circulating
blood cells in 48-hour embryos. However, GFP expression was detected at
earlier developmental stages, ie, at the 2 to 20 somite stages
(Fig 4B). Microinjection of other
constructs lacking the double GATA motif, but containing the proximal
CACCC box, also produced GFP expression in embryos at earlier stages, but it was not maintained beyond 20 hours after fertilization. This
suggests that, although the distal double GATA motif is required to
promote and maintain the level of GATA-1 expression, it is not
essential for the initiation of GATA-1 transcription. In contrast, when
embryos were microinjected either with construct DE139, which lacked
the proximal CACCC box, or with construct DE168m3, which had mutations
in the CACCC box, no GFP expression was observed at the earlier
developmental stages (Fig 4C). This shows that the CACCC box is
absolutely required for the initiation of GATA-1 expression.
View larger version (87K):
[in this window]
[in a new window]
| Fig 4.
Role of proximal CACCC box in initiation of GATA-1
expression and existence of a negative control element. GFP expression
patterns in 9 to 12 somite embryos microinjected with three critical
GATA-1/GFP linearized constructs: (A) G1-GM2 produces strong GFP
expression; (B) G1m-GM2 produces weak GFP expression; and (C) DE139
shows no GFP expression at all. Zebrafish embryos at the 18- to 19-hour
stages transgenic for G1-GM2 (D) or DE1776 (E) show similar patterns of
GFP expression. GFP is expressed in the notochord (indicated by an
arrow in F) of embryos transgenic for DE468, although GFP is also
present in abundance in the hematopoietic intermediate cell mass.
Similar results were observed in germline fish transgenic for DE421
(data not shown).
|
|
Other positive and negative regulatory elements are required for
GATA-1 expression.
We noted that constructs containing both the distal double GATA motif
and the proximal CACCC box, but with varying lengths of the region
between them, have different enhancer/promoter activity (Fig 3).
Microinjection of construct DE1776, containing 1,776 bp of proximal
region, resulted in 61.4% of embryos expressing GFP in circulating
blood cells. This result was similar to that obtained with the
full-length construct G1-GM2. However, microinjection of construct
DE367, containing only 367 bp upstream from the translation start
codon, produced only 12.1% of microinjected embryos expressing GFP in
blood cells. This is significantly less than that obtained with the
other six constructs (DE1776, DE764, DE613, DE501, DE468, and
DE421). In addition, less than 5% of the GFP positive
embryos had more than 10 GFP positive blood cells. This is also
significantly lower than that obtained with the other constructs. These
results suggest that the 49-bp region extending from -421 to -366 is a proximal positive control region that can increase the blood-specific expression of GATA-1. This region contains potential binding sites for
transcription factors such as C/EBPB, AP1, and OCT1, as shown by
analysis with MatInspector V2.1.19
When microinjected with G1-GM2, approximately 6% of the microinjected
embryos showed nonspecific expression of GFP in notochord, muscle,
skin, and other types of cells. Although embryos microinjected with
constructs containing deletions between -1777 to -468 continued to
express GFP in blood cells, approximately 40% of the microinjected embryos exhibited GFP expression in the notochord (data not shown). This result suggests that a negative cis-acting element may be required
to repress nonhematopoietic expression of zebrafish GATA-1 gene.
Essential elements of the GATA-1 promoter are confirmed by analyzing
germline transgenic zebrafish.
By observing GFP expression in progeny of the microinjected founder
fish, we identified several transgenic zebrafish lines that harbor
different GATA-1/GFP constructs, as described above. One transgenic
line derived from construct DE1776 had strong GFP expression in
hematopoietic progenitors (Fig 4E) and circulating erythrocytes. This
pattern is indistinguishable from that of the G1-GM2 germline
transgenic zebrafish (Fig 4D).16 This observation confirms
that the 2,750-bp between position -4257 to -1775 (deleted in construct
DE1776) is not required for proper expression of GATA-1. We have also
obtained transgenic germline fish from constructs DE468 and DE421.
Consistent with results from the transient expression studies, both
lines have a hematopoietic GFP expression pattern that is identical to
G1-GM2 transgenic lines (Figs 4F and D). In addition, both DE468 and
DE421 transgenic lines have GFP expression in the notochord. This
further validates the transient assay results suggesting that negative
cis-acting elements play a role in conferring hematopoietic expression
of the zebrafish GATA-1 gene.
| |
DISCUSSION |
The transcription factor GATA-1 plays an important role in
hematopoietic development by regulating the expression of downstream hematopoietic genes.16,32,33 Similarly, the expression of GATA-1 itself must be regulated by other lineage-specific transcription factors. Characterization of the cis-acting elements that control the
expression of GATA-1 gene should lead to the identification of factors
that act upstream of GATA-1.
To date, much of the knowledge concerning regulation of GATA-1 gene
expression has been obtained from studies of the mouse and chicken
promoters. Transient transfection assays in cultured cells have shown
that a double GATA motif, located upstream of the first exon, is
required for full promoter activity of the mouse GATA-1
gene.10,12 In addition, it has been shown that mutations in
a CACCC box between the double GATA motif and the first exon can reduce
this promoter activity.12 Recent studies in transgenic mice
have shown that the activation of GATA-1 gene expression in primitive
or definitive erythroid cells is controlled by different regulatory
sequences.12,13,31 For instance, a transgene with a short
proximal mouse GATA-1 promoter could only express infrequently in
definitive erythroid cells.13 The inclusion of an upstream
sequence not only increased the expression frequency in definitive
erythroid cells, but also activated the expression of the transgene in
primitive erythroid cells. However, the specific sequence motifs in
that upstream region have not been identified. So far, the implication
of CACCC boxes in the initiation of GATA-1 expression has not been
shown in the above studies.
Using transgene constructs containing zebrafish GATA-1 genomic
sequences and the GFP reporter gene, we previously demonstrated that a
5.6-kb enhancer/promoter fragment is sufficient to direct erythroid-specific expression of the GFP.16 In this study,
we have identified individual cis-acting elements that are required for
the erythroid-specific expression of the zebrafish GATA-1 gene
(Fig 5). We have found that a CACCC box in
the proximal region between -146 and -142 is critical for initiating
zebrafish GATA-1 expression, whereas a double GATA motif in the distal
region between -4635 and -4627 is necessary for enhancing and
maintaining hematopoietic expression of the GATA-1 gene. These two
regulatory elements cooperate with other positive and negative elements
to confer hematopoietic transcription of the GATA-1 gene.
View larger version (12K):
[in this window]
[in a new window]
| Fig 5.
Cis-regulatory elements in zebrafish GATA-1 genomic
locus. The proximal CACCC box element at position -146 is absolutely
required for the initiation of GATA-1 gene expression in hematopoietic
cells, while the distal double GATA motif between -4635 and -4627 is
necessary for enhancing and maintaining this expression. The CCAAT box
at -4643 and another 49-bp positive control region (pcr) between -421 and -366 strengthen the GATA-1 expression. The expression of GATA-1 in
the notochord, a nonhematopoietic tissue, is repressed by a negative
control region (ncr) located between -1776 to -468.
|
|
Cis-regulatory sequence elements mediate transcription specificity and
activation by binding to specific proteins. Our studies suggest that
factors binding to the CACCC box could be critical for the initiation
of GATA-1 expression during embryonic development. The erythroid
Kruppel-like factor (EKLF) is the first identified hematopoietic-specific transcription factor that binds to the CACCC
box.34 However, it is unlikely that the EKLF is required for GATA-1 expression because GATA-1 is still able to express in murine
EKLF-/- embryos.35 BKLF, a second erythroid
CACCC-box-binding transcription factor, shows a high-affinity with many
CACCC motifs present in the promoters of erythroid-specific genes
including GATA-1 in an in vitro assay.36 Whether BKLF or
other unidentified erythroid Kruppel-like factors can bind to the CACCC
box in vivo and activate the expression of GATA-1 in zebrafish remains
to be determined.
Studies in other species showed that a functional GATA motif in the
proximal region of GATA-1 promoters was able to be bound by
GATA-1.10-12 Based on such observations, a positive
autoregulatory mechanism was proposed for increasing and maintaining
GATA-1 expression during differentiation and cellular maturation.
McDevitt et al (1997) showed that GATA-1 is not required
for activation and maintenance of GATA-1 gene expression because a
GATA-1/lacZ transgene could express in a GATA-1-
background.13 Our studies establish an essential role for
the double GATA cis-acting element in maintaining hematopoietic
expression of GATA-1. However, which member of the GATA family does
this is yet to be identified.
Although the CCAAT box was reported to be involved in blood-specific
gene expression,22,24-26,37 its importance in GATA-1 expression has not been determined. We show that a mutation in the
CCAAT box immediately upstream of the distal double GATA site significantly reduces GATA-1 expression. Considering the short distance
between the CCAAT box and the double GATA motif, factors binding to the
CCAAT box might function through interactions with a GATA factor to
influence the transcription level of the GATA-1 gene. This kind of
interaction may involve multiple factors as suggested by the study of
Wadman et al,38 in which an erythroid specific DNA-binding
complex including TAL1, E47, GATA-1, and Ldb1/NLI proteins was shown to
interact with closely linked GATA and CAGGTG sites.
To the best of our knowledge, this study represents the first report
describing a negative regulatory mechanism for blood-specific gene
expression. The expression of GATA-1 in the notochord is apparently
suppressed through an interaction between a negative regulatory element
in the GATA-1 promoter and notochord-derived negative factors. This
type of regulation has been reported to repress the expression of
neuron-specific genes in nonneuronal tissues.39,40
We identified the cis-acting elements important for GATA-1 promoter
activity through a transient, whole zebrafish embryonic reporter gene
assay. The data obtained by transient assays have been confirmed by
expression patterns obtained in germline transgenic zebrafish. By
ligating essential elements of the zebrafish GATA-1 promoter, we
generated stable transgenic zebrafish with GFP expression comparable to
that obtained by using a full-length promoter. These results validate
the zebrafish as a whole embryo system for the efficient identification
of those cis-acting elements playing critical roles in modulating the
expression of developmentally regulated genes.
| |
ACKNOWLEDGMENT |
We thank Jason R. Jessen, Scott Marty, Billie Moore, and Han Wang for
helpful discussions and comments on the manuscript.
| |
FOOTNOTES |
Submitted August 4, 1998;
accepted September 16, 1998.
Supported by grants from the American Heart Association of Georgia and
the National Institutes of Health (to S.L.). S.L. is a recipient of the
American Society of Hematology Scholar Award.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Shuo Lin, PhD, Institute of
Molecular Medicine, Medical College of Georgia, Augusta, GA 30912;
e-mail: slin{at}mail.mcg.edu.
| |
REFERENCES |
1.
Martin DI, Zon LI, Mutter G, Orkin SH:
Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages.
Nature
344:444, 1990[Medline]
[Order article via Infotrieve]
2.
Tsai SF, Martin DI, Zon LI, D'Andrea AD, Wong GG, Orkin SH:
Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells.
Nature
339:446, 1989[Medline]
[Order article via Infotrieve]
3.
Zon LI, Yamaguchi Y, Yee K, Albee EA, Kimura A, Bennett JC, Orkin SH, Ackerman SJ:
Expression of mRNA for the GATA-binding proteins in human eosinophils and basophils: Potential role in gene transcription.
Blood
81:3234, 1993[Abstract/Free Full Text]
4.
Pevny L, Simon MC, Robertson E, Klein WH, Tsai SF, D'Agati V, Orkin SH, Costantini F:
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1.
Nature
349:257, 1991[Medline]
[Order article via Infotrieve]
5.
Pevny L, Lin CS, D'Agati V, Simon MC, Orkin SH, Costantini F:
Development of hematopoietic cells lacking transcription factor GATA-1.
Development
121:163, 1995[Abstract]
6.
Weiss MJ, Keller G, Orkin SH:
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells.
Genes Dev
8:1184, 1994[Abstract/Free Full Text]
7.
Weiss MJ, Orkin SH:
Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis.
Proc Natl Acad Sci USA
92:9623, 1995[Abstract/Free Full Text]
8.
Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH:
A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development.
EMBO J
16:3965, 1997[Medline]
[Order article via Infotrieve]
9.
Hannon R, Evans T, Felsenfeld G, Gould H:
Structure and promoter activity of the gene for the erythroid transcription factor GATA-1.
Proc Natl Acad Sci USA
88:3004, 1991[Abstract/Free Full Text]
10.
Nicolis S, Bertini C, Ronchi A, Crotta S, Lanfranco L, Moroni E, Giglioni B, Ottolenghi S:
An erythroid specific enhancer upstream to the gene encoding the cell-type specific transcription factor GATA-1.
Nucleic Acids Res
19:5285, 1991[Abstract/Free Full Text]
11.
Schwartzbauer G, Schlesinger K, Evans T:
Interaction of the erythroid transcription factor cGATA-1 with a critical auto-regulatory element.
Nucleic Acids Res
20:4429, 1992[Abstract/Free Full Text]
12.
Tsai SF, Strauss E, Orkin SH:
Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter.
Genes Dev
5:919, 1991[Abstract/Free Full Text]
13.
McDevitt MA, Fujiwara Y, Shivdasani RA, Orkin SH:
An upstream, DNase I hypersensitive region of the hematopoietic-expressed transcription factor GATA-1 gene confers developmental specificity in transgenic mice.
Proc Natl Acad Sci USA
94:7976, 1997[Abstract/Free Full Text]
14.
Evans T, Reitman M, Felsenfeld G:
An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes.
Proc Natl Acad Sci USA
85:5976, 1988[Abstract/Free Full Text]
15.
Meng A, Tang H, Ong BA, Farrell MJ, Lin S:
Promoter analysis in living zebrafish embryos identifies a cis-acting motif required for neuronal expression of GATA-2.
Proc Natl Acad Sci USA
94:6267, 1997[Abstract/Free Full Text]
16.
Long Q, Meng A, Wang H, Jessen JR, Farrell MJ, Lin S:
GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene.
Development
124:4105, 1997[Abstract]
17.
Johnson AD, Krieg PA:
pXeX, a vector for efficient expression of cloned sequences in Xenopus embryos.
Gene
147:223, 1994[Medline]
[Order article via Infotrieve]
18.
Detrich HWr, Kieran MW, Chan FY, Barone LM, Yee K, Rundstadler JA, Pratt S, Ransom D, Zon LI:
Intraembryonic hematopoietic cell migration during vertebrate development.
Proc Natl Acad Sci USA
92:10713, 1995[Abstract/Free Full Text]
19.
Quandt K, Frech K, Karas H, Wingender E, Werner T:
MatInd and MatInspector: New fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res
23:4878, 1995[Abstract/Free Full Text]
20.
Martin DI, Orkin SH:
Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1.
Genes Dev
4:1886, 1990[Abstract/Free Full Text]
21.
Orkin SH:
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575, 1992[Free Full Text]
22.
Huang MN, Hung HL, Stanfield-Oakley SA, High KA:
Characterization of the human blood coagulation factor X promoter.
J Biol Chem
267:15440, 1992[Abstract/Free Full Text]
23.
McKnight S, Tjian R:
Transcriptional selectivity of viral genes in mammalian cells.
Cell
46:795, 1986[Medline]
[Order article via Infotrieve]
24.
Myers RM, Tilly K, Maniatis T:
Fine structure genetic analysis of a beta-globin promoter.
Science
232:613, 1986[Abstract/Free Full Text]
25.
Ronchi A, Berry M, Raguz S, Imam A, Yannoutsos N, Ottolenghi S, Grosveld F, Dillon N:
Role of the duplicated CCAAT box region in gamma-globin gene regulation and hereditary persistence of fetal haemoglobin.
EMBO J
15:143, 1996[Medline]
[Order article via Infotrieve]
26.
Uzan G, Prenant M, Prandini MH, Martin F, Marguerie G:
Tissue-specific expression of the platelet GPIIb gene.
J Biol Chem
266:8932, 1991[Abstract/Free Full Text]
27.
Epperly BR, Bergenham NC, Venta PJ, Tashian RE:
Characterization of the genes encoding carbonic anhydrase I of chimpanzee and gorilla: Comparative analysis of 5 flanking erythroid-specific promoter sequences.
Gene
131:249, 1993[Medline]
[Order article via Infotrieve]
28.
Frampton J, Walker M, Plumb M, Harrison PR:
Synergy between the NF-E1 erythroid-specific transcription factor and the CACCC factor in the erythroid-specific promoter of the human porphobilinogen deaminase gene.
Mol Cell Biol
10:3838, 1990[Abstract/Free Full Text]
29.
Max-Audit I, Eleouet JF, Romeo PH:
Transcriptional regulation of the pyruvate kinase erythroid-specific promoter.
J Biol Chem
268:5431, 1993[Abstract/Free Full Text]
30.
Orkin SH:
Regulation of globin gene expression in erythroid cells.
Eur J Biochem
231:271, 1995[Medline]
[Order article via Infotrieve]
31.
Onodera K, Takahashi S, Nishimura S, Ohta J, Motohashi H, Yomogida K, Hayashi N, Engel JD, Yamamoto M:
GATA-1 transcription is controlled by distinct regulatory mechanisms during primitive and definitive erythropoiesis.
Proc Natl Acad Sci USA
94:4487, 1997[Abstract/Free Full Text]
32.
Orkin SH:
Transcription factors and hematopoietic development.
J Biol Chem
270:4955, 1995[Free Full Text]
33.
Shivdasani RA, Orkin SH:
The transcriptional control of hematopoiesis [see comments].
Blood
87:4025, 1996[Free Full Text]
34.
Miller IJ, Bieker JJ:
A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins.
Mol Cell Biol
13:2776, 1993[Abstract/Free Full Text]
35.
Nuez B, Michalovich D, Bygrave A, Ploemacher R, Grosveld F:
Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene.
Nature
375:316, 1995[Medline]
[Order article via Infotrieve]
36.
Crossley M, Whitelaw E, Perkins A, Williams G, Fujiwara Y, Orkin SH:
Isolation and characterization of the cDNA encoding BKLF/TEF-2, a major CACCC-box-binding protein in erythroid cells and selected other cells.
Mol Cell Biol
16:1695, 1996[Abstract]
37.
Tang DC, Ebb D, Hardison RC, Rodgers GP:
Restoration of the CCAAT box or insertion of the CACCC motif activates [corrected] delta-globin gene expression [erratum appears in Blood 90:2120, 1997].
Blood
90:421, 1997[Abstract/Free Full Text]
38.
Wadman IA, Osada H, Grutz GG, Agulnick AD, Westphal H, Forster A, Rabbitts TH:
The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins.
EMBO J
16:3145, 1997[Medline]
[Order article via Infotrieve]
39.
Schoenherr CJ, Anderson DJ:
The neuron-restrictive silencer factor (NRSF): A coordinate repressor of multiple neuron-specific genes.
Science
267:1360, 1995[Abstract/Free Full Text]
40.
Quinn JP:
Neuronal-specific gene expression  the interaction of both positive and negative transcriptional regulators.
Prog Neurobiol
50:363, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Kobayashi and M. Yamamoto
Regulation of GATA1 Gene Expression
J. Biochem.,
July 1, 2007;
142(1):
1 - 10.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Pi, Z. Yang, J. Wang, L. Ruan, X. Yu, J. Ling, S. Krantz, C. Isales, S. J. Conway, S. Lin, et al.
The LTR enhancer of ERV-9 human endogenous retrovirus is active in oocytes and progenitor cells in transgenic zebrafish and humans
PNAS,
January 20, 2004;
101(3):
805 - 810.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nishikawa, M. Kobayashi, A. Masumi, S. E. Lyons, B. M. Weinstein, P. P. Liu, and M. Yamamoto
Self-Association of Gata1 Enhances Transcriptional Activity In Vivo in Zebra Fish Embryos
Mol. Cell. Biol.,
November 15, 2003;
23(22):
8295 - 8305.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kobayashi, K. Nishikawa, and M. Yamamoto
Hematopoietic regulatory domain of gata1 gene is positively regulated by GATA1 protein in zebrafish embryos
Development,
June 15, 2001;
128(12):
2341 - 2350.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. M. Barton, B. Gottgens, M. Gering, J. G. R. Gilbert, D. Grafham, J. Rogers, D. Bentley, R. Patient, and A. R. Green
Regulation of the stem cell leukemia (SCL) gene: A tale of two fishes
PNAS,
May 24, 2001;
(2001)
101532998.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Dodd, P. M. Curtis, L. C. Williams, and D. R. Love
Zebrafish: bridging the gap between development and disease
Hum. Mol. Genet.,
October 1, 2000;
9(16):
2443 - 2449.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Calmont, K. Reichwald, P. Ronco, and J. Rossert
Identification of a Short cis-Acting Element in the Human Vasopressin Type 2 Receptor Gene Which Confers High-Level Expression of a Reporter Gene Specifically in Collecting Duct Cells
Mol. Endocrinol.,
October 1, 2000;
14(10):
1682 - 1695.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. Nishimura, S. Takahashi, T. Kuroha, N. Suwabe, T. Nagasawa, C. Trainor, and M. Yamamoto
A GATA Box in the GATA-1 Gene Hematopoietic Enhancer Is a Critical Element in the Network of GATA Factors and Sites That Regulate This Gene
Mol. Cell. Biol.,
January 15, 2000;
20(2):
713 - 723.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. M. Barton, B. Gottgens, M. Gering, J. G. R. Gilbert, D. Grafham, J. Rogers, D. Bentley, R. Patient, and A. R. Green
From the Cover: Regulation of the stem cell leukemia (SCL) gene: A tale of two fishes
PNAS,
June 5, 2001;
98(12):
6747 - 6752.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction