|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 2 (January 15), 1999:
pp. 554-563
Downregulation of c-kit (Stem Cell Factor Receptor) in
Transformed Hematopoietic Precursor Cells by Stroma Cells
By
Christoph Heberlein,
Jutta Friel,
Christine Laker,
Dorothee von
Laer,
Ulla Bergholz,
Martina Bögel,
Leonie K. Ashman,
Karl Klingler, and
Wolfram Ostertag
From the Department of Cell and Virus Genetics,
Heinrich-Pette-Institut für experimentelle Virologie und
Immunologie an der Universität Hamburg, Hamburg, Germany; the
Division of Haematology, Hanson Centre for Cancer Research, Adelaide,
South Australia; and the Institut für Klinische Chemie,
Universität zu Köln, Köln, Germany.
 |
ABSTRACT |
We show a dramatic downregulation of the stem cell factor
(SCF) receptor in different hematopoietic cell lines by
murine stroma. Growth of the human erythroid/macrophage progenitor cell
line TF-1 is dependent on granulocyte-macrophage colony-stimulating factor (GM-CSF) or interleukin-3 (IL-3). However, TF-1 cells clone and
proliferate equally well on stroma. Independent stroma-dependent TF-1
clones (TF-1S) were generated on MS-5 stroma. Growth of TF-1S and TF-1
cells on stroma still requires interaction between c-kit (SCF receptor)
and its ligand SCF, because antibodies against c-kit inhibit growth to
less than 2%. Surprisingly, c-kit receptor expression (RNA and
protein) was downregulated by 2 to 3 orders of magnitude in TF-1S and
TF-1 cells grown on stroma. This stroma-dependent regulation of the kit
receptor in TF-1 was also observed on exposure to kit ligand-negative
stroma, thus indicating the need for heterologous receptor ligand
interaction. Removal of stroma induced upregulation by 2 to 4 orders of
magnitude. Downregulation and upregulation of c-kit expression could
also be shown for the megakaryocytic progenitor cell line M-07e and was
comparable to that of TF-1, indicating that stroma-dependent regulation
of c-kit is a general mechanism. Downregulation may be an economic way
to compensate for the increased sensitivity of the c-kit/ligand
interaction on stroma. The stroma-dependent c-kit regulation most
likely occurs at the transcriptional level, because mechanisms, such as
splicing, attenuation, differential promoter usage, or mRNA stability,
could be excluded.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE c-kit GENE ENCODES a tyrosine kinase
receptor of critical importance for dermal, gonadal, and hematopoietic
stem cell development.1,2 The c-kit protein functions as a
receptor for two different forms of stem cell factor
(SCF), a soluble (sSCF) and a membrane bound ligand
(mSCF). Both act in a qualitatively different manner.3,4
Secretion of sSCF or presentation of mSCF by stroma cells suggests that
the hematopoietic microenvironment regulates hematopoiesis by close
cell-to-cell contact.5,6 In its soluble form, SCF induces
short-term proliferation either alone or in synergism with other growth
factors. Thus, primitive murine Sca-1+ hematopoietic
progenitor cells respond better to a combination of hematopoietic
factors if SCF is included in the cocktail.7 Stroma cells
expressing mSCF, as opposed to those releasing sSCF, maintain human
progenitors for several weeks.8 The different functions of
SCF can be explained by mechanisms either involving the SCF ligand
itself or its receptor.
To test the expression and function of molecules expected to play a key
role in cell-cell interactions, we established systems for long-term
growth of murine (ELM, Myl-D7)9,10 and human hematopoietic
progenitor cells using coculture with a murine SCF expressing stroma
cell line (MS-5). By inclusion of stroma, our cell culture systems
combine the advantages of cell lines (eg, long-term proliferation and
relatively stable phenotype) with an in vivo comparable situation of so
far undefined cell-cell interactions. The human TF-1 cells used in this
study were originally described to be strictly dependent on
granulocyte-macrophage colony-stimulating factor (GM-CSF) or
interleukin-3 (IL-3).11 We observed that MS-5 stroma cells
can alternatively stimulate long-term growth of TF-1 cells (manuscript
in preparation and this report). Several stroma adapted
TF-1S lines (TF-1S #MB1-#MB8) were established by continued passage of
cloned TF-1 on MS-5 stroma cells. After 3 months, neither GM-CSF nor
IL-3 could maintain the long-term growth of the TF-1S clones (W. Ostertag, unpublished results). Thus, the TF-1S clones
were considered to be stroma-dependent.
We used TF-1 and the M-07e megakaryoblastic cell line12 to
establish the general relevance of the c-kit regulation. M-07e was
either grown in suspension with the soluble growth factors GM-CSF
or IL-3 or by coculture with stroma cells to test the c-kit receptor
expression. We observed a stroma-dependent c-kit receptor modulation of
up to 3 orders of magnitude within 90 days.
Because regulation of c-kit could be the result of different
mechanisms, we performed expression analysis on several levels. The
influence of stroma cells on the structure of the chromatin flanking
the c-kit promoter as well as the influence of stroma on differential
promoter usage, the transcript level, and alternative splicing was
examined. Posttranscriptional controls may also affect the level of
c-kit receptor, because low-level posttranscriptional downregulation of
the related CSF-1R has been shown to occur by activation of other
receptors in early murine multipotent progenitor cells13
and in a special subset of late progenitor cells.14 Our
data show that downregulation of the c-kit mRNA level does not result
from stroma cell-mediated reduction of the mRNA stability. Therefore,
c-kit expression is most likely regulated on the transcriptional level.
| |
MATERIALS AND METHODS |
Cell lines.
TF-1 cells show an early erythro-myeloid progenitor phenotype and
depend for growth on either GM-CSF or IL-3.11 TF-1 cells were maintained in RPMI1640 medium supplemented with 10% fetal calf
serum (FCS; GIBCO BRL, Grand Island, NY), 2 mmol/L
glutamine, and 5 × 102 U/mL of recombinant human
GM-CSF (rhGM-CSF) in tissue culture flasks. Strictly stroma-dependent
TF-1 cell lines (TF-1S) were isolated by cloning (end point dilution)
of TF-1 on lethally irradiated murine MS-515 (17,600 rad)
or UNC Sl /Sl16 (3,900 rad) stroma
cells and sequential transfer of the clones to new feeder cells every 1 to 2 weeks for several weeks. The medium for these stroma-dependent
clones was the same as described above, except that GM-CSF was not
used. For studies of the c-kit receptor expression, TF-1S cells were
washed twice with medium and were subsequently transferred to uncoated
petri dishes in the presence of RPMI medium with 10% FCS, 2 mmol/L
glutamine, and 5 × 102 U/mL rhGM-CSF.
The megakaryoblastic cell line M-07e was cultured in Iscove's modified
Dulbecco's medium (IMDM; GIBCO BRL) supplemented with 10% FCS, 2 mmol/L glutamine, and 2 ng/mL rhIL-3 (Pharma
Biotechnologie, Hannover, Germany).
The murine MS-5 stroma cells15 do not secrete
GM-CSF.10 They were maintained in  -MEM supplemented with
20% horse serum (HS; BioWhittaker UK Ltd, Berkshire, UK)
and 2 mmol/L glutamine. The stroma cell feeder was prepared by growing
cells up to 40% confluency in tissue culture flasks and then 17,600 rad lethal irradiation. UNC Sl/Sl
cells16 were cultured in RPMI/10% FCS/2 mmol/L glutamine.
Inhibition of growth by monoclonal c-kit antibody.
The monoclonal antibody (MoAb) YB5.B8 (anti-c-kit) has already been
described.17 For analyzing proliferation of TF-1 on stroma,
MS-5 cells (103 cells/well of microtiter plates) were
plated in -MEM, 20% HS, and 2 mmol/L glutamine and allowed to grow
overnight. MS-5 cells were irradiated (17,600 rad). The medium was
removed. One hundred TF-1 cells per well were seeded in prewarmed
complete medium (RPMI/10% FCS/2 mmol/L glutamine) on MS-5 feeder.
After incubation of the cells for 24 hours at 37°C, fresh medium
containing the monoclonal c-kit antibody, as described in Fig 1, was
added. TF-1 cells were counted after 5 days and the numbers were
compared with a control without c-kit antibody (100% proliferation).
TF-1 grown in suspension with GM-CSF was used as a negative control.
Flow cytometric analysis of c-kit+ cells.
Phycoerythrin (PE)-conjugated MoAb (MoAb YB5.B8) specific for c-kit was
obtained from Dianova (Hamburg, Germany). PE-conjugated isotype-matched Ab (Simultest control; Becton Dickinson, San Jose, CA) was used as a negative control. Washed cells
(106) were resuspended in 30 µL staining buffer
(phosphate-buffered saline [PBS]/1% FCS) and incubated with
appropriate amounts of PE-conjugated MoAb for detection of c-kit
protein. Labeling was performed for 30 minutes at 4°C for
anti-c-kit and control antibody. Labeled cells were washed three times
with PBS/1% bovine serum albumin (BSA). Cells were analyzed with a
FACScan (Becton Dickinson). Laser excitation was at 488 nm for PE.
RNA extraction and analysis.
RNA isolation and Northern analysis were performed as
described.18 DNA fragments for hybridization probes were
obtained from plasmid pUC 19/hckit,19 containing a
full-length cDNA for c-kit, or were synthesized by reverse
transcriptase-dependent polymerase chain reaction (RT-PCR), cloned into
a PCR cloning vector (pCR; Invitrogen, NV Leek, The Netherlands), and
checked for specificity by sequencing.
Specific RNA transcripts were amplified by the RT-PCR. RNA (1 µg) was
reverse transcribed into cDNA by using avian myeloblastosis virus
reverse transcriptase and primed by a mixture of oligo
(dT)12-18 and random primer (hexanucleotide).
Specific DNA fragments were subsequently amplified with Taq polymerase
(GIBCO BRL, Life Technologies GmbH, Karlsruhe, Germany) in a
thermocycler (Perkin-Elmer, Langen, Germany), as described by Saiki et
al.20 The amplified product was separated by agarose gel
electrophoresis and detected in the presence of ethidium bromide under
UV light. To confirm specificity and to detect low quantities, DNA was
transferred to a nylon membrane and hybridized to specific probes. For
semiquantitative RT-PCR, various cycle numbers and different
concentrations of cDNA were tested to ensure a linear range of
amplification. The number of amplification cycles, if not indicated
elsewere, was as follows: for c-kit, 20; for GM-CSFR , 20; and for
actin, 15. Primers used for PCR were as follows: c-kit: forward primer
KE3 (CTTGTTGACCGCTCCTTG) (nt 376-393) and reverse primer KE7
(GCTATGGCAGCATTGACG) (nt 1215-1232) or alternatively forward primer
3 UTS66 (TGGACCACTGCATGAGCTTT) (nt 3521-3540) and reverse primer
3UTS67 (TCCTGTGGGAGCCATGCAGT) (nt 3928-3947)19; GM-CSFR: forward primer 1 (CTGGTCCCTCTGGCCCAGGC) (nt 2115-2134) and
reverse primer 2 (GACCTCCCAAGGGGGCAG) (nt 2853-2870)21; c-myc: forward primer 1 (TACTGCGACGAGGAGGAGAAC) (nt 70-90) and reverse
primer 2 (GCTGTGGCCTCCAGCAGAAG) (nt 845-864)22; actin: forward primer 1 (CGCCGCGCTCGTCGTCGACA) (nt 56-75) and reverse primer 2 (GTCACGCACGATTTCCCGCT) (nt 655-674).23 Quantitative determination was performed by either densitometric scanning of the
autoradiographs or scanning of phosphorimages using a phosphorimager (Fuji Photo Film Co Ltd, Tokyo, Japan) and TINA (version
2.0; Raytest, Straubenhardt, Germany) software for
evaluation.
To determine the start site of c-kit transcription, for both TF-1 and
stroma-dependent clones, rapid amplification of cDNA ends (RACE)-PCR
was performed (GIBCO BRL). Length and specificity of the resulting PCR
products were checked by size separation, blotting, and hybridization
to a probe containing the first and the second c-kit exons. For
cloning, the amplification was performed and the products were
visualized after separation by agarose gel electrophoresis with
ethidium bromide and UV light. The 5 ends of c-kit cDNA were
extracted from the gel using an NA-45 DNA binding membrane (Schleicher
& Schuell, Dassel, Germany). Subsequently, the cDNAs were
subcloned and sequenced.
Mapping of DNaseI hypersensitive sites (HSS).
Isolation of nuclei and DNaseI digestion was performed as
described.18 Genomic DNA was then purified, restricted with
EcoRI, and transferred to Biodyne B membranes
(Pall, Dreilich, Germany) after separation by gel
electrophoresis. Genomic c-kit DNA fragments used as probes for
indirect end labeling are indicated in the figure legends.
| |
RESULTS |
The SCF/c-kit interaction is required for the proliferation of TF-1
cells on stroma.
The importance of SCF/c-kit interaction in supporting hematopoiesis
suggested that SCF expressed by MS-5 cells may be responsible for the
sustained proliferation of TF-1 cells on these cells. GM-CSF was
excluded to be a mediator of MS-5 stroma-induced growth, because the
cells do not express this factor.10 Furthermore, murine
GM-CSF is unable to activate the human receptor. To test the function
of SCF for TF-1 proliferation, anti-c-kit antibody (YB5.B8) was added
at different concentrations to TF-1 cells growing on MS-5 stroma cells.
A dramatic decrease in proliferation was observed
(Fig 1). Within 5 days, viable cells were
reduced to 2% or less, as compared with controls without specific
antibody. Growth of the parental TF-1 cells in suspension with hGM-CSF
was not reduced by addition of the anti-c-kit antibody (specificity control).
View larger version (15K):
[in this window]
[in a new window]
| Fig 1.
Both growth of wild-type TF-1 and stroma-dependent TF-1S
clones on stroma but not growth of suspended cells in absence of stroma
can be inhibited by the monoclonal human antibody YB5.B8. ( )
Parental TF-1 grown in suspension with GM-CSF (control); ( ) parental
TF-1 cells grown on stroma; ( ) stroma-dependent clones TF-1S #MB5,
#MB6, and #MB8. Only one line is drawn for the stroma-dependent clones,
because the inhibition was almost identical. Means of three (TF-1 in
suspension with GM-CSF), three (TF-1 on stroma), and two (TF-1S #5, #6,
and #8 each) independent experiments are shown.
|
|
Not only proliferation of the parental TF-1 cells, but also that of all
three stroma-dependent TF-1S clones examined, was inhibited. Thus, the
mSCF/c-kit interaction is essential for the stroma-induced
proliferation of both the parental TF-1 cell line and the
stroma-dependent TF-1S clones. It obviously replaces the requirement of
suspended TF-1 for GM-CSF/IL-3.
Stroma cell interaction induces downregulation of c-kit mRNA.
To investigate if c-kit is expressed in TF-1 grown on stroma cells
(here MS-5), as predicted by our antibody blocking experiments, we
analyzed the steady-state level of c-kit RNA by Northern analysis and
semiquantitative RT-PCR. Surprisingly, the transcription levels of
stroma-dependent TF-1S cells were 2 to 3 orders of magnitude lower, as
compared with the parental TF-1 cells (Fig
2). The levels of -actin used as a control were only slightly
reduced, in accordance with the decrease in cell growth.
View larger version (30K):
[in this window]
[in a new window]
| Fig 2.
High levels of c-kit RNA are expressed in parental TF-1
cells in absence of stroma and low levels in stroma-dependent TF-1S
clones. To determine c-kit expression, RNA (15 µg) from cell line
TF-1 and stroma-dependent clones (TF-1S #MB6 and TF-1S #MB8) was
subjected to Northern analysis. Absence of MS-5 stroma cells for 1 day
is indicated by " MS5" (lanes 4 and 5).
|
|
Downregulation of c-kit RNA was also observed in the parental TF-1
cells when transferred to stroma in the absence of GM-CSF (Fig 3). The 2 orders of magnitude
reduction was a steady and slow process requiring as much as 12 weeks.
In contrast, the level of the GM-CSF receptor -chain remained fairly
constant.
View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
The level of c-kit mRNA () but not that of the GM-CSF
receptor -chain mRNA () is downregulated by stroma interaction.
Semiquantitative PCR was performed from TF-1 grown for different times
on MS-5 stroma. Actin was used as an internal standard for the
quantification. The relation of receptor RNAs to -actin RNA in TF-1
cells grown in suspension were set to 100.
|
|
To show that downregulation is a general property not only of TF-1
cells, we also used a different hematopoietic cell line, M-07e,12 with a megakaryoblast phenotype. M-07e, normally
grown with IL-3 or GM-CSF in suspension, can alternatively be
maintained on stroma. M-07e cells were transferred to MS-5 and analyzed
for expression of c-kit. The c-kit transcript level was also
downregulated in M-07e in coculture with stroma
(Fig 4). Both M-07e and TF-1 cells
(control) showed a fivefold reduction of the c-kit mRNA level within 2 weeks, as opposed to the c-kit transcript levels of the corresponding
cells grown in suspension with soluble factor.
View larger version (35K):
[in this window]
[in a new window]
| Fig 4.
The level of c-kit transcripts is similarly downregulated
in M-07e cells upon interaction with stroma cells. The level is
upregulated when the stroma is removed. RNA (12 µg/lane) was
subjected to Northern analysis. M-07e cells grown in suspension with
rhIL-3 or alternatively on stroma for 1 and 2 weeks were analyzed for
c-kit expression. In addition, an aliquot of the M-07e cells was
removed from the stroma (at days 7 and 14, respectively) and was grown
for 1 day in suspension with IL-3 added. In parallel, TF-1 was used as
a control for downregulation and upregulation (lanes 1 through 3). Lane
1, TF-1; lane 2, TF-1, 2 weeks on MS-5; lane 3, TF-1, 2 weeks on MS-5,
1 day in suspension (+GM-CSF); lane 4, MS-5; lane 5, M-07e; lane 6, M-07e, 1 week on MS-5; lane 7, M-07e, 1 week on MS-5, 1 day in
suspension (+IL-3); lane 8, M-07e, 2 weeks on MS-5; lane 9, M-07e, 2 weeks on MS-5, 1 day in suspension (+IL-3).
|
|
Downregulation of the c-kit receptor is reversible.
To check if downregulation of the c-kit mRNA level is a reversible
process, we removed TF-1S stroma-dependent cells from the stroma for 1 day and performed Northern analysis and semiquantitative RT-PCR.
Surprisingly, the amount of c-kit mRNA increased by 3 to 4 orders of
magnitude (Fig 2).
The complete upregulation required 1 to 3 days and varied between
clones. The levels of c-kit mRNA were higher than that of control TF-1
cells. The study could not be extended for more than 3 days because of
the reduced viability of TF-1S without stroma. Stroma-dependent TF-1S
cells, maintained in suspension with GM-CSF, showed the same degree of
upregulation as cells grown in suspension without GM-CSF (data not
shown). GM-CSF was added to the medium in most experiments, because the
cells looked healthier in medium containing the factor. Nevertheless
and surprisingly, the cells died within 1 week due to loss of
responsiveness to GM-CSF.
Upregulation of c-kit mRNA could be shown for both the parental TF-1
cells and the megakaryoblast M-07e cells (Fig 4). The c-kit mRNA was
upregulated by both cell lines upon growth in suspension for 1 day.
To determine if the degree of downregulation is inherent to the state
of the cell, we decided to test whether downregulation occurs at the
same rate in TF-1S cells as compared with wildtype TF-1 cells. As
described above, c-kit mRNA was quickly upregulated by 3 orders of
magnitude in TF-1S cells when transferred to suspension culture with
GM-CSF (Table 1). After 2 days, the cells
were reexposed to stroma. The c-kit RNA levels in the TF-1S clones
decreased again, but downregulation was now a fast process. The
magnitude and rate of downregulation was dependent on the time of
cocultivation with stroma cells.
View this table:
[in this window]
[in a new window]
|
Table 1.
Downregulation and Upregulation of the c-kit mRNA Levels
Are Immediate Consequences of Stroma Cell Interaction
|
|
Downregulation of c-kit expression is not caused by presentation of
the SCF ligand on stroma cells.
Downregulation of the c-kit mRNA level could either be mediated by SCF
or by an alternative ligand presented by the stroma. We analyzed TF-1
cells grown on SCF-deficient (UNC
Sl/Sl) stroma to directly prove
the relevance of SCF for downregulation of c-kit. SCF-deficient stroma
cells induced similar levels of downregulation of the c-kit receptor as
stroma-presenting SCF (Fig 5). These
results clearly show that downregulation of c-kit is caused by stroma,
but not by the homologous ligand.
View larger version (19K):
[in this window]
[in a new window]
| Fig 5.
Downregulation of c-kit expression in absence of c-kit
activation by use of SCF-deficient (UNC
Sl/Sl) stroma cells. Stroma feeder was
prepared by seeding 5 × 104 stroma cells per well into
6-well tissue culture plates (Nunclon). TF-1 cells grown in
GM-CSF-containing medium were washed three times in RPMI medium and
subsequently transferred to irradiated (17,600 rad) stroma. Usually
every 7 days the TF-1 cells were sequentially transferred to fresh
prepared stroma. An aliquot of cells was analyzed for expression of
c-kit as described in Materials and Methods. Aliquots of each transfer
were confirmed to be negative for factor-independent mutant cells by
recloning in medium with and without GM-CSF. Cultures that contained
mutant cells were excluded.
|
|
Downregulation of mRNA results in reduction of the c-kit receptor
protein.
Control mechanisms acting at the posttranscriptional or translational
level might overcome the stroma-induced reduction of c-kit RNA. To
determine if the amount of c-kit protein correlates with the different
RNA levels, we quantitated the receptor by antibody binding and FACS
analysis (Fig 6). Compared with the parental TF-1 cells, the amount of c-kit protein was reduced by more
than 2 orders of magnitude in both stroma-dependent TF-1S clones that
were tested (Figs 6 and 7A).
View larger version (23K):
[in this window]
[in a new window]
| Fig 6.
c-kit receptor protein is also downregulated by stroma
cells, indicating that translational mechanisms are not involved in
downregulation and upregulation. Quantification of c-kit protein
expression by binding of monoclonal anti-c-kit antibody (YB5.B8) and
FACS analysis. Mean fluorescence was compared with the mean
fluorescence of TF-1 cells grown in suspension with GM-CSF, which was
set to 100%. Unspecific binding as measured by the mouse IgG standard
control antibody was gated out. The fluorescence of the
stroma-dependent clones was in the range of the control value without
c-kit antibody and thus the values were considered not significant
(n.s.). Results of at least three independent experiments are shown.
|
|
View larger version (23K):
[in this window]
[in a new window]
| Fig 7.
Upregulation and downregulation of c-kit
protein expression in TF-1S, parental TF-1, and M-07e cells is shown by
anti-c-kit antibody binding (YB5.B8) and FACS analysis (histograms).
(A) Upregulation and downregulation of c-kit protein expression in
stroma-dependent TF-1S #MB6 clone. (1) TF-1S #MB6 labeled with mouse
IgG isotype control antibody; (2) TF-1S #MB6 on MS-5; (3) TF-1S #MB6
maintained for 40 hours in suspension with GM-CSF and then rexposed for
10 hours to stroma; (4) TF-1 grown in suspension with GM-CSF; (5) TF-1S
#MB6 maintained for 48 hours in suspension with GM-CSF. (B)
Downregulation of c-kit protein expression in M-07e on exposure to
stroma cells. (1) M-07e cells labeled with mouse IgG isotype control
antibody; (2) M-07e, 21 days on MS-5; (3) M-07e, 14 days on MS-5; (4)
M-07e, 7 days on MS-5; (5) M-07e grown in suspension with IL-3. (C)
Downregulation and upregulation of c-kit protein expression in the
parental TF-1 cells. (1) TF-1 labeled with mouse IgG isotype control
antibody; (2) TF-1 on MS-5; (3) TF-1 grown in suspension with GM-CSF;
(4) TF-1, 14 days on stroma and then cultured for 48 hours in
suspension with GM-CSF.
|
|
When the MO7 or parental TF-1 cells were plated on stroma, a striking
decrease in c-kit expression was observed within 2 weeks (Fig 7B and
C). Consistent with the mRNA levels, removal from stroma cells induced
a correlated upregulation of the c-kit protein (data shown for TF-1;
Fig 7C). The degree of upregulation of the c-kit receptor measured by
RNA and protein levels was comparable and indicated that differential
translational controls, if at all, were not of primary importance.
Because the regulation of the c-kit protein is similar to the
regulation of the c-kit mRNA, we conclude that the c-kit expression of
TF-1 cells is primarily controlled at the level of c-kit RNA.
Downregulation of c-kit mRNA is not due to reduced mRNA stability.
Stroma cells might induce a drastic decrease of the c-kit mRNA
stability. The result would also be a decrease in the steady-state c-kit mRNA level, indistinguishable from a reduction of transcription. We thus measured the mRNA stability of the c-kit transcript in TF-1
cells by Actinomycin D inhibition of RNA synthesis and semiquantitative RT-PCR. The half-life of c-kit is quite long (>10 hours) in both the
parental TF-1 and stroma-grown TF-1S #MB8 cells
(Fig 8). Northern blot analysis of the
c-kit mRNA of TF-1 cells grown in suspension confirmed these results
(data not shown). The level of c-myc mRNA, which was used as a control
for inhibition, rapidly decreased with time (half-life of ~30
minutes). Therefore, we conclude that the stroma cell interaction does
not affect the stability of the c-kit transcript.
View larger version (25K):
[in this window]
[in a new window]
| Fig 8.
The half-life of the c-kit transcript is not reduced by
the stroma cell interaction. The reduction of the c-kit mRNA level was
monitored after actinomycin D inhibition (5.0 µg/mL) of RNA synthesis
in TF-1 cells. Only data of the first 4 hours of inhibition were
evaluated, because the cells tended to clump under
prolonged action of actinomycin D. The decrease of c-kit mRNA was
measured by semiquantitative RT-PCR. One-fifth dilutions of the RNA
were reverse transcribed and amplified to check linearity of
amplification. These amplification products correspond to the second
lane at each time point. Amplification of c-kit-specific transcripts
in TF-1 cells and c-myc-specific transcripts was performed for 18 cycles. Amplification of c-kit specific transcripts was performed for
22 cycles in case of the TF-1S #MB8 cells.
|
|
Start of transcription and length of the c-kit transcript do not
differ in TF-1 and stroma cell-dependent TF-1S clones.
We could show that the expression of c-kit is reduced as a consequence
of stroma cell interaction and that binding of SCF to the SCF receptor
on TF-1 cells is necessary for proliferation on MS-5 cells. Expression
of an alternative spliced variant with an increased affinity for
binding SCF (mSCF) might explain some of our puzzling results. To
elucidate this possibility, we examined the size of the c-kit
transcripts of TF-1 and stroma-dependent clones by extensive RT-PCR
using a broad spectrum of c-kit-specific primers. No differences in
c-kit transcript lengths were detectable (data not shown).
We then analyzed the start site of c-kit transcription by RACE-PCR and
RT-PCR. RACE products of TF-1 cells, stroma cell-dependent TF-1S
clones, and clones induced to high c-kit expression (by removal of
stroma cells) had the same mobility in agarose gel electrophoresis.
Sequencing of the cloned fragments showed that all identified start
sites are clustered within a 17-bp sequence, which maps 56 bp 5
to the published initiation codon of translation (Fig 9). In agreement with the positions of
the identified start sites, we could not detect any RT-PCR product
using 5 primers located further upstream (P56 and P57).
Thus, primer P58, which maps well with the transcription start,
is the most upstream primer yielding an amplification. Results of the
RACE-PCR and the RT-PCR thus clearly show that c-kit, regardless of
growth conditions, has multiple starts of transcription located between
position 72 and 56.
View larger version (30K):
[in this window]
[in a new window]
| Fig 9.
The start sites of the c-kit transcription are the same
in cells downregulated (+ stroma) or upregulated ( stroma) for
c-kit expression. Start sites of c-kit transcription as defined by
RACE-PCR. Start sites mapped at position 72 (TF-1S #MB6), 57
(TF-1S#MB6), and 56 (TF-1 and TF-1S#MB6). No differences were found
between our sequences and the sequence published by Giebel et
al.24 5 primers that were positive (+) or negative
() in giving a signal from RT-PCR are indicated in the sequence.
|
|
Heterogeneous initiation of transcription of the c-kit gene is not
unexpected, because sequences upstream of this site contain more than
80% guanine/cytosine residues and lack a typical TATA or CAAT motif.
Therefore, the c-kit promoter appears to be similar to that of other
receptors or housekeeping genes with long GC stretches and multiple
binding motifs for the transcription factor SP1.
The results of our transcription analysis thus indicate that neither
stroma-specific c-kit variants of TF-1 are expressed nor initiation of
transcription is altered after stroma-dependent downregulation.
The chromatin proximal to the c-kit promoter is not altered by stroma
interaction.
To analyze if specific control elements of the c-kit promoter of TF-1
cells reduce the activity of the gene due to stroma cell interaction,
we mapped DNaseI hypersensitive sites (HSS). This method is commonly
used to identify control domains of transcription with an open
chromatin structure. HSS have not been previously mapped for the c-kit
gene. HSS in the c-kit gene and 5 flanking sequences in TF-1
cells grown in suspension with GM-CSF or alternatively on stroma
(TF-1S) were compared. Two probes were used that hybridized to a 4.2-kb
EcoRI genomic fragment. We could detect four HSS in TF-1 and
stroma-grown clones (Fig 10A). The first
site, HSS1, was seen as a 2.1-kb degradation band of the 4.2-kb
EcoRI fragment using probe (a) for end labeling. Interestingly
HSS1 maps to the c-kit promoter region used in hematopoietic cells
identified here (see below; Fig 10B). Three other sites (HSS2, HSS3,
and HSS4) are located at the 5 end of intron 1. Whereas HSS2 and
HSS3 had about the same intensity as HSS1, HSS4 was quite weak and not always detectable. The same pattern of HSS was seen independently using
different culture conditions for TF1 cells: all stroma cell-dependent TF-1S clones (Fig 10A, data for #MB6 and #MB8 are not shown) showed the
same DNA conformation as TF-1 grown without stroma. Thus, stroma cell
interaction does not alter the chromatin structure of the c-kit
promoter.
View larger version (49K):
[in this window]
[in a new window]
View larger version (10K):
[in this window]
[in a new window]
| Fig 10.
The DNaseI hypersensitive sites (HSS) in TF-1,
independent of downregulation or upregulation of the c-kit receptor,
are identical. (A) Mapping of HSS (1-4) (arrowheads) in different TF-1
cell lines. All major and minor degradation bands of the 4.2-kb
EcoRI fragment are indicated and numbered according to the map
of (B). HSS1 directly maps within the c-kit promoter region. HSS2,
HSS3, and HSS4 are located in the 5 region of the first intron.
DNaseI-treated genomic DNA (10 µg) was digested with EcoRI
and probed with probe (a). DNaseI concentrations were as follows: lane
1, no DNaseI; lane 2, 0.8 µg/mL; lane 3, 1.2 µg/mL; lane 4, 1.8 µg/mL; lane 5, 2.7 µg/mL; lane 6, 4.0 µg/mL. (B) The
hypersensitive sites of the c-kit promoter region of TF-1 cells (TF-1;
TF-1S #MB3, #MB6, #MB8; and TF-1S #MBs removed from stroma for 1 day).
HSS4 is a minor site and was not always found. Exon 1 is boxed, and the
coding region is indicated by shading. Probes used for mapping HSS (a
and b) are indicated.
|
|
| |
DISCUSSION |
Hematopoiesis requires two interacting cell systems: hematopoietic
cells and supporting stroma cells. The necessity of interaction with
mesenchymal stroma cells has been shown to be essential for long-term
culture systems.25,26 The molecular mechanisms that govern
these interactions are poorly understood. To obtain in vitro systems to
study interaction of hematopoietic cells with stroma, we have
successfully isolated strictly stroma-dependent clones of the human
TF-1 and murine ELM myeloid progenitor cell lines9,27 and
more recently of other even earlier hematopoietic cells, such as
Myl-D7.10 With the exception of ELM-D, showing a high
frequency of reversion to stroma cell independence, the other
stroma-dependent cells provide an excellent tool to investigate the
molecular mechanisms of cell attachment and stroma cell-induced long-term proliferation, as well as the means to pin down the regulation of molecules required for this interaction.
The growth of the human parental TF-1 on mouse stroma and of all
stroma-dependent TF-1S subclones could be inhibited by monoclonal anti-c-kit antibody. Surprisingly, previous studies have shown that
the presence of soluble SCF in absence of stroma cells had only a
limited effect as an inducer of short-term but not long-term proliferation (manuscript in preparation). However,
inhibition of TF-1 cell proliferation on SCF positive
(Sl+/Sl+) MS-5 stroma cells indicates that the
YB5.B8 antibody used here17 is sufficient not only to block
the short-term proliferation stimulus of sSCF, but also of additional
SCF-dependent signals that provide long-term proliferation. These
signals most likely depend on presentation of the membrane-inserted SCF
(mSCF; manuscript in preparation).
Growth of all stroma-interacting myeloid precursor cells tested (TF-1
and ELM-D)9,27 could always be inhibited by using neutralizing anti-c-kit antibody. Thus, the c-kit receptor may have a
general function in hematopoietic/stroma cell interaction in different
species. However, we could directly demonstrate the existence of an
alternative, yet to be identified growth-promoting activity by
interaction of TF-1 with SCF stroma cells. Cloning
and long-term growth of TF-1 cells on SCF stroma
cells demonstrate that other molecules can substitute for the function
of the c-kit ligand.
Despite the SCF/c-kit requirement for proliferation in our
stroma-dependent system (Fig 1), we detected a massive downregulation of the c-kit mRNA of TF-1S cells cocultured with stroma (Fig 2). Downregulation of c-kit mRNA could be shown for both the parental TF-1
and the megakaryoblast M-07e cells, suggesting that the mechanism of
SCF receptor modulation is shared in cells of different hematopoietic lineages (Fig 4).
Downregulation of c-kit as a consequence of hematopoietic cell/stroma
interaction occurred at both the RNA and protein levels. In TF-1 cells
grown on stroma, both the c-kit mRNA and the protein expression were
coordinately reduced by several orders of magnitude as compared with
TF-1 cells grown with GM-CSF in suspension. We therefore conclude that
translational controls have no significant overall effect on c-kit
downregulation in our system.
Alternative splicing of the c-kit mRNA, resulting in expression of a
variant with a decreased half-life, might explain the reduced levels of
c-kit. The c-kit RNA was examined for possible splice variants induced
by stroma-dependent growth, because alternative splicing has been shown
for other members of the tyrosine kinase family and found to generate
functionally different isoforms.28-30 For the c-kit
receptor, a minor splice variant (kitA) has been described.31-33 However, no evidence for a specific c-kit
splice product in TF-1 or TF-1S cells was found.
Moreover, we analyzed the stability of c-kit transcripts in TF-1 cells
grown in suspension and in stroma-dependent TF-1S #MB8 cells. Our
results demonstrate that downregulation is not due to an altered
half-life of the c-kit mRNA. Taken together, the reduction of c-kit
mRNA is most probably controlled by the transcription machinery.
Several mechanisms that could account for a reduced level of
transcription were therefore analyzed. Using RACE-PCR, we identified the initiation site of c-kit transcription and by this we can further
exclude that different promoters are activated in TF-1 cells grown with
or without stroma. All identified transcription start sites,
interestingly enough, mapped to a region that has been identified as
the melanocyte-specific c-kit promoter.24 Thus, cell type
and stroma cell-specific c-kit expression is not regulated by
differential promoter usage, as has been shown for the c-kit-related
M-CSFR gene.34 Additionally, the downregulation of the
c-kit gene is not the result of a stroma cell-induced transcriptional stop in elongation, because RT-PCR for the 5 end of the c-kit transcript was as efficient as for the 3 end (data not included due to negative results).
We showed that the DNaseI hypersensitive sites of the c-kit receptor
gene of cells grown with and without stroma are identical. Thus, the
reduction of the transcriptional activity of the c-kit gene as a
consequence of direct chromatin alterations can be excluded. This
result moreover shows that the chromatin structure of the c-kit
promoter is open and therefore not fixed to an inactive state when
transcriptional activity is reduced by 3 orders of magnitude on stroma
coculture. Indeed, upregulation of the c-kit expression after stroma
cell removal and subsequent downregulation was a fast process and often
showed an overshoot (4 orders of magnitude).
Our result of the chromatin structure of the c-kit gene further
indicates that the sequences adjacent to the transcriptional start site
might not be sufficient to permit a cell-specific transcription level.
As expected, differences in the activities of promoter-reporter-gene constructs transfected in cell lines with high or low c-kit expression were quite low (C. Heberlein, unpublished
results).35,36 Results reported by others
support the notion that far upstream DNA control elements are needed
for high expression of the c-kit gene. In the murine system, a locus
control region has been identified that is more than 50 kb upstream of
the gene.37 We cannot exclude that changes in the chromatin
structure have occurred in this region. Alternatively, transcription is
regulated either by enhancement of the basal promoter by cis-acting
elements located at far distance to the initiation start of
transcription or by the binding of transcription factors to the
promoter region with no significant (obvious) effect on the chromatin
structure.
Summarizing our data, we demonstrate that the c-kit receptor expression
is downregulated in myeloid progenitor cells due to stroma cell
interaction by mainly transcriptional control mechanisms. The
downregulation appears to be a consequence of an insufficient usage of
transcriptional activators during stroma cell interaction or
alternatively by the presence of inhibitors.
| |
ACKNOWLEDGMENT |
The authors thank Dr R.A. Spritz providing plasmid pUC KIT 27-1R4.2.
| |
FOOTNOTES |
Submitted December 22, 1997;
accepted September 24, 1998.
Supported by the Deutsche Forschungsgemeinschaft (Os 31) and Amgen. The
Heinrich-Pette-Institut is financially supported by Freie und
Hansestadt Hamburg and the Bundesministerium für Gesundheit.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Christoph Heberlein, PhD,
Heinrich-Pette-Institut für experimentelle Virologie und
Immunologie an der Universität Hamburg, Martinistr. 52, 20251 Hamburg, Germany.
| |
REFERENCES |
1.
Russel ES:
Hereditary anemias of the mouse: A review for geneticists.
Adv Genet
20:357, 1979[Medline]
[Order article via Infotrieve]
2.
Silvers WK:
Dominant-spotting, patch and rump-white; steel, flexed tail, splotch and variant-waddler, in
Silvers WK
(ed):
The Coat Colors of Mice: A Model for Gene Action and Interaction. New York, NY, Springer, 1979, p 206.
3.
Anderson DM, Lyman SD, Baird A, Wignall JM, Eisenman J, Rauch C, March CJ, Boswell HS, Gimpel SD, Cosman D, Williams DE:
Molecular cloning of mast cell growth factor, a hematopoietin that is active in both membrane bound and soluble forms.
Cell
63:235, 1990[Medline]
[Order article via Infotrieve]
4.
Flanagan JG, Chan DC, Leder P:
Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sld mutant.
Cell
64:1025, 1991[Medline]
[Order article via Infotrieve]
5.
Fujita J, Onoue H, Ebi Y, Nakayama H, Kanakura Y:
In vitro duplication and in vivo cure of mast-cell deficiency of Sl/Sld mutant mice by cloned 3T3 fibroblasts.
Proc Natl Acad Sci USA
86:2888, 1989[Abstract/Free Full Text]
6.
Nocka K, Buck J, Levi E, Besmer P:
Candidate ligand for the c-kit transmembrane kinase receptor: KL, a fibroblast derived growth factor stimulates mast cells and erythroid progenitors.
EMBO J
9:3287, 1990[Medline]
[Order article via Infotrieve]
7.
Okada S, Nakauchi H, Nagayoshi K, Nishikawa S-I, Miura Y, Suda T:
In vivo and in vitro stem cell function of c-kit- and Sca-1-positive murine hematopoietic cells.
Blood
80:3044, 1992[Abstract/Free Full Text]
8.
Toksoz D, Zsebo KM, Smith KA, Hu S, Brankow D, Suggs SV, Martin FH, Williams DA:
Support of human hematopoiesis in long term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor.
Proc Natl Acad Sci USA
89:7350, 1992[Abstract/Free Full Text]
9.
Nibbs RJB, Itoh K, Ostertag W, Harrison PR:
Differentiation arrest and stromal cell-dependent growth of murine erythroleukemia cells are associated with elevated expression of ets-related genes, but not mutation of p53.
Mol Cell Biol
13:5582, 1993[Abstract/Free Full Text]
10.
Itoh K, Friel J, Kluge N, Kina T, Kondo-Takaori A, Kawamata S, Uchiyama T, Ostertag W:
A novel hemopoietic multi-lineage clone, Myl-D-7, is stromal cell dependent and supported by an alternative mechanism(s) independent of stem cell factor/c-kit interaction.
Blood
87:3218, 1996[Abstract/Free Full Text]
11.
Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao Y-F, Miyazono K, Urabe A, Takaku F:
Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-2 or erythropoietin.
J Cell Physiol
140:323, 1989[Medline]
[Order article via Infotrieve]
12.
Avanzi GC, Brizzi MF, Giannotti J, Ciarletta A, Yang Y-C, Pegoraro L, Clark SC:
M-07e human leukemic factor dependent cell line provides a rapid and sensitive bioassay for the human cytokines GM-CSF and IL-3.
J Cell Physiol
145:458, 1990[Medline]
[Order article via Infotrieve]
13.
Helftenbein G, Krusekopf K, Just U, Cross M, Ostertag W, Niemann H, Tamura T:
Transcriptional regulation of the c-fms proto-oncogene mediated by granulocyte/macrophage colony-stimulating factor (GM-CSF) in murine cell lines.
Oncogene
12:931, 1996[Medline]
[Order article via Infotrieve]
14.
Gliniak BC, Rohrschneider RL:
Expression of the M-CSF receptor is controlled posttranscriptionally by the dominant actions of GM-CSF or Multi-CSF.
Cell
63:1073, 1990[Medline]
[Order article via Infotrieve]
15.
Itoh K, Tezuka H, Sakoda H, Konno M, Nagata K, Uchiyama T, Uchino H, Mori KJ:
Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow.
Exp Hematol
17:145, 1989[Medline]
[Order article via Infotrieve]
16.
Sutherland HJ, Hogge DE, Cook D, Eaves CJ:
Alternative mechanisms with and without steel factor support primitive human hematopoiesis.
Blood
81:1465, 1993[Abstract/Free Full Text]
17.
Lerner NB, Nocka KH, Cole SR, Qiu F, Strife A, Ashman LK, Besmer P:
Monoclonal antibody YB5.B8 identifies the human c-kit protein product.
Blood
77:1876, 1991[Abstract/Free Full Text]
18.
Heberlein C, Fischer K-D, Stoffel M, Nowock J, Ford A, Tessmer U, Stocking C:
The gene for erythropoietin receptor is expressed in multipotential hematopoietic and embryonal stem cells: Evidence for differentiation stage-specific regulation.
Mol Cell Biol
12:1815, 1992[Abstract/Free Full Text]
19.
Yarden Y, Kuang W-J, Yang-Feng T, Coussens L, Munemitsu S, Dull TJ, Chen E, Schlessinger J, Francke U, Ullrich A:
Human proto-oncogene c-kit: A new cell surface receptor tyrosine kinase for an unidentified ligand.
EMBO J
6:3341, 1987[Medline]
[Order article via Infotrieve]
20.
Saiki RK, Scharf S, Faloona F, Mullis KM, Horn GT, Erlich HA, Arnheim N:
Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.
Science
230:1350, 1985[Abstract/Free Full Text]
21.
Hayashida K, Kitamura T, Gorman DM, Arai K-I, Yokota T, Miyajima A:
Molecular cloning of a second subunit of the receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF): Reconstitution of a high-affinity GM-CSF receptor.
Proc Natl Acad Sci USA
87:9655, 1990[Abstract/Free Full Text]
22.
Watt R, Stanton LW, Marcu KB, Gallo RC, Croce CM, Rovera G:
Nucleotide sequence of cloned cDNA of human c-myc oncogene.
Nature
303:725, 1983[Medline]
[Order article via Infotrieve]
23.
Ponte Ph, Ng S-Y, Engel J, Gunning P, Kedes L:
Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA.
Nucleic Acids Res
12:1687, 1984[Abstract/Free Full Text]
24.
Giebel LB, Strunk KM, Holmes SA, Spritz RA:
Organization and nucleotide sequence of the human Kit (mast/stem cell growth factor receptor) proto-oncogene.
Oncogene
7:2207, 1992[Medline]
[Order article via Infotrieve]
25.
Dexter TM, Allen TD, Lajtha LG:
Conditions controlling the proliferation of haemopoietic stem cells in vitro.
J Cell Physiol
91:335, 1977[Medline]
[Order article via Infotrieve]
26.
Eaves CJ, Cashman JD, Kay RJ, Dougherty GJ, Otsuka T, Gaboury LA, Hogge DE, Lansdorp PM, Eaves AC, Humphries RK:
Mechanisms that regulate the cell cycle status of very primitive hematopoietic cells in long-term human marrow cultures. II. Analysis of positive and negative regulators produced by stromal cells within the adherent layer.
Blood
78:110, 1991[Abstract/Free Full Text]
27.
Itoh K, Friel J, Klingler K, Laker C, Just U, Mori KJ, Nishikawa SI, Bittner S, Zeller W, Nibbs R, Harrison PR, Ostertag W:
The role of soluble growth factors in inducing transient growth and clonal extinction of stroma-cell dependent erythroblastic leukemia cells.
Leukemia
11:1753, 1997[Medline]
[Order article via Infotrieve]
28.
Reid HH, Wilks AF, Bernard O:
Two forms of the basic fibroblast growth factor receptor-like mRNA are expressed in the developing mouse brain.
Proc Natl Acad Sci USA
87:1596, 1990[Abstract/Free Full Text]
29.
Johnson DE, Lu J, Chen H, Werner S, Williams LT:
The human fibroblast growth factor receptor genes: A common structural arrangement underlies the mechanisms for generating receptor forms that differ in their third immunoglobulin domain.
Mol Cell Biol
11:4627, 1991[Abstract/Free Full Text]
30.
Yan G, Fukabori Y, McBride G, Nikolaropolous S, McKeehan WL:
Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy.
Mol Cell Biol
13:4513, 1993[Abstract/Free Full Text]
31.
Hayashi S-I, Kunisada T, Ogawa M, Yamaguchi K, Nishikawa S-I:
Exon skipping by mutation of an authentic splice site of c-kit gene in W/W mouse.
Nucleic Acids Res
19:1267, 1991[Abstract/Free Full Text]
32.
Reith AD, Ellis C, Lyman SD, Anderson DM, Williams DE, Bernstein A, Pawson T:
Signal transduction by normal isoforms and W mutant variants of the kit receptor tyrosine kinase.
EMBO J
10:2451, 1991[Medline]
[Order article via Infotrieve]
33.
Piao X, Curtis JE, Minkin S, Minden MD, Bernstein A:
Expression of the Kit and KitA receptor isoforms in human acute myelogenous leukemia.
Blood
83:476, 1994[Abstract/Free Full Text]
34.
Visvader J, Verma IM:
Differential transcription of exon 1 of the human c-fms gene in placental trophoblasts and monocytes.
Mol Cell Biol
9:1336, 1989[Abstract/Free Full Text]
35.
Yamamoto K, Tojo A, Aoki N, Shibuya M:
Characterization of the promoter region of the human c-kit proto-oncogene.
Jpn J Cancer Res
84:1136, 1993[Medline]
[Order article via Infotrieve]
36.
Yasuda H, Galli SJ, Geissler EN:
Cloning and functional analysis of the mouse c-kit promoter.
Biochem Biophys Res Commun
191:893, 1993[Medline]
[Order article via Infotrieve]
37.
Duttlinger R, Manova K, Chu TY, Gyssler C, Zelenetz AD, Bachvarova RF, Besmer P:
W-sash affects positive and negative elements controlling c-kit expression: Ectopic c-kit expression at sites of kit-ligand expression affects melanogenesis.
Development
118:705, 1993[Abstract]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
H. Miletic, M. Bruns, K. Tsiakas, B. Vogt, R. Rezai, C. Baum, K. Kühlke, F.-L. Cosset, W. Ostertag, H. Lother, et al.
Retroviral Vectors Pseudotyped with Lymphocytic Choriomeningitis Virus
J. Virol.,
July 1, 1999;
73(7):
6114 - 6116.
[Abstract]
[Full Text]
|
|
|
|
|
Top
Abstract
Introduction