|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 2 (January 15), 1999:
pp. 655-666
Selective Expansion of Alveolar Macrophages In Vivo
by Adenovirus-Mediated Transfer of the Murine Granulocyte-Macrophage
Colony-Stimulating Factor cDNA
By
Stefan Worgall,
Ravi Singh,
Philip L. Leopold,
Robert J. Kaner,
Neil R. Hackett,
Norbert Topf,
Malcolm A.S. Moore, and
Ronald G. Crystal
From the Division of Pulmonary and Critical Care Medicine, The New
York Hospital-Cornell Medical Center, New York, NY; and James Ewing
Laboratory of Developmental Hematopoiesis, Memorial Sloan-Kettering
Cancer Center, New York, NY.
 |
ABSTRACT |
Based on the hypothesis that genetic modification of freshly
isolated alveolar macrophages (AM) with the granulocyte-macrophage colony-stimulating factor (GM-CSF) cDNA would induce AM to proliferate, this study focuses on the ability of adenoviral (Ad) vectors to transfer and efficiently express the murine (m) GM-CSF cDNA in murine
AM with consequent expansion in the number of AM in vitro and in vivo.
To demonstrate that an Ad vector can effectively transfer and express
genes in AM, murine AM recovered by bronchoalveolar lavage from the
lung of Balb/c mice were infected with an Ad vector coding for green
fluorescent protein (GFP) in vitro and expressed GFP in a
dose-dependent fashion. Infection of AM with an Ad vector containing an
expression cassette coding for mGM-CSF led to GM-CSF expression and to
AM proliferation in vitro. When AM infected with AdGFP were returned to
the respiratory tract of syngeneic recipient mice, GFP-expressing cells
could still be recovered by bronchoalveolar lavage 2 weeks later. In
vitro infection of AM with AdmGM-CSF and subsequent transplantation of
the genetically modified AM to the lungs of syngeneic recipients led to
GM-CSF expression in vivo. Strikingly, the AM recovered by lavage 5 weeks after transplantation demonstrated an increased rate of
proliferation, and the total number of alveolar macrophages was
1.9-fold greater than controls. Importantly, the increase in the
numbers of AM was selective (ie, other inflammatory cell numbers were
unchanged), and there was no modification to the lung architecture.
Thus, it is feasible to genetically modify AM with Ad vectors and to use this strategy to modify the behavior of AM in vivo. Based on the
importance of AM in the primary defense of the respiratory epithelial
surface, this strategy may be useful in enhancing pulmonary defenses in
immunodeficiency states.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE ALVEOLAR macrophage (AM), the
pulmonary representative of the mononuclear phagocyte system, plays a
central role in defending the lungs against inhaled
organisms.1-3 In the normal human lung, there are
approximately 50 AM on the epithelial surface of each alveolus and
additional AM in the alveolar interstitium.4 Under normal
circumstances, this is sufficient to provide a major defense of the
respiratory epithelium. However, in circumstances in which the
challenge of inhaled organisms is overwhelming or in which there is
dysfunction in the AM, the lung is at increased risk for
infection.5-11
Based on these considerations, one strategy to augment the defenses in
the lung is to increase the number of AM on the respiratory epithelial
surface. Theoretically, this could be accomplished by attracting more
circulating macrophage precursors to the lung or by enhancing
proliferation of AM in the alveoli. In regard to the second strategy,
although AM are usually considered to be terminally differentiated,
there is evidence that 1% to 2% of human and rodent AM proliferate
within a 24-hour period,12-14 and in vitro studies have
shown that AM proliferate in response to granulocyte-macrophage
colony-stimulating factor (GM-CSF).15,16
With this background, we hypothesized that, by genetically modifying AM
to express GM-CSF, the GM-CSF would stimulate proliferation of the AM
population, thus expanding the number of AM. The data demonstrate that
E1 , E3 Ad vectors can transfer
and express transgenes to murine AM in vitro, including the marker gene
coding for the jellyfish (Aquoriea victoria) green fluorescent
protein (GFP), as well as the murine (m) GM-CSF cDNA. With transfer of
the mGM-CSF cDNA, not only do AM express GM-CSF and proliferate in
vitro, but also transplantation of the mGM-CSF cDNA-modified AM to the
respiratory epithelial surface of syngeneic mice results in in vivo
production of GM-CSF and selective expansion in number of AM in the
lung.
| |
MATERIALS AND METHODS |
Adenovirus vectors.
The recombinant adenovirus vectors AdGFP, AdNull, and AdmGM-CSF used in
this study are E1a, partial E1b,
and partial E3, based on the Ad5 genome, with the
expression cassette in the E1 position. The expression casette includes
the cytomegalovirus early/intermediate enhancer promoter (CMV), an
artificial splice signal, the cDNA, and an SV40 stop/poly (A) signal.
The AdGFP vector carries the humanized form of the gene coding for the
jellyfish Aquoriea victoria green fluorescent
protein,17 and the AdmGM-CSF vector contains the murine
GM-CSF cDNA.18 The AdNull vector is identical to the AdGFP
and AdmGM-CSF vectors, except that it lacks a cDNA in the expression
cassette.19 The vectors were propagated, purified, and
stored at  70°C, as previously described.20,21 Titers of viral preparations were determined by plaque assay using 293 cells.22
Bronchoalveolar lavage.
The source of AM for this study was Balb/c mice (Charles River
Laboratories, Wilmington, MA). The animals were of either sex, were 6 to 8 weeks old, and weighed 15 to 20 g. After anesthesia by
intraperitoneal injection of a mixture of ketamine (60 mg/kg) and
xylazine (5 mg/kg), the animals were bled via aortic incision, the
trachea was exposed by midline incision, and the lungs were lavaged
10× with warm phosphate-buffered saline, pH 7.4 (PBS), via a
24-gauge catheter. The lavage fluid was filtered through one layer of
gauze, centrifuged (400g for 10 minutes), and washed three
times in PBS. Cells were resuspended in RPMI medium supplemented with
10% fetal calf serum, 50 U/mL penicillin, and 50 µg/mL streptomycin and plated on coverslip dishes23 or kept in teflon chambers (Savillex, Minneapolis, MN) for infection in suspension. Macrophage content (always >95%) was determined by modified Giemsa stain on
cytospin preparations. Cell viability (always >95%) was determined by trypan blue exclusion. After 3 hours, the macrophages were washed
with PBS to remove nonadherent cells. The typical yield of AM from one
mouse was 3 × 105 cells.
Adenovirus transfer of the GFP gene to AM.
AM were infected with the AdGFP vector at 10, 50, and 200 multiplicity
of infection (moi) for 90 minutes in serum-free RPMI. For
morphologic studies, the cells were infected after adherence on
coverslip dishes; for quantitative studies, the cells were infected in
suspension in teflon chambers to prevent adherence. Infection with
AdNull (200 moi) was used as a control. Thereafter, complete medium
(RPMI supplemented with 10% fetal calf serum) was added after washing
once with PBS. After 48 hours of infection, the adherent cells were
fixed with 4% paraformaldehyde and nuclei were counterstained with
4 -6-diamidiomo-2-phenyl indole (DAPI; Molecular Probes,
Eugene, OR) and then analyzed for GFP expression by fluorescence
microscopy. Cell-associated autofluorescence, commonly found in
phagocytic cells, was distinguished from specific green fluorescent
signal by superimposing the red channel and green channels. The
autofluorescence appeared yellow (red and green), whereas specific GFP
fluorescence remained green. Alternatively, cells were cultured in
suspension in teflon chambers, washed, resuspended in PBS and 0.1%
bovine serum albumin, and immediately evaluated for GFP expression by
flow cytometry.
Transplantation of AdGFP-modified AM.
To evaluate the in vivo persistence of expression of the GFP transgene
transferred to the AM, AM were infected in vitro with AdGFP at 100 moi
in suspension, washed with PBS after a 90-minute infection period, and
maintained in RPMI 10% fetal calf serum for 4 hours. Then the cells
were washed 4 times with PBS and resuspended in PBS at 4 × 106/mL. The cells modified with the GFP gene were then
slowly (over 1 minute in a total volume of 50 µL) administered (2 × 105 cells) to anesthetized naive syngeneic mice via
the intratracheal route. As a control, AM infected with AdNull were
handled in the identical manner. The animals were then killed after 2 and 14 days, and the cells on the respiratory epithelial surface were recovered by lavage. The lavaged cells were washed with PBS, and 3 × 104 cells were plated on coverslip dishes and,
after 3 hours of adherence, fixed and analyzed by fluorescence
microscopy, as described above. The remaining cells were analyzed for
GFP expression by flow cytometry, as described above.
Adenovirus transfer of the mGM-CSF cDNA to AM.
To analyze whether AM infected with AdmGM-CSF in vitro produced
mGM-CSF, AM (2 × 105 cells per dish) were infected
with AdmGM-CSF (moi 200) for 90 minutes at 37°C. After culturing
for 2 days, supernatant was collected and mGM-CSF levels in the medium
were quantified by double sandwich enzyme-linked immunoabsorbent assay
(R&D, Minneapolis, MN) following the manufacturer's instructions. To
assess the effects of Ad-mediated transfer of the mGM-CSF cDNA on AM
proliferation, AM were plated on coverslip dishes using Cell Locator
coverslips (Eppendoff, Inc, Hamburg, Germany) and infected with
AdmGM-CSF at 10, 50, 200, and 400 moi, as described above. After
infection, the cells were counted daily; a minimum of 200 cells were
counted on a defined field on the coverslip dishes. For analysis of the
proportion of cells with mitotic nuclei, the cells were fixed with 4%
paraformaldehyde and stained with DAPI.
Transplantation of AdmGM-CSF-modified AM.
To evaluate the consequences of transplanting mGM-CSF cDNA-modified AM
to syngeneic mice, AM were infected in suspension in vitro for 90 minutes with AdmGM-CSF at 100 moi as described above for AdGFP. After
washing 4×, 2 × 105 cells were transferred to
anesthetized naive mice via the intratracheal route. As a control,
AdNull-infected AM (100 moi) were transferred in the identical manner.
As an additional control, 60 ng of recombinant mGM-CSF was administered
intratracheally to Balb/c mice; this dose represents 4× the
24-hour in vitro production by 2 × 105 AM infected
with 100 moi AdmGM-CSF in vitro and is used to control for the unlikely
possibility that the mGM-CSF was produced in vitro and simply
transplanted to the lungs with the AM. After 1 and 5 weeks, the mice
underwent lavage. The lavage fluid was centrifuged and the cell-free
supernatant was analyzed for mGM-CSF expression by enzyme-linked
immunosorbent assay (ELISA). Serum was collected and also assessed for
mGM-CSF levels. The cells were resuspended in RPMI and the cell content
of the lavage was determined by counting with a Neubauer hemocytometer
(Fisher Scientific, Springfield, MA). For analysis of the types of
cells present in the lavage, cytospin samples of the lavaged cells were
stained by modified Giemsa stain. For analysis of cell proliferation, 2 × 104 cells were plated in a 96-well plate. After 1 hour of adherence and thorough washing with PBS, the cells were labeled
with [3H]thymidine for 24 and 72 hours. The cells were
detached with 0.5 mg/mL trypsin-0.5 mmol/L ethylenediamine acetic acid
and transferred to a filter membrane with a cell harvester, and the
amount of [3H]thymidine incorporated was determined using
a  -counter. From the remaining cells, total DNA was extracted using
QuiAMP DNA extraction columns (Quiagen, Santa Clarita, CA) and
amplified by polymerase chain reaction (PCR) using primers for the
adenovirus region E4 (sense primer, ACCGCCCGCAGCATAA; antisense primer,
TGAGGGGTCGCCACTT), mGM-CSF-specific transgene (sense primer,
TTGCCTTTCTCTCCACAGGTGT, covering the CMV promoter region in the Ad
vector; antisense primer, TTGGTGAAATTGCCCCGTAGA, covering the left side
of the GM-CSF cDNA) and Hydrogen-Potassium ATPase (HK-ATPase; sense
primer, TCCTTCATGGACCGTGGG; antisense primer,
CTGCAAAGCTCTCCTGGAAGA) as genomic control. The PCR settings were
94°C for 5 minutes, 40 cycles of 94°C for 30 seconds, 58°C
for 30 seconds, 72°C for 30 seconds, and a final elongation step at
72°C for 5 minutes. The PCR products were separated on a 1.6%
agarose gel and analyzed by ethidium bromide staining.
Histological evaluation of lung.
To determine if morphological changes were induced by transplanting
mGM-CSF cDNA-modified AM to the lung of syngeneic mice, AM were
infected in vitro with AdmGM-CSF or AdNull at 100 moi and transferred
to the lungs of syngeneic mice as described above. After 1 and 5 weeks,
the animals were killed and the lungs were fixed with 10% formalin.
Sections were stained with hemotoxilin-eosin and evaluated by light
microscopy.
Statistical evaluation.
All data are presented as the mean ± standard error of the mean;
statistical evaluations were performed using the two-tailed Student's
t-test.
| |
RESULTS |
AdGFP expression in AM.
To evaluate if an Ad vector can transfer genes to AM, AM were infected
in vitro with AdGFP using either adherent AM or AM in suspension.
Fluorescence microscopy of adherent cells infected with AdGFP showed a
dose-dependent, homogenous green fluorescence, characteristic for GFP
expression (Fig 1). AdNull-infected cells showed no GFP expression. Flow cytometry analysis also showed a
dose-dependent increase in the numbers of cells expressing GFP 48 hours
after infection. At 200 moi, 65% of the cells expressed the transgene,
compared with 19% at 50 moi and 6% at 10 moi
(Fig 2). From these data, we conclude that
Ad vectors can transfer to and express genes in AM in a dose-dependent
manner and that it is possible to use Ad vectors to transfer genes to
the majority of freshly isolated AM.
View larger version (65K):
[in this window]
[in a new window]
| Fig 1.
GFP expression in murine alveolar macrophages in vitro.
Shown is fluorescence microscopy of adherent alveolar marophages 48 hours after infection with AdGFP at various moi. Infection with AdNull
is used as control. GFP fluorescence is shown in green. Nuclei are
counterstained with DAPI (blue). Autofluorescent intracellular
infections appear yellow-orange. (A) AdNull, 200 moi. (B) AdGFP, 10 moi. (C) AdGFP, 50 moi. (D) AdGFP, 200 moi. Bar = 50 µm.
|
|
View larger version (27K):
[in this window]
[in a new window]
| Fig 2.
Quantitative assessment of Ad vector-mediated GFP
expression in murine alveolar macrophages in vitro. Shown is flow
cytometry analysis of alveolar macrophages infected for 48 hours in
suspension with AdGFP at 10, 50, and 200 moi. Infection withAdNull is
used as control. Shown on the ordinate is cell number and on the
abscissa is shown the intensity of GFP. (A) AdNull, 200 moi. (B) AdGFP,
10 moi. (C) AdGFP, 50 moi. (D) AdGFP, 200 moi.
|
|
AdmGM-CSF induces AM proliferation in vitro.
To analyze if Ad vector-mediated transfer of the mGM-CSF cDNA to AM
induced AM proliferation, AM were infected in vitro with AdmGM-CSF at
200 moi. Murine GM-CSF was detectable in the supernatant of
AdmGM-CSF-infected cells, but not AdNull-infected cells 48 hours after
infection (Fig 3). Fluorescence microscopy
of DAPI-stained nuclei showed an increase in cell number and an
increase in the number of mitotic figures (2.3% ± 0.4%
for AdmGM-CSF-infected cells at 48 hours, compared with less than
0.5% for AdNull-infected cells (P < .001;
Fig 4). The number of AM increased over 7 days in a dose-dependent fashion; at 7 days, the AM infected with  50 moi had severalfold more AM in the dish compared with AdNull-infected cells or noninfected cells (P < .01, all comparisons, 7 days; Fig 5). Thus, in vitro genetic modification
of AM by Ad-mediated transfer of the mGM-CSF cDNA leads to GM-CSF
production and induces proliferation of the AM.
View larger version (13K):
[in this window]
[in a new window]
| Fig 3.
Genetic modification of murine alveolar macrophages to
express murine GM-CSF. Shown is expression of mGM-CSF for 24 hours
after in vitro infection with AdmGM-CSF or AdNull (control) compared
with uninfected AM. The dashed line represents the sensitivity of the
assay. The data represent the mean ± SEM from 4 samples measured by
ELISA.
|
|
View larger version (28K):
[in this window]
[in a new window]
| Fig 4.
In vitro proliferation of murine AM after infection
withAdmGM-CSF. AM were plated on cell locator dishes and infected with
AdmGM-CSF or AdNull, each at 200 moi. The AM were fixed 96 hours later,
and the nuclei were stained with DAPI and evaluated using fluorescence
microscopy. (A) AdNull. (B) AdmGM-CSF; note the marked increase in the
number of cells. Arrows indicate mitotic figures. (C) AdmGM-CSF,
mitotic figures from (B) shown at higher magnification. Bar = 50 µm
for (A) and (B); bar = 5 µm for (C).
|
|
View larger version (28K):
[in this window]
[in a new window]
| Fig 5.
AdmGM-CSF-induced proliferation of murine AM in vitro.
AM were plated on cell locator dishes and infected with AdmGM-CSF or
AdNull at various moi as described for Fig 4. Shown is the cell number
per high power field over a 7-day period. The dashed line represents
confluency of the cells on the plate.
|
|
Transplantation of genetically modified AM.
To demonstrate that AM modified by an Ad vector retain their in vitro
genetic alteration when the modified AM were transplanted to the lung
of syngeneic mice, AM modified by AdGFP or AdNull were transplanted to
the lungs, and the mice were lavaged over time to recover AM.
Assessment by immunofluorescence microscopy demonstrated GFP-positive
AM at 2 and 14 days after transplantation in the AdGFP group
(Fig 6A through D). Quantification of the
proportion of GFP-positive cells by flow cytometry showed that
GFP-expressing cells could be recovered at 2 days (2.0% ± 0.5% of
total cells recovered) and 14 days (1.7% ± 0.4%) in the AdGFP
group after transplantation, whereas none of the AdNull group animals
showed GFP-positive cells (Fig 6E).
View larger version (94K):
[in this window]
[in a new window]
View larger version (17K):
[in this window]
[in a new window]
| Fig 6.
Persistance of genetically modified AM after in vivo
transfer of alveolar macrophages that have been modified in vitro with
AdGFP or AdNull. After infection (200 moi, 90 minutes at 37°C), the
cells were washed and 2 × 105 cells were transplanted to
the lungs of syngeneic recipient mice via the intratracheal route. AM
were recovered by lavage after 2 and 14 days, and adherent cells were
evaluated by fluorescence microscopy. GFP fluorescence is shown in
green. Nuclei are counterstained with DAPI (blue) and autofluorescence
appears yellow-orange. (A) AM recovered 2 days after transfer of
AdNull-infected cells to the lung. (B) Same as (A) but AdGFP-infected
AM. (C) AdNull, 14 days. (D) AdGFP, 14 days. Bar = 50 µm. Cells
recovered from naive mice showed only autofluorescence (not shown). (E)
Quantitative assessment of the number of genetically modified AM. Shown
is the percentage of cells expressing green fluorescence, reflecting AM
expression of GFP.
|
|
To analyze if transfer of AM infected in vitro with AdmGM-CSF can be
used to induce AM proliferation in the lung in vivo, AM were infected
in vitro with AdmGM-CSF and, after 24 hours, the cells were
transplanted to the epithelial surface of lungs of syngeneic mice.
Analysis of lavage fluid 7 days after transplantation showed increased
mGM-CSF levels in the lavage of the mice that received AM modified with
AdmGM-CSF, but not in mice receiving AdNull
(Fig 7). In contrast, for mice receiving
recombinant mGM-CSF (60 ng, the amount equivalent to 4-day in vitro
production by 2 × 105 cells), no mGM-CSF could be
detected 7 days later (Fig 7). Serum GM-CSF levels were undetectable in
all groups (not shown). Consistent with the data demonstrating that in
vitro AdmGM-CSF infection of AM induced increased proliferation of AM
in vitro, recovery of AM genetically modified in vitro with AdmGM-CSF
to express the mGM-CSF cDNA demonstrated that the AM were continuing to
proliferate at an increased rate (Fig 8A).
In this regard, AM recovered from the lungs by lavage at 7 days after
transplantation of naive AM showed low levels of
[3H]thymidine incorporation, as did AM recovered from the
lungs 7 days after transplantation of AM infected with AdNull (Fig 8A). In marked contrast, transplantation of AM genetically modified ex vivo
7 days previously with AdmGM-CSF showed a significant increase in
[3H]thymidine incorporation at 24 hours (P < .001 compared with all other groups) and 72 hours (P < .0001 compared with all other groups) of in vitro culture after recovery. In
comparison, mice receiving 60 ng recombinant mGM-CSF showed no increase
in proliferation (P > .5 compared with naive mice; P < .0001 compared with AM modified with AdmGM-CSF). To analyze if the
AM recovered 5 weeks after transfer were still proliferating, the cells
recovered by lavage were analyzed by [3H]thymidine
incorporation in vitro (Fig 8B). The cells recovered from the AM GM-CSF
group still showed increased proliferation after 24 and 72 hours of
labeling (P < .01 at 24 hours and P < .0001 at 72 hours compared with AM Null). Interestingly, at 5 weeks, GM-CSF levels
were not detectable in the lavage fluid (not shown), suggesting that
the increased proliferation of the AM at 5 weeks was secondary to
local, likely intracellular, stimulation of the AM by mGM-CSF.
View larger version (12K):
[in this window]
[in a new window]
| Fig 7.
Quantification of mGM-CSF in lavage fluid after transfer
of genetically modified AM to the lung. Alveolar macrophages were
infected in vitro with AdmGM-CSF or AdNull at 100 moi for 90 minutes
and washed, and 2 × 105 AM were transplanted by the
intratracheal route to the lungs of syngeneic mice. As a control, a
parallel group of animals received 60 ng recombinant mGM-CSF
(r-mGM-CSF). Quantification of mGM-CSF in lavage fluid was performed by
ELISA 1 week after administration. The data are expressed as picograms
of mGM-CSF in lavage fluid referenced to milligrams of total protein in
the recovered fluid. The dashed line represents the lower limit of
detection of the assay.
|
|
View larger version (14K):
[in this window]
[in a new window]
View larger version (16K):
[in this window]
[in a new window]
View larger version (45K):
[in this window]
[in a new window]
| Fig 8.
Proliferation of AM after in vitro infection of AM by
AdmGM-CSF and subsequent transplant of the genetically modified AM to
the lung. Shown is in vitro proliferation of AM recovered by lavage 1 and 5 weeks after AM transfer. (A) Proliferation in vitro of AM
recovered 1 week after transplantation. Shown is in vitro assessment of
[3H]thymidine uptake over 24 and 72 hours for AM
recovered from naive mice, from mice receiving intratracheal
recombinant mGM-CSF (60 ng), from mice receiving AM modified with
AdNull (AM Null), and from mice receiving transplanted AM modified with
AdmGM-CSF (AM GM-CSF). (B) Proliferation in vitro of AM recovered by
lavage 5 weeks after AM transfer. Shown is in vitro assessment of
[3H]thymidine uptake over 24 and 72 hours for AM
recovered from mice receiving transplanted AM modified with AdNull (AM
Null) or AM modified with AdmGM-CSF (AM GM-CSF). Note that the
ordinates of (A) and (B) are different; the assays performed at 1 week
(A) and 5 weeks (B) are performed at different times with fresh cells;
thus, the overall extent of [3H]thymidine uptake cannot
be compared between the two panels. (C) Presence of Ad genome in AM 1 and 5 weeks after AM transfer. DNA was analyzed using PCR with primers
to amplify Ad genome (E4), Ad genome plus mGM-CSF transgene
(Ad-GM-CSF), and HK-ATPase as control. Shown is ethidium bromide
staining of amplified DNA from naive control, AM Null at 1 and 5 weeks,
and AM GM-CSF 1 and 5 weeks after AM transfer.
|
|
To analyze if Ad genome is present in the cells recovered by lavage,
the DNA of the cells was analyzed by PCR using Ad- and transgene-specific primers. AM infected with Ad Null showed Ad-specific E4 signal at 1 and 5 weeks; AM infected with AdmGM-CSF demonstrated E4-
as well as AdGM-CSF-specific bands. Control cells showed no Ad signal.
The genomic control (HK-ATPase) was present in all samples.
Quantification of the cells recovered in the lavage showed an increased
number of alveolar macrophages in the group transplanted with AM
genetically modified with AdmGM-CSF compared with the other groups
(Fig 9A). At 7 days, the number of AM
recovered from the mice receiving transplants of AM modified with the
mGM-CSF cDNA was greater than twofold higher compared with the AM Null group, the recombinant mGM-CSF group, and the naive group (P < .0001, all comparisons AdmGM-CSF-modified AM to all other groups). The absolute cell number recovered in the lavage of the animals who had
received 60 ng recombinant mGM-CSF (the amount calculated to be
produced by 2 × 105 cells infected in vitro over 4 days) showed no increase in cell number in vivo (P > .5 compared with naive mice). The analysis of the differential cell count
demonstrated that there was negligible increase in the number of
lymphocytes and neutrophils in the group receiving transplants of AM
modified by AdmGM-CSF, but the percentage of AM in the lavage remained
higher than 95%, so that the increase in absolute cell number was
dominated by an increase in the number of AM. No eosinophils or
basophils were recovered in any group.
View larger version (20K):
[in this window]
[in a new window]
View larger version (13K):
[in this window]
[in a new window]
| Fig 9.
Time course of expansion in numbers of alveolar
macrophages after in vitro infection of alveolar macrophages by
AdmGM-CSF and subsequent transfer of the genetically modified AM to the
lung. Alveolar macrophages were infected in vitro with AdmGM-CSF (AM
GM-CSF) or AdNull (AM Null) at 100 moi. After 90 minutes, the cells
were washed and 2 × 105 AM were transplanted by the
intratracheal route to the lungs of syngeneic mice. (A) Total number of
cells recovered by lavage 7 days after the administration of
genetically modified AM. Shown are total numbers of AM, granulocytes,
and lymphocytes. The granulocytes were greater than 99% neutrophils.
(B) Number of AM recovered by lavage 1 and 5 weeks after administration
of AM genetically modified in vitro with AdmGM-CSF compared with AdNull
or naive mice. The data regarding the number of AM from 1 week are the
same as the AM data from (A). The data represent the mean ± standard
error of the mean for 4 to 6 mice for each data point.
|
|
Analysis of the number of AM recovered by lavage 5 weeks after
transplantation demonstrated that the number of AM was still elevated
in the AM GM-CSF group compared with the AM Null group (1.9-fold,
P < .01; Fig 9B). The minor increase in the number of AM in
the AM Null group compared with day 7 is most likely due to increase in
body weight and age over that period. The histological analysis of lung
sections from animals receiving AM modified with AdNull or AdmGM-CSF
demonstrated no abnormalities, including no accumulation of
inflammatory cells or fibrosis 1 and 5 weeks after AM transfer
(Fig 10).
View larger version (109K):
[in this window]
[in a new window]
| Fig 10.
Lung histology after in vitro infection of AM by
AdmGM-CSF or AdNull and subsequent transfer of the genetically modified
AM to the lung. Shown is light microscopy of hematoxylin/eosin-stained
sections of formalin fixed lung 1 and 5 weeks after AM transfer. (A)
Naive mice. (B) Mice receiving AM modified with AdNull 1 week
previously. (C) Mice receiving AM modified with AdmGM-CSF 1 week
previously. (D) Similar to (B), but after 5 weeks. (E) Similar to (C),
but after 5 weeks. Bar = 100 µm.
|
|
| |
DISCUSSION |
The ability of the lung to defend itself against inhaled organisms
depends, to a significant degree, on the number and function of
alveolar macrophages in the respiratory epithelial
surface.1-3 The AM is a member of mononuclear phagocyte
system and, as such, is derived from the monocytic lineage of bone
marrow cells.1,2 The number of AM on the respiratory
epithelial surface results from a balance of three processes: monocytes
recruited from the blood, AM proliferating in situ, and AM dying or
leaving the lung via the mucociliary escalator or the interstitial
lymphatics.1-3 Although a small proportion of AM do
proliferate in situ,12,13,24 the vast majority of AM are
normally derived from blood monocytes recruited to the lung. The
present study shows that this balance can be significantly altered by
modifying the genetic repertoire of the AM using an Ad vector to
transfer and express the cDNA coding for mGM-CSF, a mediator known to
mediate AM proliferation.15,16 In this regard, despite the
general concept that AM are terminally differentiated and the
challenges in genetically modifying AM, the data demonstrate that Ad
vectors can transfer and express genes in AM and that the AM remain
genetically modified when transplanted to the lungs of syngeneic mice.
Importantly, in vitro genetic modification of AM with the mGM-CSF cDNA
and transplantation of the mGM-CSF cDNA-modified AM to the respiratory
epithelial surface of syngeneic mice result in enhanced proliferation
of the AM in situ in the lung, with an associated increase in AM number
for at least 5 weeks, with Ad genome still detectable at 5 weeks. Finally, unlike the marked lung morphologic changes and recruitment of
multiple inflammatory cell types associated with lung epithelial expression of mGM-CSF,25 the selective genetic modification of AM with the mGM-CSF cDNA results in selective enhancement of AM
numbers, with no associated pulmonary pathology.
Gene transfer to AM.
The ability to transfer and express a gene in cells in vitro and in
vivo is a powerful tool to help understand the biology of the
transferred gene and the target cell and can be used as a therapeutic
strategy in which the gene product functions to modify the pathologic
processes within, or external to, the modified cells.26,27
Gene transfer is conventionally accomplished using a vector, a physical
or biologic carrier that transfers the gene of interest into the cell
and to the site where it will be expressed, usually the nucleus. With
the armamentarium of nonviral and viral vectors available, most cell
types can be genetically modified. One exception is the AM, cells that
likely impose a hurdle to efficient gene transfer through their highly
efficient capacity to scavenge and eliminate foreign
material1-3; ie, the AM likely destroys the vector and gene
before the gene can be translocated and expressed. To circumvent this
hurdle, we hypothesized that adenovirus vectors, the most efficient of
the gene transfer vectors in regard to entering cells and trafficking
to the nucleus,27,28 may be able to transfer and express
genes in AM by virtue of the efficiency of Ad breaking out of endosomes
before endosome-lysosome fusion.29
Various approaches to gene transfer to mononuclear phagocytes,
including AM, have been attempted. The nonviral approaches include
Fc-receptor-mediated endocytosis for AM targets in vitro,30 glycosylated polylysine complexes for monocyte-derived macrophages in
vitro,31 and mannosylated polylysine complexes to target spleen and liver macrophages in a murine model in vivo.32
Terminally differentiated tissue macrophages are not good targets for
murine Maloney leukemia virus derived retroviral vectors because of the requirement of this vector for proliferation of the target cells for
effective gene transfer33; thus, the use of retrovirus
vectors relevant to mononuclear phagocytes has focused primarily on
targeting proliferating stem cells of the monocytic
lineage.34,35 In vitro gene transfer to monocyte-derived
macrophages has been reported for a replication-deficient herpes
simplex-derived vector36 and an autonomous parvovirus
vector37 and to AM with an adeno-associated vector.38 Ad vectors have been used to transfer genes into
monocyte-derived macrophages.39-43 In general, the
efficiency of gene transfer to macrophages is much lower than gene
transfer to other cell types.
The concept of using Ad vectors to infect AM is based on the knowledge
that wild-type Ad can persist in monocytic cell lines for more than 1 year,44 and wild-type Ad infection has been described in
murine, porcine, canine, and bovine AM.45-48 Although we
have been successful in transferring genes to a high proportion of
naive AM in vitro, it does require a high multiplicity of infection. The reason for this is unclear; it may be because of the efficiency of
AM in scavenging and destroying microorganisms and possibly because of
a deficiency of subgroup C Ad receptors on the AM surface. In regard to
the scavenging function of AM, tissue macrophages, including AM, have
been shown to impose a hurdle for Ad-mediated gene transfer to the
respiratory epithelium in vivo.49-52 In regard to Ad
receptors, AM do not appear to have an abundance of the appropriate
receptors for subgroup C Ad,53 and upregulating integrins
relevant for Ad internalization has resulted in improved gene transfer
efficiency in monocyte-derived macrophages.40,42 Interestingly, despite the high moi required to achieve high efficiency of gene transfer to AM, the Ad does not appear to significantly injure
AM, as it does with high moi in some cell types.54,55
Effects of GM-CSF transfer to AM.
GM-CSF is a potent cytokine and growth factor with a variety of
functions. It is normally expressed by macrophages, T cells, mast
cells, endothelial cells, and fibroblasts in response to immune and
inflammatory stimuli.56 GM-CSF acts in a paracrine fashion
and usually does not appear in the circulation at detectable levels.56 Among the biological activities that have been
associated with GM-CSF relevant to macrophages in vitro are
proliferation, cytokine expression, increased parasite killing, and
tumor cell killing.56-61 Systemic overexpression of GM-CSF
in vivo is associated with hematopoiesis, eosinophilia, and the
development of a myeloproliferative syndrome56,62; whereas
GM-CSF knock-out mice developed severe lung pathology similar to
alveolar proteinosis.63 Transgenic animals overexpressing
GM-CSF developed accumulations of macrophages in the eyes, muscle,
peritoneal, and pleural cavities.64 In contrast,
transgeneic mice overexpressing GM-CSF specifically in lung epithelial
cells resulted in hyperplasia of alveolar type II epithelial
cells.65 Recombinant GM-CSF has been shown to induce
proliferation of AM in vitro.15,16 In vivo recombinant GM-CSF does not increase AM number in the lung after subcutaneous daily
injections66 or intratracheal administration67
in mice, whereas administration of aerosolized GM-CSF to the lungs of
nonhuman primates resulted in an increased number of macrophages and
neutrophils in the lung.68
With this background, our study demonstrates that transplantation to
the lung of AM genetically modified to express mGM-CSF leads to AM
proliferation in vivo in the respiratory tract, whereas administration
of recombinant GM-CSF did not result in increased AM number. Expression
of GM-CSF within the AM seems more efficient than administration of the
recombinant protein due to the site of expression and the continuous
production, although we did not directly compare the potency of
recombinant GM-CSF, which has been previously shown to induce AM
proliferation,15,16 and AdGM-CSF on AM proliferation in
vitro. Interestingly, the transplantation of AM genetically modified
with the mGM-CSF cDNA to the murine lung has different consequences
than the delivery of the mGM-CSF cDNA to the respiratory epithelium of
rats.25 In this context, our observation that
transplantation of mGM-CSF cDNA modified AM leads to enhanced AM
proliferation and expansion of AM without accumulation of other
inflammatory cell types and no associated lung pathology differs
markedly from the observation of Xing et al25 that Ad
vector-mediated transfer of the GM-CSF cDNA to the respiratory
epithelium results in accumulation of eosinophils in addition to AM and
the associated development of fibrosis. Because the mGM-CSF cDNA was
transferred to the AM in our study using an Ad vector similar in design
to that used by Xing et al25 to transfer the GM-CSF cDNA to
the respiratory epithelium, the marked differences in the results
suggest that expression of the GM-CSF cDNA may display different
biologic properties depending on the cell in which it is expressed.
Alternatively, the transfer of mGM-CSF to the respiratory epithelium
may result in the overproduction of GM-CSF leading to systemic effects
(as we have observed in Ad-vector mediated transfer of the
thrombopoietin cDNA to the respiratory epithelium69),
because the concentration of GM-CSF in the lavage fluid reported by
Xing et al was between 100 and 20,000 pg/mL compared with
54 pg/mL in our study. GM-CSF-producing macrophages could be taken up
into the pulmonary interstitium and traffic to the regional lymph
nodes. This could theoretically influence the numbers of macrophages in
the lung, but this is unlikely, because there would be no specific
mechanism where this would increase new alveolar macrophages in the
lung. Because the number of AM in the lung after AM GM-CSF transfer
doubled but the recovered AM demonstrated an eightfold increase in
thymidine incorporation in vitro, the possibility exists that the half
life of the GM-CSF-transduced AM could be decreased if the in vitro proliferation reflects the in vivo behavior accurately. If the number
of cells expressing GM-CSF would have been similar to that seen with
the GFP-transduced AM, where about 2% of the recovered cells showed
clear transgene expression, the number of AM would have theoretically
increased by 12% to 16% after 1 week, based on our in vitro studies.
However, the evaluation of GFP expression by fluorescence microscopy of
freshly isolated cells most likely underestimates the number of
transgene expressing cells, because weakly positive cells will not be
detected due to the relative high autofluorescence; furthermore, the in
vivo doubling behavior of AM might be different than in vitro. Systemic
overexpression of the mGM-CSF cDNA in mice resulted in increased
hematopoiesis and eosinophilia and leads to the development of a
myeloproliferative syndrome62; ie, marked overexpression of
GM-CSF might be potentially dangerous and outweigh the potential
benefits of selective, locally produced GM-CSF.
Potential usefulness of genetic manipulation of AM.
Alveolar macrophages represent an interesting target for genetic
modification due to their role in the innate and adaptive immune
response, importance in combating infectious organisms, and role in
inflammatory disorders as well as being a site for replication of a
variety of infectious agents, such as human immunodeficiency virus
(HIV).1-3 For example, GM-CSF cDNA-modified AM might be useful in enhancing pulmonary host defense in states of GM-CSF deficiency such as pulmonary alveolar proteinosis and possibly for
anticancer strategies.56-62 Using Ad-mediated modification of AM could also be easily accomplished using the cDNAs for other cytokines that may be beneficial to increase pulmonary host defense potential, such as interferon- .70-73 An additional
benefit of the ex vivo/in vivo strategy used in the present study is
that it had relatively long-lasting effects compared with direct Ad vector gene transfer to the lung. It is of interest, therefore, that
actively proliferating macrophages could still be recovered 5 weeks
after AM transfer, a time period when Ad vector gene expression after
direct administration of an Ad vector to the respiratory tract
decreases to undetectable levels in Balb/c mice.74 Finally, genetic manipulation of AM and the subsequent in vivo transplant of the
genetically modified cells might not only be beneficial for potential
therapeutic applications, but might also be a useful tool to study the
physiologic and pathophysiologic role of various mediators in the
respiratory tract.
| |
ACKNOWLEDGMENT |
The authors thank B. Ferris and R. Ramaligan in our laboratory for
helpful advice, Berns Gansbacher (University of Munich, Munich,
Germany) for the mGM-CSF cDNA, and N. Mohamed in help for preparing
this manuscript.
| |
FOOTNOTES |
Submitted May 11, 1998;
accepted September 14, 1998.
Supported in part by the National Institutes of Health (NIH)/National
Heart, Lung and Blood Institute (Grants No. P01 5-P01-HL51746, 1-P01-HL59312, and HL51746-03); the Cystic Fibrosis Foundation (Bethesda, MD); the Will Rogers Memorial Fund (White Plains, NY); and
GenVec, Inc (Rockville, MD). M.A.S.M. is supported by the Gar Reichman
Fund of the Cancer Research Institue (New York, NY) and NIH/Cancer
Center Support Grant No. CA-08748.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Ronald G. Crystal, MD, The New York
Hospital-Cornell Medical Center, 520 E 70th St, ST 505, New York, NY
10021; e-mail: geneticmedicine{at}mail.med.cornell.edu.
| |
REFERENCES |
1.
Fels AO, Cohn ZA:
The alveolar macrophage.
J Appl Physiol
60:353, 1986[Abstract/Free Full Text]
2.
Bezdicek P, Crystal RG:
Pulmonary macrophages, in
Crystal RG,
West JB,
Weibel ER,
Barnes PJ
(eds):
The Lung: Scientific Foundations. Philadelphia, PA, Lippincott-Raven, 1997, p 859.
3.
Reynolds HY:
Integrated host defense against infections, in
Crystal RG,
West JB,
Weibel ER,
Barnes PJ
(eds):
The Lung: Scientific Foundations. Philadelphia, PA, Lippincott-Raven, 1997, p 2353.
4.
Crapo JD, Barry BE, Gehr P, Bachofen M, Weibel ER:
Cell number and cell characteristics of the normal human lung.
Am Rev Respir Dis
126:332, 1982[Medline]
[Order article via Infotrieve]
5.
Gudewicz PW, Ferguson JL, Kapin MA, Jaffe RC:
The effects of cortisone treatment and burn injury on plasma and lung lavage cortisol concentrations and alveolar macrophage activity.
Adv Shock Res
5:123, 1981[Medline]
[Order article via Infotrieve]
6.
Jakab GJ:
Immune impairment of alveolar macrophage phagocytosis during influenza virus pneumonia.
Am Rev Respir Dis
126:778, 1982[Medline]
[Order article via Infotrieve]
7.
Winston DJ, Territo MC, Ho WG, Miller MJ, Gale RP, Golde DW:
Alveolar macrophage dysfunction in human bone marrow transplant recipients.
Am J Med
73:859, 1982[Medline]
[Order article via Infotrieve]
8.
Shennib H, Chiu RC, Mulder DS, Richards GK, Prentis J:
Pulmonary bacterial clearance and alveolar macrophage function in septic shock lung.
Am Rev Respir Dis
130:444, 1984[Medline]
[Order article via Infotrieve]
9.
Wallaert B, Aerts C, Bart F, Hatron PY, Dracon M, Tonnel AB, Voisin C:
Alveolar macrophage dysfunction in systemic lupus erythematosus.
Am Rev Respir Dis
136:293, 1987[Medline]
[Order article via Infotrieve]
10.
Thrasher AJ, Keep NH, Wientjes F, Segal AW:
Chronic granulomatous disease.
Biochim Biophys Acta
1227:1, 1994[Medline]
[Order article via Infotrieve]
11.
Sanders A, Crystal RG:
Consequences to the lung of specific deficiencies in host defense, in
Crystal RG,
West JB,
Weibel ER,
Barnes PJ
(eds):
The Lung: Scientific Foundations. Philadelphia, PA, Lippincott-Raven, 1997, p 2367.
12.
Bitterman PB, Saltzman LE, Adelberg S, Ferrans VJ, Crystal RG:
Alveolar macrophage replication: One mechanism for the expansion of the mononuclear phagocyte population in the chronically inflamed lung.
J Clin Invest
74:460, 1984
13.
Shellito J, Esparza C, Armstrong C:
Maintenance of the normal rat alveolar macrophage cell population. The roles of monocyte influx and alveolar macrophage proliferation in situ.
Am Rev Respir Dis
135:78, 1987[Medline]
[Order article via Infotrieve]
14.
Spurzem JR, Saltini C, Rom W, Winchester RJ, Crystal RG:
Mechanisms of macrophage accumulation in the lungs of asbestos-exposed subjects.
Am Rev Respir Dis
136:276, 1987[Medline]
[Order article via Infotrieve]
15.
Chen BD, Mueller M, Chou TH:
Role of granulocyte/macrophage colony-stimulating factor in the regulation of murine alveolar macrophage proliferation and differentiation.
J Immunol
141:139, 1988[Abstract]
16.
Nakata K, Akagawa KS, Fukayama M, Hayashi Y, Kadokura M, Tokunaga T:
Granulocyte-macrophage colony-stimulating factor promotes the proliferation of human alveolar macrophages in vitro.
J Immunol
147:1266, 1991[Abstract]
17.
Zolotukhin S, Potter M, Hauswirth WW, Guy J, Muzyczka N:
A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.
J Virol
70:4646, 1996[Abstract]
18.
Stanley E, Metcalf D, Sobieszczuk P, Gough NM, Dunn AR:
The structure and expression of the murine gene encoding granulocyte-macrophage colony stimulating factor: Evidence for utilisation of alternative promoters.
EMBO J
4:2569, 1985[Medline]
[Order article via Infotrieve]
19.
Hersh J, Crystal RG, Bewig B:
Modulation of gene expression after replication-deficient, recombinant adenovirus-mediated gene transfer by the product of a second adenovirus vector.
Gene Ther
2:124, 1995[Medline]
[Order article via Infotrieve]
20.
Rosenfeld MA, Siegfried W, Yoshimura K, Yoneyama K, Fukayama M, Stier LE, Paakko PK, Gilardi P, Stratford-Perricaudet LD, Perricaudet M, Jallat S, Pavirani A, Lecocq J, Crystal RG:
Adenovirus-mediated transfer of a recombinant alpha 1-antitrypsin gene to the lung epithelium in vivo.
Science
252:431, 1991[Abstract/Free Full Text]
21.
Rosenfeld MA, Yoshimura K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Fukayama M, Bargon J, Stier LE, Stratford-Perricaudet L, Perricaudet M, Guggino WB, Pavirani A, Lecocq J, Crystal RG:
In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium.
Cell
68:143, 1992[Medline]
[Order article via Infotrieve]
22.
Graham FL, Prevec L:
Manipulation of adenovirus vectors, in
Murray EJ
(ed):
Methods In Molecular Biology, vol 7: Gene Transfer and Expression Protocols. Clifton, NJ, Humana, 1991, p 109.
23.
Baird DH, Hatten ME, Heintz N, Mason CA:
Micromethods for analyzing axon-target interactions in vitro.
Neuroprotocols: A Companion to Methods in Neurosciences
4:106, 1994
24.
Spurzem JR, Saltini C, Kirby M, Konishi K, Crystal RG:
Expression of HLA class II genes in alveolar macrophages of patients with sarcoidosis.
Am Rev Respir Dis
140:89, 1989[Medline]
[Order article via Infotrieve]
25.
Xing Z, Ohkawara Y, Jordana M, Graham F, Gauldie J:
Transfer of granulocyte-macrophage colony-stimulating factor gene to rat lung induces eosinophilia, monocytosis, and fibrotic reactions.
J Clin Invest
97:1102, 1996[Medline]
[Order article via Infotrieve]
26.
Mulligan RC:
The basic science of gene therapy.
Science
260:926, 1993[Abstract/Free Full Text]
27.
Crystal RG:
Transfer of genes to humans: Early lessons and obstacles to success.
Science
270:404, 1995[Abstract/Free Full Text]
28.
Greber UF, Willetts M, Webster P, Helenius A:
Stepwise dismantling of adenovirus 2 during entry into cells.
Cell
75:477, 1993[Medline]
[Order article via Infotrieve]
29.
Fitz Gerald DJ, Padmanabhan R, Pastan I, Willingham MC:
Adenovirus-induced release of epidermal growth factor and pseudomonas toxin into the cytosol of kb cells during receptor-mediated endocytosis.
Cell
32:607, 1983[Medline]
[Order article via Infotrieve]
30.
Rojanasakul Y, Wang LY, Malanga CJ, Ma JK, Liaw J:
Targeted gene delivery to alveolar macrophages via Fc receptor-mediated endocytosis.
Pharm Res
11:1731, 1994[Medline]
[Order article via Infotrieve]
31.
Erbacher P, Bousser MT, Raimond J, Monsigny M, Midoux P, Roche AC:
Gene transfer by DNA/glycosylated polylysine complexes into human blood monocyte-derived macrophages.
Hum Gene Ther
7:721, 1996[Medline]
[Order article via Infotrieve]
32.
Ferkol T, Perales JC, Mularo F, Hanson RW:
Receptor-mediated gene transfer into macrophages.
Proc Natl Acad Sci USA
93:101, 1996[Abstract/Free Full Text]
33.
Miller AD:
Retroviral vectors.
Curr Top Microbiol Immunol
158:1, 1992[Medline]
[Order article via Infotrieve]
34.
Ohashi T, Boggs S, Robbins P, Bahnson A, Patrene K, Wei FS, Wei JF, Li J, Lucht L, Fei Y, Clark S, Kimak M, He H, Mowery-Rushton P, Braranger JA:
Efficient transfer and sustained high expression of the human glucocerebrosidase gene in mice and their functional macrophages following transplantation of bone marrow transduced by a retroviral vector.
Proc Natl Acad Sci USA
89:11332, 1992[Abstract/Free Full Text]
35.
Malik P, Krall WJ, Yu XJ, Zhou C, Kohn DB:
Retroviral-mediated gene expression in human myelomonocytic cells: A comparison of hematopoietic cell promoters to viral promoters.
Blood
86:2993, 1995[Abstract/Free Full Text]
36.
Weir JP, Elkins KL:
Replication-incompetent herpesvirus vector delivery of an interferon alpha gene inhibits human immunodeficiency virus replication in human monocytes.
Proc Natl Acad Sci USA
90:9140, 1993[Abstract/Free Full Text]
37.
Dupont F, Tenenbaum L, Guo LP, Spegelaere P, Zeicher M, Rommelaere J:
Use of an autonomous parvovirus vector for selective transfer of a foreign gene into transformed human cells of different tissue origins and its expression therein.
J Virol
68:1397, 1994[Abstract/Free Full Text]
38.
Inouye RT, Du B, Boldt-Houle D, Ferrante A, Park IW, Hammer SM, Duan L, Groopman JE, Pomerantz RJ, Terwilliger EF:
Potent inhibition of human immunodeficiency virus type 1 in primary T cells and alveolar macrophages by a combination anti-rev strategy delivered in an adeno-associated virus vector.
J Virol
71:4071, 1997[Abstract]
39.
Haddada H, Lopez M, Martinache C, Ragot T, Abina MA, Perricaudet M:
Efficient adenovirus-mediated gene transfer into human blood monocyte-derived macrophages.
Biochem Biophys Res Commun
195:1174, 1993[Medline]
[Order article via Infotrieve]
40.
Huang S, Endo RI, Nemerow GR:
Upregulation of integrins alpha v beta 3 and alpha v beta 5 on human monocytes and T lymphocytes facilitates adenovirus-mediated gene delivery.
J Virol
69:2257, 1995[Abstract]
41.
Thrasher AJ, Casimir CM, Kinnon C, Morgan G, Segal AW, Levinsky RJ:
Gene transfer to primary chronic granulomatous disease monocytes.
Lancet
346:92, 1995[Medline]
[Order article via Infotrieve]
42.
Huang S, Kamata T, Takada Y, Ruggeri ZM, Nemerow GR:
Adenovirus interaction with distinct integrins mediates separate events in cell entry and gene delivery to hematopoietic cells.
J Virol
70:4502, 1996[Abstract]
43.
Schneider SD, Rusconi S, Seger RA, Hossle JP:
Adenovirus-mediated gene transfer into monocyte-derived macrophages of patients with X-linked chronic granulomatous disease: Ex vivo correction of deficient respiratory burst.
Gene Ther
4:524, 1997[Medline]
[Order article via Infotrieve]
44.
Chu Y, Sperber K, Mayer L, Hsu MT:
Persistent infection of human adenovirus type 5 in human monocyte cell lines.
Virology
188:793, 1992[Medline]
[Order article via Infotrieve]
45.
Grad R, Sobonya RE, Witten ML, Quan SF, Ray CG, Devine LC, Lentz LA, Lemen RJ:
Localization of inflammation and virions in canine adenovirus type 2 bronchiolitis.
Am Rev Respir Dis
142:691, 1990[Medline]
[Order article via Infotrieve]
46.
Adair BM, McNulty MS, Foster JC:
Effects of two adenoviruses (type 1 and type 8) on functional properties of bovine alveolar macrophages in vitro.
Am J Vet Res
53:1010, 1992[Medline]
[Order article via Infotrieve]
47.
Ginsberg HS, Prince GA:
The molecular basis of adenovirus pathogenesis.
Infect Agents Dis
3:1, 1994[Medline]
[Order article via Infotrieve]
48.
Torres JM, Alonso C, Ortega A, Mittal S, Graham F, Enjuanes L:
Tropism of human adenovirus type 5-based vectors in swine and their ability to protect against transmissible gastroenteritis coronavirus.
J Virol
70:3770, 1996[Abstract]
49.
Kuzmin AI, Finegold MJ, Eisensmith RC:
Macrophage depletion increases the safety, efficacy and persistence of adenovirus-mediated gene transfer in vivo.
Gene Ther
4:309, 1997[Medline]
[Order article via Infotrieve]
50.
Wolff G, Worgall S, van Rooijen N, Song WR, Harvey BG, Crystal RG:
Enhancement of in vivo adenovirus-mediated gene transfer and expression by prior depletion of tissue macrophages in the target organ.
J Virol
71:624, 1997[Abstract]
51.
Worgall S, Wolff G, Falck-Pedersen E, Crystal RG:
Innate immune mechanisms dominate elimination of adenoviral vectors following in vivo administration.
Hum Gene Ther
8:37, 1997[Medline]
[Order article via Infotrieve]
52.
Worgall S, Leopold PL, Wolff G, Ferris B, van Rooijen N, Crystal RG:
Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithelial surface of the respiratory tract.
Hum Gene Ther
8:1687, 1997
53.
Kaner RJ, Stolze E, Wickham TJ, Kovesdi I, Granstein RD, Crystal RG:
Adenovirus-mediated gene transfer to macrophages and a Langerhans' cell-like line is enhanced by genetically modifying fiber protein with polylysine repeats.
Am J Respir Crit Care Med
155:A458, 1997 (abstr)
54.
Teramoto S, Johnson LG, Huang W, Leigh MW, Boucher RC:
Effect of adenoviral vector infection on cell proliferation in cultured primary human airway epithelial cells.
Hum Gene Ther
6:1045, 1995[Medline]
[Order article via Infotrieve]
55.
Weber M, Deng S, Kucher T, Shaked A, Ketchum RJ, Brayman KL:
Adenoviral transfection of isolated pancreatic islets: A study of programmed cell death (apoptosis) and islet function.
J Surg Res
69:23, 1997[Medline]
[Order article via Infotrieve]
56.
Gasson JC:
Molecular physiology of granulocyte-macrophage colony-stimulating factor.
Blood
77:1131, 1991[Free Full Text]
57.
Donahue RE, Wang EA, Stone DK, Kamen R, Wong GG, Sehgal PK, Nathan DG, Clark SC:
Stimulation of haematopoiesis in primates by continuous infusion of recombinant human GM-CSF.
Nature
321:872, 1986[Medline]
[Order article via Infotrieve]
58.
Grabstein KH, Urdal DL, Tushinski RJ, Mochizuki DY, Price VL, Cantrell MA, Gillis S, Conlon PJ:
Induction of macrophage tumoricidal activity by granulocyte-macrophage colony-stimulating factor.
Science
232:506, 1986[Abstract/Free Full Text]
59.
Weiser WY, Van Niel A, Clark SC, David JR, Remold HG:
Recombinant human granulocyte/macrophage colony-stimulating factor activates intracellular killing of leishmania donovani by human monocyte-derived macrophages.
J Exp Med
166:1436, 1987[Abstract/Free Full Text]
60.
Young DA, Lowe LD, Clark SC:
Comparison of the effects of IL-3, granulocyte-macrophage colony-stimulating factor, and macrophage colony-stimulating factor in supporting monocyte differentiation in culture. analysis of macrophage antibody-dependent cellular cytotoxicity.
J Immunol
145:607, 1990[Abstract]
61.
Muranaka H, Suga M, Nakagawa K, Sato K, Gushima Y, Ando M:
Effects of granulocyte and granulocyte-macrophage colony-stimulating factors in a neutropenic murine model of trichosporonosis.
Infect Immun
65:3422, 1997[Abstract]
62.
Johnson GR, Gonda TJ, Metcalf D, Hariharan IK, Cory S:
A lethal myeloproliferative syndrome in mice transplanted with bone marrow cells infected with a retrovirus expressing granulocyte-macrophage colony stimulating factor.
EMBO J
8:441, 1989[Medline]
[Order article via Infotrieve]
63.
Dranoff G, Crawford AD, Sadelain M, Ream B, Rashid A, Bronson RT, Dickersin GR, Bachurski CJ, Mark EL, Whitsett JA, Mulligan RC:
Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis.
Science
264:713, 1994[Abstract/Free Full Text]
64.
Lang RA, Metcalf D, Cuthbertson RA, Lyons I, Stanley E, Kelso A, Kannourakis G, Williamson DJ, Klintworth GK, Gonda TJ, Dunn AR:
Transgenic mice expressing a hemopoietic growth factor gene (GM-CSF) develop accumulations of macrophages, blindness, and a fatal syndrome of tissue damage.
Cell
51:675, 1987[Medline]
[Order article via Infotrieve]
65.
Huffman Reed JA, Rice WR, Zsengeller ZK, Wert SE, Dranoff G, Whitsett JA:
GM-CSF enhances lung growth and causes alveolar type II epithelial cell hyperplasia in transgenic mice.
Am J Physiol
273:L715, 1997
66.
Mandujano JF, D'Souza NB, Nelson S, Summer WR, Beckerman RC, Shellito JE:
Granulocyte-macrophage colony stimulating factor and pneumocystis carinii pneumonia in mice.
Am J Respir Crit Care Med
151:1233, 1995[Abstract]
67.
Denis M, Ghadirian E:
Murine hypersensitivity pneumonitis: Production and importance of colony-stimulating factors in the course of a lung inflammatory reaction.
Am J Respir Cell Mol Biol
7:441, 1992
68.
Rose RM, Kobzik L, Dushay K, Wolfthal S, Hondalus M, Metzger M, Stoudemire J, Brain JD, Garnick M, O'Donnell C, Donahue RE:
The effect of aerosolized recombinant human granulocyte macrophage colony-stimulating factor on lung leukocytes in nonhuman primates.
Am Rev Respir Dis
146:1279, 1992[Medline]
[Order article via Infotrieve]
69.
Cannizzo SJ, Frey BM, Raffi S, Moore MA, Eaton D, Suzuki M, Singh R, Mack CA, Crystal RG:
Augmentation of blood platelet levels by intratracheal administration of an adenovirus vector encoding human thrombopoietin cDNA.
Nat Biotechnol
15:570, 1997[Medline]
[Order article via Infotrieve]
70.
Jaffe HA, Buhl R, Mastrangeli A, Holroyd KJ, Saltini C, Czerski D, Jaffe HS, Kramer S, Sherwin S, Crystal RG:
Organ specific cytokine therapy. Local activation of mononuclear phagocytes by delivery of an aerosol of recombinant interferon-gamma to the human lung.
J Clin Invest
88:297, 1991
71.
Lei D, Lancaster JR Jr, Joshi MS, Nelson S, Stoltz D, Bagby GJ, Odom G, Shellito JE, Kolls JK:
Activation of alveolar macrophages and lung host defenses using transfer of the interferon-gamma gene.
Am J Physiol
272:L852, 1997[Abstract/Free Full Text]
72.
Skerrett SJ, Martin TR:
Intratracheal interferon-gamma augments pulmonary defenses in experimental legionellosis.
Am J Respir Crit Care Med
149:50, 1994[Abstract]
73.
Stoeckle MY, Falck-Pederson E, Rubin BY, Anderson SL, Murray HW:
Delivery of human interferon-gamma via gene transfer in vitro: Prolonged expression and induction of macrophage antimicrobial activity.
J Interferon Cytokine Res
16:1015, 1996[Medline]
[Order article via Infotrieve]
74.
Zsengeller ZK, Wert SE, Hull WM, Hu X, Yei S, Trapnell BC, Whitsett JA:
Persistence of replication-deficient adenovirus-mediated gene transfer in lungs of immune-deficient (nu/nu) mice.
Hum Gene Ther
6:457, 1995[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. N. Ballinger, L. L. N. Hubbard, T. R. McMillan, G. B. Toews, M. Peters-Golden, R. Paine III, and B. B. Moore
Paradoxical role of alveolar macrophage-derived granulocyte-macrophage colony-stimulating factor in pulmonary host defense post-bone marrow transplantation
Am J Physiol Lung Cell Mol Physiol,
July 1, 2008;
295(1):
L114 - L122.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Rice, R. Connor, S. Worgall, J. P. Moore, P. L. Leopold, R. J. Kaner, and R. G. Crystal
Inhibition of HIV-1 Replication in Alveolar Macrophages by Adenovirus Gene Transfer Vectors
Am. J. Respir. Cell Mol. Biol.,
August 1, 2002;
27(2):
214 - 219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Burg, V. Krump-Konvalinkova, F. Bittinger, and C. J. Kirkpatrick
GM-CSF expression by human lung microvascular endothelial cells: in vitro and in vivo findings
Am J Physiol Lung Cell Mol Physiol,
August 1, 2002;
283(2):
L460 - L467.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Santosuosso, M. Divangahi, A. Zganiacz, and Z. Xing
Reduced tissue macrophage population in the lung by anticancer agent cyclophosphamide: restoration by local granulocyte macrophage-colony-stimulating factor gene transfer
Blood,
February 15, 2002;
99(4):
1246 - 1252.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Paine III, S. B. Morris, H. Jin, S. E. Wilcoxen, S. M. Phare, B. B. Moore, M. J. Coffey, and G. B. Toews
Impaired functional activity of alveolar macrophages from GM-CSF-deficient mice
Am J Physiol Lung Cell Mol Physiol,
November 1, 2001;
281(5):
L1210 - L1218.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Tallone, S. Malin, A. Samuelsson, J. Wilbertz, M. Miyahara, K. Okamoto, L. Poellinger, L. Philipson, and S. Pettersson
A mouse model for adenovirus gene delivery
PNAS,
July 3, 2001;
98(14):
7910 - 7915.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. C. Russell
Update on adenovirus and its vectors
J. Gen. Virol.,
November 1, 2000;
81(11):
2573 - 2604.
[Full Text]
|
|
|
|
|
|
|
Z. Zsengellér, K. Otake, S.-A. Hossain, P.-Y. Berclaz, and B. C. Trapnell
Internalization of Adenovirus by Alveolar Macrophages Initiates Early Proinflammatory Signaling during Acute Respiratory Tract Infection
J. Virol.,
October 15, 2000;
74(20):
9655 - 9667.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. J. Kaner, J. V. Ladetto, R. Singh, N. Fukuda, M. A. Matthay, and R. G. Crystal
Lung Overexpression of the Vascular Endothelial Growth Factor Gene Induces Pulmonary Edema
Am. J. Respir. Cell Mol. Biol.,
June 1, 2000;
22(6):
657 - 664.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. Wang, D. P. Snider, B. R. Hewlett, N. W. Lukacs, J. Gauldie, H. Liang, and Z. Xing
Transgenic expression of granulocyte-macrophage colony-stimulating factor induces the differentiation and activation of a novel dendritic cell population in the lung
Blood,
April 1, 2000;
95(7):
2337 - 2345.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction