|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 3 (February 1), 1999:
pp. 1045-1061
The Novel Synthetic Retinoid
6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene Carboxylic Acid (CD437)
Causes Apoptosis in Acute Promyelocytic Leukemia Cells Through Rapid
Activation of Caspases
By
Luca Mologni,
Isabella Ponzanelli,
Filippo Bresciani,
Gabriele Sardiello,
Daniele Bergamaschi,
Maurizio Gianní,
Uwe Reichert,
Alessandro Rambaldi,
Mineko Terao, and
Enrico Garattini
From the Laboratory of Molecular Biology, Centro Catullo e Daniela
Borgomainerio, Laboratory of Cancer Chemotherapy, Istituto di Ricerche
Farmacologiche "Mario Negri," Milano, Italy; GALDERMA Research
and Development, Sophia Antipolis; and the Divisione di Ematologia,
Ospedali Riuniti di Bergamo, Bergamo, Italy.
 |
ABSTRACT |
The synthetic retinoid
6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene carboxylic acid
(CD437), which was originally developed as an retinoic acid receptor
(RAR)- agonist, induces rapid apoptosis in all-trans retinoic acid
(ATRA)-sensitive and ATRA-resistant clones of the NB4 cell line, a
widely used experimental model of acute promyelocytic leukemia (APL).
In addition, the compound is apoptogenic in primary cultures of freshly
isolated APL blasts obtained from a newly diagnosed case and an
ATRA-resistant relapsed patient. NB4 cells in the S-phase of the cycle
are most sensitive to CD437-triggered apoptosis. CD437-dependent
apoptosis does not require de novo protein synthesis and activation of
RAR- or any of the other nuclear retinoic acid receptors. The
process is preceded by rapid activation of a caspase-like enzymatic
activity capable of cleaving the fluorogenic DEVD but not the
fluorogenic YVAD tetrapeptide. Increased caspase activity correlates
with caspase-3 and caspase-7 activation. Inhibition of caspases by
z-VAD suppresses the nuclear DNA degradation observed in NB4 cells
treated with CD437, as well as the degradation of pro-caspase-3 and
pro-caspase-7. CD437-dependent activation of caspases is preceded by
release of cytochrome c from the mitochondria into the cytosol of
treated cells. Leakage of cytochrome c lays upstream of caspase
activation, because the phenomenon is left unaffected by pretreatment
of NB4 cells with z-VAD. Treatment of APL cells with CD437 is
associated with a caspase-dependent degradation of
promyelocytic leukemia-RAR- , which can be completely
inhibited by z-VAD.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
ACUTE PROMYELOCYTIC leukemia (APL) is a
rare disease representing approximately 10% to 15% of
all the acute myelogenous leukemias in the adult.1 APL is
associated with a typical chromosomal translocation, which results in
the synthesis of an aberrant form of the retinoic acid receptor
RAR- , known as promyelocytic leukemia (PML)-RAR-.2
PML-RAR- is thought to play a crucial role in the clonal expansion
and the differentiation block along the granulocytic pathway observed
in the APL blast.2 Paradoxically, in spite of the
derangement of the major form of RAR present in the hematopoietic system, the APL blast is exquisitely sensitive to the antiproliferative and cytodifferentiating action of all-trans retinoic acid
(ATRA).3,4 The retinoid is extremely powerful in inducing
granulocytic maturation of APL blasts in vitro.5 This
cytodifferentiating effect is also observed in vivo and explains the
efficacy of ATRA in the clinical management of
APL.3
In vitro, ATRA-dependent granulocytic maturation of APL blasts is
followed by a slow6 and relatively inefficient7
process of apoptosis or programmed cell death (PCD),* which seems to be PML-RAR-- or RAR--mediated.8 Furthermore,
ATRA-induced apoptosis is entirely dependent on granulocytic
maturation, as it is not observed in ATRA-resistant APL cell
lines9,10 and freshly isolated leukemic cells obtained from
ATRA-insensitive relapsed patients.11 These may be two
important reasons as to why ATRA alone cannot eradicate the leukemic
cells and current therapeutic protocols are based on combinations
between ATRA and chemotherapeutic agents.12,13 The long
time required for the completion of the apoptotic process set in motion
by ATRA and the relative inefficiency of this retinoid in inducing
apoptosis may be related to the fact that APL cells have prolonged cell
survival,14 which is likely to be the consequence of the
expression of the PML-RAR- protein.15 Because apoptosis
is probably the main modality by which leukemic cells are cleared from
the body following treatment with pharmacologically active agents, the
identification of new retinoid molecules inducing PCD in
PML-RAR--expressing cells could be an important goal in APL
therapy. The availability of new retinoids or combinations of retinoids
that accelerate the process of apoptosis and/or render it
granulocytic-maturation-independent would be advantageous in the
setting of the first- and second-line clinical treatment of APL.
CD437 (6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene carboxylic acid)
is a promising synthetic molecule, which seems to represent the
prototype of a new class of retinoids with strong apoptogenic properties. The compound, which was originally developed as an RAR--selective agonist,16 has recently been reported to
induce apoptosis in human mammary carcinoma,17,18
melanoma,19,20 and myeloid21 cell lines in
vitro. The spectrum of CD437 activity may not be limited to these types
of neoplasia and is likely to extend to other kinds of cancer and
leukemia.22-25 In vivo preclinical studies indicate that
the compound is well tolerated at the doses that show antitumor
activity.19 All this prompted us to investigate the in
vitro effects of CD437 on APL cells and to study the underlying mechanisms of action. In NB4 cells and primary cultures of APL blasts,
the compound is capable of inducing a granulocytic maturation- and
nuclear receptor-independent process of apoptosis. Apoptosis does not
require de novo protein synthesis and is accompanied by degradation of
PML-RAR-. The process is associated with activation of caspases, an
expanding family of cysteine proteases that play an important role in
the execution phase of PCD triggered by various stimuli.26
Activation of caspase-3 and caspase-7 seems to be of pivotal importance
in CD437-induced apoptosis, a process that can be completely blocked by
specific and cell-permeable caspase inhibitors.
| |
MATERIALS AND METHODS |
Chemicals
The RAR- agonists 6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene
carboxylic acid (CD437), CD232527 and CD2781, the pan-RAR reverse agonist CD3106 (AGN193109),28 the pan-RXR
antagonist CD3159 (LG100754),29 and the RAR- ,
antagonist CD266530 were synthesized by GALDERMA Research
and Development (Sophia Antipolis, France). ATRA was purchased from
Sigma (St Louis, MO). Stock solutions of retinoids in dimethylsulfoxide
(10 2 mol/L) were kept in aliquots at  80°C
protected from the light until use.
Cell Culture and Treatment
The NB4 cell line31 was obtained from Dr
Michel Lanotte (Unité INSERM 301, Hopital St Louis, Paris,
France), and the ATRA-resistant NB4.30632,33 cell clone was
provided by Dr Carlo Passerini-Gambacorti (Istituto Nazionale dei
Tumori di Milano, Italy). PR9 and MT8 cells were obtained from Dr Pier
Giuseppe Pelicci (Istituto Oncologico Europeo, Milano, Italy), and U937
cells were from the American Type Culture Collection (ATCC;
Rockville, MD). The cell lines were free from mycoplasma
contamination, as assessed by staining with Hoechst 33258. Freshly
isolated APL cells were obtained from the bone marrow of two APL
patient as already described34-37 following informed
consent and were characterized for the presence of the typical t(15:17)
chromosomal translocation and for the expression of the PML-RAR-
transcript. Cell lines and freshly isolated cells were cultured in the
presence of RPMI 1640 containing 10% fetal calf serum (FCS).
Cell Viability, Apoptosis, and Determination of DEVD-amc Hydrolytic
Activity
Cell viability was determined by counting the percentage of red/white
cells in Burker chambers following staining with erythrosin (Sigma).
For the determination of the apoptotic index, cells were fixed under
methanol and stained with 4'-6-diamidine-2-phenylindole (DAPI).38 Following extensive washing in phosphate-buffered saline (PBS), slides were scored in double-blind under the fluorescence microscope. The apoptotic index represents the percentage of fragmented nuclei and was determined on a microscopic field of at least 400 cells/each experimental point.
For the determination of DEVD-amc hydrolytic activity, cells (1 × 106) were resuspended in 100 µL of lysis buffer (10 mmol/L HEPES, pH 7.4; 0.1% CHAPS; 2 mmol/L EDTA; 2mmol/L
dithiothreitol [DTT]). Following determination of the protein content
by the Bradford method,39 a volume equivalent to 3 µg of
proteins (generally 1 to 3 µL) was incubated in 500 µL of reaction
buffer (20 mmol/L HEPES, pH 7.4, 10% [vol/vol] glycerol, 2 mmol/L
DTT, and 20 µmol/L DEVD-amc [Peptide Co, Osaka, Japan]) in the dark
at 37°C for 2 hours. At the end of the incubation time, reactions
were stopped by the addition of 500 µL of the same reaction buffer
without DEVD-amc. Samples were read in a Kontron
spectrophotofluorometer (Kontron Instruments, Milano, Italy) at an
excitation wavelength of 380 nm and an emission wavelength of 460 nm.40
Tdt-Mediated dUTP Nick End-Labeling (TUNEL) Assay
The TUNEL assay was performed with a commercially available kit
according to the instructions of the manufacturer (In situ cell
detection kit, Fluorescein; Boehringer Mannheim, Mannheim, Germany).
Briefly, 2 × 106 control and treated NB4 cells were
obtained, fixed in 70% ethanol/saline, washed in PBS, and resuspended
in 0.1% Triton X-100 in sodium citrate. Following incubation and
staining with the components of the kit, the cell suspension was
analyzed by flow cytometry using the FacSort system (Becton Dickinson,
Sunnyvale, CA).
DNA Fragmentation
Diphenylamine assay.
Cells (1 × 106) were centrifuged in 1.5-mL tubes at
13,000g for 2 minutes, washed with cold PBS, and lysed with 10 mmol/L Tris, pH 7.5, 1 mmol/L EDTA, and 0.2% Triton X-100. After
incubation on ice for 15 minutes, low- and high-molecular weight DNA
(DNA from apoptotic and nonapoptotic cells) was separated by
centrifugation at 13,000g at 4°C for 20 minutes.
Centrifugation-resistant, low-molecular weight DNA in the supernatant
was precipitated with 12.5% (vol/vol) trichloro acetic acid (TCA) for
18 hours,41 and pellets were resuspended in 300 µL cold
12.5% TCA. Samples were then centrifuged at 13,000g at 4°C
for 5 minutes, and DNA in the precipitates was extracted with 20 µL 5 mmol/L NaOH and 20 µL 1 mol/L perchloric acid at 70°C for 20 minutes. Subsequently, 120 µL diphenylamine reagent (Sigma) was added
and the samples were incubated at 37°C for 18 hours. From each
sample, 120 µL was transferred to flat-bottomed 96-well plates and
absorbance at 600 nm was measured on an automated plate reader
(Titertek Multiskan, Flow ICN, Milano, Italy). Fragmentation was
calculated as the percentage of total DNA (supernatant and pellet)
recovered as low-molecular weight DNA in the
supernatant.41
DNA electrophoresis.
Cells (1 × 106) were centrifuged in 1.5 mL tubes at
13,000g for 2 minutes, washed with cold PBS, and lysed in 0.5 mL hypotonic buffer (10 mmol/L Tris, pH 7.4, 1 mmol/L EDTA, 0.2%
Triton X-100) for 15 minutes on ice. Lysates were centrifuged at
13,000g at 4°C for 20 minutes. Pellets containing
high-molecular weight DNA were mixed with 0.4 mL 10 mmol/L EDTA, 50 mmol/L Tris, 0.5% N-lauryl-sarcosine, and 0.5 µg/mL proteinase K and
were incubated at 48°C for 18 hours. Centrifugation-resistant
low-molecular weight DNA was incubated with 20 µg/mL RNase at
37°C for 1 hour. Low- and high-molecular weight DNA were
extracted with phenol/chloroform (1:1, vol/vol), precipitated with 0.5 mol/L NaCl and 1 vol propanol, resuspended in water, mixed with loading
buffer (2.5% Ficoll, 0.025% bromophenol blue, and 0.025% xylene
cyanol), heated at 75°C for 5 minutes, and electrophoresed in 1%
agarose containing 1 µg/mL ethidium bromide.41
Cell Kinetics
To obtain a distinct evaluation of the cell cycle perturbations,
exponentially growing NB4 cells were treated for 15 minutes with 20 µmol/L bromodeoxyuridine (BrdU). At the end of the incubation with
BrdU, the medium was removed and cells were washed twice in PBS and
treated for various amounts of time with CD437. After treatment, the
drug-containing medium was removed, and the cells were washed twice
with PBS and fixed in 70% ethanol. For the detection of BrdU
incorporation into DNA, the fixed cells were washed with cold PBS and
the DNA was denatured with 1 mL of 2 mol/L HCl for 20 minutes at room temperature. DNA denaturation was stopped by addition
of 3 mL of 0.1 mol/L sodium tetraborate, pH 8.5. Following centrifugation, the pellet was incubated with 1 mL of 0.5%
Tween-20 (Sigma) in PBS and 1% normal goat serum (Dako, Copenhagen,
Denmark) for 15 minutes at room temperature. Incorporated BrdU was
visualized by incubation with an anti-BrdU monoclonal antibody (MoAb;
Becton Dickinson) diluted 1:10 in 0.5% Tween-20 in PBS for 1 hour at room temperature in the dark. Following centrifugation, the pellet was
incubated with 1 mL of 0.5% Tween-20 and 1% NGS for 15 minutes at
room temperature. This was followed by incubation with a fluorescent fluorescein isothiocyanate (FITC)-conjugated F(ab')2
fragment of a goat anti-mouse IgG MoAb (Jackson Immuno Research
Laboratories Inc, West Grove, PA) diluted 1:50 in 0.5% Tween-20 in PBS
for 1 hour at room temperature in the dark. The cell pellet was finally resuspended in 2 mL of a PBS solution containing 2.5 µg/mL propidium iodide and 25 µg/mL RNAse (Boehringer) and stained overnight at 4°C in the dark. Monoparametric DNA and biparametric BrdU/DNA analyses were performed on at least 20,000 cells for each sample with
the FacSort system (Becton Dickinson), and the data were analyzed with
the Cell Quest software (Becton Dickinson). The fluorescence pulses were detected using a band pass 530 ± 30 nm and
620 ± 35 nm filter for the green and red fluorescence,
respectively, in combination with a dichroic 570-nm mirror.
Intracellular Cytochrome c Redistribution
Cytosolic and mitochondrial fractions from NB4 cells were obtained
essentially as described by Pastorino et al,42 the major difference being represented by the initial homogenization buffer and
the added ultracentrifugation step at 100,000g. Briefly,
approximately 4 × 106 cells per each experimental
point were washed twice in PBS and the pellet was resuspended in 5 mL
of ice-cold buffer (20 mmol/L HEPES, pH 7.5/1.5 mmol/L
MgCl2/10 mmol/L KCl/1 mmol/L EDTA/1 mmol/L EGTA/1 mmol/L
DTT/0.1 mmol/L phenylmethylsulfonyl fluoride/10 µg/mL leupeptin,
aprotinin, and pepstatin A, 250 mmol/L sucrose). Cells were homogenized
with 30 strokes of a teflon/glass potter until disruption of the cells,
as assessed under the microscope. An aliquot of the homogenate
(approximately 5%) was kept for the determination of the total amount
of cytochrome c (cyt c) and for the determination of DEVD-amc
hydrolytic activity. The remainder of the homogenate was centrifuged at
2,500g to eliminate nuclei and cell debris. The supernatant was
centrifuged at 12,000g to sediment the microsomal fraction. The
supernatant of this centrifugation was further centrifuged at
100,000g for 1 hour to obtain the cytosolic fraction, which was
filtered through 0.2-µm Ultrafree MC filters (Millipore, Bedford,
MA). The total homogenate and the two subcellular fractions were stored
at 80°C until use.
Western Blot Analysis
For Western blot analysis, total cellular extracts from NB4
(approximately 3 × 106) were prepared at 4°C in
50 µL of suspension buffer containing 0.1 mol/L NaCl, 10 mmol/L
Tris/HCl (pH 7.6), 1 mmol/L EDTA, 1 mg/mL aprotinin, 1 mg/mL leupeptin,
2.5 mg/mL soybean trypsin inhibitor, and 100 mg/mL
phenylmethylsulfonylfluoride (all from Sigma). The cells were lysed by
adding 50 µL of lysis buffer containing 100 mmol/L Tris/HCl (pH 6.8),
200 mmol/L dithiothreitol, 4% sodium dodecyl sulfate (SDS), 0.2%
bromophenol blue, and 20% glycerol. Samples were then boiled for 10 minutes, sonicated, and centrifuged. Aliquots of the supernatants were
fractionated by electrophoresis on 10% SDS acrylamide gel and
electrotransferred to nitrocellulose membranes, blocked with 5% nonfat
powdered milk in TBS-T (20 mmol/L Tris/HCl [pH 7.6], 137 mmol/L NaCl,
0.1% Tween-20) and then incubated for 2 hours at 37°C with
commercially available rabbit polyclonal antibodies recognizing
caspase-1 (ICE p10 [C-20], raised against a peptide corresponding to
the carboxyl terminus of the caspase-1 precursor of human origin; cat
no. sc-515), caspase-2 (ICH-1S/L[H-19], raised against a
peptide corresponding to the amino terminus of the caspase-2 precursor
of human origin; cat no. sc-623), caspase-3 (CPP32 p20 [N-19], raised
against a peptide corresponding to the amino terminus of the p20
subunit of the caspase-3 precursor of human origin; cat no. sc-1226),
caspase-4 (TX p20 [N-15], raised against a peptide corresponding to
amino acids 95-109 mapping at the amino terminus of the
p20 subunit of the caspase-4 precursor of human origin; cat no.
sc-1229), caspase-10 (Mch4 p20 [C-16], raised against a peptide
corresponding to the carboxyl terminus of the caspase-10 precursor of
human origin; cat no. sc-6185), poly ADP ribose polymerase (PARP; PARP
[N-20], raised against a peptide corresponding to amino acids 1-20 of
the amino terminus of the protein of human origin; cat no. sc-1561;
Santa Cruz Biotechnology, Santa Cruz, CA), and caspase-7 (generated by
immunizing rabbits with the synthetic peptide KPDRSSFVPSLFSKKKKN,
corresponding to the amino terminal portion of the putative p20 subunit
of caspase-7)43 (a kind gift of Dr Marta Muzio, Istituto di
Ricerche Farmacologiche Mario Negri, Milano). Following extensive
washing with TBS-T, the blots were incubated for 90 minutes with
peroxidase-conjugated goat anti-rabbit IgG. After a brief rinsing with
TBS-T, immunoreactive protein bands were visualized with a
chemiluminescence-based procedure using the ECL detection kit
(Amersham, Little Chalfont, UK) according to the instructions of the manufacturer.
Polymerase Chain Reaction (PCR)
Total RNA was extracted from NB4 cells as already
described.34-37 Single-strand DNA was synthesized from 1 µg of total RNA with reverse transcriptase (RT) and PCR amplified
using couples of amplimers specific for the various caspase isoenzymes
and for actin using a commercially available kit (Perkin Elmer,
Norwalk, CT). The following amplimers were used: pro-caspase-1
(GenBank acc. No. X65019)
5'GGGTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCG3' (nucleotide
596-634), 5'GCCCATTGTGGGATGTCTCCAAGAA3' (complementary to
nucleotide 1021-1045); pro-caspase-2 (GenBank acc. no. U13022), 5'GTGCACTTCACTGGAGAGAAA3' (nucleotide 617-637),
5'GGGCAGTCTCATCTTCGGCAA3' (complementary to nucleotide
1113-1133); pro-caspase-3 (GenBank acc. no. U13737),
5'AAGGTATCCATGGAGAACACTGAAAAC3' (nucleotide 216-242),
5'AACCACCAACCAACCATTTCT3' (complementary to nucleotide 1059-1079); pro-caspase-4 (GenBank acc. no. U28014),
5'CAGAGCACAAGTCCTCTGACA3' (nucleotide 621-641),
5'AGGGCTGGGCTGCTTGTG3' (complementary to nucleotide
1182-1199); pro-caspase-6 (GenBank acc. no. U20536), 5'CCGGCAGGTGGGGAAGAAAA3' (nucleotide 112-131),
5'TGCAACAGAGTAACACATGAGGAAGTC3' (complementary to
nucleotide 691-717); pro-caspase-7 (GenBank acc. no. U37449),
5'GGGCTGTATTGAAGAGCAGC3' (nucleotide 161-179), 5'GATCTGCATGATTTCCAGGT3' (complementary to nucleotide
877-895); pro-caspase-8 (GenBank acc. no. U60520),
5'TAAACACTAGAAAGGAGGAGATGGAAAGGGAACT3' (nucleotide
492-525), 5'CATGGGAGAGGATACAGCAGATGAAGCA3' (complementary to nucleotide 1232-1259); pro-caspase-10 (GenBank acc. no. U60519), 5'ATGGGAGATTTGGAGCTGTC3' (nucleotide 1091-1110),
5'TTAGTGTGAAAGCAGGCTGG3' (complementary to nucleotide
1511-1530); -actin,44
5'GCGCTCGTCGTCGACAACGG3' (nucleotide 60-79),
5'GATAGCAACGTACATGGCTG3' (complementary to nucleotide
430-449). These amplimers have already been described by Martins et
al,45 and their use results in specific amplification products. PCR reactions were initiated under hot start conditions and
continued for a total of 30 cycles under step-cycle conditions on
Perkin-Elmer 9600 DNA thermal cycler using 95°C (45 seconds) for
denaturation, 54°C (45 seconds) for annealing, and 72°C (60 seconds) for extension. At the end of the reaction one tenth of the
sample was run on a 1.2% agarose gel and stained with ethidium bromide.
| |
RESULTS |
The Synthetic Retinoid CD437 Is Apoptogenic in NB4 Cells and Causes
Rapid Activation of a Caspase-Like Activity
Treatment of the APL-derived NB4 cell line for 16 hours with CD437
(106 mol/L)16 results in the appearance
of a large number of cells presenting typical signs of apoptosis or
PCD, upon May-Grunwald-Giemsa staining (data not shown). The morphology
of NB4 apoptotic cells includes membrane blebbing, cytoplasmic
shrinking, and nuclear fragmentation. This last feature is highlighted
by staining with the fluorogenic substrate DAPI and by flow cytometric
analysis, following application of the TUNEL assay46
(Fig 1A). In the experiment presented, the
TUNEL assay shows that CD437 increases, by approximately threefold
(41% v 13%), the number of cells showing signs of DNA
fragmentation. Agarose gel electrophoresis of DNA isolated from NB4
cells treated with CD437 shows the typical internucleosomal fragmentation ladder observed during apoptosis (Fig 1B). The level of
DNA fragmentation caused by CD437 is of the same order of magnitude as
that observed after treatment with staurosporine, a classical and
robust apoptogenic stimulus.
View larger version (64K):
[in this window]
[in a new window]
| Fig 1.
Apoptotic effects of CD437 on NB4 cells. NB4 cells
(200,000/mL) were treated with vehicle alone (DMSO, Control), CD437
(106 mol/L), or Staurosporine (Stauro,
106 mol/L) for 16 hours. (A) Fluorescence
microphotographs of DAPI-stained cells (original magnification × 40)
are shown in the top two panels. The bottom panels show flow cytometric
TUNEL analyses with forward scatter on the horizontal axis and
fluorescence intensity on the vertical axis. The percentage of
apoptotic, necrotic, and viable cells is indicated on the top-right,
bottom-left, and bottom-right, respectively. (B) Intranucleosomal DNA
fragmentation, as assessed by agarose gel electrophoresis. LMW,
centrifugation-resistant low-molecular weight DNA; HMW,
high-molecular weight DNA.
|
|
To investigate whether CD437 has any effect on the cell cycle and
whether apoptosis is phase-specific, we pulse-labeled NB4 cells with
BrdU, a pyrimidine analog that is incorporated into DNA
(Fig 2). In control conditions,
approximately 60% of the cells are in S-phase and become labeled with
BrdU. The length of the NB4 cell cycle is approximately 18 hours, as
calculated by the time intervening between two successive S-phases. The
number and the proportion of BrdU-labeled cells does not significantly
change within the time frame of our experiment. Treatment of cells with CD437 for 3 hours is associated with a lower percentage of
BrdU-positive cells (approximately 40%), suggesting early death of a
proprtion of cells in the S-phase of the cycle. At the same time point, CD437 causes the appearance of a detectable proportion (22%) of BrdU-labeled cells with a hypodiploid content of DNA (presumably apoptotic cells). At 6 and 18 hours, the percentage of BrdU-positive and hypodiploid cells has increased to 26% and 46%, respectively. By
18 hours, the BrdU-negative cells and the remaining BrdU-positive cells
are blocked in G1 or are hypodiploid. Taken together, the results
suggest that NB4 cells in the S-phase of the cycle are the ones that
are most susceptible to the apoptogenic effects of CD437.
View larger version (29K):
[in this window]
[in a new window]
| Fig 2.
NB4 cell kinetics following treatment with CD437. NB4
cells were seeded at 200,000/mL in RPMI 1640 containing 10% FCS,
allowed to enter the exponential phase of growth by incubation for 12 hours in the same medium. Subsequently cells were pulse-labeled with
BrdU for 15 minutes as described in Materials and Methods before
incubation with vehicle (DMSO), alone (Control), or with
106 mol/L CD437 for the indicated amount of time. Cells
were analyzed for the content of DNA following staining with propidium
iodide (horizontal axis) or for the amount of BrdU incorporated into
DNA (vertical axis) by flow cytometry. Numbers below each panel
indicate the percentage of BrdU-positive cells.
|
|
PCD is the major mechanism by which CD437 causes cell demise
(Fig 3A). In fact, before undergoing death,
the majority of the cells in culture (approximately 80% at 15 hours)
present signs of nuclear fragmentation and apoptosis. Cells showing
clear signs of nuclear fragmentation by DAPI staining start to be
evident following 2 hours of treatment and reach a plateau at 15 hours. This is followed by a progressive decrease in the number of viable cells that completely disappear from the culture by 48 hours. The
concentration curve for the apoptogenic effects of CD437 is shown in
Fig 3B, along with the effects of the retinoid on the percentage of
viable cells in culture. Following 16 hours of treatment, CD437 is
maximally apoptogenic at 106 mol/L with a calculated
EC50 of approximately 3 × 10-7 mol/L.
Apoptosis is accompanied by activation of caspases, as assessed by an
increase in DEVD-amc hydrolytic activity (Fig 3C), whereas YVAD-amc
hydrolytic activity is barely detectable in untreated NB4 cells and is
left unaffected by CD437 (data not shown). Considering that DEVD is a
relatively specific substrate for caspase-3-like proteases (caspase-2,
caspase-3, caspase-6, and caspase-7), whereas YVAD is recognized
predominantly by caspase-1,47 our data indicate that CD437
activates the first type of proteolytic enzymes. The time course of
caspase activation parallels that of DNA fragmentation, although a
dramatic drop in DEVD-amc hydrolytic activity caused by cell
distruction is observed between 30 and 48 hours of treatment. The
EC50 of CD437 for the increase in DEVD-amc hydrolytic
activity in NB4 cell extracts (Fig 3D) is very similar to that causing a 50% reduction in cell viability and half-maximal increase in the
number of apoptotic cells. Taken together, our data indicate that
CD437-dependent apoptosis, loss of cell viability, and caspase activation are three strictly related processes.
View larger version (26K):
[in this window]
[in a new window]
| Fig 3.
Effects of CD437 on NB4 cell viability, apoptosis, and
DEVD-amc hydrolytic activity. (A) NB4 cells (300,000/mL) were
treated for the indicated amount of time with vehicle (DMSO, open
symbols) or with 106 mol/L CD437 (solid symbols).
Circles indicate the percentage of viable cells (erythrosin staining),
whereas triangles indicate the percentage of apoptotic cells (DAPI
staining). (B) NB4 cells (300,000/mL) were treated for 16 hours with
the indicated concentration of CD437. Solid circles indicate the
percentage of viable cells, whereas open circles indicate the
percentage of apoptotic cells. (C and D) Extracts from the cells of the
experiments presented in (A) and (B), respectively, were assayed for
DEVD-amc hydrolytic activity. Open circles represent extracts from
vehicle-treated cells, whereas solid circles represent CD437-treated
cells. Results are the mean ± SD of three separate culture dishes.
|
|
The Apoptogenic Effects of CD437 Are Independent of Retinoic Acid
Sensitivity
The apoptogenic effects of CD437 are independent of cell sensitivity to
ATRA (Fig 4). After 10 hours of treatment
at a concentration of 106 mol/L, the retinoid causes
similar levels of nuclear fragmentation and apoptosis in both NB4 cells
and the ATRA-resistant NB4.306 cell line.32 Consistent with
the results in Fig 3, at this early time point, there is only a slight
decrease in cell viability; however, at later time points the kinetics
of cell demise in the two cell lines are similar (data not shown). Even
in the case of NB4.306 cells, CD437-induced apoptosis is associated
with the appearance of DEVD-amc but not YVAD-amc hydrolytic activity
(data not shown). This suggests that the effector phase of the
apoptotic process triggered by CD437 in both NB4 and NB4.306 cells is
likely to be regulated by the same type of caspase isoenzymes. This is supported by the fact that the two cell lines express the same complement of caspases in basal conditions (see Fig 7 and
data not shown).
View larger version (18K):
[in this window]
[in a new window]
| Fig 4.
Effects of CD437 on viability, DNA fragmentation, and
DEVD-amc hydrolytic activity in the ATRA-resistant NB4.306 cell line.
NB4 or NB4.306 cells (300,000/mL) were treated for 10 hours with
vehicle (DMSO, Control) or with 106 mol/L CD437. At the
end of the treatment cells were obtained and processed for analysis.
White columns indicate the number of viable cells (erythrosin
staining), black columns indicate the amount of fragmented DNA
(diphenylamine assay), and shaded columns indicate DEVD-amc
hydrolytic activity. Results are the mean ± SD of three separate
culture dishes.
|
|
CD437 Induces Caspase Activity and Cell Death in Freshly Isolated APL
Cells
To support the significance of the results obtained in the NB4 model,
we evaluated the ability of CD437 to cause in vitro cell death and to
induce activation of caspases in freshly isolated blasts obtained from
two APL patients representing a newly diagnosed case (patient 1) and an
ATRA-resistant relapsed case (patient 2;
Table 1). In both cultures, exposure of
blasts to CD437 (106 mol/L) for 16 hours does not
result in a significant decrease in the number of viable cells relative
to control conditions. Following 68 hours, treatment of blasts from
patient 1 with the retinoid results in a remarkable decrease in the
number of viable cells. A similar effect is also observed in blasts
from patient 2, although, in this case, it is necessary to slightly
protract the exposure time to CD437 to observe a significant diminution in the number of viable cells. Noticeably, exposure of cells from patient 2 to ATRA (106 mol/L) for the same amount of
time has no effect on the number of cells or viability relative to
control conditions (data not shown). In patient 1, an increase in
DEVD-amc hydrolytic activity is evident 68 hours after challenge with
CD437, whereas in patient 2, caspase activation is already observed at
16 hours and is maintained, albeit at slightly lower levels at least
until 60 hours (fluorescence arbitrary units: CD437 = 6.2 ± 0.2, control = 2.5 ± 0.7; mean ± SD of three replicates), decreasing
to almost background levels by 84 hours (Table 1). Although we could
not get a quantitative assessment of the degree of nuclear
fragmentation in the blasts from patient 1, we performed a TUNEL assay
on the cells obtained from patient 2 (Fig
5). Following 60 hours of treatment, CD437 causes a significant increase in the percentage of TUNEL positive blasts relative to what is observed in blasts maintained in medium containing vehicle alone (68% v 36%). Taken together, the
results show that primary cultures of APL blasts are responsive to
CD437 regardless of their in vivo sensitivity to ATRA. Furthermore, our
data are consistent with the fact that a bona fide process of apoptosis
is responsible for at least part of the cytocidal effect of CD437 in
cultures of freshly isolated APL cells. Finally, relative to what is
observed for NB4 blasts, the longer exposure time necessary to cause
cell demise in primary cultures of APL promyelocytes is probably due to
the very low proliferation rate typical of these cells in standard
culture conditions.
View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
CD437-dependent apoptosis in primary cultures of freshly
isolated APL blasts, as assessed by the TUNEL assay. Freshly isolated
APL blasts (300,000/mL) from patient 2 (Table 1) were treated with
vehicle (DMSO), alone (Control; A and B), or with CD437
(106 mol/L; C) for 60 hours. The panels show flow
cytometric TUNEL analyses with forward scatter on the horizontal axis
and fluorescence intensity on the vertical axis. (A) Negative control
for the TUNEL assay, showing the level of background fluorescence in
samples treated with fluorescent dUTP in the absence of TdT. The
results shown were obtained on an aliquot of the control culture, but
similar results were obtained on an aliquot of the CD437 culture (not
shown). The percentage of apoptotic, necrotic, and viable cells is
indicated on the top-right, bottom-left, and bottom-right,
respectively.
|
|
Apoptosis and Induction of Caspase Activity by CD437 Are
Receptor-Independent Events and Do Not Require De Novo Protein
Synthesis
To verify whether the strong apoptogenic activity of CD437 is a
peculiarity of this compound or is a feature observed in other RAR--selective agonists, the effect of this retinoid on NB4 cells was compared with that of CD2325 and CD2781
(Table 2). These two selective RAR-
agonists were chosen because the affinity of CD2325 and CD2781 for
RAR- (Ki of 53 nmol/L and 76 nmol/L, respectively) is
not different from that of CD437 (77 nmol/L). In addition, the
transactivation potential of the three compounds on RAR- is similar
(EC50: CD437, 7 nmol/L; CD2325, 12 nmol/L; CD2781, 20 nmol/L). When cells were treated for 16 hours at a concentration of
106 mol/L, CD437 is more apoptogenic than CD2325,
whereas CD2781 does not cause any sign of apoptosis, at this
concentration or at any of the concentrations tested (Table 2 and data
not shown). Thus, apoptosis is not related to the binding affinity or
transactivation potential of the three compounds for RAR-. The
degree of apoptosis triggered by CD437 and CD2325 is quantitatively
correlated with the level of induction of DEVD-amc hydrolytic activity.
This indicates that caspase activation is fundamental for the
apoptogenic activity of both CD437 and CD2325.
Although CD437, CD2325, and CD2781 are selective agonists of RAR-,
they show residual transactivating activity in the presence of RAR-
and RAR-. In addition, binding of the three compounds to RXRs has
not been studied in detail. Thus, it is possible that the apoptogenic
activity of CD437 is mediated by activation of any of these retinoic
acid receptors. However, the effects of CD437 on NB4 cells are not due
to activation of RARs or RXRs (Table 3). In
fact, challenge of the promyelocytic blasts with the pan-RAR reverse
agonist CD3106, the RAR-, selective antagonist CD2665, or the RXR
antagonist CD3159 has no effect on the level of nuclear fragmentation
and caspase activation observed following treatment of NB4 cells with
CD437 for 6 hours. At the 10:1 molar ratio of antagonist/agonist used,
CD3106, CD2665, and CD3159 readily block the transactivation of
RAR-, RAR-, and RXR- by their respective agonists AM580,
CD437, and 9-cis retinoic acid in transient transfection assays
performed in COS-7 cells using appropriate reporter constructs (data
not shown). Furthermore, the pan-RAR antagonist CD3106 completely blunts the cytodifferentiating and growth inhibitory effects of AM580
or ATRA in NB4 cells (E.G., unpublished results, January 1998).
In various biological systems, the process of apoptosis requires de
novo protein synthesis and is blocked by protein synthesis inhibitors,
such as cycloheximide (CHX). In addition, in melanoma cells,19 CD437 has been shown to increase the AP1
transcriptional complex, which can trigger apoptosis in certain
conditions. On the other hand, drug-induced apoptosis has been reported
to occur in the presence of protein synthesis
inhibitors.48,49 For all these reasons, we tested the
effects of CHX on CD437-dependent PCD in NB4 cells
(Table 4). In our experimental conditions,
CHX inhibits protein synthesis by more than 90% and is not toxic. Pretreatment of cells for 2 hours with CHX before addition of CD437 has
only minimal effects on the number of apoptotic cells present in the
culture following 6 hours of treatment with the retinoid. Similarly,
the protein synthesis inhibitor does not affect the level of caspase
activation observed in the presence of CD437. These data indicate that
de novo protein synthesis is not necessary to produce caspase
activation and subsequent apoptosis.
Inhibition of Caspases Blocks CD437-Induced Apoptosis
As CD437 causes a rapid increase in DEVD-amc hydrolytic activity, we
investigated the effects of Z-Val-Ala-DL-Asp-fluoromethylketone (z-VAD), a general inhibitor of caspases, on CD437-induced apoptosis in
NB4 cells (Fig 6A). At the two
concentrations used (50 and 100 µmol/L), challenge of NB4 blasts for
6 hours with z-VAD alone does not change the number of cells showing
signs of apoptosis. However, the caspase inhibitor completely blunts
the appearance of apoptotic cells following treatment with CD437.
Suppression of the apoptotic process is the consequence of specific
caspase inhibition, as shown by the Western blot experiment conducted with antibodies recognizing PARP, a substrate protein specific for
various caspase isoenzymes (Fig 6B). PARP is rapidly cleaved by CD437
into two fragments of approximately 80 and 30 kD (only the latter
fragment is evident in our blot, as the 80-kD proteolytic fragment of
PARP is masked by a nonspecific band). Cotreatment with CD437 and z-VAD
results in a dose-dependent decrease in the amount of the 30-kD
proteolytic fragment. The CD437-dependent cleavage of PARP is also
partially blocked by the inhibitor of caspase-3-like enzymes,
DEVD-cho, whereas it is left totally unaffected by the caspase-1
inhibitor YVAD-cho (data not shown). This further supports the concept
that CD437 causes activation of caspase-3 and/or
caspase-3-like proteolytic activity.
View larger version (44K):
[in this window]
[in a new window]
| Fig 6.
Inhibition of apoptosis and PARP cleavage by the caspase
inhibitor z-VAD in NB4 cells. NB4 cells (300,000/mL) were treated for 6 hours with vehicle (DMSO, Control) or with 106 mol/L
CD437 following pretreatment for 2 hours in the presence or absence of
the indicated concentration of z-VAD. (A) Dashed columns indicate the
percentage of viable cells (erythrosin staining), whereas solid columns
indicate the percentage of apoptotic cells (DAPI staining). Results are
the mean ± SD of three separate culture dishes. (B) Extracts from
cells treated as in (A) were subjected to Western blot analysis using
an anti-PARP-specific antibody. Filters were reprobed with actin to
ensure that similar amounts of protein were loaded in each lane.
Arrowheads on the right indicate the position of the PARP intact
protein and one of its proteolytic fragments. The molecular weight of
protein standards is indicated on the left. The results were replicated
in a separate experiment.
|
|
CD437 Causes Degradation of Various Types of Caspase Precursors
To gain insight into the type(s) of caspase responsible for the
elevation of DEVD-amc hydrolytic activity in NB4 cell extracts treated
with CD437, we first studied the profile of expression of the mRNAs
coding for 8 of the 11 known members of the caspase family by RT-PCR.
Undifferentiated NB4 cells express transcripts coding for all the
members of the caspase family taken into consideration (Fig 7A). The amounts of caspase mRNAs are
left unaffected by treatment with CD437 for 6 hours (data not shown).
Expression at the mRNA level is generally accompanied by synthesis of
the respective precursor protein, as assessed by Western blot analysis performed with available antibodies (Fig 7B). Treatment of NB4 cells
with CD437 (106 mol/L) for 2 hours results in the
prompt disappearance of pro-caspase-1 and in a dramatic reduction in
the levels of pro-caspase-7, whereas the kinetics of degradation of
pro-caspase-3 is relatively slower. Although a slight degradation of
pro-caspase-2 is observed in the experiment presented, in most
experiments, the effect is barely detectable and of minor significance.
The amounts of pro-caspase-4 and -10 are not affected by CD437
challenge.
View larger version (57K):
[in this window]
[in a new window]
View larger version (62K):
[in this window]
[in a new window]
| Fig 7.
Expression of caspase mRNA and proteins in untreated and
CD437-treated NB4 cells. NB4 cells (300,000/mL) were grown in basal
conditions (A) and treated for the indicated amount of time (B) with
vehicle (DMSO, Control) or with 106 mol/L CD437. (A)
One microgram of total RNA was reverse transcribed and
PCR amplified with couple of amplimers specific for the indicated
caspase cDNAs or for actin cDNA. One tenth of the PCR reaction mixture
was run on a 1.2% agarose gel stained with ethidium bromide.
Appropriate blanks reverse transcribed in the absence of RNA (no RNA)
were set up for each RT-PCR reaction; only the blank corresponding to
actin is shown. The molecular weight of DNA standards is indicated on
the left. (B) Aliquots of the NB4 homogenates containing an equivalent
amount of protein were subjected to Western blot analysis with
antibodies specific for the indicated caspases or for actin. The
molecular weight of protein standards is indicated on the left. The
data are representative of those obtained in three separate
experiments.
|
|
Activation of caspases is accompanied by the appearance of two specific
proteolytic bands corresponding to the large and small subunit of the
catalitically active enzyme.47,50 The process is blocked by
caspase inhibitors, as cleavage of individual caspases is an
autocatalytic process or is triggered by other members of the caspase
family in a cascade fashion.47,50 To establish whether
CD437-dependent degradation of pro-caspase-3 and pro-caspase-7 is
accompanied by activation of the two enzymes, we performed the Western
blot experiments presented in Fig 8. The
data obtained confirm that treatment of NB4 cells with CD437 for 6 hours results in the degradation of pro-caspase-3. Although z-VAD
pretreatment does not have any effect on the basal level of the
precursor protein, the compound dose-dependently inhibits degradation
of pro-caspase-3. However, in our experimental conditions, we were not
able to document the presence of specific caspase-3 proteolytic
fragments (data not shown). This may be related to the particular type
of antibody used in our experiments or to the very short half-life of
the activated form of caspase-3 in NB4 cells. In the case of caspase-7, CD437 treatment of NB4 cells results in the appearance of two bands
whose apparent molecular weight is consistent with the large and small
subunits of the active enzymatic form. In addition, pretretreatment of
NB4 cells with z-VAD results in the disappearance of the two
degradation bands.
View larger version (25K):
[in this window]
[in a new window]
| Fig 8.
Effect of the caspase inhibitor z-VAD on the degradation
of caspase-3 and caspase-7 in CD437-treated NB4 cells. NB4 cells
(300,000/mL) were treated for 6 hours with vehicle (DMSO, Control) and
with 106 mol/L CD437 following 2 hours preincubation in
the absence or in the presence of the indicated concentration of z-VAD.
Aliquots of the NB4 homogenates containing an equivalent amount of
protein were subjected to Western blot analysis with antibodies
specific for caspase-3, caspase-7, and for actin. Solid arrows indicate
the position of the band corresponding to pro-caspase-3 and
pro-caspase-7, whereas broken arrows indicate the bands corresponding
to the large and small subunit of activated caspase-7. The molecular
weight of protein standards is indicated on the left. The results were
replicated in a separate experiment.
|
|
Taken together the data indicate that caspase-3 and caspase-7 are
activated upon treatment of NB4 cells with CD437. In addition, they
suggest that the two enzyme are responsible for the appearance of
DEVD-amc hydrolytic activity observed upon treatment with CD437. In
fact, DEVD-amc is a good substrate for caspase-3 and caspase-7, but a
poor substrate for caspase-1.
CD437 Induces Release of Cytochrome c From the Mitochondria Into the
Cytosol: The Phenomenon Accompanies Caspase Activation and Is
Caspase-Independent
Activation of caspases can be triggered by different types of
mechanisms, which are dependent on the type of apoptotic stimulus considered.50 Release of cyt c from the mitochondria into
the cytosol results in activation of caspases and
apoptosis.51,52 Thus, the subcellular localization of this
protein was investigated in NB4 cells grown for various amounts of time
in the absence or presence of CD437
(Fig 9A). The total
intracellular pool of cyt c observed in control conditions is left
unaffected by CD437, as assessed by Western blot analysis of
unfractionated NB4 cell extracts. Only trace amounts of cyt c (visible
on longer exposures of the films) are present in the cytoplasm of cells
grown in control conditions, and these background levels are probably
due to leakage from the mitochondria during the process of subcellular
fractionation. Treatment of NB4 promyelocytes with CD437 results in a
significant increase in the levels of cytoplasmic cyt c. Release into
the cytoplasm is accompanied by a decrease in the amount of cyt c associated with the mitochondria, which is consistent with a
redistribution of the protein in the two intracellular compartments.
The redistribution of cyt c from the mitochondria to the cytoplasm is a
relatively rapid event, being observed already following 2 hours of
challenge with the retinoid and gradually increasing thereafter. The
phenomenon accompanies the increase in DEVD-amc hydrolytic activity,
and it is of the same order of magnitude as that observed in the
presence of apoptogenic concentrations of staurosporine. To examine
whether cyt c release from the mitochondria is affected by caspases, we evaluated the effects of z-VAD on the process (Fig 9B). Until 6 hours
of treatment, z-VAD has no effect on the intracellular levels of cyt c
observed in the absence or in the presence of CD437. In addition, the
caspase inhibitor does not significantly affect the redistribution of
cyt c into the cytosol observed in the presence of the retinoid. These
data indicate that the leakage of cyt c from the mitochondria is
independent of caspase activation.
View larger version (43K):
[in this window]
[in a new window]
View larger version (28K):
[in this window]
[in a new window]
| Fig 9.
Intracellular redistribution of cyt c in NB4
cells following treatment with CD437. (A) NB4 cells (300,000/mL) were
treated for the indicated amount of time with vehicle (DMSO, Control)
and with 106 mol/L CD437. Following harvesting and
homogenization, a small aliquot of the homogenate was directly
processed for Western blot analysis (total) and for the determination
of DEVD-amc hydrolytic activity. The remaining amount of homogenate was
subjected to differential ultracentrifugation to separate the
mitochondrial fraction (Mit.) from the cytosol before Western blot
analysis. Aliquots of the various fractions containing an equivalent
amount of protein (30 µg) were subjected to Western blot analysis
with antibodies specific for cyt c and actin. The molecular weight of
protein standards is indicated on the right. The values of DEVD-amc
hydrolytic activity are the mean ± SD of three replicates of the same
homogenate. (B) NB4 cells (300,000/mL) were treated for 6 hours with
vehicle (DMSO, Control) and with 106 mol/L CD437
following 2 hours preincubation in the absence or in the presence of
z-VAD (100 µmol/L). Aliquots of the NB4 homogenates (total) or the
cytosol fraction as in (A) containing an equivalent amount of protein
were subjected to Western blot analysis with antibodies specific for
cyt c and for actin. The molecular weight of protein standards is
indicated on the right. The experiments are representative of at least
four other experiments giving essentially the same results.
|
|
PML-RAR- Is Degraded by CD437 and Degradation Is Blocked by
the Caspase Inhibitor z-VAD
The APL-specific oncogene PML-RAR- has antiapoptotic
activity,14,15 and it has been proposed that the
proteasome-dependent degradation of the protein observed following
treatment of APL cells with retinoic acid53 and
arsenic54,55 may be important for the clinical activity of
the two compounds. Because the levels of PML-RAR- may also be
critical in the process of apoptosis triggered by CD437, we were
prompted to examine the effects of the retinoid on the protein in the
NB4 cell line. Challenge of cells with CD437 for 6 and 21 hours results
in the degradation of PML-RAR- and to a lesser extent of RAR- as
well (Fig 10A). The effect is relatively
specific, because the levels of actin are left unaltered by the
retinoid. PML-RAR- and RAR- degradation is blocked by
pretreatment with z-VAD (Fig 10B). This indicates that caspases are
directly or indirectly responsible for the proteolytic cleavage of the
two receptors.
View larger version (41K):
[in this window]
[in a new window]
View larger version (41K):
[in this window]
[in a new window]
View larger version (34K):
[in this window]
[in a new window]
| Fig 10.
Degradation of PML-RAR- by CD437 in PR9 and NB4
cells. (A) NB4 cells (300,000/mL) were treated for the indicated amount
of time with vehicle (DMSO, Control) or with 106 mol/L
CD437. (B) NB4 cells (300,000/mL) were treated for 6 hours with vehicle
(DMSO, Control) or with 106 mol/L CD437 following
pretreatment for 2 hours in the absence or presence of z-VAD (100 µmol/L). (C) U937, PR9, and MT8 cells (300,000/mL) were treated for
16 hours with vehicle (DMSO, Control) or with 106 mol/L
CD437 in the presence or absence of zinc sulfate (Zn, 100 µmol/L) as
indicated. The percentage of cells showing nuclear fragmentation upon
staining with DAPI was scored on parallel cultures. Each value
represents the mean ± SD of three replicate cultures. ND, not
determined. For Western blot analysis, cells were obtained,
homogenized, and aliquots of the homogenate containing an equivalent
amount of protein were subjected to polyacrylamide gel electrophoresis,
electrotransfer to nitrocellulose membranes, and incubation with
antibodies recognizing human RAR- and human actin (A).
Alternatively, blots were sequentially probed with the two antibodies
(B and C). The molecular weight of protein standards is indicated on
the left. The results were replicated in a separate experiment.
|
|
To support the data obtained in NB4 cells in a different model of
PML-RAR- expression, we evaluated degradation of the protein in PR9
cells. This is a U937-derived clone stably transfected with an
inducible form of the PML-RAR- cDNA,14 which expresses elevated amounts of the protein upon induction with zinc sulfate (Zn).
As expected, whereas the parental cell line U937 and the MT8 clone
(stably transfected with the empty vector) do not express the protein
upon treatment with Zn, treatment of PR9 with appropriate concentrations of the metal ion results in the synthesis of
PML-RAR-, which can be easily detected under the form of a 110-kD
protein by Western blot analysis (Fig 10C). Challenge of PR9 cells with Zn and CD437 (106 mol/L), for 16 hours, results in a
dramatic reduction in the levels of the PML-RAR- protein, which is
the consequence of a progressive degradation of the oncogene product,
as the levels of the respective transcript do not change significantly
in the same experimental conditions (data not shown). Similarly to what observed in NB4 cells, PML-RAR- degradation in PR9 blasts is accompanied by a remarkable elevation in DEVD-amc-hydrolyzing activity
(fluorescence arbitrary units: 45 ± 7 in CD437 + Zn-treated cells
v 10 ± 2 in cells treated with Zn alone) and by the
appearance of a significant number of cells showing signs of nuclear
fragmentation and apoptosis (Fig 10C).
Taken together the results obtained in NB4 and PR9 cells indicate that
CD437-dependent caspase activation, apoptosis, and PML-RAR-
degradation are three strictly related phenomena, regardless of the
cellular context taken into consideration.
| |
DISCUSSION |
In this article, we report on the apoptogenic effects, in APL cells, of
CD437, a new retinoid originally developed as a selective RAR-
agonist16 and characterized by promising in vitro and in
vivo antitumor activity in human and mouse experimental
models.19 The compound is devoid of cytodifferentiating
activity,36 yet is capable of inducing apoptosis in both
ATRA-sensitive and ATRA-resistant APL cells, as shown in the NB4 and
NB4.306 models and confirmed in primary cultures of APL blasts. The
apoptogenic activity of CD437 in APL cells is not related to the
ability of the retinoid to interact with RAR- or any of the other
retinoic acid receptors belonging to the family of RARs or RXRs. In
fact, the RAR- mRNA is not expressed at detectable levels in NB4
cells, as assessed by the Northern blot technique.56
Furthermore, CD2871, another RAR- agonist with binding and
trans-activating activity for the receptor similar to that of CD437, is
completely incapable of inducing apoptosis in NB4 cells. Finally,
specific pan-RAR; RAR-,; and pan-RXR antagonists or reverse
agonists do not inhibit CD437-dependent apoptosis.
CD437-induced apoptosis is mediated by caspases, a growing family of
proteases involved in the effector phase of various types of
PCD.47,50 In fact, CD437 induces caspase activity and
caspase inhibitors delay the process. A DEVD-amc caspase-type
hydrolytic activity is rapidly increased by the retinoid, and the
cell-permeable caspase inhibitor z-VAD affords complete protection from
CD437-induced NB4 apoptosis. Caspases are enzymes normally present in
various cell types under the form of inactive precursor proteins that need to be activated by specific proteolytic
cleavage.26,47,50 Often, individual caspases are activated
by other members of the caspase family in a cascade fashion. Although
NB4 cells express the precursors for at least 6 of the 11 known caspase
isoforms, activation of a few selected caspase isoenzymes is likely to
be of paramount importance for the appearance of DEVD-amc hydrolytic activity in NB4 cell extracts. First, following treatment with CD437,
the levels of the precursors for caspase-4 and caspase-10 are left
unaltered. Second, though caspase-1 is the first caspase to disappear
from the cytosol of CD437-treated cells, degradation is not associated
with activation of the enzyme. In fact, CD437 does not cause the
appearance of YVAD-amc hydrolytic activity, which would be expected in
case of caspase-1 activation, as the fluorogenic tetrapeptide is a good
substrate for the protein.47 At present we cannot rule out
a role for caspase-2, although degradation of this enzyme is not
dramatic and is just appreaciable in some experiments. By contrast,
degradation of the caspase-7 and the caspase-3 precursors is likely to
be associated with activation of the two enzymes. The active forms of
these two proteases are probably responsible for the appearance of
DEVD-amc hydrolytic activity in the cytosol of CD437-treated NB4 cells.
In addition, activation of caspase-3 and caspase-7 is likely to be
important for the effector phase of the apoptotic process triggered by
CD437, since these two isoenzymes, as well as caspase-6, have been
implicated in other types of drug-induced apoptosis in leukemia
cell.45,57-59 Proteolytic cleavage and activation of
caspase-3 and caspase-7 are either the consequence of an autocatalytic
process or are the result of the activity of another caspase. As
caspase-3 and caspase-7 can cleave each other, it would be important to
establish the order of activation of the two enzymes. However, based on the kinetics of cleavage of the precursor, it seems that activation of
caspase-7 precedes the activation of caspase-3 (see Fig 7B). Nevertheless, it is important to notice that CD437 acts on caspase isoenzymes that are different from those involved in the process of PCD
induced by ATRA. For instance, whereas caspase-3 is degraded and
activated by CD437, we did not observe any sign of degradation or
activation of caspase-3 by ATRA (E.G., unpublished results, January
1998). This supports the concept that the apoptogenic and cytotoxic
processes triggered by the two retinoids are intrinsically different,
which is consistent with the fact that CD437 induces apoptosis also in
the ATRA-resistant NB4.306 cell line.
The rapidity by which CD437 induces caspase-like activity and APL cell
death suggests that the compound directly activates the effector phase
of apoptosis. In NB4 cells, the process of CD437-triggered apoptosis
and the associated activation of caspases do not require gene
expression and de novo protein synthesis as they are left unaffected by
the protein synthesis inhibitor cycloheximide. This indicates that the
machinery necessary for the demise of NB4 cells is already present in
basal conditions, as observed in other paradigms of
PCD,48,49 and the phenomenon is in line with the fact that
caspase activation and apoptosis are not mediated by activation of the
nuclear retinoic acid receptors. Interestingly Piedrafita et
al60 reported that CD437 causes rapid and caspase dependent
degradation of the SP1 transcription factor through a pathway that is
also cycloheximide-insensitive. Thus, the retinoid either directly
activates caspases or sets in motion intracellular second messenger
pathways that lead to activation of this type of proteases through
posttranslational events. As to the first possibility, in vitro
incubation of control cell extracts with CD437 does not result in the
appearance of DEVD-amc cleavage (E.G., unpublished results, January
1998), indicating that the compound is not capable of causing direct
activation of caspases. As to the second possibility, experiments
conducted with inhibitors of intracellular second messanger pathways
involved in different types of apoptotic processes are consistent with
the following conclusions. Activation of caspases and subsequent
apoptosis in NB4 cells are not mediated by an increase in the
intracellular levels of toxic oxygen radicals, a purported cause of
PCD.61 In fact, the only radical scavanger tested showing
protection from CD437 cellular effects is N-acetyl cysteine (NAC).
However, the compound acts downstream of caspase activation and through a mechanism which is not related to radical scavenging activity (E.G.,
unpublished results, March 1998). Similarly, tyrosine kinases do not
seem to be activated by CD437, as genistein and erbstatin, two
relatively specific inhibitors of this class of kinases, have no effect
on the processes of apoptosis and caspase activation observed in NB4
cells following treatment with the retinoid (E.G., unpublished results,
January 1998). Furthermore, activation and downregulation of protein
kinase C by phorbol esters do not alter the kinetics or the levels of
caspase activation and subsequent apoptosis in NB4 cells challenged
with CD437 (E.G., unpublished results, January 1998). By contrast,
certain types of phosphatases may play a role in NB4 PCD, as shown by
the results obtained with calyculin A (Cal), a phosphatase inhibitor
acting preferentially on phosphatase 2A. Inhibition of a Cal-dependent
phosphatase reduces by approximately 70% the increase in DEVD-amc
hydrolytic activity observed in CD437-treated NB4 cells. Interestingly,
in the presence of CD437, Cal is partially necrogenic to NB4 cells,
suggesting that inhibition of phosphatase 2A may tip the balance
between apoptosis and necrosis toward the latter modality of cell death (E.G., unpublished results, March 1998).
Although the intracellular signals leading to caspase activation and
apoptosis in APL cells treated with CD437 are still unknown, these very
signals influence the activity of the mitochondria and lead to the
release of cyt c into the cytosol. Release of cyt c into the cytosol is
likely to be responsible for the proteolytic degradation and activation
of caspase-3 and caspase-7. In fact, it is known that cyt c, in concert
with apoptosis activated factor 1 (apaf1) and caspase-9, triggers
specific proteolysis and activation of effector caspases in various
models of apoptosis.51 In addition, the release of cyt c
from the mitochondria triggered by CD437 in NB4 cells cannot be blocked
by the caspase inhibitor z-VAD, at least during the early phase of the
process, suggesting that the phenomenon lays upstream of caspase
activation. This is similar to what was reported by Kim et
al62 for Ara-C-induced release of cyt c. Finally, the
kinetics of cyt c release from the mitochondria are consistent with its
possible causative role in the appearance of DEVD-amc hydrolytic
activity in the cytosol of NB4 cells treated with CD437. At present, it
is unknown whether CD437-dependent leakage of cyt c from the
mitochondria is the result of an increase in membrane permeability
consequent to the opening of the mitochondrial pore complex regulated
by members of the Bcl-2 family of proteins63 or is a pore
complex-independent process, as recently suggested by Bossy-Wetzel et
al64 in other paradigms of cytochrome c release. With
respect to this, however, we observed that pretreatment with cyclosporin, a ligand of one of the components of the pore complex and
a known inhibitor of mitochondrial permeability
transition,63 reduces by approximately 50% CD437-induced
apoptosis in NB4 cells. In addition, Hsu et al21 very
recently reported that CD437 downregulates expression of Bcl-2 in HL-60 cells.
Because PML-RAR- is an antiapoptotic protein14,15 and
its degradation has been implicated as a possible cause of the
therapeutic efficacy of ATRA and arsenic,53,54 we analyzed
the effects of CD437 on the protein in NB4 and PR9 cells. Treatment of
the NB4 cell line with CD437 results in the degradation of PML-RAR- and to a minor extent of RAR- as well. This is similar to what has
been observed for arsenic54 and to what has been very
recently reported for ATRA.55 The data obtained with z-VAD
indicate that the degradation of PML-RAR- triggered by CD437 is
directly or indirectly a caspase-dependent process. At present, we do
not know whether PML-RAR- is a direct target for the activity of caspases or its degradation is the consequence of a caspase-triggered activation of other as yet unknown downstream proteases. With respect
to this, there are examples of downstream proteases that can be
activated by caspases during the process of apoptosis.65 Nevertheless, our data indicate that the receptor can be degraded by
CD437 through a pathway that is different from the proteasome-dependent pathway triggered by ATRA.53 As to the role that
PML-RAR- degradation plays in the process of apoptosis triggered by
CD437, it is unlikely that disabling of the protein is necessary to
induce this type of PCD. First, in NB4 cells, degradation of
PML-RAR- is not observed at 2 hours (E.G., unpublished results,
March 1998), a time at which DEVD-hyrolizing activity is not yet
induced by CD437 (see Fig 3). Thus, proteolysis of PML-RAR- seems
to accompany rather than preceed caspase activation in NB4 cells.
Secondly, disabling of the receptor is blocked by a caspase inhibitor
like z-VAD, further supporting the concept that PML-RAR-
degradation lies downstream of the activation of the same caspases that
are responsible for the apoptotic process triggered by CD437. Thirdly
and more importantly, in PR9 cells, CD437 induces caspase activation
and apoptosis also in the absence of PML-RAR- induction (see Fig 10C). In addition, the compound is also active in the NB4.306 cell line
that has lost expression of the PML-RAR- protein.32
However, the situation may not be so simple. In fact, in PR9 cells,
overexpression of PML-RAR- obtained by raising the concentration of
Zn seems to initially protect from CD437-induced apoptosis
(E.G., unpublished results, March 1997). Although caution
should be exercised in interpreting the results because of the ability
of Zn to inhibit caspase-366 as well as other types of
caspases,67 these data are in line with the general
antiapoptotic effect of the APL oncogene.2,14,15,68 This
antiapoptotic effect seems to be operative also in the case of
CD437-induced PCD, although the phenomenon is eventually overcome by
the caspase-dependent degradation triggered by the retinoid.
In conclusion, the data reported in this article support the idea that
CD437 may find clinical application in the treatment of APL, given a
mechanism of action that looks substantially different from that of
other retinoids and possibly also of other chemotherapeutic agents. It
is possible to envision the use of the compound in association with
ATRA in the first-line treatment of APL patients to obtain rapid
clearance of ATRA-differentiated APL cells by apoptosis. In addition,
CD437 may find application in the second-line treatment of
ATRA-resistant APL relapses, as suggested by in vitro activity on
blasts obtained from an ATRA-resistant relapsed patient. However, two
PML-RAR- negative myeloid cell lines HL-60 and U937 have been
recently proven sensitive to the apoptogenic action of
CD437.21 Furthermore, we observed morphological apoptosis and caspase activation in freshly isolated blasts of two AML cases (interestingly one of the two cases analyzed was a
chemotherapy-resistant and relapsed patient) and one ALL case treated
in vitro with pharmacologically active concentrations of the retinoid
(E.G., unpublished results, April 1998). Thus, the therapeutic
potential of CD437 is certainly not limited to APL and the compound may
be clinically useful for other types of acute myeloid and nonmyeloid leukemia.
| |
ACKNOWLEDGMENT |
We thank Dr M. Lanotte (Unité INSERM 301, "Genetique
cellulaire et moleculaire des leucemies," Centre G; Hayem, Hopital
St Louis, Paris, France) for supplying us with the NB4 acute
promyelocytic cell line. We are grateful to Dr Carlo
Gambacorti-Passerini (Istituto Nazionale dei Tumori, Milano) for the
kind gift of the ATRA-resistant NB4.306 cell line. We thank Dr Marta
Muzio (Istituto "Mario Negri," Milano) for providing us with the
polyclonal antibodies against caspase-7 and Dr Pier Giuseppe Pelicci
(Istituto Oncologico Europeo, Milano) for the PR9 cell line. Finally,
we are also grateful to Prof S. Garattini, Dr M. Salmona, and Dr
Eugenio Erba for the critical reading of the manuscript.
| |
FOOTNOTES |
Submitted June 29, 1998; accepted September 29, 1998.
*
Throughout the text, the terms "apoptosis" and "programmed
cell death (PCD)" are used indifferently.
Supported by a grant to E.G. from the Associazione Italiana per la
Ricerca contro il Cancro (AIRC). I.P. is the recipient of an
"Alfredo Leonardi" fellowship.
L.M. and I.P. contributed equally to the results presented in this report.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Enrico Garattini, MD, Laboratory of
Molecular Biology, Centro Catullo e Daniela Borgomainerio, Istituto di
Ricerche Farmacologiche "Mario Negri," via Eritrea, 62, 20157 Milano, Italy; e-mail: egarattini{at}irfmn.mnegri.it.
| |
REFERENCES |
1.
Kantarjian HM, Keating MJ, Walters RS, Estey EH, McCredie KB, Smith TL, Dalton WT Jr, Cork A, Trujillo JM, Freireich EJ:
Acute promyelocytic leukemia. M.D. Anderson hospital experience.
Am J Med
80:789, 1997
2.
Grignani F, Fagioli M, Ferrucci PF, Alcalay M, Pelicci PG:
The molecular genetics of acute promyelocytic leukemia.
Blood Rev
7:87, 1993[Medline]
[Order article via Infotrieve]
3.
Warrell RP Jr, Frankel SR, Miller WJ Jr, Scheinberg DA, Itri LM, Hittelman WN, Vyas R, Andreef M, Tafuri A, Jakubowski A, Gabrilove J, Gordon MS, Dmitrovsky E:
Differentiation therapy of acute promyelocytic leukemia with tretinoin (all-trans retinoic acid).
N Engl J Med
324:1385, 1991[Abstract]
4.
Garattini E, Fortino I, Terao M:
Molecular mechanisms of retinoid action in acute promyelocytic leukemia.
Int J Oncol
11:397, 1997
5.
Casini T, Grignani F, Pelicci PG:
Genetics of APL and the molecular basis of retinoic acid treatment.
Int J Cancer
70:473, 1997[Medline]
[Order article via Infotrieve]
6.
Taimi M, Breitman TR:
Growth, differentiation, and death of retinoic acid-treated human acute promyelocytic leukemia NB4 cells.
Exp Cell Res
230:69, 1997[Medline]
[Order article via Infotrieve]
7.
Calabresse C, Barbey S, Venturini L, Balitrand N, Degos L, Fenaux P, Chomienne C:
In vitro treatment with retinoids or the topoisomerase inhibitor, VP-16, evidences different functional apoptotic pathways in acute promyelocytic leukemic cells.
Leukemia
9:2049, 1995[Medline]
[Order article via Infotrieve]
8.
Chen J-Y, Clifford J, Zusl C, Starrett J, Tortolani D, Ostrowski J, Raczek PR, Chambon P, Gronemeyer H:
Two distinct actions of retinoid-receptor ligands.
Nature
382:819, 1996[Medline]
[Order article via Infotrieve]
9.
Duprez E, Lillehaug JR, Gaub MP, Lanotte M:
Differential changes of retinoid-X-receptor (RXR alpha) and its RAR alpha and PML-RAR alpha partners induced by retinoic acid and cAMP distinguish maturation sensitive and resistant t(15;17) promyelocytic leukemia NB4 cells.
Oncogene
12:2443, 1996[Medline]
[Order article via Infotrieve]
10.
Duprez E, Ruchaud S, Houge G, Martin Thouvenin V, Valensi F, Kastner P, Berger R, Lanotte M:
A retinoid acid `resistant' t(15;17) acute promyelocytic leukemia cell line: Isolation, morphological, immunological, and molecular features.
Leukemia
6:1281, 1992[Medline]
[Order article via Infotrieve]
11.
Tobita T, Takeshita A, Kitamura K, Ohnishi K, Yanagi M, Hiraoka A, Karasuno T, Takeuchi M, Miyawaki S, Ueda R, Naoe T, Ohno R:
Treatment with a new synthetic retinoid, Am80, of acute promyelocytic leukemia relapsed from complete remission induced by all-trans retinoic acid.
Blood
90:967, 1997[Abstract/Free Full Text]
12.
Degos L:
Differentiation therapy in acute promyelocytic leukemia: European experience.
J Cell Physiol
173:285, 1997[Medline]
[Order article via Infotrieve]
13.
Fenaux P, Wattel E, Archimbaud E, Sanz M, Hecquet B, Guerci A, Link H, Fegueux N, Fey M, Castaigne S, Degos L:
Prolonged follow up confirms that all trans retinoic acid (ATRA) followed by chemotherapy reduces the risk of relapse in newly diagnosed acute promyelocytic leukemia (APL).
Blood
84:66, 1994
14.
Grignani F, Ferrucci PF, Testa U, Talamo G, Fagioli M, Alcalay M, Mencarelli A, Grignani F, Peschle C, Nicoletti I, Pelicci PG:
The expression of the PML/RAR protein in U937 blocks vitamin D3-induced differentiation and increases proliferation and survival of cells in low serum concentration.
Cell
74:423, 1991
15.
Fagioli M, Grignani F, Ferrucci PF, Alcalay M, Mencarelli A, Nicoletti I, Pelicci PG:
Effect of acute promyelocytic leukemia PML/RAR protein on differentiation and survival of myeloid precursors.
Leukemia
8:S7, 1994 (suppl 1)
16.
Bernard BA, Bernardon JM, Delescluse C, Martin B, Lenoir MC, Maignan J, Charpentier B, Pilgrim WR, Reichert U, Shroot B:
Identification of synthetic retinoids with selectivity for human nuclear retinoic acid receptor gamma.
Biochem Biophys Res Commun
186:977, 1992[Medline]
[Order article via Infotrieve]
17.
Hsu CK, Rishi AK, Li XS, Dawson MI, Reichert U, Shroot B, Fontana JA:
Bcl-X(L) expression and its downregulation by a novel retinoid in breast carcinoma cells.
Exp Cell Res
232:17, 1997[Medline]
[Order article via Infotrieve]
18.
Li XS, Rishi AK, Shao ZM, Dawson MI, Jong L, Shroot B, Reichert U, Ordonez J, Fontana JA:
Posttranscriptional regulation of p21WAF1/CIP1 expression in human breast carcinoma cells.
Cancer Res
56:5055, 1996[Abstract/Free Full Text]
19.
Schadendorf D, Kern MA, Artuc M, Pahl HL, Rosenbach T, Fichtner I, Nurnberg W, Stuting S, von Stebut E, Worm M, Makki A, Jurgovsky K, Kolde G, Henz BM:
Treatment of melanoma cells with the synthetic retinoid CD437 induces apoptosis via activation of AP-1 in vitro, and causes growth inhibition in xenografts in vivo.
J Cell Biol
135:1889, 1996[Abstract/Free Full Text]
20.
Schadendorf D, Worm M, Jurgovsky K, Dippel E, Reichert U, Czarnetzki BM:
Effects of various synthetic retinoids on proliferation and immunophenotype of human melanoma cells in vitro.
Recent Results Cancer Res
139:183, 1995[Medline]
[Order article via Infotrieve]
21.
Hsu CA, Rishi AK, Su-Li X, Gerald TM, Dawson MI, Schiffer C, Reichert U, Shroot B, Poirer GC, Fontana JA:
Retinoid induced apoptosis in leukemia cells through a retinoic acid nuclear receptor-independent pathway.
Blood
89:4470, 1997[Abstract/Free Full Text]
22.
Adachi H, Preston G, Harvat B, Dawson MI, Jetten AM:
Inhibition of cell proliferation and induction of apoptosis by the retinoid AHPN in human lung carcinoma cells.
Am J Resp Cell Mol Biol
18:323, 1998[Abstract/Free Full Text]
23.
Sun SY, Yue P, Dawson MI, Shroot B, Michel S, Lamph WW, Heyman RA, Teng M, Chandraratna RA, Shudo K, Hong WK, Lotan R:
Differential effects of synthetic nuclear retinoid receptor-selective retinoids on the growth of human non-small cell lung carcinoma cells.
Cancer Res
57:4931, 1997[Abstract/Free Full Text]
24.
Oridate N, Higuchi M, Suzuki S, Shroot B, Hong WK, Lotan R:
Rapid induction of apoptosis in human C33A cervical carcinoma cells by the synthetic retinoid 6-[3-(1-adamantyl)hydroxyphenyl]-2-naphtalene carboxylic acid (CD437).
Int J Cancer
70:484, 1997[Medline]
[Order article via Infotrieve]
25.
Gianni' M, Zanotta S, Terao M, Garattini S, Garattini E:
Effects of synthetic retinoids and retinoic acid isomers on the expression of alkaline phosphatase in F9 teratocarcinoma cells.
Biochem Biophys Res Commun
196:252, 1993[Medline]
[Order article via Infotrieve]
26.
Salvesen GS, Dixit VM:
Caspases: Intracellular signaling by proteolysis.
Cell
91:443, 1997[Medline]
[Order article via Infotrieve]
27.
Sun SY, Yue P, Dawson MI, Shroot B, Michel S, Lamph WW, Heyman RA, Teng M, Chandraratna RA, Shudo K, Hong WK, Lotan R:
Differential effects of synthetic nuclear retinoid receptor-selective retinoids on the growth of human non-small cell lung carcinoma cells.
Cancer Res
57:4931, 1997
28.
Agarwal C, Chandraratna RA, Johnson AT, Rorke EA, Eckert RL:
AGN193109 is a highly effective antagonist of retinoid action in human ectocervical epithelial cells.
J Biol Chem
271:12209, 1996[Abstract/Free Full Text]
29.
Canan Koch SS, Dardashti LJ, Hebert JJ, White SK, Croston GE, Flatten KS, Heyman RA, Nadzan AM:
Identification of the first retinoid X, receptor homodimer antagonist.
J Med Chem
39:3229, 1996[Medline]
[Order article via Infotrieve]
30.
Sun SY, Yue P, Shroot B, Hong WK, Lotan R:
Induction of apoptosis in human non-small cell lung carcinoma cells by the novel synthetic retinoid CD437.
J Cell Physiol
173:279, 1997[Medline]
[Order article via Infotrieve]
31.
Lanotte M, Martin Thouvenin V, Najman S, Balerini P, Valensi F, Berger R:
NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3).
Blood
77:1080, 1991[Abstract/Free Full Text]
32.
Dermime S, Grignani F, Clerici M, Nervi C, Sozzi G, Talamo GP, Marchesi E, Formelli F, Parmiani G, Pelicci PG, Gambacorti-Passerini C:
Occurrence of resistance to retinoic acid in the acute promyelocytic leukemia cell line NB4 is associated with altered expression of the pmL/RAR alpha protein.
Blood
82:1573, 1993[Abstract/Free Full Text]
33.
Gianni' M, Terao M, Gambacorti Passerini C, Rambaldi A, Garattini E:
Effects of 1,25-dihydroxy vitamin D3 on all-trans retinoic acid sensitive and resistant acute promyelocytic leukemia cells.
Biochem Biophys Res Commun
224:50, 1996[Medline]
[Order article via Infotrieve]
34.
Rambaldi A, Terao M, Bettoni S, Tini ML, Bassan R, Barbui T, Garattini E:
Expression of leukocyte alkaline phosphatase gene in normal and leukemic cells: Regulation of the transcript by granulocyte colony-stimulating factor.
Blood
76:2565, 1990[Abstract/Free Full Text]
35.
Gianni' M, Terao M, Norio P, Barbui T, Rambaldi A, Garattini E:
All-trans retinoic acid and cyclic adenosine monophosphate cooperate in the expression of leukocyte alkaline phosphatase in acute promyelocytic leukemia cells.
Blood
85:3619, 1995[Abstract/Free Full Text]
36.
Gianni' M, Li Calzi M, Terao M, Guiso G, Caccia S, Barbui T, Rambaldi A, Garattini E:
AM580, a stable benzoic derivative of retinoic acid, has powerful and selective cyto-differentiating effects on acute promyelocytic leukemia cells.
Blood
87:1520, 1996[Abstract/Free Full Text]
37.
Gianni' M, Terao M, Fortino I, Li Calzi M, Viggiano V, Barbui T, Rambaldi A, Garattini E:
Stat1 is induced and activated by all-trans retinoic acid in acute promyelocytic leukemia cells.
Blood
89:1001, 1997[Abstract/Free Full Text]
38.
Hotz MA, Gong J, Traganos F, Darzynkiewicz Z:
Flow cytometric detection of apoptosis: Comparison of the assays of in situ DNA degradation and chromatin changes.
Cytometry
15:237, 1994[Medline]
[Order article via Infotrieve]
39.
Bradford MM:
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:248, 1976[Medline]
[Order article via Infotrieve]
40.
Takahashi A, Goldschmidt-Clermont PJ, Alnemri ES, Fernandes-Alnemri T, Yoshizawa-Kumagawa K, Nakajima K, Sasada M, Poirier GG, Earnshaw WC:
Inhibition of ICE-related proteases (caspases) and nuclear apoptosis by phenylarsine oxide.
Exp Cell Res
231:123, 1997[Medline]
[Order article via Infotrieve]
41.
Diomede L, Colotta F, Piovani B, Re F, Modest EJ, Salmona M:
Induction of apoptosis in human leukemic cells by the ether lipid 1-octadecyl-2-methyl-RAC-glycero-3-phosphocholine. A possible basis for its selective action.
Int J Cancer
53:124, 1993[Medline]
[Order article via Infotrieve]
42.
Pastorino JG, Chen S-T, Tafani M, Snyder JW, Farber JL:
The overexpression of Bax produces cell death upon induction of the mitochondrial permeability transition.
J Biol Chem
273:7770, 1998[Abstract/Free Full Text]
43.
Duan H, Chinnaiyan AM, Hudson PL, Wing JP, He W-W, Dixit VM:
ICE-LAP3, a novel mammalian homologue of the Caenorhabditis elegans cell death protein Ced-3 is activated during FAS- and tumor necrosis factor-induced apoptosis.
J Biol Chem
271:1621, 1996[Abstract/Free Full Text]
44.
Ponte P, Ng SY, Engel J, Gunning P, Kedes L:
Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA.
Nucleic Acids Res
12:1687, 1984[Abstract/Free Full Text]
45.
Martins LM, Kottke T, Mesner PW, Basi GS, Sinha S, Frigon N, Tatar E, Tung JS, Bryant K, Takahashi A, Svingen PA, Madden BJ, McCormick DJ, Earnshaw WC, Kaufmann SH:
Activation of multiple Interleukin-1 converting enzyme homologues in cytosol and nuclei of HL-60 cells during etoposide-induced apoptosis.
J Biol Chem
272:7421, 1997[Abstract/Free Full Text]
46.
Gorczyca W, Gong, Darzynkiewicz Z:
Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assay.
Cancer Res
53:1945, 1993[Abstract/Free Full Text]
47.
Henkart PA:
ICE family proteases: Mediators of all apoptotic cell death.
Immunity
4:195, 1996[Medline]
[Order article via Infotrieve]
48.
Kaufmann M, Desnoyers S, Ottaviano Y, Davidson NE, Poirier GG:
Specific proteolytic fragmentation of Poly(ADP-ribose) polymerase: An early marker of chemotherapy-induced apoptosis.
Cancer Res
53:3976, 1993[Abstract/Free Full Text]
49.
Weil M, Jacobson MD, Coles HS, Davies TJ, Gardner RL, Raff KD, Raff MC:
Constitutive expression of the machinery for programmed cell death.
J Cell Biol
133:1053, 1996[Abstract/Free Full Text]
50.
Martin SJ, Green DR:
Protease activation during apoptosis: Death by a thousand cuts?
Cell
82:349, 1995[Medline]
[Order article via Infotrieve]
51.
Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X:
Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.
Cell
91:479, 1997[Medline]
[Order article via Infotrieve]
52.
Li F, Srinivasan A, Wang Y, Armstrong RC, Tomaselli KJ, Fritz LC:
Cell-specific induction of apoptosis by microinjection of cytochrome c. Bcl-Xl has activity independent of cytochrome c release.
J Biol Chem
272:30299, 1997[Abstract/Free Full Text]
53.
Yoshida H, Kitamura K, Tanaka K, Omura S, Miyazaki T, Hachiya T, Ohno R, Naoe T:
Accelerated degradation of PML-retinoic acid receptor (PML-RAR) oncoprotein by all-trans retinoic acid in acute promyelocytic leukemia: Possible role of the proteasome pathway.
Cancer Res
56:2945, 1996[Abstract/Free Full Text]
54.
Zhu C, Koken MHM, Quignon F, Chelbi-Alix MK, Degos L, Wang ZY, Chen Z, de Thé H:
Arsenic-induced PML targeting onto nuclear bodies: Implications for the treatment of acute promyelocytic leukemia.
Proc Natl Acad Sci USA
94:3978, 1997[Abstract/Free Full Text]
55.
Gianni' M, Koken MHM, Chelbi-Alix MK, Benoit G, Lanotte M, Chen Z, de Thé H:
Combined arsenic and retinoic acid treatment enhances differentiation and apoptosis in arsenic-resistant NB4 cells.
Blood
91:4300, 1998[Abstract/Free Full Text]
56.
Gianni' M, Terao M, Zanotta S, Barbui T, Rambaldi A, Garattini E:
Retinoic acid and granulocyte-colony stimulating factor synergistically induce leukocyte alkaline phosphatase in acute promyelocytic lekemia cells.
Blood
83:1909, 1994[Abstract/Free Full Text]
57.
Orth K, Chinnaiyan AM, Garg M, Froelich CJ, Dixit VM:
The CED-3/ICE-like protease Mch2 is activated during apoptosis and cleaves the death substrate lamin A.
J Biol Chem
271:16443, 1996[Abstract/Free Full Text]
58.
Faleiro L, Kobayashi R, Fearnhead H, Lazebnik Y:
Multiple species of CPP32 and Mch2 are the major active caspases present in apoptotic cells.
EMBO J
16:2271, 1997[Medline]
[Order article via Infotrieve]
59.
MacFarlane M, Cain K, Sun XM, Alnemri ES, Cohen GM:
Processing/activation of at leas four interleukin-1 beta converting enzyme-like proteases occurs during the execution phase of apoptosis in human monocytic tumor cells.
J Cell Biol
137:469, 1997[Abstract/Free Full Text]
60.
Piedrafita FJ, Pfahl M:
Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.
Mol Cell Biol
17:6348, 1997[Abstract]
61.
Buttke TM, Sandstrom PA:
Oxidative stress as a mediator of apoptosis.
Immunol Today
15:7, 1994[Medline]
[Order article via Infotrieve]
62.
Kim CN, Wang X, Huang Y, Ibrado AM, Liu L, Fang G, Bhalla K:
Overexpression of Bcl-X(L) inhibits Ara-C-induced mitochondrial loss of cytochrome c and other perturbations that activate the molecular cascade of apoptosis.
Cancer Res
57:3115, 1997[Abstract/Free Full Text]
63.
Zamzami N, Brenner C, Marzo I, Susin SA, Kroemer G:
Subcellular and submitochondrial mode of action of Bcl-2-like oncoproteins.
Oncogene
16:2265, 1998[Medline]
[Order article via Infotrieve]
64.
Bossy-Wetzel E, Newmeyer DD, Green DR:
Mitochondrial cytochrome c release in apoptosis occurs upstream of DEVD-specific caspase activation and independently of mitochondrial transmembrane depolarization.
EMBO J
17:37, 1998[Medline]
[Order article via Infotrieve]
65.
Wright SC, Schellenberger U, Wang H, Wang Y, Kinder DH:
Chemotherapeutic drug activation of the AP24 protease in apoptosis: Requirement for caspase-3-like proteases.
Biochem Biophys Res Comm
245:797, 1998[Medline]
[Order article via Infotrieve]
66.
Perry DK, Smyth MJ, Stennicke HR, Salvesen GS, Duriez P, Poirier GG, Hannun YA:
Zinc is a potent inhibitor of the apoptotic protease, caspase-3. A novel target for Zinc in the inhibition of apoptosis.
J Biol Chem
272:18530, 1997[Abstract/Free Full Text]
67.
Takahashi A, Alnemri ES, Lazebnik YA, Fernandes-Alnemri T, Litwack G, Moir RD, Goldman RD, Poirier GG, Kaufmann SH, Earnshaw WC:
Cleavage of lamin A by Mch2 alpha but not CPP32: Multiple interleukin 1 beta-converting enzyme-related proteases with distinct substrate recognition properties are active in apoptosis.
Proc Natl Acad Sci USA
93:8395, 1996[Abstract/Free Full Text]
68.
Mu ZM, Chin KV, Liu JH, Lozano G, Chang KS:
PML, a growth suppressor disrupted in acute promyelocytic leukemia.
Mol Cell Biol
14:6858, 1994[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
L. Farhana, M. I. Dawson, L. Xu, J.-H. Dannenberg, and J. A. Fontana
SHP and Sin3A expression are essential for adamantyl-substituted retinoid-related molecule-mediated nuclear factor-{kappa}B activation, c-Fos/c-Jun expression, and cellular apoptosis
Mol. Cancer Ther.,
June 1, 2009;
8(6):
1625 - 1635.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Valli, G. Paroni, A. M. Di Francesco, R. Riccardi, M. Tavecchio, E. Erba, A. Boldetti, M. Gianni', M. Fratelli, C. Pisano, et al.
Atypical retinoids ST1926 and CD437 are S-phase-specific agents causing DNA double-strand breaks: significance for the cytotoxic and antiproliferative activity
Mol. Cancer Ther.,
September 1, 2008;
7(9):
2941 - 2954.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Farhana, M. I. Dawson, M. Leid, L. Wang, D. D. Moore, G. Liu, Z. Xia, and J. A. Fontana
Adamantyl-Substituted Retinoid-Related Molecules Bind Small Heterodimer Partner and Modulate the Sin3A Repressor
Cancer Res.,
January 1, 2007;
67(1):
318 - 325.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Parrella, M. Gianni, M. Fratelli, M. M. Barzago, I. Raska Jr, L. Diomede, M. Kurosaki, C. Pisano, P. Carminati, L. Merlini, et al.
Antitumor Activity of the Retinoid-Related Molecules (E)-3-(4'-Hydroxy-3'-adamantylbiphenyl-4-yl)acrylic Acid (ST1926) and 6-[3-(1-Adamantyl)-4-hydroxyphenyl]-2-naphthalene Carboxylic Acid (CD437) in F9 Teratocarcinoma: Role of Retinoic Acid Receptor {gamma} and Retinoid-Independent Pathways
Mol. Pharmacol.,
September 1, 2006;
70(3):
909 - 924.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. N. Harris, B. Ozpolat, F. Abdi, S. Gu, A. Legler, K. G. Mawuenyega, M. Tirado-Gomez, G. Lopez-Berestein, and X. Chen
Comparative proteomic analysis of all-trans-retinoic acid treatment reveals systematic posttranscriptional control mechanisms in acute promyelocytic leukemia
Blood,
September 1, 2004;
104(5):
1314 - 1323.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Bayon, M. A. Ortiz, F. J. Lopez-Hernandez, P. H. Howe, and F. J. Piedrafita
The Retinoid Antagonist MX781 Induces Clusterin Expression in Prostate Cancer Cells via Heat Shock Factor-1 and Activator Protein-1 Transcription Factors
Cancer Res.,
August 15, 2004;
64(16):
5905 - 5912.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. G. Keedwell, Y. Zhao, L. A. Hammond, S. Qin, K.-Y. Tsang, A. Reitmair, Y. Molina, Y. Okawa, L. I. Atangan, D.-L. Shurland, et al.
A Retinoid-Related Molecule that Does Not Bind to Classical Retinoid Receptors Potently Induces Apoptosis in Human Prostate Cancer Cells through Rapid Caspase Activation
Cancer Res.,
May 1, 2004;
64(9):
3302 - 3312.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Garattini, E. Parrella, L. Diomede, M. Gianni', Y. Kalac, L. Merlini, D. Simoni, R. Zanier, F. F. Ferrara, I. Chiarucci, et al.
ST1926, a novel and orally active retinoid-related molecule inducing apoptosis in myeloid leukemia cells: modulation of intracellular calcium homeostasis
Blood,
January 1, 2004;
103(1):
194 - 207.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Garattini
New approaches to cancer therapy
Ann. Onc.,
June 1, 2003;
14(6):
813 - 816.
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. J. Lopez-Hernandez, M. A. Ortiz, Y. Bayon, and F. J. Piedrafita
Z-FA-fmk Inhibits Effector Caspases but not Initiator Caspases 8 and 10, and Demonstrates That Novel Anticancer Retinoid-related Molecules Induce Apoptosis via the Intrinsic Pathway
Mol. Cancer Ther.,
March 1, 2003;
2(3):
255 - 263.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. F. Holmes, D. R. Soprano, and K. J. Soprano
Elucidation of Molecular Events Mediating Induction of Apoptosis by Synthetic Retinoids Using a CD437-resistant Ovarian Carcinoma Cell Line
J. Biol. Chem.,
November 15, 2002;
277(47):
45408 - 45419.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Pisano, P. Kollar, M. Gianni, Y. Kalac, V. Giordano, F. F. Ferrara, R. Tancredi, A. Devoto, A. Rinaldi, A. Rambaldi, et al.
Bis-indols: a novel class of molecules enhancing the cytodifferentiating properties of retinoids in myeloid leukemia cells
Blood,
November 15, 2002;
100(10):
3719 - 3730.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Garattini, M. Gianni', M. Terao, and H. K. Parekh
Correspondence re: A. Kumar et al., Cross-Resistance to the Synthetic Retinoid CD437 in a Paclitaxel-resistant Human Ovarian Carcinoma Cell Line Is Independent of the Overexpression of Retinoic Acid Receptor-{gamma}. Cancer Res., 61: 7552-7555, 2001.
Cancer Res.,
April 1, 2002;
62(7):
2192 - 2194.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Gianni', Y. Kalac, I. Ponzanelli, A. Rambaldi, M. Terao, and E. Garattini
Tyrosine kinase inhibitor STI571 potentiates the pharmacologic activity of retinoic acid in acute promyelocytic leukemia cells: effects on the degradation of RAR{alpha} and PML-RAR{alpha}
Blood,
May 15, 2001;
97(10):
3234 - 3243.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Babina, K. Mammeri, and B. M. Henz
Retinoic acid up-regulates myeloid ICAM-3 expression and function in a cell-specific fashion--evidence for retinoid signaling pathways in the mast cell lineage
J. Leukoc. Biol.,
March 1, 2001;
69(3):
361 - 372.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S.-Y. Sun, P. Yue, R. A. S. Chandraratna, Y. Tesfaigzi, W. K. Hong, and R. Lotan
Dual Mechanisms of Action of the Retinoid CD437: Nuclear Retinoic Acid Receptor-Mediated Suppression of Squamous Differentiation and Receptor-Independent Induction of Apoptosis in UMSCC22B Human Head and Neck Squamous Cell Carcinoma Cells
Mol. Pharmacol.,
September 1, 2000;
58(3):
508 - 514.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
I. Ponzanelli, M. Gianni, R. Giavazzi, A. Garofalo, I. Nicoletti, U. Reichert, E. Erba, A. Rambaldi, M. Terao, and E. Garattini
Isolation and characterization of an acute promyelocytic leukemia cell line selectively resistant to the novel antileukemic and apoptogenic retinoid 6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene carboxylic acid
Blood,
April 15, 2000;
95(8):
2672 - 2682.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. le Coutre, E. Tassi, M. Varella-Garcia, R. Barni, L. Mologni, G. Cabrita, E. Marchesi, R. Supino, and C. Gambacorti-Passerini
Induction of resistance to the Abelson inhibitor STI571 in human leukemic cells through gene amplification
Blood,
March 1, 2000;
95(5):
1758 - 1766.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Le Doze, D. Debruyne, F. Albessard, L. Barre, and G. L. Defer
Pharmacokinetics of All-trans Retinoic Acid, 13-cis Retinoic Acid, and Fenretinide in Plasma and Brain of Rat
Drug Metab. Dispos.,
February 1, 2000;
28(2):
205 - 208.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
P. Marchetti, N. Zamzami, B. Joseph, S. Schraen-Maschke, C. Mereau-Richard, P. Costantini, D. Metivier, S. A. Susin, G. Kroemer, and P. Formstecher
The Novel Retinoid 6-[3-(1-adamantyl)-4-hydroxyphenyl]-2-naphtalene Carboxylic Acid Can Trigger Apoptosis through a Mitochondrial Pathway Independent of the Nucleus
Cancer Res.,
December 1, 1999;
59(24):
6257 - 6266.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. X. Kang, J. Bell, R. L. Beard, and R. A. S. Chandraratna
Mannose 6-Phosphate/Insulin-like Growth Factor II Receptor Mediates the Growth-Inhibitory Effects of Retinoids
Cell Growth Differ.,
August 1, 1999;
10(8):
591 - 600.
[Abstract]
[Full Text]
|
|
|
|
|
Top
Abstract
Introduction