|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 3 (February 1), 1999:
pp. 963-973
The 5' Flanking Region of the Human Granzyme H Gene Directs
Expression to T/Natural Killer Cell Progenitors and
Lymphokine-Activated Killer Cells in Transgenic Mice
By
Debra M. MacIvor,
Christine T.N. Pham, and
Timothy J. Ley
From the Departments of Internal Medicine and Genetics, Division of
Bone Marrow Transplantation and Stem Cell Biology, Washington
University Medical School, St Louis, MO.
 |
ABSTRACT |
Human granzyme H is a neutral serine protease that is expressed
predominantly in the lymphokine-activated killer (LAK)/natural killer
(NK) compartment of the immune system. The gene that encodes this
granzyme is located between the granzyme B and cathepsin G genes on
human chromosome 14q11.2. Although the murine orthologue of human
granzyme H has not yet been identified, murine granzymes C, D, E, F,
and G also lie between the murine granzyme B and cathepsin G genes on
murine chromosome 14; murine granzymes C, D, and F are also highly
expressed in LAK cells, but minimally in cytotoxic T lymphocytes (CTL).
We therefore tested whether the 5' flanking region of human
granzyme H contains the cis-acting DNA sequences necessary to target a
reporter gene to the LAK/NK compartment of transgenic mice. A 1.2-kb
fragment of 5' flanking human granzyme H sequence was linked to
an SV40 large T-antigen (TAg) reporter gene and used to create six
transgenic founder lines. SV40 TAg was specifically expressed in the
LAK cells of these mice, but not in resting T or NK cells, in CTL, or
in any other tissues. Most mice eventually developed a fatal illness
characterized by massive hepatosplenomegaly and disseminated organ
infiltration by large malignant lymphocytes. Cell lines derived from
splenic tumors were TAg+ and NK1.1+ large
granular lymphocytes and displayed variable expression of CD3, CD8, and
CD16. Although these cell lines contained perforin and expressed
granzymes A, B, C, D, and F, they did not exhibit direct cytotoxicity.
Collectively, these results suggest that the 5' flanking
sequences of the human granzyme H gene target expression to an NK/T
progenitor compartment and to activated NK (LAK) cells. Mice and humans
may therefore share a regulatory "program" for the transcription
of NK/LAK specific granzyme genes.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE HUMAN GRANZYME H gene encodes a
neutral serine protease1-4 that is expressed predominantly
in the cytotoxic granules of natural killer (NK) and
lymphokine-activated killer (LAK) cells. This gene lies between the
human granzyme B and cathepsin G genes on human chromosome
14q11.2.5 Although granzyme B and cathepsin G are highly
conserved between mice and humans, the precise functional orthologue of
human granzyme H has not been determined.6,7 Several murine
granzymes lie between murine granzyme B and murine cathepsin G,
including granzymes C, F, G, D, and E (5'  3').8-10 Interestingly, granzymes C, D, and F are
minimally expressed in murine cytotoxic T lymphocytes (CTL) (created by
5-day mixed lymphocyte cultures or 2 days of exposure to 50 U/mL
recombinant human interleukin-2 [rhIL-2] and 5 µg/mL concanavalin A
[Con A]), but are highly expressed in murine LAK cells.11
Therefore, murine granzymes C, D, and F and human granzyme H are
similarly located between granzymes B and cathepsin G and have similar
expression profiles. These data suggest that mice may have an NK/LAK
regulatory compartment for granzymes that is similar to that of humans.
To test this hypothesis, we created transgenic mice containing granzyme
H regulatory sequences driving a reporter gene. We decided to use the
5' flanking region of granzyme H in our initial targeting
construct because a similar 5' flanking region upstream from the
the human granzyme B gene specifically directs expression of a growth
hormone reporter gene to the activated CTL compartment of transgenic
mice.12,13 These results suggested that regulatory information that restricts granzyme H expression to the LAK/NK compartment might also lie immediately upstream from that gene.
Therefore, we used a 1.2-kb region just upstream from granzyme H to
drive the SV40 TAg gene in transgenic mice. Young transgenic mice
containing this construct express T-antigen (TAg) predominantly in the
LAK compartment. With time, a large percentage of mice expressing this
transgene developed a fatal lymphoma-like illness; the tumor cells in
the spleens of these mice were TAg+ and were capable of
transferring the tumor phenotype to secondary severe combined
immunodeficient (SCID) animals. Cell lines derived from tumors had a
large granular lymphocyte morphology, and were NK1.1+ and
CD16+; the lines variably expressed CD3, CD8, and CD16,
suggesting that TAg contributed to the transformation of cells that are
of the NK/T lineage. These data suggest that the regulatory compartment in which human granzyme H is expressed is conserved in the mouse, and
that murine transcription factors can recognize the human sequences.
They also suggest that granzyme H, and its murine counterparts, granzymes C, D, and F, are probably expressed normally at an early stage of NK/T cell development, and in activated NK (LAK) cells.
| |
MATERIALS AND METHODS |
Construct.
1.2 kb of the 5' region of granzyme H was obtained by polymerase
chain reaction (PCR) using the forward primer:
GTCGACGGAGTCTCGCTCTGTCACCC ( 1212 to 1183) and the reverse
primer: TATACCTAGGAGGCTGCCCAGGTCAGAGCT (+20 to +1). The resulting
Sal 1/BamH1 fragment was subcloned into pUC19. A
BamH1 linkered fragment containing 2.7 kb of SV40 Large TAg
(+5156 to +2450)14 was inserted into the BamH1 site downstream from the sequence in the "sense" orientation. A 1.0-kb Nde 1 fragment derived from the SV40 sequence was used as a
probe for Southern blotting.
Production of transgenic mice.
The 3.9-kb gel-purified fragment containing 5' granzyme H
(1212 to +20) driving TAg was microinjected into the male
pronuclei of oocytes derived from C57BL/6 × C3H/He crosses. These
oocytes were implanted into pseudopregnant Swiss Webster outbred female recipients. Tail DNA samples derived from 39 potential founders were
analyzed by Southern blotting using a 1-kb Nde 1 TAg fragment to detect the presence of the transgene. Mice were maintained in a
Specific Virus Antibody Free (SVAF) barrier facility.
Production of CTL and adherent (Ad) LAK.
One-way mixed lymphocyte cultures were performed as previously
described15 to generate alloreactive CTL. Activated CTL
were also generated by incubating splenocytes in K5 media (5%
heat-inactivated fetal calf serum, 1% glutamine-L, 1% nonessential
amino acids, 1% sodium pyruvate, 0.05% penicillin/streptomycin, in
RPMI 1640 pH 7.2) with 50 U/mL rhIL-2 (Chiron, Emeryville,
CA) and 5 µg/mL Concanavalin A (ConA; Sigma, St Louis,
MO).12 AdLAK cells were generated by isolating
lymphocytes with a Hypaque-Ficoll 1119 (Sigma) gradient
and plating cells at 2 × 106 cells/mL in K5 media
with 1,000 U/mL rhIL-2 for 10 days.11 On day 3, media was
centrifuged at 2,000 rpm for 5 minutes to remove dead cells, and the
supernatant was returned to the flask. Cells were procured for analysis
7 days later.
Western blots.
Total proteins were prepared from activated CTL, AdLAK, or organ
homogenates by sonicating these cells in 200 µL of lysis buffer (1 mol/L NaCl, 25 mmol/L Tris 7.5, 0.1% Triton X-100); extracts were
cleared by centrifugation, and protein concentration was determined
using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules,
CA). Equal quantities of total proteins were loaded onto
10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels using reducing conditions, transferred to
nitrocellulose, and analyzed with a standard Western blotting technique
using anti-SV40 large TAg antiserum (Pharmingen, Los Angeles, CA),
antigranzyme B antiserum,16 or anti- -actin antiserum
(Sigma) followed by detection with chemiluminescense (Amersham,
Arlington Heights, IL).
Production of cell lines.
Cell lines were generated by plating 1 or 10 spleen cell(s)/well in
96-well plates in K5 media with 1,000 U/mL rhIL-2. Plates were
incubated at 37°C, in 5% CO2 for 4 to 5 weeks. All
cell lines were maintained in K5 media with 500 U/mL rhIL-2 and
passaged with a 1:10 split weekly.
Flow cytometry.
A total of 2 × 106 cells per sample were washed twice
in cold phosphate-buffered saline (PBS), resuspended in 100 µL
fluorescence-activated cell sorting (FACS) buffer (1% bovine serum
albumin [BSA], 0.1% NaN3 in PBS), and incubated with
antibodies (see Table 1) directly conjugated to either phycoerythrin
(PE) or fluorescein isothiocyanate (FITC) (Pharmingen) at 4°C, 45 minutes. Cells were then washed twice and resuspended in FACS buffer
and scanned using a Becton Dickinson FACScan (San Jose,
CA). To label cells with antimouse SV40 large TAg antibody
(FITC), 2 × 106 cells in 100 µL FACS buffer were
first incubated with PE-conjugated monoclonal antibodies specific for
cell surface antigens (CD4, CD8, CD16, NK1.1,   TCR) for 30 minutes on ice. Cells were washed twice with FACS buffer, and then
permeabilized and fixed with 100 µL of Cytofix/Cytoperm solution
(Pharmingen, San Diego, CA) for 20 minutes at 4°C. Cells were
washed twice in 1 × Perm/wash solution (Pharmingen), resuspended
in 50 µL of Perm/wash solution containing 0.25 µg of
FITC-conjugated SV40 large TAg antibody (Pharmingen) and incubated at
4°C for 30 minutes. Cells were washed twice with Perm/wash
solution, resuspended in FACS buffer, and analyzed using a
Becton-Dickinson FACScan.
Direct cytolytic assays.
Six cell lines or AdLAK cells were incubated with the NK-sensitive
YAC-1 (H-2a; a tissue culture cell line of a Moloney murine
leukemia virus-induced lymphoma of A/Sn origin) target cells in
standard 51Cr or Iododeoxyuridine [125I]
(125IUdR) release assays, essentially as
described.17
| |
RESULTS |
Vector design and production of transgenic mice.
We previously showed that 1.1 kb of 5' flanking sequence from the
human granzyme B gene was sufficient to target expression to activated
CTL in transgenic mice.13 A sequence analysis comparing human and murine granzyme B 5' flanking sequences showed
extensive regions of homology within the first 500 bp upstream from the transcription initiation site.13 We performed dot matrix
analyses comparing the 5' flanking regions of human granzyme H,
human granzyme B, and mouse granzymes C, D, and F. These results showed
limited regions of homology between human granzymes H and B, with more extensive homology in the 5' flanking regions of human granzyme H
and murine granzymes C, D, and F (ref 3 and data not shown).
Therefore, we created a targeting vector containing 1.2 kb of 5'
genomic granzyme H sequence (1212 to +20) driving a 2.7-kb fragment derived from SV40 containing large TAg (nucleotides +5156 to
+2450). Transgenic mice were created using established
methods.13 DNA samples derived from 39 potential founders
were analyzed by Southern blotting using a 1.0-kb Nde1 fragment derived
from the TAg gene. Six founders were identified (nos. 33, 36, 37, 153, 164, and 171) containing transgene copy numbers of 3, 2, 4, 7, 1, and 2 per haploid genome, respectively (data not shown).
Expression of the granzyme H-TAg construct in the LAK, but not CTL
compartment.
To determine whether these mouse lines expressed the transgene, each
founder was bred with nontransgenic C57Bl/6 × C3H/He mice, and
transgenic F1 mice from these matings were analyzed. Spleens from young
mice ( 3 months) were harvested and divided into two equal portions.
One portion was incubated in 50 U/mL rhIL-2 and 5 µg/mL
ConA for 2 days to generate CTL. The other half of the spleen was
incubated with 1,000 U/mL rhIL-2 for 10 days to generate AdLAK cells.
Total proteins were extracted from the cultured cells, normalized for
total protein contact, and analyzed by Western blotting
(Fig 1). Blots were first hybridized with
an anti-TAg antibody, and then stripped and rehybridized with an
antimurine granzyme B antibody (as a measure of lymphocyte activation),
and then an antimurine -actin antibody (as a protein loading and
transfer control). Large TAg ( 94 kD) is detected in the
positive control cell line 419b18 (lane 1). In CTL derived from an F1 mouse from founder line 33, granzyme B is easily detected, showing that these cells are activated (resting CTL do not express granzyme B); however, no TAg is detected. In contrast, adherent LAK
cells from the same spleen express granzyme B and TAg. In Fig 1B, an
analysis is performed with three F1 mice derived from three independent
founder lines (nos. 33, 36, and 37); TAg is easily detected in the
AdLAK cells, but is minimally expressed in CTL derived from the same
spleens. Granzyme B levels were similar for the CTL and AdLAK cells for
all of these spleens (data not shown). Of the three additional founder
lines (nos. 153, 164, and 171), only no. 153 showed expression of TAg
in the LAK compartment, and levels were similar to that of line 37. Lines 164 and 171 had no detectable expression of TAg in AdLAK cells.
View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
(A) Western analysis of total proteins obtained from CTL
or AdLAK cells from a mouse derived from founder line 33. Total protein
from the positive control cell line (419b, lane 1) or from CTL or AdLAK
cells from the spleen of a single mouse were cultured as described, and
whole cell extracts were made. Total protein content was normalized,
and SDS-PAGE was performed followed by Western analysis. The blots were
first hybridized with an anti-TAg antibody, stripped, and then
rehybridized with antibodies against murine granzyme B and then
-actin. CTL from the spleen of this mouse contains abundant granzyme
B, but no detectable TAg; AdLAK cells contain granzyme B and TAg. (B)
An analysis similar to that performed in (A) is shown, but with mice
from three independent founder lines, as designated.
|
|
These results were confirmed and extended using two-color flow
cytometric analysis (see Fig 2). Resting
splenocytes derived from all three founder lines showed very few
TAg+ cells by flow cytometric techniques (data not shown,
and see Fig 7). Similarly, CTL generated by day 5 mixed lymphocyte
reactions or day 2 conA/IL-2 treatment did not show TAg+
cells by flow cytometric methods (data not shown). In contrast, day 10 AdLAK cells from all three founder lines showed 10% to 40%
TAg+ cells (representative data from one such experiment is
shown in Fig 2). Approximately 10% to 15% of the AdLAK cells from the spleen of this transgenic animal were TAg+, and virtually
all of the TAg+ cells were CD16+ and/or
NK1.1+. Importantly, CD8+ cells generated by
high dose treatment with IL-2 were not TAg+. These data
strongly suggest that the TAg+ cells within the AdLAK
population are predominantly activated NK cells.
View larger version (31K):
[in this window]
[in a new window]
| Fig 2.
Flow cytometric analysis of LAK cells. Spleen cells were
incubated in high dose IL-2 for 10 days, and AdLAK cells were harvested
for flow cytometric analysis. TAg expression is detected on the x-axis
and lymphoid markers on the y-axis. Approximately 10% to 15% of the
cells derived from the day 10 adherant LAK preparation are
TAg+ and are also CD16+ and/or
NK1.1+. Note that the percentage of cells in each
compartment is not altered by expression of the transgene.
|
|
To determine whether TAg was expressed exclusively in AdLAK cells,
total proteins were prepared from the organs of transgenic mice. A
representative analysis is shown in Fig 3.
Equal amounts of protein from the organs of an F1 mouse from founder
line 36 were harvested and analyzed by Western blotting with TAg and
anti--actin antibodies. Abundant TAg expression was detected in the
AdLAK cells derived from the spleen of this mouse, but not in CTL or in
any other organ, including the resting spleen. Similar results were
obtained from the F1 progeny from lines 33 and 37.
View larger version (34K):
[in this window]
[in a new window]
| Fig 3.
Western analysis of total proteins extracted from the
various tissues of an F1 mouse from founder line 36. CTL and AdLAK
cells were generated as described in Fig 1. The same blot was probed
with an anti-TAg antibody, stripped, and then rehybridized with an
antimurine -actin antibody. Note that TAg is expressed only in the
AdLAK cells of this mouse.
|
|
Granzyme H-TAg mice develop fatal lymphomas.
Young mice from founder lines 33, 36, and 37 had no observable
phenotype. They displayed normal growth and development, and were
fertile. Complete blood counts from these animals showed no
abnormalities (data not shown). Gross examination of the spleens from
these animals showed that they were not enlarged; however, pathologic
evaluation of the spleens showed prominent mantle zones (Fig 4A v B) and
prominent germinal centers.
View larger version (114K):
[in this window]
[in a new window]
| Fig 4.
Gross pathology and
histopathology of transgenic mice. (A) Low power hematoxylin and eosin
(H&E) stain of a spleen from a 2-month-old wild-type
mouse. (B) Low power H&E stain of a spleen from a 2-month-old mouse
derived from founder line 33. Note the prominent mantle zones and
germinal centers in follicles. (C) Spleens from a healthy nontransgenic
mouse (top) and a clinically ill transgenic mouse (bottom) from founder
line 33 at the time of autopsy. Note massive enlargement of the
transgenic spleen. (D) Wright's-stained peripheral blood smear from a
clinically ill mouse. At the time of autopsy, the mouse had massive
hepatosplenomegaly and mesenteric lymphadenopathy. The white blood cell
count at death was 156,600/µL, the hemoglobin level was 7.8 g/dL, the
hematocrit was 17.7%, and the platelet count was 140,000/µL. Note
the appearance of intermediate-sized, abnormal lymphocytes in the
peripheral blood;  95% of peripheral blood cells had this
appearance. (E) Low-power view of an H&E-stained section of a spleen
from a mouse from founder line 33 dying with massive
hepatosplenomegaly. Note the uniform appearance of large cleaved
lymphocytes replacing the structure of the spleen. (F) Low-power view
of a spleen from a mouse from founder line 37 dying with massive
hepatosplenomegaly. Note that the tumor does not completely replace the
spleen, in contrast to the spleen shown in (E). (G) High-power view of
lymphocytes from a splenic tumor. Note the large cells with irregular
cleaved nuclei and eosinophilic nucleoli. (H) Cell line 37.4. Note the
appearance of large lymphocytes with multiple azurophilic granules,
vacuolization, and large irregular nuclei. All cell lines had similar
morphologic features.
|
|
Many mice from founder lines 33, 36, and 37 eventually developed a
clinical illness consisting of weight loss, distention of the abdomen,
difficulty with respiration, and hair loss. Mice developing this
clinical syndrome were autopsied and analyzed using histopathological
techniques. Virtually all of the autopsied mice (n = 30) with this
syndrome exhibited massive splenomegaly (Fig 4C), and 21 of 30 exhibited massive hepatomegaly. Thirteen of 30 had grossly evident
adenopathy in the mesenteric and/or thoracic lymph nodes. Other
organs that were grossly involved at autopsy included the uterus,
kidneys, thymus, and lungs in some of the animals. Complete blood
counts obtained at the time of autopsy showed abnormalities in many
mice. Nine of 30 mice analyzed at autopsy had an elevation in the total
white blood cell count (16,000 to 150,000/µL); most of
these mice had an elevated number of abnormal lymphocytes in the
peripheral blood (Fig 4D). Twenty-one of 30 mice exhibited moderate to
severe anemia, frequently associated with severe polychromasia on
peripheral smears, suggesting the possibility of a hemolytic component.
Twenty-six of 30 mice exhibited a mild to moderate reduction in the
absolute platelet count.
The cause of death for most of animals in all three founder lines was a
fatal lymphoma-like illness (Fig 5).
Transgenic mice from founder lines 36 and 37 began to die from this
illness as early as 6 months of age. One hundred percent of mice from
line 36 were dead at 500 days, while mice from lines 33 and 37 did not
always develop fatal lymphoma-like illnesses. A small percentage (10%) of transgenic mice from all three founder lines developed a
"head-tilt" syndrome associated with bilateral osteosarcomas originating from petrous portion of the temporal bones of the skull.
These tumors have previously been described,19 and are presumably due to TAg expression from regulatory sequences within the
TAg portion of this transgene, and not due to hybrid transcripts initiated from the granzyme H promoter. These mice were excluded from
the analysis shown in Fig 5.
View larger version (15K):
[in this window]
[in a new window]
| Fig 5.
Kaplan-Meyer plot of lymphoma-free survival from founder
lines 33, 36, 37, and nontransgenic lettermates. Mice that developed
temporal bone osteosarcomas were not included in this analysis. n = 117 mice for nontransgenic littermates, n = 25 for line 33, n = 44 for line 36, and n = 48 for line 37.
|
|
The splenic pathology of several tumors derived from these mice are
shown in Fig 4E, F, and G. Although virtually all of the mice with the
clinical illness exhibited massive splenomegaly, the tumor burden in
these affected spleens was highly variable. Some mice exhibited
complete replacement of the spleen with tumor cells, and others had
smaller tumor burdens (with large numbers of reactive cells in the
spleen and partially preserved follicular morphology). Regardless of
the relative tumor burden, the morphology of the abnormal cells in the
spleen was consistent in most of the tumors examined. The tumor cells
were generally intermediate to large in size, containing nuclei that
were oval, irregular, and occasionally frankly cleaved with vesicular
chromatin. Many of the nuclei contained distinct (and often prominent)
eosinophilic nucleoli. The cytoplasm was generally moderate in
abundance and contained no obvious granules on H and E staining. The
mitotic rate was brisk (80 mitotic figures per 10 high-power fields). In spleens in which the follicular architecture was not completely effaced, the tumors had a T-zone/red pulp distribution. In sum, the
splenic tumors were best characterized morphologically as high-grade,
diffuse, large cell lymphomas.
The splenic tumors from 30 mice displaying clinical illness were
analyzed for TAg expression by flow cytometry and/or Western blotting. All tumors contained TAg+ cells, but the
percentage of TAg+ spleen cells varied considerably from
mouse to mouse. Ten of 30 spleen tumors had <2% TAg-expressing
cells. Four of 30 tumors had 2% to 20% TAg+ cells, 6 had
20% to 40% TAg+ cells, 3 had 40% to 70% positive cells,
and 7 had 70% to 93% TAg+ cells. Western blot analysis of
protein extracts derived from spleen tumors also displayed considerable
variability in the total TAg that was detected (see
Fig 6A, lanes 6 and 7); no TAg was detected
in nontransgenic spleens (Fig 6A, lanes 2 and 3) or in transgenic
spleens from young healthy animals (Fig 6A, lanes 4 and 5).
View larger version (33K):
[in this window]
[in a new window]
| Fig 6.
Western blot analysis of protein extracts made from
wild-type and transgenic mice. (A) Total protein extracts were made
from nontransgenic spleens (lanes 2 and 3) or from the spleens of
transgene positive mice at age 2 months (lanes 4 and 5). Extracts made
from individual spleen tumors from founder lines 36 and 37 are shown in
lanes 6 and 7. Extracts made from a young transgenic mouse spleen
activated with ConA and 50 U/mL rhIL-2 (CTL) versus 1,000 U/mL rhIL-2
(AdLAK), are shown in lanes 8 and 9. Extracts made from tumor line 37.4 and 37.29 are shown in lanes 10 and 11. (B) Total protein extracts
derived from transgenic spleens or SCID spleens injected with wild-type
spleen cells or tumor spleen cells are shown. An extract obtained from
a tumor spleen derived from founder line 36 is shown in lane 2. Extracts from a SCID spleens injected 8 weeks earlier with wild-type
spleen cells are shown in lanes 3 and 5. An extract from a SCID spleen
injected with 1 × 108 cells from a line 36 tumor spleen
is shown in lane 4, and SCID spleens injected with independent tumors
from founder line 37 are shown in lanes 6 and 7. Note the presence of
TAg in the SCID spleens from the animals injected with granzyme H-TAg
splenic tumors.
|
|
Although we were able to define TAg+ populations within
most of the primary tumor spleens, we were not able to successfully perform two-color flow analysis for the primary tumors described above.
Single-color flow analysis of these tumors showed that most of the
tumors were comprised predominantly of either CD4+ cells or
NK1.1+ cells; two tumors were predominantly
CD8+. Histologic analysis suggested that many of these
tumors contained large numbers of cells that were reactive; therefore,
it is impossible to know which cells were the TAg+ tumor
cells and which were the reactive cells. However, improved technology
for detecting TAg with a novel permeabilization and fixation solution
allowed us to perform accurate two-color analysis on two tumors. An
example of one is shown in Fig 7. The top
panel represents two-color flow analysis of spleen cells from a
16-week-old nontransgenic mouse; the middle set of flow diagrams is
from a healthy 16-week-old mouse from founder line 37. The bottom panel represents the analysis from a massively enlarged spleen from a
20-week-old mouse from line 37. In the primary tumor, the
TAg+ cells are B220+, CD16+, and
NK1.1+. In the second tumor analyzed in this way (from
founder line 33), the TAg+ cells were predominantly
CD4+. Because of the heterogeneity in the cells in the
tumor-bearing spleens, we decided to further analyze the origins of the
primary tumor cells by cloning independent lines from several primary tumors.
View larger version (46K):
[in this window]
[in a new window]
| Fig 7.
Flow cytometric analysis of primary spleen cells. Spleen
cells from a 4-month-old wild-type spleen (top row), a 4-month-old
transgenic spleen from a founder line 37 (middle row), or a massively
enlarged spleen from an ill, 5-month-old line 37 mouse were subjected
to two-color flow cytometric analysis using an anti-TAg antibody and a
variety of lymphoid markers. In the representative tumor shown in this
figure, a significant proportion (60%) of the primary spleen cells
are TAg+. The TAg+ cells are
B220+, CD16+, and NK1.1+, but
do not stain for CD4 or CD8.
|
|
Ten independent tumors were placed into culture, but cell lines grew
out from only two tumors, one from a mouse derived from founder line 36 and one from founder line 37. Seven cell lines were obtained from the
line 36 tumor, and 11 from the line 37 tumor; the phenotypes of these
cell lines have been stable for more than 100 passages. Protein
extracts derived from all tumor cell lines contained abundant TAg by
Western analysis (see Fig 6A, lanes 10 and 11); flow cytometric
analysis also showed expression of TAg in all of the cell lines.
Dual-color flow studies (Fig 8 and
Table 1) showed that all of the cell lines
fell into one of four basic categories, designated A, B, C, and D. All
of the cell lines in all four categories were
NK1.1+/TAg+. In group A (five lines), the cells
were CD3- and CD8 . In group B (6 lines),
the NK1.1/TAg+ cells were CD3+
CD8. In groups C (3 lines) and D (4 lines), the
cells were CD3+ and CD8+. In categories A, B,
and C, the NK1.1+ cells were CD16+; however, in
category D, the NK1.1+ cells were CD16.
All of the cell lines were lymphocyte function-associated antigen (LFA)-1+ and IL-2 receptor  +,
but were CD2, LY49A, and LY49C negative (Table 1). Cell lines in
categories B and D exhibited 2B4 antigen positivity. All of the cell
lines were examined for rearrangements of the -subunit of the T-cell
receptor (TCR, Fig 9). Four of five cell
lines in group A (CD3) showed a germline configuration
of C 1 and C2,20 while all
cell lines derived from group B, C, and D (all of which are
CD3+) demonstrated TCR C2 rearrangements.
Many individual clones from the same tumor displayed unique TCR
rearrangements (see Fig 9, lane 3 v 6), suggesting that each
spleen contained several independently transformed clones that
contributed to the overall tumor phenotype.
View larger version (37K):
[in this window]
[in a new window]
| Fig 8.
Flow cytometric analyses of cell lines. Dual-color flow
analysis was performed with an antibody directed against TAg versus CD3
or CD8 (top panels) or with an antibody directed against CD16 versus
NK1.1 (bottom panel). Note that all four cell lines analyzed are
TAg+ NK1.1+. Cell lines from group A are
CD3 CD8, those in group B are
CD3+CD8, those in groups C and D are
CD3+ CD8+. Groups A, B, and C are
CD16+, while the cells from group D are
CD16.
|
|
View larger version (62K):
[in this window]
[in a new window]
| Fig 9.
TCR rearrangements in the tumor cell lines. Southern blot
analysis of tumor cell lines from groups A, B, C, and D was performed.
Genomic DNA from each of the cell lines was cut to completion with
HindIII, and analyzed by Southern blotting using a probe
specific for TCR C1 and C2. Note that the
cell lines in group A have a germline configuration of
C2, while those in groups B, C, and D have an altered or
absent C2 band, indicating that clonal rearrangement of
the TCR has occurred. RW-4 (lane 7) represents DNA from an embryonic
stem cell line with germline configurations of C1 and
C2.
|
|
The tumor phenotype could be transferred to secondary SCID recipients
with primary splenic tumors, or with the tumor cell lines. When 1 × 108 splenic tumor cells from founder lines 33, 36, or 37 were injected into C3H SCID recipients (n = 6), all of the
recipients developed large cell lymphomas in 8 to 10 weeks, and died of
these tumors. The spleens from SCID mice procured with these tumors
were all TAg+ (see Fig 6B, lanes 4, 6, and 7). In addition,
1 × 107 cells from each of six tumor cell lines were
injected into secondary SCID recipients; all of the recipients
developed fatal TAg+ lymphomas within 6 to 8 weeks.
Granzyme H-TAg tumor cell lines contain cytotoxic granules, but do
not exhibit direct cytotoxicity.
The morphology of all of the cultured tumor cell lines was virtually
identical. All of the cell lines consisted of large granular lymphocytes with prominent azurophil granules, abundant vacuolated cytoplasm, and large irregular nuclei (Fig 4H). RNA made from all 18 cell lines showed abundant expression of perforin and of granzymes A,
B, C, D, and F, as previously described (see Pham et al,11
Fig 2; cell line 3-1 is line 37.31); the pattern of granzyme gene
expression was identical to that for mouse LAK cells. Western
blots of protein extracts made from these cell lines also showed abundant perforin (that was capable of lysing sheep red blood
cells [RBCs]; S. Shresta and T. Ley, unpublished) and
granzyme B; granzyme B was localized immunohistochemically to the
granules of the cells (D. Thomas and T. Ley,
unpublished). Despite the fact that these cell lines
displayed cell surface integrins (Table 1) and contained all of the
same granular components as LAK cells, they were unable to kill in
direct cytotoxicity assays using susceptible YAC-1 targets (data not
shown). None of the cell lines tested showed antibody-directed cellular
cytotoxicity against a variety of target cell lines, nor did they
secrete detectable IL-2 or -interferon (IFN) (data not shown).
| |
DISCUSSION |
In this report, we have shown that the 5' flanking region of
human granzyme H contains cis-acting DNA sequences that allow it to specifically target expression of the SV40 TAg to the LAK cell
compartment of transgenic mice. Young mice bearing this transgene were
normal, but these mice developed a fatal lymphoma-like illness after 6 to 18 months of life. The tumors were apparently polyclonal, suggesting
that multiple tumors may arise nearly simultaneously within individual
spleens. The tumors were very aggressive and had morphologic features
and cell surface markers that suggested that they were comprised of T
and/or NK cells. Two IL-2-dependent cell lines derived from
the tumor spleens of these animals were shown to be NK1.1+
and variably expressed CD3, CD8, and CD16. Despite the fact that these
cell lines contain cytotoxic granule proteins, they were unable to kill
susceptible target cells.
Expression of human granzyme H is primarily restricted to LAK cells in
humans, and this gene is located between granzyme B and cathepsin G on
chromosome 14.3 Similarly, murine granzymes C, D, and F
have an expression pattern that is restricted to the LAK cell
compartment of mice, and these genes are also located between granzyme
B and cathepsin G in a gene cluster that includes many more genes than
its human counterpart.11 The 5' flanking region from
human granzyme H contain regions of homology with the 5' flanking
regions of murine granzymes C, D, F (and other NK-specific
genes21), and this region contains cis-acting
sequences that allow a reporter gene to be targeted specifically to the LAK compartment of transgenic animals. In sum, these data strongly suggest that granzyme H and murine granzymes C, D, and F are regulatory homologues of one another; however, these genes cannot be said to be
truly orthologous because the functions of these LAK/NK restricted
granzymes is not yet known.
Three independent founder lines bearing the granzyme H-TAg transgene
showed similar patterns of transgene expression, and developed similar
kinds of tumors. The tumors developed only after a long latency,
suggesting that secondary genetic events contribute to tumorigenesis.
The tumors were aggressive, large cell lymphomas, and tended to be
extensively disseminated in the mice at the time of clinical illness.
The percentage of TAg+ cells in the spleens of these
animals was highly variable, as was the morphologic tumor burden.
However, the morphology of the tumor cells in the spleens of these
animals was similar from tumor to tumor. The tumor phenotypes could be
transferred to SCID mouse recipients using primary tumors or the cloned
cell lines; the resulting tumors in the SCID mice were TAg+
and had the same morphology as the primary tumors.
Cell lines derived from two tumors contained several independent
transformed clones, suggesting that multiple independent transformation
events occurred within individual spleens. The cell lines derived from
the tumors were IL-2-dependent, and all exhibited expression of TAg,
NK1.1, and LFA-1. Expression of CD3, CD8, and CD16 was variable, so
that four different types of NK1.1+ cells were identified;
at least three of these types of cells existed within each of the
tumors from which the cell lines were cloned. Analysis of TCR
rearrangements from these cell lines showed that the CD3-
cell lines had germline TCR configurations, while CD3+ cell
lines uniformly had TCR rearrangements, again suggesting that multiple
independent transformed clones existed within individual spleens. These
data are similar to that reported by Hanahan et al,22-24 who have shown that TAg expressed
under the control of the rat insulin promoter is capable of yielding
multiple independent transformed islet cell tumors within a single
pancreas. The ability of SV40 TAg to interfere with the functions of
Rb and p5325-27 may allow multiple
independent progenitor cells within a spleen to acquire second genetic
hits that permit tumor progression within a relatively narrow time
frame. The cells that are tumorigenic retain expression of TAg and
express the cell surface NK1.1 marker after they are cloned in the
presence of high-dose IL-2. In the two primary tumors that we could
characterize by two-color flow, the TAg+ cells were
NK1.1+/CD16+ in one case, and predominantly
CD4+ in the other. Collectively, the results suggest that
the granzyme H-TAg transgene must be expressed during an early phase of
normal NK/T cell development, and then again in activated (but not
resting) NK cells. The variable presence of CD3, CD4, and CD8 on the
transformed cells or cell lines strongly suggest that the cell at risk
for transformation is capable of T-cell development, a situation that has previously been observed in many human tumors bearing NK
markers.28,29
The tumors that develop in granzyme H-TAg mice are similar to those
that develop in human patients with NK-large granular lymphocyte (LGL)
leukemia/lymphoma. These patients usually have systemic symptoms and
frequently develop massive hepatosplenomegaly with dissemination of the
lymphoma to multiple solid organs; frequently, these organs display
angiocentric and/or angiodestructive infiltrates. Patients with
NK leukemia/lymphoma usually display an aggressive clinical course, and
most patients die of disseminated disease within a few months of
presentation, despite therapy.28,30,31 NK-LGL
leukemia/lymphoma cells are usually CD3
CD56+ and usually contain numerous azurophilic granules.
Although normal human NK cells and many NK leukemia/lymphoma tumors are
CD3/CD56+/CD16+, some
individual patients with NK leukemia/lymphoma have
CD3+/CD56+ or
CD3+/CD8+/CD56+ tumor
cells,28-30,32-36 similar to that found in our cell lines from groups B, C, and D. Because patients with NK leukemia/lymphoma presumably have tumors that are derived from a single clone, usually only a single NK phenotype is present (although variability in CD16
expression can be observed). However, the cell surface phenotypes of NK
cells in patients and in our mice are similar, suggesting that similar
patterns of transformation during NK/T-cell development may occur in
both species.
All of the cell lines derived from granzyme H-TAg tumors have a similar
large granular lymphocyte morphology, with extensive vacuolization and
numerous azurophil granules in the cytoplasm. These cells have abundant
amounts of perforin and express very high levels of granzymes A, B, C,
D, and F, like that of LAK cells derived from normal animals. All of
the cell lines (regardless of the cell surface profile) display
virtually identical patterns of perforin and granzyme gene expression.
Despite the fact that these cells seem to be armed with cytotoxic
granules, they display no direct cytotoxicity against the susceptible
YAC-1 cell line. Similarly, they had no detectable antibody-directed
cellular cytotoxicity (data not shown). All of the cell lines expressed
LFA-1 (Table 1) so binding of these cell lines to susceptible target
cells should be possible. While none of the cell lines expressed 5e6 (LY-49C), a molecule that is proposed to interact with a self-major histocompatability complex (MHC) class I receptor to initiate the
inhibitory signal,37,38 all of the lines expressed NK1.1, which (in humans) is required for activation of the NK cytolytic pathway.32 Further experiments will be required to
precisely define the nature of the cytotoxic defect in these cells.
In conclusion, the human granzyme H gene appears to have many features
that are similar to that of murine granzymes C, D, and F; these genes,
located between granzymes B and cathepsin G within their respective
gene clusters, are preferentially expressed in the LAK/NK compartment.
Although these genes are regulatory homologues, their roles in the
normal function of NK/LAK cells has not yet been defined; selective
loss-of-function mutations of these murine granzymes should further
define their normal roles. In addition, regulatory sequences near these
genes may be very useful for targeting novel genes of interest to the
NK/LAK compartment to create more precise mouse models of NK-LGL
leukemia/lymphoma.
| |
ACKNOWLEDGMENT |
The authors thank Drs John Russell, Wayne Yokoyama, and Bill Grossman
for helpful suggestions and advice during the course of this project,
and Dan Link for critically reading the manuscript. We thank Brian Rush
and Koho Iizuka for measuring IL-2 and -IFN levels in the NK cell
lines. Dr David Skalnik kindly provided the TAg fragment and 410b cell
line. The authors thank Dr M.D. Kraus for expert assistance with
interpretation of histopathology. We thank Robin Wesselschmidt and Pam
Goda for the production and care of these animals, respectively. Nancy
Reidelberger expertly prepared the manuscript.
| |
FOOTNOTES |
Submitted July 23, 1997; accepted September 25, 1998.
Supported by Grants No. DK49786 and CA49712 from the National
Institutes of Health and the Washington University/Monsanto Agreement.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Timothy J. Ley, MD, Washington University
Medical School, 660 S Euclid, Box 8007, St Louis, MO 63110-1093.
| |
REFERENCES |
1.
Haddad P, Dieter J, Tschopp J, Clément M-V, Mathieu-Mahul D, Sasporte M:
Structure and evolutionary origin of the human granzyme H gene.
Int Immunol
3:57, 1990[Abstract/Free Full Text]
2.
Klein JL, Selvakumar A, Trapani JA, Dupont B:
Characterization of a novel human cytotoxic lymphocyte-specific serine protease cDNA clone (CSP-C).
Tissue Antigens
35:220, 1990[Medline]
[Order article via Infotrieve]
3.
Heusel JW, Hanson RD, Silverman GA, Ley TJ:
Structure and expression of a cluster of human hematopoietic serine protease genes found on chromosome 14.11.2.
J Biol Chem
266:6152, 1991[Abstract/Free Full Text]
4.
Ojcius DM, Zheng LM, Sphicas EC, Zychlinsky A, Young JD-E:
Subcellular localization of perforin and serine esterase in lymphokine-activated killer cells and cytotoxic T cells by immunogold labeling.
J Immunol
146:4427, 1991[Abstract]
5.
Hanson RD, Hohn PA, Popescu NC, Ley TJ:
A cluster of hematopoietic serine protease genes is found on the same chromosomal band as the human / T-cell receptor locus.
Proc Natl Acad Sci USA
87:960, 1990[Abstract/Free Full Text]
6.
Heusel JW, Scarpati EM, Jenkins NA, Gilbert DJ, Copeland NG, Shapiro SD, Ley TJ:
Molecular cloning, chromosomal location, and tissue-specific expression of the murine cathepsin G gene.
Blood
81:1614, 1993[Abstract/Free Full Text]
7.
Crosby JL, Bleackley RC, Nadeau JH:
A complex of serine protease genes expressed preferentially in cytotoxic T-lymphocytes is closely linked to the T-cell receptor - and -chain genes on mouse chromosome 14.
Genomics
6:252, 1990[Medline]
[Order article via Infotrieve]
8.
Garcia-Sanz JA, MacDonald HR, Jenne DE, Tschopp J, Nabholz M:
Cell specificity of granzyme gene expression.
J Immunol
145:3111, 1990[Abstract]
9.
Jenne DE, Masson D, Zimmer M, Haefliger J-A, Li W-H, Tschopp J:
Isolation and complete structure of the lymphocyte serine protease granzyme G, a novel member of the granzyme multigene family in murine cytolytic T lymphocytes. Evolutionary origin of lymphocyte proteases.
Biochemistry
28:7953, 1989[Medline]
[Order article via Infotrieve]
10.
Lobe CG, Upton C, Duggan B, Ehrman N, Letellier M, Bell J, McFadden G, Bleackley RC:
Organization of two genes encoding cytotoxic T lymphocyte-specific serine proteases CCPI and CCPII.
Biochemistry
27:6941, 1988[Medline]
[Order article via Infotrieve]
11.
Pham CTN, MacIvor DM, Hug BA, Heusel JW, Ley TJ:
Long-range disruption of gene expression by a selectable marker cassette.
Proc Natl Acad Sci USA
93:13090, 1996[Abstract/Free Full Text]
12.
Hanson RD, Ley TJ:
Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.
Mol Cell Biol
10:5655, 1990[Abstract/Free Full Text]
13.
Hanson RD, Sclar GM, Kanagawa O, Ley TJ:
The 5'-flanking region of the human CGL-1/granzyme B gene targets expression of a reporter gene to activated T-lymphocytes in transgenic mice.
J Biol Chem
266:24433, 1991[Abstract/Free Full Text]
14.
Reddy VB, Thimmappaya B, Dhar R, Subramanian KN, Zain BS, Pan J, Ghosh PK, Celma ML, Weissman SM:
The genome of Simian virus 40.
Science
200:494, 1978[Abstract/Free Full Text]
15.
Heusel JW, Wesselschmidt RL, Shresta S, Russell JH, Ley TJ:
Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells.
Cell
76:977, 1994[Medline]
[Order article via Infotrieve]
16.
Shresta S, MacIvor DM, Heusel JW, Russell JH, Ley TJ:
Natural killer and lymphokine-activated killer cells require granzyme B for the rapid induction of apoptosis in susceptible target cells.
Proc Natl Acad Sci USA
92:5679, 1995[Abstract/Free Full Text]
17.
Russell JH, Masakowski V, Rucinsky T, Phillips G:
Mechanisms of immune lysis. III. Characterization of the nature and kinetics of the cytotoxic T-lymphocyte-induced nuclear lesion in the target.
J Immunol
23:2087, 1982
18.
Skalnik DG, Dorfman DM, Willliams DA, Orkin SH:
Restriction of neuroblastoma to the prostate gland in transgenic mice.
Mol Cell Biol
11:4518, 1991[Abstract/Free Full Text]
19.
Behringer RR, Peschon JJ, Messing A, Gartside CL, Hauschka SD, Palmiter RD, Brinster RL:
Heart and bone tumors in transgenic mice.
Dev Biol
85:2648, 1988
20.
Malissen M, Minard K, Mjolsness S, Kronenberg M, Goverman J, Hunkapiller T, Prystowsky MB, Yoshikai Y, Fitch F, Mak TW, Hood L:
Mouse T cell antigen receptor: Structure and organization of constant and joining gene segments encoding the polypeptide.
Cell
37:1101, 1984[Medline]
[Order article via Infotrieve]
21.
Gessner JE, Grussenmeyer T, Dumbsky M, Schmidt RE:
Separate promoters from proximal and medial control regions contribute to the natural killer cell-specific transcription of the human FcgRIII-A (CD16-A) receptor gene.
J Biol Chem
271:30755, 1996[Abstract/Free Full Text]
22.
Hanahan D:
Heritable formation of pancreatic -cell tumours in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes.
Nature
315:115, 1985[Medline]
[Order article via Infotrieve]
23.
Parangi S, Dietrich W, Christofori G, Lander ES, Hanahan D:
Tumor suppressor loci on mouse chromosomes 9 and 16 are lost at distinct stages of tumorigenesis in a transgenic model of islet cell carcinoma.
Cancer Res
55:6071, 1995[Abstract/Free Full Text]
24.
Dietrich WF, Radany EH, Smith JS, Bishop JM, Hanahan D, Lander ES:
Genome-wide search for loss of heterozygosity in transgenic mouse tumors reveals candidate tumor suppressor genes on chromosomes 9 and 16.
Proc Natl Acad Sci USA
91:9451, 1994[Abstract/Free Full Text]
25.
Manfredi JJ, Prives C:
Binding p53 and p105-Rb is not sufficient for oncogenic transformation by a hybrid polyomavirus-simian virus 40 large T antigen.
J Virol
64:5250, 1990[Abstract/Free Full Text]
26.
Zhu JY, Rice PW, Gorsch L, Abate M, Cole CN:
Transformation of a continuous rat embryo fibroblast cell line requires three separate domains of simian virus 40 large T antigen.
J Virol
66:2780, 1992[Abstract/Free Full Text]
27.
Zhu JY, Abate M, Rice PW, Cole CN:
The ability of simian virus 40 large T antigen to immortalize primary mouse embryo fibroblasts cosegregates with its ability to bind to p53.
J Virol
65:6872, 1991[Abstract/Free Full Text]
28.
Jaffe ES:
Classification of natural killer (NK) cell and NK-like T-cell malignancies.
Blood
87:1207, 1996[Free Full Text]
29.
Spits H, Lanier LL, Phillips JH:
Development of human T and natural killer cells.
Blood
85:2654, 1995[Free Full Text]
|
Top
Abstract
Introduction