|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 4 (February 15), 1999:
pp. 1137-1144
RAPID COMMUNICATION
Interferon- Upregulates CCR5 Expression in Cord and Adult Blood
Mononuclear Phagocytes
By
Deepa Hariharan,
Steven D. Douglas,
Benhur Lee,
Jian-Ping Lai,
Donald E. Campbell, and
Wen-Zhe Ho
From the Divisions of Neonatology and Immunologic and Infectious
Diseases and the Clinical Immunology Laboratories, The Children's
Hospital of Philadelphia, Philadelphia, PA; and the Division of
Pathology and Laboratory Medicine, University of Pennsylvania School of
Medicine, Philadelphia, PA.
 |
ABSTRACT |
The C-C chemokine receptors CCR5 and CCR3 are fusion coreceptors for
human immunodeficiency virus (HIV) entry into macrophages. The
regulation of their expression influences infectivity by HIV. We report
here that interferon- (IFN-) a cytokine that has bidirectional effects on HIV infection of macrophages, significantly upregulated CCR5
and CCR3 cell surface expression in human mononuclear phagocytes isolated from placental cord blood and adult peripheral blood. Monocytes treated with IFN- showed increased chemotaxis to the CCR5
ligands macrophage inflammatory protein-1 (MIP-1) and MIP-1 , confirming the functional relevance of IFN--induced CCR5
expression. However, IFN- suppressed HIV entry into macrophages.
Interestingly, we demonstrated that IFN- inhibited cell surface
expression of CD4, the major receptor for HIV. This finding may explain
the suppressive effect of IFN- on HIV entry into macrophages,
despite its enhancing effect on the expression of CCR5 and CCR3 by
these cells. In addition, IFN--induced secretion of C-C chemokines (RANTES, MIP-1, and MIP-1) by mononuclear phagocytes may also suppress HIV entry into macrophages. These data provide further evidence for cytokine-mediated regulation of CCR5 expression and are
consistent with a novel paradigm in which cytokines regulate HIV
infection and leukocyte migration by reciprocal and opposing effects on
the expression of CD4 and chemokine receptors.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
INTERFERON- (IFN-), a cytokine with
multiple immunoregulatory effects, mediates host defence against
several infections and is a potent activator of mononuclear
phagocytes.1 The role of IFN- in modulating human
immunodeficiency virus (HIV) infection is well established. IFN- has
been shown to have suppressive as well as enhancing effects on HIV
replication.2-4 However, the underlying mechanisms are
incompletely understood. IFN- secretion is dysregulated in children
with perinatally transmitted HIV infection.5,6
Chemokines are chemotactic cytokines of which there are two main
classes: C-X-C ( ) chemokines, which are primarily active on
neutrophils, and C-C () chemokines, which act on several leukocyte populations (monocytes, basophils, eosinophils, and natural killer [NK] cells).7 Chemokines bind to and activate
seven-transmembrane domain receptors.7 Chemokines and their
receptors play a crucial role in immune and inflammatory reactions and
in HIV infection. The C-C chemokine receptors CCR5, CCR2b, and CCR3 are
fusion coreceptors for HIV entry into macrophages.8-12 Of
these, CCR5 is a major determinant of HIV entry into
macrophages.8-12 Individuals with homozygous mutant of CCR5
are highly resistant to HIV infection.13 Therefore, the
expression pattern of CCR5 and its regulation are thought to influence
HIV infection and acquired immunodeficiency syndrome (AIDS)
pathogenesis. Three C-C chemokines that are ligands for
CCR5 RANTES (regulated upon activation, normal T-cell expressed and
secreted), macrophage inflammatory protein-1 (MIP1-), and MIP1-inhibit HIV infection of macrophages and are being
investigated as potential therapeutic agents in HIV
infection.14,15 Although the roles of CCR5 and C-C
chemokines in HIV infection are well established, little is known about
the regulation of the C-C chemokine system. Understanding the
regulation of HIV coreceptors will help to elucidate the interplay
between these receptors and HIV in the pathogenesis of AIDS. Therefore,
we investigated the in vitro effect of IFN- on CCR5 expression in
mononuclear phagocytes isolated from placental cord blood and adult
peripheral blood.
| |
MATERIALS AND METHODS |
Cells.
Monocytes were obtained according to our previously described
technique16 from the cord blood of healthy, term neonates and healthy adult donors. In brief, mononuclear cells were separated by
centrifugation for 45 minutes over Lymphocyte Separation Medium (LSM;
Organon Teknika Corp, Durham, NC) at 1,500g. The mononuclear cell layer was collected and incubated with Dulbecco's modified Eagle
medium (DMEM) in gelatin-coated flasks for 45 minutes at 37°C,
followed by washing off nonadherent cells with DMEM. After detachment
with ethylenediamine tetra-acetic acid (EDTA), monocytes were
resuspended in DMEM supplemented with 10% fetal bovine serum, 2 mmol/L
glutamine, penicillin (100 U/mL), streptomycin (100 µg/mL), and
nonessential aminoacids and plated in 48-well culture plates at a
density of 106 cells/mL. The monocytes were greater than
97% pure as assessed by fluorescence-activated cell sorting using
monoclonal antibody (MoAb) against CD14 (Leu-M3). Freshly isolated
monocytes (within 48 hours postisolation) and monocyte-derived
macrophages (MDM; 7 to 8 days postisolation) were used for the study.
Reagents.
Human recombinant IFN-, IFN-, and IFN- and polyclonal blocking
rabbit antihuman IFN- antibody were obtained from Genzyme (Cambridge, MA). Monoclonal mouse antibodies to CCR5 (2D7) and CCR3
(7B11) from LeukoSite Inc (Cambridge, MA) were obtained through the
AIDS Research and Reference Reagent Program, Division of AIDS, NIAID,
NIH (Rockville, MD). Fluorescein-conjugated (FITC) goat antimouse
antibody, CD4-FITC, IgG1-FITC, and IgG2a-FITC were obtained from
Immunotech (Westbrook, ME). Recombinant human MIP-1 and MIP-1 and
enzyme-linked immunosorbent assay (ELISA) kits for MIP-1, MIP-1,
and RANTES were purchased from R&D Systems (Minneapolis, MN).
Flow cytometry.
To determine CCR5 and CCR3 expression by indirect immunofluorescence, 2 × 105 monocytes or MDM were suspended in 100 µL of
phosphate-buffered saline (PBS; 1×) and incubated first with
unlabeled CCR5 antibody (2D7) or CCR3 antibody (7B11) for 30 minutes at
4°C. The cells were then washed twice with PBS and incubated with the
second antibody, fluorescein-conjugated goat antimouse antibody, for 30 minutes at 4°C. After washing again with PBS, the cells were fixed
with 1% paraformaldehyde in PBS. CD4 expression was determined by
direct immunofluorescence. Fluorescein-conjugated control antibodies were isotype-matched for CCR5/CCR3 (IgG2a) and CD4 (IgG1). Fluorescence was analysed on an EPICS-elite flow cytometer (Beckman-Coulter Electronics, Hialeah, FL). In some cases, results are expressed as the
relative fluorescence intensity (RFI), calculated according to the formula: RFI = mean fluorescence (sample)  mean fluorescence (control)/mean fluorescence (control).
Polymerase chain reaction (PCR) analysis for CCR5.
Total cellular RNA was extracted by the single-step, acid guanidium
thiocyanate-phenol-chloroform extraction. Total RNA (1 µg) was
reverse transcribed using Reverse Transcription System (Promega,
Madison, WI) with the specific primers for CCR5
(antisense) for 1 hour at 42°C, and the resulting cDNA was used as a
template for PCR amplification. PCR amplification was performed with
one tenth of the cDNA for 40 cycles with AmpliTaq Gold (Perkin Elmer, Branchburg, NJ) in a GeneAmp PCR system 2400 (Perkin Elmer-Cetus, Norwalk, CT). The PCR reaction mixture contained 0.2 mmol/L of dNTPs, 20 pmol/L of each of two primers, and 1.5 U of
AmpliTaq Gold in 1× reaction buffer (Perkin Elmer). Each PCR
amplification consisted of heat inactivation of AmpliTaq Gold for 8.5 minutes at 94°C, followed by 5 cycles of 94°C for 1 minute, 55°C
for 1 minute, and 72°C for 1.5 minutes; 35 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds; and
elongation at 72°C for 7 minutes, using the specific primers for
CCR5: 5' CAAAAAGAAGGTCTTCATTACACC 3' (sense); 5'
CCTGTGCCTCTTCTTCTCATTTCG 3' (antisense).13 Quantification of CCR5 mRNA was performed by a competitive PCR procedure using a
competitor DNA fragment carrying the identical primer recognition sites
for CCR5. The competitor DNA fragment was constructed using PCR MIMIC
construction kit (Clontech, Palo Alto, CA). Increasing dilutions of the
competitive templates were added to the same amount of cDNA from the
samples. The cycle conditions were the same as those mentioned above.
Amplification products were resolved by 4% agarose gel electrophoresis
and quantified by densitometric scanning. According to the principles
of competitive PCR, quantification of the target molecules in the
samples was obtained by estimation of the ratio between the
amplification products (ratio of competitor to CCR5). -Actin was
used as the control to monitor the amount and integrity of RNA in each sample.
Chemotaxis.
Monocytes were incubated with or without IFN- (10, 100, 500, and
1,000 U/mL) for 12 hours in Teflon wells. Cell migration was measured
in 96-well chemotaxis chambers (Neuro Probe Inc, Cabin John, MD).
Thirty microliters of chemoattractant solution (MIP-1 or MIP-1)
at a concentration of 10 ng/mL or control medium (DMEM with 1% fetal
calf serum [FCS]) was added to the lower wells of a chemotaxis
chamber. A polycarbonate filter (5-µm pore size; Neuro Probe) was
layered onto the wells. Twenty-seven microliters of cell suspension
(1.5 × 106 monocytes/mL) were seeded in the wells in
the upper part of the filter. The chamber was incubated at 37°C in
air with 5% CO2 for 2 hours. At the end of the incubation,
filters were removed and fixed and the number of cells in five
high-power oil-immersion fields were counted. All assays were performed
in triplicate.
Luciferase reporter virus entry assay.
Recombinant luciferase-encoding HIV virions pseudotyped with M-tropic
ADA Env were used to study HIV infectability of untreated and
IFN--treated MDM. The plasmid encoding HIV ADA was provided by John
Moore (Aaron Diamond AIDS Research Center, New York, NY), and the NL4-3
luciferase virus backbone was provided by Ned Landau (Aaron Diamond
AIDS Research Center). In brief,
NL4-3-Luc-R E virus stocks pseudotyped by
ADA were generated by transfecting 293T cells with
NL4-3-Luc-RE and pSV7d-based expression
vectors encoding HIV ADA. Virus-containing supernatants were collected
48 hours posttransfection and frozen at 70°C. MDM at a
concentration of 1 × 106 cells/mL in 48-well plates were
infected for 4 hours with 100 µL of the supernatants (50 ng of
p24gag virus). At 72 hours postinfection, the cells were
lysed in 150 µL of 0.5% Triton-X-100 in 1× PBS. Luciferase
activity was determined in 50 µL of each lysate in a Wallac Trilux
Microbeta luminometer (Wallac, Turku, Finland).
HIV infection and reverse transcriptase (RT) assay.
MDM at a concentration of 1 × 106 cells/mL in 48-well
plates were infected by adding 0.05 mL of HIV BaL virus
(5 × 105 cpm/mL of RT activity) to each well. After 3 hours the inoculum was removed and the cells were washed three times
with DMEM to remove unabsorbed virus. Supernatants were tested for RT
activity every 5 days. To determine the level of RT activity, 10 µL
of culture supernatants was added to 50 µL of a cocktail containing poly (A), oligo (dt), MgCl2, Nonidet p-40, and
[32P]dTTP and incubated for 20 hours at 37°C. Thirty
microliters of the reaction mixture was then spotted on DE 81 paper and
air-dried. The filters were then washed in 2× standard saline citrate
(SSC; 0.3 mol/L NaCl/0.03 mol/L sodium citrate, pH 7) and 100%
ethanol, dried, cut, and placed in a scintillation counter (LS 7000;
Beckman Instruments, Inc, Palo Alto, CA) for measurement of radioactivity.
Statistical analysis.
The data were analyzed using the Student's t-test for paired samples.
| |
RESULTS |
Effect of IFN- on CCR5 expression in mononuclear
phagocytes.
Monocytes obtained from the cord blood of healthy, term neonates and
healthy adult donors and MDM (7 to 8 days postisolation) were incubated
for 24 hours under one of the following conditions: control
(untreated), IFN-, or IFN- plus anti-IFN- antibody. Cells
expressing CCR5 were identified by immunofluorescence staining and flow
cytometry. Cord and adult blood monocytes treated with IFN- showed
increased CCR5 cell surface expression in comparison to untreated cells
(Fig 1), with respect to the percentage of cells positive for CCR5 (IFN-, 50% to 94%; untreated, 1% to 30%; P < .001) and mean fluorescence intensity (IFN-, 6 to
29; untreated, 2.6 to 10; P < .05). In contrast, monocytes
treated with IFN- (200 U/mL) and IFN- (200 U/mL) did not show
significant changes in CCR5 expression (data not shown). Monocytes
derived from cord blood (n = 10) showed slightly lower levels of CCR5
expression in comparison to monocytes from adult blood (n = 10)
(percentage of untreated cells positive for CCR5: cord, 1% to 18%;
adult, 2% to 34%; P = .16). Monocytes derived from cord and
adult blood showed similar levels of augmentation of CCR5 expression in
response to IFN- (6- to 10-fold). Significant stimulation of CCR5
expression was observed at a concentration of 10 U/mL of IFN-, with
only a slight increase in CCR5 expression with higher doses of IFN- (100 U/mL to 1,000 U/mL; Fig 2). The
augmentation of CCR5 expression by IFN- was inhibited by polyclonal
anti-IFN- antibody (Fig 2). Significant stimulation of CCR5
expression was seen at 12 hours after incubation with IFN-, whereas
the maximum effect occurred at 18 to 24 hours after treatment with
IFN- (data not shown).
View larger version (30K):
[in this window]
[in a new window]
| Fig 1.
Effect of IFN- on CCR5 expression in monocytes. Cord
and adult blood monocytes (1 × 106 cells/mL) were
incubated with IFN- (500 U/mL) for 24 hours. CCR5 expression was
determined by flow cytometry. The shaded histogram represents control
staining with isotype-matched antibody (IgG2a). The open histogram
represents CCR5 expression using 2D7 MoAb. Results are shown as the
percentage of CCR5-positive cells and are representative of 10 cord
blood samples and 10 adult donors.
|
|
View larger version (14K):
[in this window]
[in a new window]
| Fig 2.
Effect of various doses of IFN- and anti-IFN-
antibody. Monocytes were either untreated, pretreated for 24 hours with
IFN- at the concentrations indicated, or pretreated for 24 hours
with IFN- (500 U/mL) plus anti-IFN- antibody. CCR5 expression
was determined by flow cytometry. Results are shown as the percentage
of cells positive for CCR5 expression (mean ± SEM) (A) and as the
RFI (B) and are representative of 3 cord blood samples and 2 adult
donors (*P < .05, **P < .01, IFN- v
untreated).
|
|
MDM also showed higher levels of CCR5 expression, after incubation with
IFN-, in comparison to untreated cells (Fig
3). Interestingly, we observed
downregulation of CCR5 expression after the isolation of monocytes, and
during the differentiation of monocytes to macrophages, in vitro (Fig
3). However, MDM showed a greater degree of augmentation of CCR5
expression in response to IFN- (10- to 15-fold) in comparison to
monocytes (6- to 10-fold; Fig 3).
View larger version (20K):
[in this window]
[in a new window]
| Fig 3.
Effect of state of differentiation of mononuclear
phagocytes on CCR5 expression. Untreated mononuclear phagocytes from
adult blood (n = 2) and cord blood (n = 3) were examined for
CCR5 expression immediately after isolation, at 48 hours postisolation,
and at 8 days postisolation. Monocytes at 24 hours postisolation and
MDM at 7 days postisolation were also incubated with IFN- (500 U/mL
for 24 hours), and CCR5 expression was studied in IFN--treated
cells at 48 hours and 8 days postisolation. Results are shown as the
percentage of cells staining positive for CCR5 expression by flow
cytometry (mean ± SEM). Similar changes were seen in mean
fluorescence intensity (data not shown).
|
|
Semiquantitative RT-PCR analysis showed no significant increase in CCR5
mRNA in monocytes at 30 minutes, 1 hour, 2 hours, and 4 hours after
treatment with IFN-. Competitive PCR confirmed similar levels of
CCR5 mRNA in IFN--treated and untreated monocytes (Fig
4), indicating that upregulation of CCR5
expression by IFN- occurs at the posttranscriptional level.
View larger version (40K):
[in this window]
[in a new window]
| Fig 4.
(A) RT-PCR analysis of the effect of IFN- on CCR5
mRNA. Monocytes were incubated with IFN- (500 U/mL) and total
cellular RNA was extracted at 30 minutes, 1 hour, 2 hours, and 4 hours
after incubation with IFN-. (B) Competitive PCR analysis for
quantification of mRNA. cDNA from the samples (untreated monocytes and
monocytes incubated with IFN- for 30 minutes) were mixed with
varying dilutions of the competitor DNA fragment and amplified with
CCR5 primer sets. Lanes 1 through 6 represent increasing dilutions of
competitor DNA fragment (3 × 106,
1.5 × 106, 0.7 × 106,
0.35 × 106, 3 × 105, and
3 × 104 molecules/µL). Amplification products were
resolved by 4% agarose gel electrophoresis and the ratios of
competitor/CCR5 DNA for untreated and IFN--treated cells were
determined by densitometric scanning. Lane to lane variation in RNA
loading was less than 18% as assessed by densitometric analysis of
-actin expression. Representative results from 4 cord blood samples
are shown.
|
|
Functional relevance of IFN--induced CCR5
expression.
To determine the physiologic significance of IFN--induced CCR5
expression, chemotactic migration of untreated and IFN--treated monocytes to the CCR5 ligands MIP-1 and MIP-1 was studied.
Pretreatment of monocytes with various concentrations of IFN- (10 to
1,000 U/mL) for 12 hours resulted in a significant increase in the
number of cells migrating in response to MIP-1 and MIP-1 in a
concentration-dependent fashion (Fig 5).
This effect was best evident at a concentration of 10 ng/mL of these
chemokine agonists and confirms the functional relevance of
IFN--induced CCR5 expression.
View larger version (25K):
[in this window]
[in a new window]
| Fig 5.
Effect of IFN- on chemotaxis to MIP-1 and MIP-1.
Monocytes from adult blood (n = 2) and cord blood (n = 1) were
incubated for 12 hours with IFN- (10, 100, 500, and 1,000 U/mL).
Migration of untreated and IFN--treated monocytes to control
medium, MIP-1, and MIP-1 (10 ng/mL) was studied as described in
Materials and Methods. Results (number of cells migrated per high power
field after subtraction of spontaneous migration; mean ± SEM; 3 replicates) from 1 representative donor are shown
(*P < .05, IFN- v untreated).
|
|
Effect of IFN- on HIV entry into MDM.
To study the effect of IFN--induced enhancement of CCR5 cell
surface expression on HIV entry into MDM, untreated MDM and MDM
pretreated with IFN- (500 U/mL for 24 hours) were infected in vitro
with recombinant luciferase-encoding HIV particles pseudotyped with ADA
(M-tropic) Env. Upregulation of CCR5 expression by IFN- was
confirmed by flow cytometry before infecting the cells from the same
donor. Interestingly, we observed that the M-tropic ADA strain that
uses CCR5 as the major fusion coreceptor for entry into MDM was unable
to infect IFN--treated MDM, as indicated by the very low levels of
luciferase activity in these cells in comparison to untreated cells
(Fig 6A). Infection of untreated and
IFN--pretreated MDM with the M-tropic HIV strain BaL confirmed suppression of HIV infection of macrophages by IFN-, as determined by the measurement of reverse transcriptase activity in the culture supernatants (Fig 6B).
View larger version (18K):
[in this window]
[in a new window]
| Fig 6.
Effect of IFN- on HIV infection of MDM. (A)
Recombinant luciferase-encoding HIV reporter viruses pseudotyped with
ADA Env were used to infect untreated MDM and IFN--pretreated MDM
(500 U/mL for 24 hours). Luciferase activity was quantitated in cell
lysates 72 hours after infection. Results are representative of 4 (3 cord and 1 adult) experiments (*P < .0001, IFN-
v untreated). (B) Untreated or IFN--pretreated (500 U/mL
for 24 hours) MDM were infected with BaL strain of HIV and reverse
transcriptase activity was measured in the culture supernatants at the
times indicated. Each experiment was performed in triplicate and
variability between triplicate results was less than 15%.
Representative results from 4 donors (3 cord and 1 adult) are shown.
|
|
Effect of IFN- on CCR3 and CD4 expression in
mononuclear phagocytes.
To understand the mechanisms involved in the inhibition of HIV entry
into macrophages by IFN- (despite upregulation of CCR5 expression),
we then studied the effects of IFN- on the expression of other
receptors that mediate entry of M-tropic HIV strains into macrophages.
We observed that IFN- also upregulated cell surface expression of
CCR3, another chemokine coreceptor for M-tropic HIV. However, IFN-
inhibited cell surface expression of CD4, the major receptor for HIV
(Fig 7). To confirm the suppressive effect
of CD4 downregulation on HIV infection of macrophages, we then infected
MDM using recombinant luciferase-encoding HIV particles pseudotyped
with M-tropic (ADA) Env after blocking CD4 with anti-CD4 (Leu 3a) MoAb.
Before infection, the cells were either untreated or incubated with
anti-CD4 or control (irrelevent) MoAb at 5 µg/mL for 30 minutes.
Blocking CD4 on MDM using anti-CD4 MoAb completely inhibited entry of
M-tropic HIV, whereas pretreatment of MDM with control MoAb failed to
inhibit HIV infection (data not illustrated).
View larger version (24K):
[in this window]
[in a new window]
| Fig 7.
Effect of IFN- on CCR3 and CD4 expression. Monocytes
were incubated with IFN- (500 U/mL) for 24 hours. CCR3 and CD4
expression were determined in untreated and IFN--treated monocytes
by flow cytometry. The shaded histograms represent control staining
with isotype-matched antibodies, and the open histograms represent
cells staining positive for CCR3 and CD4. Results are shown as the
percentage of cells positive for CCR3 or CD4 expression and are
representative of 3 cord blood samples.
|
|
Effect of IFN- on C-C chemokine secretion by
mononuclear phagocytes.
To determine whether IFN- modulates C-C chemokine secretion in
monocytes, monocytes isolated from cord and adult blood were incubated
with or without IFN- (500 U/mL) for 72 hours, after which the
supernatants were harvested for ELISA. Increased levels of MIP-1,
MIP-1, and RANTES were demonstrated in the supernatants from
IFN--treated monocyte cultures compared with supernatants from
untreated cells (Fig 8).
View larger version (44K):
[in this window]
[in a new window]
| Fig 8.
Effect of IFN- on C-C chemokine secretion. Monocytes
were incubated for 72 hours with IFN- (500 U/mL), and the
supernatants from untreated and IFN--treated cells were assayed for
MIP-1, MIP-1, and RANTES by ELISA. Results are representative of
3 cord blood samples (*P < .05, IFN- v
untreated).
|
|
| |
DISCUSSION |
IFN- has bidirectional effects on HIV infection of macrophages. Some
investigators demonstrated suppressive effects of IFN- on HIV
infection of macrophages.3 Dichotomous effects of IFN- on HIV replication have also been observed, with inhibition of virus
expression in primary mononuclear phagocytes pretreated with this
cytokine and upregulation of p24 Ag production in cells treated with
IFN- after infection.4 Elevated levels of IFN- and/or the IFN--inducible factor neopterin have been found
in the plasma and cerebrospinal fluid17 and in the lymph
nodes of HIV-infected persons,18 in which the number of
infected cells actively expressing HIV is higher compared with
peripheral blood,19 suggesting a potential role for IFN-
in the in vivo regulation of HIV infection. Peripheral blood
mononuclear cells from HIV-infected children show decreased
stimulus-induced secretion of type 1 cytokines (interleukin-2 [IL-2]
and IFN-) in association with disease progression.5,6 IFN- has been used as a therapeutic agent in the treatment of HIV
infection, and AIDS-associated Kaposi's sarcoma20,21 and reduction of p24 antigen levels and improvement of immune function and
clinical course have been described.20 The mechanisms
responsible for the suppressive or enhancing effects of IFN- on HIV
infection of macrophages are unclear.
In this study, we demonstrate that IFN- upregulates CCR5 and CCR3
expression in cord and adult blood monocytes and MDM at the
posttranscriptional level. Upregulation of expression of the coreceptors CCR5 and CCR3 may potentially increase HIV entry into macrophages. However, we observed suppression of HIV infection of
macrophages by IFN-. Our further experiments showed pronounced inhibition of expression of the major HIV receptor CD4 in monocytes pretreated with IFN-. This is in agreement with the findings of
Dhawan et al22 and may explain the suppressive effect of IFN- on HIV entry into macrophages, despite its enhancing effect on
the expression of CCR5 and CCR3 by these cells. The CD4 dependence for
infection by M-tropic HIV strains has been
established.23,24 Di Marzio et al24 observed
that completely blocking CD4 on MDM using anti-CD4 MoAb completely
inhibited entry of M-tropic HIV strains, whereas completely blocking
CCR5 on MDM inhibited viral entry only by 60%. In addition,
IFN--induced secretion of C-C chemokines by monocytes may also
contribute to suppression of HIV infection of macrophages.
The in vitro effects of IFN- on HIV infection depend on experimental
conditions. We observed increased CCR5 and CCR3 expression and
decreased infectability by HIV (ADA strain) in human MDM pretreated for
24 hours with this cytokine. However, Zella et al25
observed increased CCR5 and CCR3 expression and enhanced susceptibility to HIV infection (HXB strain) in monocytoid U937 cells pretreated with
IFN- for 5 days. The differences between our findings and these
observations may be due to differences in the cell types used, the
duration of pretreatment with IFN-, and the HIV strains used. The in
vivo interpretations of these findings remain to be determined. IFN-
has diverse effects on the expression of various chemokine receptors.
Although it upregulates CCR5 and CCR3 expression, it has been shown to
inhibit CCR2 expression in mononuclear phagocytes.26
Mononuclear cells from neonates have diminished ability to secrete
IFN- in comparison to cells from adults.27 We have
reported increased susceptibility of neonatal macrophages to HIV
infection compared with adult macrophages.28 We observed
similar expression of CD4 on cord and adult blood mononuclear
phagocytes. Whether the enhanced susceptibility of neonatal macrophages
to HIV is related to the diminished ability of neonates to secrete
IFN- and/or to differences in CCR5 expression on these cells
is under investigation. Fear et al29 recently reported
decreased CCR5 expression in neonatal monocytes in comparison to adult
monocytes. Our data support this observation, showing that cord blood
monocytes have lower levels of CCR5 expression in the resting state in
comparison to adult blood monocytes. However, augmentation of CCR5
expression in response to IFN- was similar in cord and adult blood
mononuclear phagocytes, which is consistent with the similar levels of
IFN- receptors expressed on cord and adult blood mononuclear
phagocytes.30 CXCR4 is the fusion coreceptor for T-cell
tropic HIV strains.7 Mark et al31 have
demonstrated greater expression of CXCR4 mRNA in cord blood lymphocytes
in comparison to adult blood lymphocytes. We speculate that, whereas
the lower expression of CCR5 in neonatal macrophages may be protective
to the fetus when the mother transmits M-tropic strains of HIV, the
greater expression of CXCR4 may contribute to the rapid progression of
AIDS in perinatally infected children.
Macrophages are reservoirs of HIV and maturation of monocytes to
macrophages results in increased susceptibility to HIV
infection.32 Di Marzio et al24
recently reported upregulation of CCR5 expression during the in vitro
differentiation of monocytes. However, the data presented by this group
show that upregulation of CCR5 expression occured in 1-day cultured
monocytes (1 day postisolation), whereas there was no significant
increase in CCR5 mRNA in MDM (7 days postisolation) in comparison to
monocytes (1 day postisolation).24 Fear et al29
reported increased cytoplasmic (but not cell surface) CCR5 expression
in placental macrophages and suggested that changes in CCR5 expression
during the differentiation of monocytes are due to movement of the
receptor in and out of the cytoplasm. We observed higher levels of CCR5
expression in freshly isolated cord and adult blood monocytes and
progressive decrease in CCR5 cell surface expression during
differentiation of monocytes to macrophages. These differences between
our observations and others may be due to differences in the methods of
isolation of monocytes. It is possible that activation of monocytes in
the process of purification using gelatin-coated flasks (our previously
described technique16) causes elevated CCR5 expression,
with subsequent decrease to unstimulated, baseline levels over time in
culture. Macrophages have greater expression of interferon receptors
compared with monocytes.33 This may explain the greater
levels of augmentation of CCR5 expression in MDM treated with IFN-
(10- to 15-fold) compared with monocytes treated with IFN- (6- to
10-fold).
The regulation of CD4 and chemokine coreceptor expression in
mononuclear phagocytes by IFN- has potential implications in inflammation as well as in HIV infection and AIDS pathogenesis. The
divergent effects of cytokines on chemokine receptor expression and
chemokine ligand production have been demonstrated.7
Endotoxin inhibits expression of C-C chemokine receptors and augments
C-C chemokine secretion by mononuclear phagocytes. Whereas these
effects suppress HIV infection of macrophages, inhibition of chemokine receptor expression may possibly limit leukocyte
recruitment.34,35 Our data suggest an emerging paradigm in
which HIV infection and leukocyte migration are regulated by reciprocal
effects on CD4 and chemokine coreceptor expression. The opposing
effects of IFN- on CCR5/CCR3 and CD4 expression may augment
leukocyte recruitment while containing HIV infection in sites of
inflammation such as lymph nodes, where the number of infected cells
actively expressing HIV is higher compared with peripheral blood. This
may have important implications in the use of IFN- as a therapeutic
agent in HIV infection and AIDS.
| |
ACKNOWLEDGMENT |
The authors are grateful to Joann Cutilli, Li Song, and Zangwei Xu for
technical assistance.
| |
FOOTNOTES |
Submitted March 7, 1998; accepted November 13, 1998.
Supported by 1UO1 AI 32921, NIHMH 49981, NIDA 11887-01, and the W.W.
Smith Foundation.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Wen-Zhe Ho, MD, Division of Immunologic and
Infectious Diseases, Room 1202B, Abramson Research Building, The
Children's Hospital of Philadelphia, 34th St and Civic Ctr Blvd,
Philadelphia, PA 19104; e-mail: HO{at}EMAILCHOP.EDU.
| |
REFERENCES |
1.
Billiau A, Dijkmans R:
Interferon-gamma: Mechanism of action and therapeutic potential.
Biochem Pharmacol
40:1433, 1990[Medline]
[Order article via Infotrieve]
2.
Vyakarnam A, McKeating J, Meager A, Beverley PC:
Tumor necrosis factors (alpha, beta) induced by human immunodeficiency-1 in peripheral blood mononuclear cells potentiate virus replication.
AIDS
4:21, 1990[Medline]
[Order article via Infotrieve]
3.
Kornbluth RS, Oh PS, Munis JR, Cleveland PH, Richman DD:
Interferons and bacterial lipopolysaccharide protect macrophages from productive infection by human immunodeficiency virus in vitro.
J Exp Med
169:1137, 1989[Abstract/Free Full Text]
4.
Koyanagi Y, O'Brien WA, Zhao JQ, Golde DW, Gasson JC, Chen IS:
Cytokines alter production of HIV-1 from primary mononuclear phagocytes.
Science
241:1673, 1988[Abstract/Free Full Text]
5.
Than S, Hu R, Oyaizu N, Romana J, Wang X, Sheikh S, Pawha S:
Cytokine pattern in relation to disease progression in human immunodeficiency virus-infected children.
J Infect Dis
175:47, 1997[Medline]
[Order article via Infotrieve]
6.
Hyjek E, Lischner HW, Hyslop T, Bartkowiak J, Kubin M, Trinchieri G, Kozbor D:
Cytokine patterns during progression to AIDS in children with perinatal HIV infection.
J Immunol
155:4060, 1995[Abstract]
7.
Rollins BJ:
Chemokines.
Blood
90:909, 1997[Free Full Text] (review)
8.
Dragic T, Litwin V, Allaway GP, Martin SR, Huang Y, Nagashima KA, Cayanan C, Maddon PJ, Koup RA, Moore JP, Paxton WA:
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667, 1996[Medline]
[Order article via Infotrieve]
9.
Choe H, Farzan M, Sun Y, Sullivan N, Rollins B, Ponath PD, Wu L, Mackay CR, LaRosa G, Newman W, Gerard N, Gerard C, Sodroski J:
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135, 1996[Medline]
[Order article via Infotrieve]
10.
Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, Berger EA:
CC CKR5: A RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955, 1996[Abstract]
11.
Doranz BJ, Rucker J, Yi Y, Smyth RJ, Samson M, Peiper SC, Parmentier M, Colllman RG, Doms RW:
A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149, 1996[Medline]
[Order article via Infotrieve]
12.
Deng H, Liu R, Ellmeier W, Choe S, Unutmaz D, Burkhart M, Di Marzio P, Marmon S, Sutton RE, Hill CM, Davis CB, Peiper SC, Schall TJ, Littman DR, Landau NR:
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661, 1996[Medline]
[Order article via Infotrieve]
13.
Huang Y, Paxton WA, Wolinsky SM, Neumann AU, Zhang L, He T, Kang S, Ceradini D, Jin Z, Yazdanbakhsh K, Kuntsman K, Erickson D, Dragon E, Landau NR, Phair J, Ho DD, Koup RA:
The role of a mutant CCR5 allele in HIV-1 transmission and disease progression.
Nat Med
2:1240, 1996[Medline]
[Order article via Infotrieve]
14.
Cocchi F, DeVico AL, Garzino-Demo A, Arya SK, Gallo RC, Lusso P:
Identification of RANTES, MIP-1alpha, and MIP-1beta as the major HIV-suppressive factors produced by CD8+ T cells.
Science
270:1811, 1995[Abstract/Free Full Text]
15.
Vicenzi E, Biswas P, Mengozzi M, Poli G:
Role of pro-inflammatory cytokines and beta-chemokines in controlling HIV replication.
J Leukoc Biol
62:34, 1997[Abstract]
16.
Hassan NF, Cutilli JR, Douglas SD:
Isolation of highly purified human blood monocytes for in vitro HIV-1 infection studies of monocytes/macrophages.
J Immunol Methods
130:283, 1990[Medline]
[Order article via Infotrieve]
17.
Griffin DE, McArthur JC, Cornblath DR:
Neopterin and interferon-gamma in serum and cerebrospinal fluid of patients with HIV-associated neurologic disease.
Neurology
41:69, 1991[Abstract/Free Full Text]
18.
Emilie D, Peuchmaur M, Maillot MC, Crevon MC, Brousse N, Delfraissy JF, Dormont J, Galanaud P:
Production of interleukins in human immunodeficiency virus-1 replicating lymph nodes.
J Clin Invest
86:148, 1990
19.
Pantaleo G, Graziosi C, Butini L, Pizzo PA, Schnittman SM, Kotler DP, Fauci AS:
Lymphoid organs function as major reservoirs for human immunodeficiency virus.
Proc Natl Acad Sci USA
88:9838, 1991[Abstract/Free Full Text]
20.
Heagy W, Groopman J, Schindler J, Finberg R:
Use of IFN-gamma in patients with AIDS.
AIDS
3:584, 1990
21.
Ganser A, Brucher W, Brodt HR, Busch W, Brandhorst I, Helm EB, Hoelzer D:
Treatment of AIDS-related Kaposi's sarcoma with recombinant gamma-interferon.
Onkologie
9:163, 1986[Medline]
[Order article via Infotrieve]
22.
Dhawan W, Heredia A, Wahl LM, Epstein JS, Meltzer MS, Hewlett IK:
Interferon--induced downregulation of CD4 inhibits the entry of human immunodeficiency virus type-1 in primary monocytes.
Pathobiology
63:93, 1995[Medline]
[Order article via Infotrieve]
23.
Kozak SL, Platt EJ, Madani N, Ferro FE Jr, Peden K, Kabat D:
CD4, CXCR-4 and CCR-5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type-1.
J Virol
71:873, 1997[Abstract]
24.
Di Marzio P, Tse J, Landau NR:
Chemokine receptor regulation and HIV type 1 tropism in monocytes-macrophages.
AIDS Res Hum Retroviruses
14:129, 1998[Medline]
[Order article via Infotrieve]
25.
Zella D, Barabitskaja O, Burns JM, Romerio F, Dunn DE, Revello MG, Gerna G, Reitz MS Jr, Gallo RC, Weichold FF:
Interferon- increases expression of chemokine receptors CCR1, CCR3, and CCR5, but not CXCR4 in monocytoid U937 cell lines.
Blood
91:4444, 1998[Abstract/Free Full Text]
26.
Penton-Rol G, Polentarutti N, Luini W, Borsatti A, Mancinelli R, Sica A, Sozzani S, Mantovani A:
Selective inhibition of expression of the chemokine receptor CCR2 in human monocytes by IFN-.
J Immunol
160:3869, 1998[Abstract/Free Full Text]
27.
Wilson CB, Westall J, Johnston L, Lewis DB, Dower SK, Alpert AR:
Decreased production of interferon-gamma by human neonatal cellsIntrinsic and regulatory deficiencies.
J Clin Invest
77:860, 1986
28.
Ho WZ, Lioy J, Song L, Cutilli JR, Polin RA, Douglas SD:
Infection of cord blood monocyte-derived macrophages with human immunodeficiency virus type 1.
J Virol
66:573, 1992[Abstract/Free Full Text]
29.
Fear WR, Kesson AM, Naif H, Lynch GW, Cunningham AL:
Differential tropism and chemokine receptor expression of human immunodeficiency virus type 1 in neonatal monocytes, monocyte-derived macrophages, and placental macrophages.
J Virol
72:1334, 1998[Abstract/Free Full Text]
30.
Marodi L, Kaposzta R, Campbell DE, Polin RA, Csongor J, Johnston RB:
Candidacidal mechanisms in the human neonate. Impaired IFN- activation of macrophages in newborn infants.
J Immunol
153:5643, 1994[Abstract]
31.
Mark DG, Yue X, Gray SM:
Cord blood CD4+ T lymphocytes differentially express CCR5 and CXCR4 HIV-1 coreceptors.
Pediatr Res
43:240A, 1998 (abstr)
32.
Rich EA, Chen IS, Zack JA, Leonard ML, O'Brien WA:
Increased susceptibility of differentiated mononuclear phagocytes to productive infection with human immunodeficiency virus-1.
J Clin Invest
89:176, 1992
33.
Gessani S, Borghi P, Fantuzzi L, Varano B, Conti L, Puddu P, Belardelli F:
Induction of cytokines by HIV-1 and its gp120 protein in human peripheral blood monocyte/macrophages and modulation of cytokine response during differentiation.
J Leukoc Biol
62:49, 1997[Abstract]
34.
Sica A, Saccani A, Borsatti A, Power CA, Wells TNC, Luini W, Polentarutti N, Sozzani S, Mantovani A:
Bacterial lipopolysaccharide rapidly inhibits expression of C-C chemokine receptors in human monocytes.
J Exp Med
185:969, 1997[Abstract/Free Full Text]
35.
Verani A, Scarlatti G, Comar M, Tresoldi E, Polo S, Giacca M, Lusso P, Siccardi AG, Vercilli D:
C-C chemokines released by lipopolysaccharide (LPS)-stimulated human macrophages suppress HIV-1 infection in both macrophages and T cells.
J Exp Med
185:805, 1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
C. S. McKimmie, M. Moore, A. R. Fraser, T. Jamieson, D. Xu, C. Burt, N. I. Pitman, R. J. Nibbs, I. B. McInnes, F. Y. Liew, et al.
A TLR2 ligand suppresses inflammation by modulation of chemokine receptors and redirection of leukocyte migration
Blood,
April 30, 2009;
113(18):
4224 - 4231.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Happel, A. D. Steele, M. J. Finley, M. A. Kutzler, and T. J. Rogers
DAMGO-induced expression of chemokines and chemokine receptors: the role of TGF-{beta}1
J. Leukoc. Biol.,
April 1, 2008;
83(4):
956 - 963.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. King, J. Baillie, and J. H. Sinclair
Human cytomegalovirus modulation of CCR5 expression on myeloid cells affects susceptibility to human immunodeficiency virus type 1 infection.
J. Gen. Virol.,
August 1, 2006;
87(Pt 8):
2171 - 2180.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R M Ransohoff
Immunologic Correlates of MS Pathologic Subtypes
Multiple Sclerosis,
February 1, 2005;
11(1):
101 - 102.
[PDF]
|
|
|
|
|
|
|
C. Trebst, S. M. Staugaitis, P. Kivisakk, D. Mahad, M. K. Cathcart, B. Tucky, T. Wei, M. R. S. Rani, R. Horuk, K. D. Aldape, et al.
CC Chemokine Receptor 8 in the Central Nervous System Is Associated with Phagocytic Macrophages
Am. J. Pathol.,
February 1, 2003;
162(2):
427 - 438.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Losana, C. Bovolenta, L. Rigamonti, I. Borghi, F. Altare, E. Jouanguy, G. Forni, J.-L. Casanova, B. Sherry, M. Mengozzi, et al.
IFN-{gamma} and IL-12 differentially regulate CC-chemokine secretion and CCR5 expression in human T lymphocytes
J. Leukoc. Biol.,
October 1, 2002;
72(4):
735 - 742.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Trebst, T. Lykke Sorensen, P. Kivisakk, M. K. Cathcart, J. Hesselgesser, R. Horuk, F. Sellebjerg, H. Lassmann, and R. M. Ransohoff
CCR1+/CCR5+ Mononuclear Phagocytes Accumulate in the Central Nervous System of Patients with Multiple Sclerosis
Am. J. Pathol.,
November 1, 2001;
159(5):
1701 - 1710.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Dulkys, C. Kluthe, T. Buschermohle, I. Barg, S. Kno{beta}, A. Kapp, A. E. I. Proudfoot, and J. Elsner
IL-3 Induces Down-Regulation of CCR3 Protein and mRNA in Human Eosinophils
J. Immunol.,
September 15, 2001;
167(6):
3443 - 3453.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Nagai, S.-i. Hashimoto, T. Yamashita, N. Toyoda, T. Satoh, T. Suzuki, and K. Matsushima
Comprehensive gene expression profile of human activated Th1- and Th2-polarized cells
Int. Immunol.,
March 1, 2001;
13(3):
367 - 376.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Lee, C. K. Lapham, H. Chen, L. King, J. Manischewitz, T. Romantseva, H. Mostowski, T. S. Stantchev, C. C. Broder, and H. Golding
Coreceptor Competition for Association with CD4 May Change the Susceptibility of Human Cells to Infection with T-Tropic and Macrophagetropic Isolates of Human Immunodeficiency Virus Type 1
J. Virol.,
June 1, 2000;
74(11):
5016 - 5023.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
D. Hariharan, W. Ho, J. Cutilli, D. E. Campbell, and S. D. Douglas
C-C chemokine profile of cord blood mononuclear cells: selective defect in RANTES production
Blood,
January 15, 2000;
95(2):
715 - 718.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Wang, E. Guan, G. Roderiquez, V. Calvert, R. Alvarez, and M. A. Norcross
Role of Tyrosine Phosphorylation in Ligand-independent Sequestration of CXCR4 in Human Primary Monocytes-Macrophages
J. Biol. Chem.,
December 21, 2001;
276(52):
49236 - 49243.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction