|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 5 (March 1), 1999:
pp. 1651-1657
Clonality of Isolated Eosinophils in the Hypereosinophilic Syndrome
By
Hsiao-Wen Chang,
Kah-Hoo Leong,
Dow-Rhoon Koh, and
Szu-Hee Lee
From the Department of Pathology, the National University Medical
Institutes; the Department of Physiology, National University of
Singapore; and the Division of Haematology, National University
Hospital, Singapore.
 |
ABSTRACT |
The idiopathic hypereosinophilic syndrome (IHES) is a rare disorder
characterized by unexplained, persistent eosinophilia associated with
multiple organ dysfunction due to eosinophilic tissue infiltration. In
the absence of karyotypic abnormalities, there is no specific test to
detect clonal eosinophilia in IHES. Analysis of X-chromosome
inactivation patterns can be used to determine whether proliferative
disorders are clonal in origin. Methylation of HpaII and
Hha I sites near the polymorphic trinucleotide repeat of the
human androgen receptor gene (HUMARA) has been shown to correlate with
X-inactivation. In this study, we have used the polymerase chain
reaction (PCR) with nested primers to analyze X-inactivation patterns
of the HUMARA loci in purified eosinophils from female patients with
eosinophilia. Peripheral blood eosinophils were isolated by their
autofluoresence using flow cytometric sorting. Eosinophils purified
from a female patient presenting with IHES were found to show a clonal
pattern of X-inactivation. Eosinophil-depleted leukocytes from this
patient were polyclonal by HUMARA analysis, thus excluding skewedness
of random X-inactivation. After corticosteroid suppression of her blood
eosinophilia, a clonal population of eosinophils could no longer be
detected in purified eosinophils. In contrast, eosinophils purified
from a patient with Churg-Strauss syndrome and from six patients with
reactive eosinophilias attributed to allergy, parasitic infection, or
drug reaction showed a polyclonal pattern of X-inactivation by HUMARA
analysis. The finding of clonal eosinophilia in a patient presenting
with IHES indicates that such patients may have, in reality, a
low-grade clonal disorder that can be distinguished from reactive
eosinophilias by HUMARA analysis. Further, the method described can be
used to monitor disease progression.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE IDIOPATHIC hypereosinophilic syndrome
(IHES) is a rare disorder characterized by persistent eosinophilia of
unknown origin often associated with multiple organ dysfunction as a
result of infiltration by tissue eosinophils and the toxic effects of their released granule contents.1 There is no specific test that is diagnostic for IHES; rather the syndrome is defined as the
combination of unexplained prolonged eosinophilia and evidence of organ
involvement.2 It must be distinguished from reactive, clinically benign eosinophilia associated with parasitic, allergic, and
other unexplained causes of eosinophilia,3 and also from eosinophilic leukemias associated with increased blast cells and cytogenetic abnormalities. Moreover, some patients with IHES may show
features usually associated with myeloproliferative syndromes such as
splenomegaly and thrombocytopenia.1,4,5 Cases of clonal
eosinophilia as evidenced by karyotypic abnormalities in bone marrow
cells can usually be classified as chronic eosinophilic leukemia,
myelodysplastic syndromes, or myeloproliferative
disorders.6 However, in the absence of karyotypic
abnormalities, the distinction between these entities and IHES may be
difficult. A method that can detect clonal eosinophilia could allow
more accurate diagnosis and treatment of cases presenting as IHES and
help to clarify its relationship to the myeloproliferative disorders.
Analysis of maternal and paternal X-chromosome activation status has
been used as a means of determining whether certain proliferative disorders are clonal in origin.7-10 These methods are based
on the assumption that random inactivation of one X-chromosome occurs in each somatic cell during early embryogenic development, and that
this is passed on to the progeny of the cell in a stable fashion.11-14 Therefore, some cells from a normal
female carry active maternal X-chromosome, while other cells
carry active paternal X-chromosome. Differential methylation patterns
between the active and inactive X-chromosome have been
documented at several loci such as the phosphoglycerate kinase (PGK),
hypoxanthine phosphoribosyl transferase (HPRT), and the hypervariable
DXS255 (M27 ) loci.15 Recently, Allen et al9
have shown that methylation of HpaII and Hha I sites
near the polymorphic trinucleotide CAG repeat of the human androgen
receptor gene (HUMARA) correlates with X-inactivation. Digestion of DNA
with a methylation-sensitive restriction endonuclease, such as
HpaII, permits the distinction of the active (unmethylated) from the inactive (methylated) X-chromosome. Therefore, one strategy to
determine whether eosinophils from female patients with IHES are clonal
would be to analyze the X-inactivation patterns of the HUMARA loci in
purified eosinophils.
In a recent report, Luppi et al16 analyzed the methylation
status of the PGK gene in granulocytes from a female IHES patient with
70% eosinophilia and found this to show a clonal pattern by Southern
hybridization. However, PGK gene analysis is restricted by a low
incidence of constitutional heterozygosity of approximately 40% in the
general female population.10 By contrast, the HUMARA loci
have been reported to show a much higher incidence of constitutional heterozygosity of approximately 90%.9,17 Further, it would be an advantage to extend such studies to patients with lesser proportions of eosinophils in the peripheral blood by isolating eosinophils for clonality analysis. Human eosinophils emit marked fluorescence at 520 nm when excited at 450 nm due to their fluorescent granule contents, and this property may be used to purify eosinophils for study.18,19 Here, we have purified peripheral blood
eosinophils by their autofluorescence using flow cytometric sorting and
investigated the clonality of purified eosinophils from female patients
by analysis of X-inactivation patterns of the HUMARA loci using
polymerase chain reaction (PCR) amplification with nested primers.
| |
MATERIALS AND METHODS |
Sample Preparation
Peripheral blood samples in EDTA were collected from the patients
studied. Informed consent was obtained from all patients in this study,
which was approved by the local Institutional Review Board (Ethics).
Red blood cells were lysed with buffer containing 15.5 mmol/L
NH4Cl, 1 mmol/L KHCO3, and 10 µmol/L
Na2 EDTA. White blood cells were collected by
centrifugation at 2,000 rpm for 10 minutes. After centrifugation, the
samples were resuspended in 5 mL phosphate-buffered saline (PBS, pH
7.4) and washed twice. Each sample was then separated by flow cytometry
into a purified eosinophil fraction and an eosinophil-depleted
leukocyte fraction.
Isolation of eosinophils from peripheral blood leukocytes by flow
cytometry and cell sorting.
Eosinophils were separated by flow cytometry based on their
autofluorescence and granularity18,19 to greater than 90%
purity (Figs 1 and
2). Flow cytometric analysis and cell
sorting was performed on a FACStarPLUS flow cytometer
(Becton Dickinson, Franklin Lakes, NJ). Cells were excited
with a 488-nm argon ion laser and fluorescence was measured through a
BP 525 nm (FL1 detector) and 575 nm (FL2) filters. Results were
analyzed using the LYSYS II version 1.1 software (Becton Dickinson).
Cells were sorted at a cell flow rate of 800 events/s. A small sample
of sorted cells were cytospun onto glass slides for Giemsa staining to
confirm either eosinophil purity (Fig 2) or eosinophil depletion by
morphology. The remainder of the sorted cells were processed for DNA
extraction.
View larger version (26K):
[in this window]
[in a new window]
| Fig 1.
Flow cytometric sorting of eosinophils using
autofluorescence and light scatter patterns. (A) Peripheral blood
leukocytes from case 1 were obtained from whole blood after removal of
erythrocytes by lysis and analyzed on a FACStarPLUS flow
cytometer. (AI) The populations of leukocytes were differentiated by
their side scatter and autofluorescence patterns: eosinophils (R1,
57.9%), granulocytes (R2, 26.5%), and lymphocytes (R3, 12.8%). Cells
of the region R1 exhibited marked autofluorescence that was detected on
FL1, and to a lesser extent, on FL2. Cells in R1 were sorted into
sterile tubes containing 2 mL of sterile PBS (pH 7.4). (AII) Resultant
cell populations contained 98.5% eosinophils (R1), 1.0% granulocytes
(R2), and 0.4% lymphocytes (R3). (B) Twenty-six months later,
peripheral blood leukocytes from case 1 were obtained and again
analyzed on a FACStarPLUS flow cytometer. (BI) Eosinophil
(R1, 6.0%), granulocyte (R2, 74.0%), and lymphocyte (R3, 17.3%)
populations were noted among the leukocytes. Cells in R1 were purified
by flow cytometric sorting. (BII) The resultant cell populations
contained 92.0% eosinophils (R1), 4.0% granulocytes (R2), and 4.0%
lymphocytes (R3).
|
|
View larger version (116K):
[in this window]
[in a new window]
| Fig 2.
Purified eosinophils isolated by flow cytometric sorting.
Photomicrograph showing eosinophils purified from peripheral blood by
flow cytometric sorting to greater than 90% purity. (Giemsa, × 1,300 original magnification).
|
|
HUMARA Analysis
Preparation of DNA from peripheral blood samples was performed as
described elsewhere.20,21 Briefly, about 600 µL of
solution containing 50 mmol/L Tris (pH 8.0), 0.5% sodium dodecyl
sulfate, 1 mmol/L EDTA, and 10 mg/mL proteinase K was added to a final concentration of 100 µg/mL and incubated at 55°C for 15 hours. The samples were then extracted once with phenol, twice with
phenol-chloroform, and precipitated by 2.5 vol of ethanol. After
centrifugation, the DNA was resuspended in 200 µL 10 mmol/L Tris (pH
8.0) with 1 mmol/L EDTA.
Clonality studies at the HUMARA locus were performed as described
previously,9 except that internal ("nested") primers were included (Fig 3). Briefly, about 200 ng of DNA was either digested overnight with 10 U of HpaII or
not digested. The reaction was terminated by heating at 95°C for 5 minutes. The PCR reaction was performed in a total volume of 20 µL
containing 0.5 µmol/L oligomers, 150 µmol/L of each
dNTP (Dupont, Wilmington, DE), 2.5 mmol/L
MgCl2, 50 mmol/L KCl, 10 mmol/L Tris-HCl, 5% dimethyl
sulfoxide, 0.8 U of Taq polymerase, and 200 ng of DNA. The sequences of
the primers were: 5' TCCAGAATCTGTTCCAGAGCGTGC 3' (primer A)
and 5' GCTGTGAAGGTTGCTGTTCCTCAT 3' (primer B). Samples were
amplified for 28 cycles comprising 1 minute at 95°C, 45 seconds at
60°C, and 45 seconds at 72°C with initial denaturation at
95°C for 5 minutes. One-tenth volume of this PCR mixture was added
into another reaction mixture. The following internal primers were then
added: 5' GTGCGCGAAGTGATCCAGGA 3' (primer A1) and 5'
TTCCTCATCCAGGACCAGGT 3' (primer B1). The amplification was
repeated as described above except that the PCR reaction was performed
in a total vol of 10 µL for 20 amplification cycles and 50 to 100 nmol/L  -33P-adenosine triphosphate (ATP)
end-labeled primer A1 (>1,000 Ci/mmol; Dupont) was added. Five
microliters of sequencing gel-loading buffer (95% formamide, 10 mmol/L
EDTA, 0.025% bromophenol blue) were added to the reaction mixture.
Four microliters of this mixture were loaded onto a denaturing 6%
(39:1 acrylamide/bis with 6 mol/L urea) gel and electrophoresed at 80 W
for 3 hours. The gel was dried and exposed.
View larger version (4K):
[in this window]
[in a new window]
| Fig 3.
Diagram of the region amplified in the HUMARA gene. Two
HpaII sites are adjacent to the polymorphic CAG repeats.
|
|
HUMARA clonality analyses of all the samples in this study were
repeated at least twice to ensure that the results were reproducible.
To obtain the proportional expression of the maternal and paternal
alleles in HUMARA analysis, band intensities from the autoradiographs were analyzed using Molecular Analyst software (Bio-Rad Laboratories, Hercules, CA). The proportional expression of the two alleles was
obtained as described by Gale et al,17 except that the
final ratio was expressed as percentages of the total signal from the two alleles. Briefly, the intensity of each band after HpaII
digestion was first corrected by dividing it by the signal obtained for that allele in the undigested sample. The intensity of the signals from
the two alleles was then expressed as a ratio. The ratio was finally
expressed as a percentage of the total signal for the two alleles.
Therefore, a ratio of 50:50 would represent equal (balanced) expression
of the two alleles.
| |
RESULTS |
Patients
Studies were performed on eight female patients (mean age, 48.5 years;
range, 41 to 65 years) with eosinophilia (Table
1). The diagnosis in one patient (case 1)
was consistent with IHES, and in another (case 2), with the
Churg-Strauss syndrome. Eosinophilia in the remaining patients (cases 3 to 8) was judged clinically to be reactive in nature based on a likely
cause for eosinophilia, such as drug reaction due to phenytoin (case
3), parasitic infection due to Strongyloidiaisis (case 4),
atopic eczema secondary to house dustmite allergy (case 5), asthma
secondary to house dustmite allergy (case 6), and extrinsic allergic
asthma (cases 7 and 8). The patients with reactive eosinophilia did not
manifest tissue damage attributable to eosinophilia, and the duration
of eosinophilia was transient in cases 3 and 4. Details of the patients
presenting as IHES or Churg-Strauss syndrome were as follows.
Case 1.
A50-year-old housewife was admitted with progressive exertional
dyspnea, orthopnea, and bilateral ankle swelling for several days. She
gave a history of chronic nonproductive cough for several months and
weight loss of 10 kg in the preceding 10 months. Examination showed
physical signs of severe congestive cardiac failure. The total white
cell count was 13.5 × 109/L with 40% eosinophils
with an absolute eosinophil count (AEC) of 5.4 × 109/L and a mild normochromic anemia (hemoglobin, 10.2 g/dL) with occasional macrocytes in the blood film. Liver and renal
biochemical screening tests showed mildly elevated serum alanine and
aspartate aminotransferases and lactate dehydrogenase, but were
otherwise normal. Chest x-ray showed cardiac enlargement with pulmonary edema. Cardiac doppler echocardiography confirmed a dilated
cardiomyopathy with poor left ventricular function and a small
pericardial effusion. Serum folate was low at 6.6 nmol/L (normal range
[NR] = 10.0 to 40.0 nmol/L). Serum vitamin B12 and the
neutrophil alkaline phosphatase score were in the normal range.
Polyclonal IgE was increased to 1,107 U/mL (NR = 10.0 to 180 U/mL). Rheumatoid factor, antinuclear factor, and anti-DNA antibodies
were negative. Stool examinations for ova, cysts, and parasites were
repeatedly negative. The bone marrow aspirate showed moderately
hypercellular fragments with a marked increase in eosinophils and
eosinophilic precursors. Cytogenetic analysis of bone marrow cells
showed a normal karyotype. She was treated with diuretics and folic
acid and started on prednisolone 1 mg/kg/d. Her symptoms improved
dramatically with a fall in the AEC to 0.4 × 109/L after 3 days of treatment. During the first 12 months
after initial presentation, her AEC rose above 1.5 × 109/L on several occasions, accompanied by symptoms and
signs of congestive heart failure. As she refused  -interferon
therapy, control was reestablished by an increase in prednisolone
dosage. Twelve months after initial presentation, due to increasing
side effects of corticosteroid therapy, hydroxyurea was substituted for
prednisolone, but had to be discontinued 20 months after initial presentation due to worsening macrocytic anemia. From that time until
the present, the patient has been maintained on a small dose of
prednisolone to suppress her eosinophil count. During treatment, her
serum IgE level fell, but remained mildly elevated at 356 U/mL, 26 months after initial presentation. HUMARA analysis of purified blood
eosinophils was performed at initial presentation and at 26 months
after initial presentation.
Case 2.
A 43-year-old Caucasian woman presented with rashes on her hands and
paraesthesia and swelling of her feet for 10 days. She gave a history
of asthma for about 15 years, controlled with intermittent courses of
corticosteroids and salbutamol. Fifteen years ago, in a hospital
abroad, she had been diagnosed with "pulmonary eosinophilia" and
2 years previously, she had suffered a severe angioneurotic orbital
cellulitis. On examination she had vasculitic lesions on her hands and
sensory loss to pinprick in a "glove and stocking" distribution
of her hands and feet and bilateral pitting edema up to the midcalves.
Chest radiography showed old scarring and small areas of "ground
glass" appearance consistent with pulmonary allergic granulomatosis.
The total white cell count was 26.5 × 109/L, with
43% eosinophils. Biopsy of the skin lesions showed vasculitis and
tissue eosinophilia. IgE levels were elevated (895 U/mL). Nerve
conduction studies showed a mild sensory neuropathy of the lower limbs.
A large pericardial effusion was confirmed by doppler echocardiography.
Antineutrophil cytoplasmic antibodies, anti-DNA antibodies, rheumatoid
factor, and antifilarial antibody were negative. A diagnosis of
Churg-Strauss syndrome with peripheral neuropathy and myositis was
made. Her symptoms are presently well-controlled with prednisolone and salbutamol.
HUMARA Analysis
Amplification of the HUMARA gene by nested primers gives a 240-bp
fragment that spans two HpaII cutting sites and the variable CAG tandem repeats (Fig 3). Analysis of the HUMARA gene is
based on the rationale that amplification by PCR cannot take place if the active (unmethylated) X-chromosome is predigested with a
methylation sensitive enzyme (HpaII). Methylation at these
sites has been shown to correlate with X-inactivation,9 so
that a product will only be obtained if the X-chromosome is inactive.
In a polyclonal cell population in which random X-inactivation has
taken place, both alleles persist after HpaII predigestion so
that in a high resolution polyacrylamide gel, two bands are seen, as
the maternal inactive X-allele is distinct from paternal inactive
X-allele because of a different number of CAG repeats. By contrast, in a monoclonal cell population in which nonrandom X-inactivation has
taken place, the active allele disappears after HpaII
predigestion, as all cells contain the same inactive
X-chromosome,9 so that only one band from either parental
inactive X-allele is shown by gel electrophoresis. The band
representing an allele is sometimes accompanied by a minor band one
trinucleotide repeat smaller, which is due to slippage of Taq
polymerase along the repeated sequences.17
PCR amplification of the hypervariable HUMARA target gene was performed
on both purified eosinophil fractions and eosinophil-depleted leukocyte
fractions from each patient. Eosinophil-depleted leukocyte fractions
consisted of variable proportions of a mixed population of peripheral
blood neutrophils, lymphocytes, and monocytes, with fewer than 10%
eosinophils. These fractions served as polyclonal controls to exclude
skewedness of X-inactivation that is found in a small proportion of
females in HUMARA analysis.9,17 In the patient presenting
with IHES (case 1), peripheral blood eosinophils were purified to
98.5% purity by flow cytometry at initial presentation (Fig 1A). Gel
electrophoresis under denaturing conditions of HpaII-digested samples of eosinophil-depleted leukocytes showed a band originating from each parental X-chromosome (Fig 4,
cases 1A and 1B, WBC-). Eosinophil-depleted leukocyte fractions from
case 1, therefore, showed a random (polyclonal) pattern of
X-inactivation, thus excluding extreme skewedness of X-inactivation in
this individual. By contrast, HUMARA analysis of the purified
eosinophil fraction from this patient at initial presentation (Fig 4,
case 1A, EO) showed only a band from one parental allele after
HpaII digestion, consistent with a nonrandom (clonal) pattern
of X-inactivation in the purified eosinophils.
View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
HUMARA analysis of patients with eosinophilia. Case 1, idiopathic hypereosinophilic syndrome; case 2, Churg-Strauss syndrome;
case 3, eosinophilia secondary to phenytoin ingestion; case 4, eosinophilia secondary to Strongyloidiasis infection; and case
5, eosinophilia secondary to house dustmite allergy causing atopic
eczema. Case 1A, sample obtained at initial presentation; case 1B,
sample obtained 26 months after initial presentation; EO, purified
eosinophil fraction; WBC-, eosinophil-depleted leukocyte fraction;
+, DNA amplified after HpaII precutting; -, DNA amplified
without HpaII precutting; *, percent allelic ratio: this is the
ratio of the band intensity of the upper allele to the lower allele
after HpaII digestion as a percentage of the total intensity of
the two alleles. The intensity of each band after HpaII
digestion was first corrected by dividing it by the signal obtained for
that allele in the undigested sample (for details, see Materials and
Methods).  , eosinophilia: percentage eosinophils of the peripheral
blood total white cell count before eosinophil purification.
|
|
Twenty-six months after initial presentation when the patient's
symptoms and blood eosinophil count (AEC = 0.5 × 109/L) were controlled with a small dose of prednisolone,
eosinophils were once again purified by flow cytometry (Fig 1B) for
HUMARA reanalysis (Fig 4, case 1B). The eosinophil content of the
purified eosinophil fraction was 92% (Fig 1B). By HUMARA analysis, a
polyclonal pattern of X-inactivation was seen (Fig 4, case 1B, EO),
indicating either that the clonal eosinophilic population was absent or
that it was insufficient, as a proportion of the total eosinophil
population, to give rise to a clonal pattern.
Samples from case 1 were also assayed for clonality using PGK gene
analysis by PCR,22 but the patient was not heterozygous at
the PGK locus, which was therefore uninformative (not shown).
In case 2, a patient with the Churg-Strauss syndrome, HUMARA analysis
of both purified eosinophil and eosinophil-depleted leukocyte fractions
showed a similar polyclonal pattern (Fig 4, case 2), indicating that
the purified eosinophils were of polyclonal origin in this condition.
In all of the other six patients with reactive eosinophilia, HUMARA
analyses of both purified eosinophil and eosinophil-depleted leukocyte
fractions showed a polyclonal pattern of X-inactivation, confirming
that the eosinophil populations in these patients were polyclonal in
origin. Representative analyses are shown (Fig 4, cases 3 to 5). HUMARA
results in all samples in this study were found to be consistent on
repeated analyses.
| |
DISCUSSION |
The distinction between a malignant and nonmalignant process in IHES
can be extremely difficult, as there are no specific markers that can
be applied to ascertain the clonality of eosinophils.2 We
have attempted to solve this problem by analysis of the X-inactivation status of the HUMARA loci in purified eosinophils from female patients
with eosinophilia. One patient presented with IHES, as evidenced by
recurrent elevated AEC and organ damage involving the heart. A second
patient presented with vasculitic lesions, asthma, pulmonary
eosinophilia, peripheral neuropathy, pericarditis, and myositis and
clinically fulfilled the criteria for the Churg-Strauss syndrome.23,24 The remaining six patients with reactive
eosinophilia showed either transient or persistent eosinophilia that
was attributable to drug reactions, allergies, or parasitic infection.
These cases were clinically benign and did not show evidence of organ
damage associated with eosinophilia. By X-inactivation analysis, we
found clonal eosinophilia in the patient with IHES, whereas eosinophils were polyclonal in the patient with Churg-Strauss syndrome, and also in
the six other patients with reactive eosinophilia. Further, in the
patient with IHES, analysis of eosinophil-depleted leukocyte fractions
showed a polyclonal pattern of X-inactivation. This indicated that the
clonal pattern observed in purified eosinophils at initial presentation
was not due to skewedness of random X-inactivation that could, in
principle, result in an imbalanced expression of one allele in a
population of cells.
Our patient presenting with IHES showed similarities to the case
described by Luppi et al.16 Both patients showed evidence of organ damage associated with sustained eosinophilia, an absence of
features associated with myeloproliferative disorders, a normal bone
marrow karyotype, a clonal eosinophilia by X-inactivation analysis, and
corticosteroid-responsiveness with a favorable outcome. In our patient
(case 1), a very high IgE level at presentation was also found, which
is associated with a good prognosis in IHES.2 After
therapy, the IgE level fell, but remained mildly elevated, although
clonal eosinophilia could no longer be demonstrated. In a previous
study, 38% of IHES patients were found to have markedly elevated IgE
levels, suggesting an association between an IgE-mediated mechanism and
eosinophilia in this subgroup.25 These patients required no
therapy or responded with a complete remission when treated with
corticosteroids.25,26 This interesting association raises
the possibility that the eosinophilia and perhaps the organ damage in
this subgroup of patients with IHES is associated with an IgE-mediated
hypersensitivity response to an as yet unidentified antigen or
antigens.25
One advantage of HUMARA analysis compared with other X-inactivation
markers is its high degree of informativeness, as the HUMARA loci show
a high incidence of constitutional heterozygosity of approximately 90%
in the female population.9,17 By contrast, the incidence of
constitutional heterozygosity reported for other polymorphic X-linked
markers, such as the PGK and HPRT loci, are significantly
lower.15 In practice, X-inactivation data may be
corroborated by further analyses of other polymorphic X-linked loci. We
attempted to verify clonal eosinophilia in the patient presenting with
IHES by PGK analysis, but the patient was found to be not heterozygous
at the PGK locus. It should be noted that clonality analysis using
X-linked polymorphisms is only useful in females and, therefore, only
in a minority of patients with IHES, as the majority (approximately
90%2) of these patients are male.
Eosinophil purification allows HUMARA analysis to be extended to detect
clonal eosinophilia when the proportion of peripheral blood eosinophils
is low. This should, in principle, permit detection of clonal relapse
in IHES patients and facilitate the assessment of therapeutic
responses. However, it has to be noted that an absence of clonal
eosinophilia by this method of analysis cannot completely exclude the
possibilty that a minor clonal population of eosinophils may persist.
Long-term follow-up of our patient presenting with IHES is necessary to
determine whether continued suppression of clonal eosinophilia by a low
dose of corticosteroids can be maintained.
Although vasculitis is not a prominent feature of IHES, individual
patients with IHES may exhibit pathologic evidence of
vasculitis.1,2 The major vasculitis that is associated with
eosinophilia is the Churg-Strauss syndrome.23 A history of
asthma, nonfixed pulmonary infiltrates, blood eosinophilia greater than
10%, paranasal sinus abnormalities, mononeuropathy or polyneuropathy,
and a biopsied blood vessel demonstrating extravascular eosinophils are
features of this syndrome.23,24 In some patients, clear
distinction between IHES and Churg-Strauss syndrome may not be
possible. However, our patient (case 2) showed the characteristic
features of this syndrome. The finding that eosinophils were polyclonal
in this patient provides definitive evidence that eosinophilia is
reactive in nature in the Churg-Strauss syndrome.
There are several possible explanations for the underlying pathogenesis
of a clonal eosinophilia in IHES. Eosinophilic proliferation and
differentiation is promoted by several cytokines, including interleukin
(IL)-3, granulocyte-macrophage colony-stimulating factor, and IL-5,
which is the most important and, in humans, is restricted to
stimulating eosinophil production.27 Reactive eosinophilias
such as infections, allergies, drug reactions, skin diseases,
connective tissue diseases, and malignancies are associated with
eosinophilia through stimulation by IL-5 secreted by T
cells.2,6 Recently, there have been reports of a clonal
population of T cells with an unusual phenotype, CD3 ,
CD4+ or CD3+, CD4,
CD8, in the peripheral blood of several cases of
eosinophilia, including IHES.28,29 In one
report,28 a patient with IHES who had excessive production
of IgE was found to have a CD3, CD4+ Type 2 helper T-cell clone that secreted high levels of IL-5 and IL-4, which
stimulates IgE production. In patients with IHES who have high levels
of IgE, it has been proposed that hypereosinophilia may result from an
IgE-mediated hypersensitivity response to an as yet unidentified
antigen or antigens.25 This subgroup of patients is
characterized by responsiveness to corticosteroid therapy and a good
prognosis,25,26 as seen in the case that we have described.
It is possible that hypereosinophilia in these patients may be due to a
dysregulated, autonomous replication of a clonal population of
eosinophils after stimulation by increased levels of IL-5. Other
hypotheses for the pathogenesis of IHES have been suggested, such as
defects in cytokine receptors, or in their signal transduction or
suppressor regulatory pathways,30,31 but these remain
speculative. Alternatively, the finding of clonal eosinophilia in a
patient with IHES could imply that somatic mutation affecting the
eosinophil lineage is present in the patient, in the absence of
karyotypic abnormalities, and that the patient has, in reality, a
low-grade clonal myeloproliferative disorder. Cases of IHES that show a
clonal cytogenetic abnormality should be classified as eosinophilic
leukemia,32 and it has been argued that all cases of clonal
eosinophilia should, by definition, be excluded from IHES.6
The method of analysis that we have described would allow clonal
eosinophilias to be distinguished from reactive eosinophilias in female
patients presenting with IHES. In summary, in the absence of karyotypic
abnormalities, HUMARA analysis of isolated eosinophils can be used to
detect clonal eosinophilias and can provide a marker to assess disease progression.
| |
FOOTNOTES |
Submitted March 25, 1998; accepted October 21, 1998.
Supported by National Medical Research Council Grant No 0040/94.
H.-W.C. was a Medical Research Scientist Award recipient of the
National Medical Research Council, Singapore.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Szu-Hee Lee, MD, PhD, Division of
Haematology, National University Hospital, Singapore 119074.
| |
REFERENCES |
1.
Fauci AS, Harley JB, Roberts WC, Ferrans VJ, Gralnick HR, Bjornson BH:
NIH Conference. The idiopathic hypereosinophilic syndrome. Clinical, pathophysiologic, and therapeutic considerations.
Ann Intern Med
97:78, 1987
2.
Weller PF, Bubley GJ:
The idiopathic hypereosinophilic syndrome.
Blood
83:2759, 1994[Free Full Text]
3.
Chusid MJ, Dale DC, West BC, Wolff SM:
The hypereosinophilic syndrome: Analysis of fourteen cases with review of the literature.
Medicine (Baltimore)
54:1, 1975[Medline]
[Order article via Infotrieve]
4.
Lefebvre C, Bletry O, Degoulet P, Guillevin L, Bentata-Pesyre M, Le Thi HD, Godeau P:
Facteurs pronostiques du syndrome hyperéosinophilique. Étude de 40 observations.
Ann Med Interne (Paris)
140:253, 1989[Medline]
[Order article via Infotrieve]
5.
Schooley RT, Flaum MA, Gralnick HR, Fauci AS:
A clinico-pathologic correlation of the idiopathic hypereosinophilic syndrome. II. Clinical manifestations.
Blood
58:1021, 1981[Abstract/Free Full Text]
6.
Brito-Babapulle F:
Clonal eosinophilic disorders and the hypereosinophilic syndrome.
Blood Rev
11:129, 1997[Medline]
[Order article via Infotrieve]
7.
Vogelstein B, Fearon ER, Hamilton SR, Preisinger AC, Willard HF, Michelson AM, Riggs AD, Orkin SH:
Clonal analysis using recombinant DNA probes from the X-chromosome.
Cancer Res
47:4806, 1987[Abstract/Free Full Text]
8.
Boyd Y, Fraser NJ:
Methylation patterns at the hypervariable X-chromosome locus DXS255 (M27): Correlation with X-inactivation status.
Genomics
7:182, 1990[Medline]
[Order article via Infotrieve]
9.
Allen CR, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW:
Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen receptor gene correlates with X-chromosome inactivation.
Am J Hum Genet
51:1229, 1992[Medline]
[Order article via Infotrieve]
10.
Gale RE, Wainscoat JS:
Clonal analysis using X-linked DNA polymorphisms.
Br J Haematol
85:2, 1993[Medline]
[Order article via Infotrieve]
11.
Lyon MF:
X-chromosome inactivation and developmental patterns in mammals.
Biol Rev Camb Philos Soc
47:1, 1972[Medline]
[Order article via Infotrieve]
12.
Riggs AD:
X-inactivation, differentiation and DNA-methylation.
Cytogenet Cell Genet
14:9, 1975[Medline]
[Order article via Infotrieve]
13.
Martin GR, Epstein CJ, Travis B, Tucker G, Yatziv S, Martin DW Jr, Clift C, Cohen S:
X-chromosome inactivation during differentiation of female teratocarcinoma stem cells in vitro.
Nature
271:329, 1978[Medline]
[Order article via Infotrieve]
14.
Lyon MF:
X-chromosome inactivation and the location and expression of X-linked genes.
Am J Hum Genet
42:8, 1988[Medline]
[Order article via Infotrieve]
15.
Busque L, Gilliland G:
Clonal evolution in acute myeloid leukemia.
Blood
82:337, 1993[Free Full Text]
16.
Luppi M, Marasca R, Morselli M, Barozzi P, Torelli G:
Clonal nature of the hypereosinophilic syndrome.
Blood
84:349, 1994[Free Full Text]
17.
Gale RE, Mein CA, Linch DC:
Quantification of X-chromosome inactivation patterns in haematological samples using the DNA PCR-based HUMARA assay.
Leukemia
10:362, 1996[Medline]
[Order article via Infotrieve]
18.
Weil GJ, Chused TM:
Eosinophil autofluorescence and its use in isolation and analysis of human eosinophils using flow microfluorometry.
Blood
57:1099, 1981[Abstract/Free Full Text]
19.
Mayeno AN, Hamann KJ, Gleich GJ:
Granule-associated flavin adenine dinucleotide (FAD) is responsible for eosinophil autofluorescence.
J Leukoc Biol
51:172, 1992[Abstract]
20.
Maniatis T, Fritsch EF, Sambrook J:
Molecular cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1988.
21.
Anan K, Ito M, Misawa M, Ohe Y, Kai S, Kohsaki M:
Clonal analysis of peripheral blood and haemopoietic colonies in patients with aplastic anaemia and refractory anaemia using polymorphic short tandem repeat on the HUMARA gene.
Br J Haematol
89:839, 1995
22.
Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn HF:
Clonality in myeloproliferative disorders: Analysis by the polymerase chain reaction.
Proc Natl Acad Sci USA
88:6848, 1991[Abstract/Free Full Text]
23.
Churg J, Strauss L:
Allergic granulomatosis, allergic angiitis and periarteritis nodosa.
Am J Pathol
27:277, 1951
24.
Masi AT, Hunder GG, Lie JT, Michael BA, Bloch DA, Arend WP, Calabrese LH, Edworthy SM, Fauci AS, Leavitt RY, Lightfoot RWJ, McShane DJ, Mills JA, Stevens MB, Wallace SL, Zvaifler NJ:
The American College of Rheumatology 1990 criteria for the classification of Churg-Strauss syndrome (allergic granulomatosis and angiitis).
Arthritis Rheum
33:1094, 1990[Medline]
[Order article via Infotrieve]
25.
Parillo JE, Lawley TJ, Frank MM, Kaplan AP, Fauci AS:
Immunologic reactivity in the hypereosinophilic syndrome.
J Allergy Clin Immunol
64:113, 1979[Medline]
[Order article via Infotrieve]
26.
Parillo JE, Fauci AS, Wolff SM:
Therapy of the hypereosinophilic syndrome.
Ann Intern Med
89:167, 1978
27.
Sanderson CJ:
Interleukin 5, eosinophils and disease.
Blood
79:3101, 1992[Free Full Text]
28.
Cogan E, Schandené L, Crusiaux A, Cochaux P, Velu T, Goldman M:
Clonal proliferation of type 2 helper T cells in a man with hypereosinophilic syndrome.
N Engl J Med
330:535, 1994[Free Full Text]
29.
Kitano K, Ichikawa N, Shimodaira S, Ito T, Ishida F, Kiyosawa K:
Eosinophilia associated with clonal T-cell proliferation.
Leuk Lymphoma
27:335, 1997[Medline]
[Order article via Infotrieve]
30.
Spry CJF:
Idiopathic hypereosinophilic syndrome, in
Makino T,
Fukuda S
(eds):
Eosinophils: Biological and Clinical Aspects. Boca Raton, FL, CRC, 1992, p 403.
31.
Weller PF, Goetze EJ:
The regulatory and effector roles of eosinophils.
Adv Immunol
27:339, 1979[Medline]
[Order article via Infotrieve]
32.
Bain BJ:
Eosinophilic leukaemias and the idiopathic hypereosinophilic syndrome.
Br J Haematol
95:2, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. Tefferi
Blood Eosinophilia: A New Paradigm in Disease Classification, Diagnosis, and Treatment
Mayo Clin. Proc.,
January 1, 2005;
80(1):
75 - 83.
[Abstract]
[PDF]
|
|
|
|
|
|
|
K. J. Smith, E. Jacobson, S. Hamza, and H. Skelton
Unexplained Hypereosinophilia and the Need for Cytogenetic and Molecular Genetic Analyses
Arch Dermatol,
May 1, 2004;
140(5):
584 - 588.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Gotlib, J. Cools, J. M. Malone III, S. L. Schrier, D. G. Gilliland, and S. E. Coutre
The FIP1L1-PDGFR{alpha} fusion tyrosine kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia: implications for diagnosis, classification, and management
Blood,
April 15, 2004;
103(8):
2879 - 2891.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. D. Klion, P. Noel, C. Akin, M. A. Law, D. G. Gilliland, J. Cools, D. D. Metcalfe, and T. B. Nutman
Elevated serum tryptase levels identify a subset of patients with a myeloproliferative variant of idiopathic hypereosinophilic syndrome associated with tissue fibrosis, poor prognosis, and imatinib responsiveness
Blood,
June 15, 2003;
101(12):
4660 - 4666.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Pardanani, T. Reeder, L. F. Porrata, C.-Y. Li, H. D. Tazelaar, E. J. Baxter, T. E. Witzig, N. C. P. Cross, and A. Tefferi
Imatinib therapy for hypereosinophilic syndrome and other eosinophilic disorders
Blood,
May 1, 2003;
101(9):
3391 - 3397.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Cools, D. J. DeAngelo, J. Gotlib, E. H. Stover, R. D. Legare, J. Cortes, J. Kutok, J. Clark, I. Galinsky, J. D. Griffin, et al.
A Tyrosine Kinase Created by Fusion of the PDGFRA and FIP1L1 Genes as a Therapeutic Target of Imatinib in Idiopathic Hypereosinophilic Syndrome
N. Engl. J. Med.,
March 27, 2003;
348(13):
1201 - 1214.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. W. Chang, A. Chan, D. L. W. Kwong, W. I. Wei, J. S. T. Sham, and A. P. W. Yuen
Detection of Hypermethylated RIZ1 Gene in Primary Tumor, Mouth, and Throat Rinsing Fluid, Nasopharyngeal Swab, and Peripheral Blood of Nasopharyngeal Carcinoma Patient
Clin. Cancer Res.,
March 1, 2003;
9(3):
1033 - 1038.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. P. van Dijk, L. H. Heuver, B. A. van der Reijden, R. A. Raymakers, T. de Witte, and J. H. Jansen
A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction
Am. J. Pathol.,
September 1, 2002;
161(3):
807 - 812.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction