|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 5 (March 1), 1999:
pp. 1684-1696
Overexpression of the Receptor for Hyaluronan-Mediated Motility
(RHAMM) Characterizes the Malignant Clone in Multiple Myeloma:
Identification of Three Distinct RHAMM Variants
By
Mary Crainie,
Andrew R. Belch,
Michael J. Mant, and
Linda M. Pilarski
From the Departments of Oncology and Medicine, University of Alberta
and the Cross Cancer Institute, Edmonton, Canada.
 |
ABSTRACT |
The receptor for hyaluronan (HA)-mediated motility (RHAMM) controls
motility by malignant cells in myeloma and is abnormally expressed on
the surface of most malignant B and plasma cells in blood or bone
marrow (BM) of patients with multiple myeloma (MM). RHAMM cDNA was
cloned and sequenced from the malignant B and plasma cells comprising
the myeloma B lineage hierarchy. Three distinct RHAMM gene products,
RHAMMFL, RHAMM 48, and
RHAMM147, were cloned from MM B and plasma cells.
RHAMMFL was 99% homologous to the published sequence of
RHAMM. RHAMM48 and RHAMM147 variants
align with RHAMMFL, but are characterized by sequence
deletions of 48 bp (16 amino acids [aa]) and 147 bp (49 aa),
respectively. The relative frequency of these RHAMM transcripts in MM
plasma cells was determined by cloning of reverse-transcriptase
polymerase chain reaction (RT-PCR) products amplified from MM plasma
cells. Of 115 randomly picked clones, 49% were RHAMMFL,
47% were RHAMM48, and 4% were RHAMM147.
All of the detected RHAMM variants contain exon 4, which is alternatively spliced in murine RHAMM, and had only a single copy of
the exon 8 repeat sequence detected in murine RHAMM. RT-PCR analysis of
sorted blood or BM cells from 22 MM patients showed that overexpression
of RHAMM variants is characteristic of MM B cells and BM plasma cells
in all patients tested. RHAMM also appeared to be overexpressed in B
lymphoma and B-chronic lymphocytic leukemia (CLL) cells. In B cells
from normal donors, RHAMMFL was only weakly detectable in
resting B cells from five of eight normal donors or in chronically
activated B cells from three patients with Crohn's disease.
RHAMM48 was detectable in B cells from one of eight
normal donors, but was undetectable in B cells of three donors with
Crohn's disease. RHAMM147 was undetectable in normal
and Crohn's disease B cells. In situ RT-PCR was used to determine the
number of individual cells with aggregate RHAMM transcripts. For six
patients, 29% of BM plasma cells and 12% of MM B cells had detectable
RHAMM transcripts, while for five normal donors, only 1.2% of B cells
expressed RHAMM transcripts. This work suggests that
RHAMMFL, RHAMM48, and
RHAMM147 splice variants are overexpressed in MM and
other B lymphocyte malignancies relative to resting or in
vivo-activated B cells, raising the possibility that RHAMM and its
variants may contribute to the malignant process in B-cell malignancies
such as lymphoma, CLL, and MM.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
MULTIPLE MYELOMA (MM) is an incurable
cancer characterized by the presence of monoclonal Ig in the blood,
lytic bone lesions, and monoclonal plasma cells in the bone marrow
(BM). Median survival is approximately 3 years. Compared with its
incidence, MM accounts for a disproportionate number of the deaths from
hematologic malignancies. Although many patients achieve initial
clinical remission, nearly all relapse and become refractory to
treatment.1,2 The molecular basis of the malignancy is
unknown, and no consistent oncogenic or genetic abnormality
characterizes all myeloma patients. Although clinically MM is viewed as
a disease restricted to the BM, molecular studies confirm it to be a
systemic malignancy that includes peripheral blood. Many groups,
including ours, have identified clonotypic IgH VDJ among peripheral
blood mononuclear cells (PBMC) of MM patients,3-11 or
purified B cells from MM PBMC.6,12-14 We have identified
and verified the IgH VDJ clonal sequences that characterize each MM
patient, and have shown that clonotypic B cells are frequent in the
circulation of myeloma patients (0.16 × 109/L blood).12-14 These B cells are
late-stage, drug-resistant cells with stem-cell-like
properties.6,12-18 The majority of B cells in MM PBMC are
surface Ig+ (sIg), express pan-B cell markers (CD19, CD20,
CD24) and by a variety of measures appear to be in an activated late
stage of B-cell differentiation.13,16,19,20 They express
the stem-cell marker CD34,12 and a large constellation of
receptors involved in adhesion to endothelium or extracellular matrix
(ECM) and in motility.13,17,20-23 Morphologically and
functionally, these B cells are distinct from plasma
cells.17,24,25 Both MM B and plasma cells are characterized
by their expression of the receptor for hyaluronan (HA)-mediated
motility (RHAMM), but only circulating B cells are
motile.17,22,24 The heterogeneity in phenotype and
morphology seen among these clonotypic B cells, including resting B
cells, lymphoblasts, and more differentiated phenotypes, is suggestive
of sequentially related cell types resulting from continuous stimulation.
Interactions between HA and RHAMM are required for motile
behavior of a wide variety of cells, including sperm, fibroblasts, astrocytes, microglia, and white blood cells.17,22,26-30
Binding of HA by RHAMM triggers signal transduction, dissolution of
focal adhesions, and motility, and is involved in cell cycle
control.24,26,31-34 RHAMM is a glycophosphatidylinositol
(GPI)-anchored receptor, lacking both a signal sequence and a
transmembrane domain, that is alternatively spliced to yield soluble,
cytoplasmic, and surface receptor isoforms.26,27 RHAMM
mediates motility, is itself oncogenic when overexpressed, and is
essential for ras-mediated transformation.27
Activated normal lymphocytes transiently express a low level of
RHAMM.22,28 In MM, RHAMM on B and leukemic plasma cells
binds HA and mediates HA-dependent motility.17 Although nonmotile BM-anchored MM plasma cells also express RHAMM, its function
on these cells is as yet unknown. The relatively abundant RHAMM on most
B and plasma cells in MM, as well as its apparently constitutive
functional properties,17 suggests it may be deregulated or
overexpressed, and thus implicated in the malignant process.
In this study, we have characterized the RHAMM expression of malignant
B-lineage cells in myeloma by sequencing and mapping the expression
patterns of RHAMM transcripts in MM B and plasma cells from patients as
compared with malignant B cells in lymphoma and chronic lymphocytic
leukemia (CLL) and B cells from normal donors or donors with
nonmalignant but activated B cells (Crohn's disease). We find that
three distinct RHAMM transcripts are detectable ex vivo in MM B and
plasma cells, lymphoma cells, and CLL cells, two of which are novel
deletion splice variants. All three forms of RHAMM are detectably
overexpressed in malignant B-lineage cells as compared with resting or
activated normal B cells.
| |
MATERIALS AND METHODS |
Patients.
Peripheral blood was obtained from 101 patients with MM, three patients
with CLL, eight healthy normal volunteers, and three patients with
Crohn's disease after informed consent; BM was obtained from 11 patients with MM. Malignant lymphoma nodes from three patients were
pathology specimens obtained after surgery.
Antibodies and reagents.
B4-FITC (CD19) was from Coulter (Hialeah, FL). FMC63 (CD19) was from Dr
H. Zola (Adelaide Women's and Children's Hospital, Australia)35,36 and was conjugated to fluorescein
isothiocyanate (FITC). Anti-CD38 (Leu-17-phycoerythrin [PE]) was
purchased from Becton Dickinson (San Jose, CA). Goat antimouse Ig
conjugated to FITC or PE and antihuman Ig (goat antihuman Ig
[H+L]-FITC) was from Southern Biotechnology (Birmingham, AL). RHAMM
monoclonal antibody (mAb) 3T3.5 was from Dr Eva Turley (Hospital for
Sick Children University of Toronto, Toronto, Canada).
Tissue and cell preparations.
All cell preparations were used immediately ex vivo. Peripheral blood
or BM cells from MM and CLL patients and normal donors or donors with
Crohn's disease were collected into heparinized vacutainer tubes,
centrifuged over a Ficoll-hypaque gradient, washed, and resuspended in
Trizol (GIBCO-BRL/Life Technologies, Burlington, Ontario,
Canada). Lymphoma nodes were minced to prepare single-cell suspensions,
pelleted, and resuspended in Trizol. Only nodes with greater than 50%
B cells among lymph node mononuclear cells were used for this study.
Our previous work indicated that only B cells in nodes from lymphoma
patients expressed surface RHAMM, and that RHAMM was not expressed by
normal B or T cells from lymph node.22 PBMC from B-CLL
samples included greater than 98% B cells.
Immunofluorescence and sorting.
For phenotypic analysis, MM PBMC or BM cells, or normal PBMC, were
stained in two-color immunofluorescence with mAb to CD19 (direct
conjugate) and to RHAMM or an IgG1 isotype-matched control (indirect
staining) followed by washing, blocking with mouse gamma-globulin, and
detection with a goat antimouse Ig fluorescent conjugate, as previously
described.6,17 MM B cells are
CD19+CD20med/hi,6 and B cells from
normal donors are CD19+CD20hi. BM plasma cells
in MM are CD19loCD20/lo. Identical
staining patterns were obtained with either B4 or FMC63. Samples were
analyzed by FACSsort (Becton Dickinson), collecting 10,000 to 20,000 events gated to exclude RBCs and dead cells. Files were analyzed by
gating for CD19+ and plotting the staining of RHAMM or
IgG1. Staining was considered positive only if it exceeded that of the
isotype control. All B cells from myeloma PBMC (termed MM B cells)
express CD19 and IgH mRNA.12 MM B cells express IgH
transcripts identical to those of autologous BM plasma cells,
confirming their membership within the malignant clone in
MM.12-14
For sorting, mononuclear cells were collected from the interface,
washed twice in cold phosphate-buffered saline (PBS), resuspended in
PBS/10% fetal calf serum (FCS) at 2 × 106 cells/mL,
stained with anti-CD19, or anti-CD38 plus antihuman Ig at 4°C for
30 to 60 minutes, and washed twice with cold PBS containing 0.06 g/L
EDTA to inhibit cell aggregation. Mononuclear cells were sorted on a
Coulter Elite flow cytometer. B cells from normal donors and patients
with Crohn's disease were sorted as CD19+ cells gated for
low forward and side scatter to exclude monocytes. B cells from MM PBMC
were sorted as CD19+ cells with no gates set on scatter
beyond those excluding RBCs and dead cells, as previously
described.12-14 For MM PBMC, unlike normal or Crohn's
PBMC, nearly all cells within the monocytoid scatter gates are B cells,
as confirmed by their by their IgH and CD19 transcripts, as well as by
their phenotypic profile.12-14 BM plasma cells were sorted
as CD38hi, Ig+ cells; nearly all of the plasma
cells within these gates expressed the clonal marker sequence unique to
each MM patient,12-14 confirming selection of malignant
cells. Sort gates were set to include cells staining brighter than
isotype controls. Reanalysis of sorted samples gave a purity of 97% or
better. Cells were sorted into PBS plus 1% FCS, washed, resuspended in
Trizol, and stored at  80°C.
Reverse-transcriptase polymerase chain reaction.
RNA was extracted using Trizol, resuspended in diethyl pyrocarbonate
(DEPC)-treated water, and stored at 80°C. Next, total RNA
(500 ng or 1 µg) was denatured at 70°C for 10 minutes, annealed to 0.5 µmol/L oligo dT15, and reverse-transcribed with 0.5 mmol/L deoxyribonucleoside triphosphates (dNTPs), 0.01 mol/L dithiothreitol (DTT), 200 U Superscript (GIBCO/BRL), and 1× reverse
transcriptase (RT) buffer (GIBCO BRL) in a volume of 20 µL at
42°C for 60 minutes, and heat-inactivated at 99°C for 3 minutes. The cDNA template (1 to 4 µL) was amplified in a 50-µL
polymerase chain reaction (PCR) mix (Boehringer Mannheim,
Laval, Quebec, Canada; BMH) containing 1× PCR buffer, 0.2 mmol/L
dNTPs, 0.4 µmol/L upstream and downstream primers, and 1U Taq DNA
polymerase. The PCR cycling parameters were denaturation for 5 minutes
at 94°C, followed by 35 cycles of denaturation for 1 minute at
94°C, annealing for 30 seconds, and extension at 72°C for 2 minutes, with a final extension period of 7 minutes at 72°C. Primer
annealing temperature (TA) was calculated as
TA= 4 × (G + C) + 2 × (A + T) 5.
The primers used to amplify RHAMM were as follows: (1) 5'
GGCCGTCAACATGTCCTTTCCTA, 3' TTGGGCTATTTTCCCTTGAGACTC; (2)
5' CAGGTCACCCAAAGGAGTCTCG, 3' CAAGCTCATCCAGTGTTTGC; (3)
5' GCAAACACTGGATGAGCTTG, 3' TTGCCTTCTTTTAATGGGGTC; (4)
5' AGGAGGAACAAGCTGAAAGG, 3' TTCCTGAGCTGCACCATGTT; (5)
5' GGCCGTCAACATGTCCTTTCCTA, 3' ACAGCAACATCAATAACAACAAGA;
(6) 5' GAGAATTCTAAGCTTGGAGTTG, 3' CAAGCTCATCCAGTGTTTGC; (7)
5' TCCTAGAAGAAAAGCTGAAAGGGAA, 3' CTTGGCCGCTTTTTCCTGTAATGA; and (8) 5' GTTTCTGGAGCTGGCCGTC, 3' ACTGGTCCTTTCAATACTTCTAAAGT.
Cloning and sequencing.
The PCR products were ligated into the PCR TM II or PCR
TM2.1 vector and transformed into One ShotTM competent cells with the
TA cloning kit according to the manufacturer's instructions (Invitrogen, San Diego, CA). Single bacterial colonies were introduced into a 25-µL PCR reaction mix containing 1× PCR buffer, 0.2 mol/L dNTPs, 0.4 µmol/L upstream and downstream primers, and 0.5 U
Taq DNA polymerase. The PCR cycling parameters were bacterial lysis for
10 minutes at 94°C, followed by 25 cycles of denaturation for 1 minute at 94°C, annealing at TA for 30 seconds, and extension at 72°C for 1 minute, with a final extension
period of 7 minutes at 72°C. The amplified products were analyzed
by agarose gel electrophoresis. The cloned inserts were sequenced with
the ABI PRISM TM Dye Terminator Cycle Sequencing Ready
Reaction Kit (Perkin Elmer, Applied Biosystems, Mississauga, Ontario,
Canada) with Ampli Taq DNA polymerase on a Perkin Elmer 373 A DNA Sequencer.
Amplification and detection of RHAMM isoforms.
Total RNA (500 ng or 1 µg) was prepared and reverse-transcribed as
described earlier. To detect RHAMMFL and
RHAMM48, 5 µL of cDNA was amplified with RHAMM
primer set 1 (described earlier).
To ensure mRNA integrity, 1 µL of cDNA was amplified with histone
primers: 5' CCACTGAACTTCTGATTCGC, 3' GCGTGCTAGCTGGATGTCTT; or 5 µL of cDNA was amplified with CD19 primers: 5'
TACTATGGCACTGGCTGCTG, 3' CACGTTCCCGTACTGGTTCT.
The amplified products were analyzed on a 1% agarose, ethidium
bromide, 50 mmol/L Tris, 45 mmol/L boric acid, 0.5 mmol/L EDTA, pH 8.3 (0.5× TBE) gel.
To detect RHAMM147, 5 µL of cDNA was amplified
with RHAMM primer set 3 (described earlier), electrophoresed on a 1%
agarose gel, and transferred overnight onto Hybond-N nylon membrane
(Amersham Canada Ltd, Oakville, Ontario, Canada). The
membrane was prehybridized in 5× SSC, 0.1%
N-lauroylsarcosine, 0.2% sodium dodecyl sulfate (SDS), and 2%
blocking reagent (BMH) for 1 hour at 65°C and then hybridized to a
20-ng/mL digoxigenin (DIG)-labeled RHAMM probe overnight at 65°C in
prehybridization solution. The probe template was amplified from BM
plasma-cell cDNA with RHAMM primer set 9: 5'
GAAAAGTAGTGCTGCTCATACC, 3' GGTCTGCAGATCTAGAAGCATC; and labeled with DIG-11-dUTP with a DIG DNA-labeling kit (BMH) according to the
manufacturer's instructions. After hybridization, the membrane was
washed once in 2× SSC, 0.1% SDS for 10 minutes at room
temperature, twice in 0.1× SSC, 0.1% SDS for 15 minutes at
65°C, blocked with 2% blocking reagent for 30 minutes at room
temperature, incubated with 1:5,000 anti-DIG Fab alkaline
phosphatase/2% blocking solution for 30 minutes at room temperature,
washed twice in 0.1 mol/L maleic acid, 0.1 mol/L NaCl, 0.3% Tween-20
for 15 minutes at room temperature and equilibrated in 0.1 mol/L
Tris-HCl, 0.15 mol/L NaCl pH 9. Amplified RHAMM was detected by
incubating the membrane with 4.5 µg/mL 4-Nitro blue tetrazolium
chloride (NBT), 1.7 µg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP;
BMH) in 0.1 mol/L Tris-HCl, 0.15 mol/L NaCl, 0.05 mol/L
MgCl2 pH 9 at room temperature and monitoring color
development or by overlaying the membrane with Lumi-phos 530 chemiluminescence substrate sheet (Schleicher & Schuell, Keene,
NH) and exposure to Hyperfilm-ECL (Amersham).
Comparison of primer efficiency.
The open-reading frame (ORF) of each cloned RHAMM isoform was
restriction-digested from the PCR TM II vector with EcoRV plus Kpn I, electrophoresed on a low-melting-point agarose gel, and purified with  -Agarase (New England Biolabs, Beverly,
MA) according to the manufacturer's instructions. RHAMMFL
and RHAMM48 (100 pg, 10 pg, 1 pg) were amplified
with primer set 1, and the products analyzed by electrophoresis on an
ethidium bromide-stained agarose gel. RHAMMFL and
RHAMM147 (100 pg, 10 pg, 1 pg) were amplified with
primer set 3, and the products analyzed by electrophoresis, transfer to
a nylon membrane, hybridization to a DIG-labeled RHAMM probe, and
chemiluminescent detection as described earlier.
In situ RT-PCR.
In situ RT-PCR was as previously described.12,13 Briefly,
normal B cells, MM B cells, and BM plasma cells were purified and
stained as described earlier. The cells were fixed in 10% formalin/PBS
overnight and sorted onto In Situ PCR glass slides (Perkin Elmer) at
10,000 cells/spot. Each slide had three spots that included a negative
control, which was not reverse-transcribed to confirm digestion of
genomic DNA, a positive control with intact genomic DNA, and a test
spot. The slides were air-dried, permeabilized with 2 mg/mL
pepsin/0.01N HCl (BMH) at times optimal for each cell type, normal B
cells for 45 minutes, MM B cells for 40 minutes, and MM BM plasma cells
for 35 minutes, followed by a 1-minute wash in DEPC-treated water and
then 1 minute in 95% ethanol. The negative control and test spot were
digested with 1,000 U/mL DNAse I (RNAse-free; BMH) overnight at
37°C followed by a water and ethanol wash. The test sample was
reverse transcribed with Superscript according to the manufacturer's
recommendations followed by a water and ethanol wash. Amplification was
performed on the negative, positive and test spots with an In Situ Core
Kit (Perkin Elmer) with direct incorporation of DIG-11-dUTP (BMH).
Cycling parameters were denaturation for 5 minutes at 94°C,
followed by 25 cycles of denaturation for 1.5 minutes at 94°C,
annealing for 1.5 minutes at 65°C, and extension for 2 minutes at
72°C, with a final extension period of 7 minutes at 72°C. The
primers used to amplify RHAMM were primer set 10: 5'
ATCACAAAGATTTAAACAACAAAAAGAAT, 3' CTTCCATCTTTTCCAACTCAGTTTC.
The slides were washed in 2× SSC (20× SSC = 3 mol/L sodium
chloride, 0.3 mol/L sodium citrate, pH 7) for 5 minutes at room temperature, blocked with 0.1× SCC/0.2% bovine
serum albumin (BSA) for 5 minutes at 45°C, and equilibrated for 10 minutes in 0.1 mol/L Tris-HCl, 0.15 mol/L NaCl pH 7.5. Amplified DNA
was detected by incubation with 1:200 anti-DIG Fab alkaline phosphatase
(BMH) for 30 minutes at room temperature. The slides were washed in 0.1 mol/L Tris-HCl, 0.15 mol/L NaCl, 0.05 mol/L MgCl2 pH 9.5 for 5 minutes, and incubated with 0.2 mg/mL NBT, 0.1 mg/mL BCIP at room
temperature for up to 1 hour. Color development was monitored under the
microscope. The reaction was stopped by washing in water.
| |
RESULTS |
RHAMM is expressed by members of the B-lineage hierarchy in myeloma.
Multicolor immunofluorescence was used to determine the expression of
RHAMM on MM B and plasma cells (Table 1 and
Fig 1). The majority of MM plasma cells
resident in the BM express RHAMM (mean, 66% ± 9%). The MM clone
also includes circulating B cells expressing IgH transcripts identical
to those of autologous BM plasma cells.12-14 Of circulating
CD19+ MM B cells, 56% ± 5% expressed RHAMM (Table 1
and Fig 1). In contrast, of B cells from healthy donors, only 3.5%
expressed RHAMM, possibly representing the minority of normal
circulating B cells in the early stages of activation in
vivo.22
View larger version (21K):
[in this window]
[in a new window]
| Fig 1.
RHAMM is expressed on the majority of MM blood B cells,
but is absent from most normal B cells. PBMC from MM or normal donors
were stained with B4-FITC (CD19) and RHAMM or an isotype-matched IgG1
control (indirect immunofluorescence with a second-stage goat antimouse
Ig-PE). Files were gated for B cells and the expression of RHAMM
plotted as a histogram. ( ) RHAMM staining; (-) isotype control
staining.
|
|
Sequence analysis of RHAMM gene products.
Using cDNA pools from the BM plasma cells of two MM patients and from
the B cells of six MM patients, RHAMM cDNA fragments were amplified by
RT-PCR with RHAMM-specific primers (Fig 2). The amplified cDNA fragments were cloned and colonies screened by PCR
with the appropriate RHAMM primers to identify those containing potential RHAMM cDNA inserts. Each cloned insert was sequenced and
identified as a RHAMM cDNA fragment by alignment with the published
sequence of human breast RHAMM.37 Alignment of RHAMM cDNA
fragments produced three distinct RHAMM gene products from B cells and
from BM plasma cells designated RHAMMFL,
RHAMM48, and RHAMM147 (Fig
3).
B-cell and BM plasma cell RHAMM was 99% homologous to breast RHAMM.
The two start codons, stop codon, and the two HA-binding domains,
previously described for RHAMM,32,37 were all present in
the aligned cDNA fragments cloned from MM B and plasma cells. RHAMM48 and RHAMM147 align with
RHAMM, but have sequence deletions of 48 bp and 147 bp, respectively.
The 48-bp deletion that characterizes RHAMM48 lies
between the two start codons. Comparison of the cDNA nucleotide sequences of B-cell RHAMMFL, RHAMM48,
and RHAMM147 with plasma cell RHAMMFL,
RHAMM48, and RHAMM147 showed that
the RHAMM gene products from these two cell types were 99% homologous.
Thus, three distinct RHAMM gene products were identified in MM B and
plasma cells by sequence analysis.
View larger version (14K):
[in this window]
[in a new window]
| Fig 2.
Location of RHAMM primer sets within RHAMM cDNA.
Locations of the primers used to amplify RHAMM are identified with
reference to the start (ATG) and stop (TAA) codons; the 48-bp and
147-bp deletion; exon 4; and the repeat sequence.
|
|
View larger version (237K):
[in this window]
[in a new window]
| Fig 3.
Comparison of B-cell and plasma cell RHAMM. RHAMM cDNA
fragments were amplified from MM B cells and BM plasma cells by RT-PCR
with RHAMM-specific primers and subsequently cloned and sequenced. The
nucleotide sequences of the RHAMM fragments were aligned to generate
the sequence of B-cell RHAMMFL and BM plasma cell
RHAMMFL. The 48-bp deletion and the 147-bp deletion that
characterize RHAMM48 and RHAMM147,
respectively, are marked in bold lowercase. The 2 ATG start codons
(base 18-20 and base 363-365) and TAA stop codon (base 2197-2199),
previously described for breast RHAMM, plus the 2 HA-binding domains
are underlined.
|
|
Cloning of RHAMM variants.
Because the identification of RHAMMFL,
RHAMM48, and RHAMM147 was
performed by sequence alignment of RHAMM cDNA fragments, we confirmed that each variant identified was transcribed into a complete RHAMM message in vivo. The complete ORF of RHAMM was amplified from BM plasma
cell cDNA and screened for full-length RHAMMFL,
RHAMM48, or RHAMM147 clones
(Table 2). Full-length RHAMMFL,
RHAMM147, and RHAMM48 clones were
initially identified by PCR screening of colonies with primer set 1 (described earlier), which amplifies two products of 613 bp,
corresponding to RHAMMFL or RHAMM147,
and of 565 bp corresponding to RHAMM48. Next, clones
scoring positive for RHAMMFL/RHAMM147
were rescreened by PCR with primer set 4, which amplifies two products:
one of 666 bp, corresponding to RHAMMFL, and
one of 519 bp, corresponding to RHAMM147. The 519-bp
PCR product that characterizes the 147-bp deletion of
RHAMM147 clones was not amplified from
RHAMM48 clones rescreened with primer set 4, but the
666-bp product was, showing that the 48-bp and 147-bp deletions are not
found in the same RHAMM transcript and that RHAMM48
and RHAMM147 are distinct RHAMM variants. Figure
4A shows the pattern of PCR products
amplified by primer sets 1 and 4 for each RHAMM isoform. A
representative clone of each RHAMM isoform was sized by gel electrophoresis to confirm that RHAMMFL,
RHAMM48, and RHAMM147 were indeed
full-length RHAMM gene products (Fig 4B). The frequency of transcripts
for each isoform expressed in MM was estimated by determining the
frequency of clones derived from the ORF amplification (Table 2).
RHAMMFL was the most frequent transcript, appearing in 49%
of the randomly selected clones. RHAMM48 was present
in 47% of the clones, and RHAMM147, detected in 4%
of the clones, was relatively infrequent.
View larger version (60K):
[in this window]
[in a new window]
| Fig 4.
Identification of ORF RHAMM isoforms from MM plasma
cells. (A) Plasma cell ORF RHAMM was amplified, cloned, and colonies
screened by PCR with primer set 1 and primer set 4. The amplification
products from cloned RHAMMFL were 613 bp (lane 2) and 666 bp (lane 6), from RHAMM48 were 565 bp (lane 3) and 666 bp (lane 7), and from RHAMM147 were 613 bp (lane 4) and
519 bp (lane 8). Markers (lane 1 and 5) are 700, 600, 500, 400, and 300 bp. (B) A representative clone of each ORF RHAMM isoform was
restriction-digested from the PCR TM II vector with EcoRV plus
Kpn I and sized on a 1% agarose gel. RHAMMFL
is 2.319 kb; RHAMM48 is 2.268 kb; and
RHAMM147 is 2.172 kb. Markers are 2.5, 2, 1.5, and 1 kb.
|
|
RHAMM transcripts from MM cells include exon 4 and have a truncated
"repeat" region in exon 8.
Murine RHAMM has been shown to include an isoform termed RHAMMv4 to
designate the presence of exon 4,26 which is transforming for normal fibroblasts (Fb) and is associated with
tumorigenicity.27 Transformed murine Fb also include a
multiple repeat sequence within RHAMM exon 8.26 In the
human, the RHAMM transcript detected in breast epithelium appears to
include exon 4 and has only one copy of the "repeat" sequence
found in mouse Fb.37 To characterize usage of exon 4 in
RHAMM expressed by MM cells, we designed primers to amplify a region
spanning exon 4 (primer set 6), such that any transcripts lacking exon
4 would appear as a smaller size than those incorporating exon 4. A
single amplification product of 667 bp, incorporating exon 4, was
detected in MM B cells and plasma cells (Fig
5A). No small transcripts were detectable,
suggesting that in MM, all RHAMM incorporates exon 4. Using primers
spanning exon 8 (primer set 7), a 214-bp product (Fig 5B) indicates
transcripts with one repeat sequence, and larger products would
indicate transcripts having more than one of the repeated sequence. A
single amplification product, of 214 bp, corresponding to a single
sequence in the repeat region, was detected in MM B cells and plasma
cells (Fig 5B).
View larger version (64K):
[in this window]
[in a new window]
| Fig 5.
Amplification of exon 4 and the "repeat" region
from MM B cells and plasma cells. (A) The region spanning exon 4 was
amplified from MM B cells and plasma cells with primer set 6. A single
band of 667 bp was detected. Markers are 700, 600, 500, and 400 bp. (B)
The "repeat" region of RHAMM was amplified from MM B cells and
plasma cells with primer set 7. A single band of 214 bp was detected.
Markers are 500, 400, 300, 200, and 100 bp.
|
|
Expression of RHAMM isoforms is detectable in B and plasma cells from
all MM patients.
To confirm that RHAMMFL, RHAMM48, and
RHAMM147 were expressed in B and plasma cells from
all myeloma patients, we analyzed the pattern of RHAMM isoforms
expressed by the sorted B cells from 11 individual MM patients and BM
plasma cells from 11 individual MM patients. Figures
6 and 7 show
the pattern of RHAMM isoforms amplified by primer set 1 and primer set
3, respectively. RHAMMFL and RHAMM48
were amplified from the B cells of all 11 patients analyzed (six representative patients are shown in Fig 6A, lanes a through f) and
from the BM plasma cells of all 11 patients analyzed (five representative patients are shown in Fig 6A and C, lanes g through k).
RHAMM147 was amplified from the BM plasma cells of
six of six MM patients (Fig 7A, lanes 1 to 6, top panel) and from the B
cells of four of five MM patients (Fig 7A, lanes 1 to 5, middle panel).
Amplification and detection of MM B-cell genomic DNA, under identical
conditions, did not generate products corresponding to
RHAMMFL, RHAMM48, or
RHAMM147, but a genomic interleukin-2 (IL-2) product
was amplified with IL-2-specific primers, showing that the RHAMM
sequences detected were not amplified genomic products. As an
additional control, BM RNA was incubated with or without superscript in
the RT step and then amplified; RHAMM amplification products were only
detected "with Superscript" showing that the RHAMM sequences were
derived from RNA and not DNA. Thus, the RHAMM transcripts identified
here are expressed by all MM patients.
View larger version (41K):
[in this window]
[in a new window]
| Fig 6.
Overexpression of RHAMMFL and
RHAMM48 from MM B and plasma cells, B-lymphoma, and
B-CLL, as compared with normal B cells and chronically activated B
cells from patients with Crohn's disease. (A) RHAMMFL and
RHAMM48 were amplified by RT-PCR from 500 ng of RNA from
the B cells of 6 myeloma patients (a, b, c, d, e, f), the BM plasma
cells of 5 myeloma patients (g, h, I, j, k), and the pooled B cells
from 2 patients with Crohn's disease (lane l). The same quantity of
RNA (500 ng) and cDNA (5 µL) was used in the RT-PCR step for all cell
populations analyzed so that the level of RHAMM expression could be
compared between the different cell populations in the figure. The
quality of RNA isolated from all B-cell populations was comparable as
determined by amplification of CD19 transcripts from a separate aliquot
of the same cDNA (5 µL) from which RHAMM was amplified (data not
shown). A 613-bp fragment was amplified for RHAMMFL and a
565-bp fragment for RHAMM48. (B) RHAMMFL and
RHAMM48 were amplified by RT-PCR from 500 ng of RNA from
the malignant lymph nodes of 3 patients (m, n, o), the PBMC of 3 CLL
patients (p, q, r), the B cells of 3 normal individuals (s, t, u), and
the B cells from a patient with Crohn's disease (v). The same quantity
of RNA (500 ng) and cDNA (5 µL) was used in the RT-PCR step for all
cell populations analyzed so that the level of RHAMM expression could
be compared between the different cell populations in the figure. The
quality of RNA isolated from all B-cell populations was comparable as
determined by amplification of CD19 transcripts from a separate aliquot
of the same cDNA (5 µL) from which RHAMM was amplified (data not
shown). (C) Shows that the amplification product in A, from the BM
plasma cells of patients g, h, I, j, and k, resolves into
RHAMMFL and RHAMM48. The amplification
products were analyzed by gel electrophoresis and visualized by
ethidium bromide staining.
|
|
View larger version (74K):
[in this window]
[in a new window]
| Fig 7.
Overexpression of RHAMMFL and
RHAMM147 in MM, B-lymphoma, and B-CLL, as
compared with normal B cells and chronically activated B cells from
patients with Crohn's disease. (A) RHAMMFL and
RHAMM147 were amplified by RT-PCR of 1µg RNA from the
BM plasma cells of 6 myeloma patients, from the B cells of 5 myeloma
patients, and from the B cells of 5 normal individuals. The same
quantity of RNA (1 µg) and cDNA (5 µL) was used in the RT-PCR step
for all cell populations analyzed so that the level of RHAMM expression
could be compared between the different cell populations in the figure.
The quality of RNA isolated from all cell populations was comparable as
determined by amplification of histone transcripts from a separate
aliquot of the same cDNA (1 µL) from which RHAMM was amplified (data
not shown). Markers are 1,114, 900, and 692 bp. A 989-bp fragment was
amplified for RHAMMFL and a 842-bp fragment for
RHAMM147. The amplification products were transferred to
a nylon membrane and hybridized to a DIG-labeled RHAMM probe. BM plasma
cell RHAMM was visualized by colorimetric detection; color development
was for 1 hour. MM B-cell RHAMM and normal B cell RHAMM was detected by
chemiluminescence; exposure was for 18 hours. (B) RHAMMFL
and RHAMM147 were amplified by RT-PCR of 500 ng RNA from
the malignant lymph nodes of 3 patients (m, n, o), the PBMC of 3 CLL
patients (p, q, r), the B cells of 3 normal individuals (s, t, u), and
the B cells from a patient with Crohn's disease (v). The same quantity
of RNA (500 ng) and cDNA (5 µL) was used in the RT-PCR step for all
cell populations analyzed so that the level of RHAMM expression could
be compared between the different cell populations in the figure. The
quality of RNA isolated from all B-cell populations was comparable as
determined by amplification of CD19 transcripts from a separate aliquot
of the same cDNA (5 µL) from which RHAMM was amplified (data not
shown). A 989-bp fragment was amplified for RHAMMFL and a
842-bp fragment for RHAMM147; arrows indicate their
position. The amplification products were transferred to a nylon
membrane and hybridized to a DIG-labeled RHAMM probe. RHAMM was
visualized by colorimetric detection; color development was for 1 hour.
Markers are 1,114 and 900 bp.
|
|
RHAMMFL and RHAMM48 were easily
visualized by ethidium bromide staining, while detection of
RHAMM147 necessitated the increased sensitivity of
hybridization to a DIG-labeled RHAMM probe, which suggests that
RHAMM147 is less abundant in MM B cells and plasma
cells than RHAMMFL and RHAMM48, although
for one MM patient, RHAMM147 was easily detectable
by ethidium bromide staining for both B and plasma cells (not shown).
Because RHAMMFL and RHAMM147 were
amplified simultaneously, this suggests that
RHAMM147 is less abundant in MM B cells and plasma
cells than RHAMMFL. However, the conclusion that
RHAMM147 is generally less abundant than
RHAMMFL assumes that
RHAMMFL/RHAMM147 are amplified equally
by primer set 3. To determine whether there was any difference in the
efficiency of amplification of
RHAMMFL/RHAMM147 by primer set 3 or in
the efficiency of amplification of
RHAMMFL/RHAMM48 by primer set 1, we
amplified sequential dilutions of cloned RHAMM. Figure
8A shows that equivalent amounts of DNA
were amplified by primer set 1 from 100, 10, and 1 pg of
RHAMMFL and RHAMM48. Therefore, primer
set 1 should equivalently amplify RHAMMFL and
RHAMM48 transcripts. Figure 8B shows that equivalent
amounts of DNA were amplified by primer set 3 from 100 and 10 pg of
RHAMMFL and RHAMM147. A longer exposure
(Fig 8C) of the hybridized membrane in Fig 8B shows that equivalent
amounts of DNA were amplified from 1 pg of RHAMMFL and
RHAMM147. Therefore, primer set 3 should
equivalently amplify RHAMMFL and
RHAMM147 transcripts present in MM B cells and BM
plasma cells. In comparison to RHAMMFL expression,
RHAMM147 could either be expressed at a low level by
all MM B cells/plasma cells or, alternatively, may be expressed by only
a few cells within these populations.
View larger version (47K):
[in this window]
[in a new window]
| Fig 8.
Comparison of primer efficiency. (A) 100 pg, 10 pg, and 1 pg of RHAMMFL and RHAMM48 were amplified
with primer set 1. The amplification products for RHAMMFL
(666 bp) and RHAMM48 (613 bp) were analyzed by gel
electrophoresis and visualized by ethidium bromide staining. (B and C)
100 pg,10 pg, and 1 pg of RHAMMFL and
RHAMM147 were amplified with primer set 3. The
amplification products for RHAMMFL (989 bp) and
RHAMM147 (842 bp) were transferred to a nylon membrane
and hybridized to a DIG-labeled RHAMM probe. RHAMM was detected by
chemiluminescence; exposure was for 1 hour in (B) and for 10 hours in
(C).
|
|
To evaluate the expression of RHAMM and its splice variants in other
B-cell malignancies, transcripts from three malignant B lymphomas and
from three B-CLL were analyzed by RT-PCR (Fig 6B and Fig 7B).
B-lymphoma cells have been previously shown to express surface RHAMM as
measured by flow cytometry and immunohistochemistry, but B-CLL cells do
not express surface RHAMM.22 RHAMMFL and
RHAMM48 were detectable for all patients (Fig
6B, lanes m through r). RHAMM147 was detectable for
two of three lymphoma patients (Fig 7B, lanes m and o) and for
two of three CLL patients (Fig 7B, lanes q and r). For lymphoma (m),
RHAMM147 was visible by ethidium bromide staining
(not shown). The expression of RHAMM transcripts by B-CLL cells, which
lack surface RHAMM,22 suggests that they may encode
intracellular RHAMM.
RHAMMFL, RHAMM48 or
RHAMM147 are overexpressed in malignant B cells (MM,
lymphoma, and CLL) relative to resting or chronically activated normal
B cells.
To determine which, if any, RHAMM species were overexpressed by
malignant B-lineage cells, we compared the pattern of RHAMM transcripts
in malignant B cells with those of resting B cells from normal donors,
and of chronically activated B cells from patients with Crohn's
disease. The same quantity of RNA and cDNA was used in the RT-PCR step
for all cell populations analyzed so that the level of RHAMM expression
could be compared between nonmalignant and malignant B cells. Unlike B
cells from normal donors or patients with nonmalignant disease,
circulating B cells from patients with Crohn's disease have a
phenotype similar to that of MM B cells. This includes expression of
CD45R0 by MM B and plasma cells.16,19 CD45R0 is absent from
normal B cells, but is expressed in vivo on PBMC B cells from patients
with Crohn's disease.38,39 RHAMM48 (Fig
6A, lane l and Fig 6B, lane v) and RHAMM147 (Fig 7B,
lane v) were not detectable in these polyclonal B cells in Crohn's
disease, and RHAMMFL was weakly detectable by hybridization
to a DIG-labeled probe (Fig 7B, lane v). RHAMMFL
and RHAMM48 were weakly detected by
ethidium bromide staining in B cells from one of eight normal donors
(three representative samples are shown in Fig 6B, lanes s through u).
However, use of hybridization to a DIG-labeled RHAMM probe (Fig 7)
showed that RHAMMFL transcripts were weakly detectable in
populations of B cells from five of eight normal donors (Fig 7A, bottom
panel, lanes 1 to 5, and Fig 7B, lanes s through u). In contrast,
amplified RHAMMFL was easily detected in myeloma B cells
from 11 of 11 patients by ethidium bromide staining (six representative
samples are shown in Fig 6A, lanes a through f), although at lower
levels than those for MM plasma cells, B lymphoma, or B-CLL. The
quality of RNA isolated from normal B-cell populations was comparable
to that isolated from malignant B-cell populations, because equivalent levels of histone or CD19 transcripts were amplified in all B-cell populations from a separate aliquot of the same cDNA from which RHAMM
was amplified (data not shown). This work, together with the phenotypic
expression of RHAMM by B-lineage cells in MM and lymphoma, suggests
that all three RHAMM variants are overexpressed in malignant B or
plasma cells, relative to B cells from normal donors or donors with
Crohn's disease.
In situ RT-PCR indicates expression of RHAMM transcripts by MM B or
plasma cells, but few normal B cells.
To quantitate the number of cells expressing RHAMM, in situ RT-PCR was
performed on MM plasma cells, MM B cells, and normal B cells (Table
3) with primers (primer set 11) that would
amplify all three RHAMM isoforms. For six patients, 22% to 36% of BM
plasma cells expressed RHAMM (mean, 29%); for six patients, 8% to
13% of B cells expressed RHAMM (mean, 12%); and for four normal
volunteers, 0% to 1.8% of B cells expressed RHAMM (mean, 1%).
Comparison of the in situ RT-PCR values with the number of B cells
expressing surface RHAMM protein, as detected phenotypically (Fig
1),17 suggests that most RHAMM+ B and plasma
cells have downregulated RHAMM mRNA, and/or that these cells
have a low RHAMM mRNA copy number. Overall, this analysis indicates
that in MM, cells with sufficient RHAMM transcripts to be detected in
situ were more abundant in the BM plasma cell population than in the
B-cell population, and confirms that detectable RHAMM transcripts are
absent from nearly all normal B cells, consistent with their lack of
surface RHAMM protein.
View this table:
[in this window]
[in a new window]
|
Table 3.
Individual B and Plasma Cells in MM But Not in Normal
Donors Express RHAMM Transcripts as Measured by In Situ RT-PCR With
Primers Annealing to RHAMM
|
|
| |
DISCUSSION |
This study identifies three distinct variants transcribed from the
RHAMM gene in MM B and plasma cells. Our results suggest that
RHAMMFL, RHAMM48, and
RHAMM147 are overexpressed in malignant B and plasma
cells from myeloma, in B lymphomas, and in B-CLL cells, as compared
with resting or chronically activated normal B cells. RHAMM has been
linked to oncogenesis, enables the transforming properties of ras
mutations in murine systems,27 and mediates motility of
malignant human B cells.17,22,24 The overexpression of
RHAMM variants in MM, lymphoma, and CLL implicates them in progression
and spread of malignant B cells, and perhaps in the oncogenic events
giving rise to myeloma and other B-cell malignancies.
In myeloma, RHAMMFL is virtually identical to the
published sequence of human breast RHAMM.37 In
addition, myeloma cells express two novel isoforms,
RHAMM48, which has a deletion of 48 bp, and
RHAMM147, which has a deletion of 147 bp. These
correspond to coding deletions of 16 amino acids (aa) and 49 aa,
respectively, in the RHAMM protein. The 48-bp deletion lies between two
possible start codons and could alternatively represent a noncoding
deletion, in the 5' untranslated region of a RHAMM transcript,
translated from the second start codon.
The significance of the 16-aa and 49-aa deletions to the interaction of
RHAMM with HA, a prerequisite for transducing a motile signal,31 is not readily apparent because these deletions
lie outside of the HA-binding domains. The deletion variants may encode conformationally altered RHAMM and/or have a cellular or
intracellular localization different from that of RHAMMFL,
which is known to be present on the cell surface as a GPI-linked receptor.26,27 In MM, surface and intracellular forms of
RHAMM are detected,17 but their correlation with the splice
variants identified here is as yet unknown. The nucleotide sequences of the HA-binding domains cloned from MM B and plasma cells translate into
a (B[X7]B) HA-binding motif32,40 and thus
encode two functional HA-binding domains. Because RHAMM appears to be
part of an HA receptor complex,41 and has been shown to
interact with src and ras family signaling
molecules,31,42,43 deletion of key regulatory regions would
have profound functional consequences that may facilitate malignant
processes. Alternatively, deletion of the regions described may modify
the affinity of the RHAMM receptor for its ligand, HA. This suggestion
is not without precedent, because it has been documented that variant
isoforms of the CD44 HA receptor have intact HA-binding domains yet
differ in their ability to bind HA.44
The observation that overexpressed RHAMM is oncogenic in the absence of
other known transforming events27 suggests that RHAMM is
unique among adhesion receptors. Although CD44 isoforms are associated
with increased metastatic spread,45-47 overexpression of
CD44 itself has not been associated with oncogenesis. In this context,
our observation that all of the RHAMM variants detected here are
overexpressed in myeloma cells is provocative. Consistent with previous
work showing strong surface expression of RHAMM, RHAMM is also
overexpressed in B lymphoma.22 B-CLL cells, which lack
surface RHAMM,22 have strong expression of RHAMM
transcripts for all variants, suggesting that in B-CLL, RHAMM is
intracellular. In contrast, resting B cells from normal donors and
chronically activated B cells from patients with Crohn's disease,
which also lack surface RHAMM (not shown), have undetectable or weakly
detectable RHAMM transcripts. In myeloma, the unusual expression of
novel RHAMM variants, as well as of RHAMMFL, is consistent
with the expression of surface RHAMM by the majority of B and plasma
cells in 90 of 90 MM patients, and its relative absence from nearly all
normal B cells. Expression of RHAMM appears to be a distinguishing
feature of MM, lymphoma, and CLL, as compared with resting or
chronically activated normal B cells.14 RHAMM may be
involved in progression and spread of malignant B cells, based on our
observations that motility by MM B and leukemic plasma cells is
HA-dependent and mediated by RHAMM.17 However, the RHAMM
isoforms involved in the motile process have yet to be identified. RHAMM has been shown to enable transforming mutations of ras; if RHAMM is inactivated by treatment with antisense or by a dominant negative RHAMM, ras-transformed cell lines acquire a normal
phenotype and lose their tumorigeneic properties in vivo.27
Thus, the overexpression of RHAMM in MM and its known role in migratory behavior suggest that deregulation of RHAMM isoforms may play a central
role in the oncogenic events underlying myeloma.
Our study suggests that at some point during malignant transformation,
B cells upregulate, or lose the ability to downregulate RHAMMFL, RHAMM48, and
RHAMM147. In so doing, they may acquire the ability
to move and metastasize to distant bone marrow sites. The trigger for
such a switch is not yet apparent, but ras and RHAMM colocalize
on the ruffles in migrating cells, both are involved in signaling via
HA, and both are required to convert myeloma cell lines from sessile to motile behavior.48 Ras is elevated in MM, and,
aside from overexpression of RHAMM, ras mutations are the most
common oncogenic abnormality in MM.49-53 Ras
induces metastatic behavior in tumor cells by inducing CD44 variant
isoform expression,54 suggesting it may also play a role in
RHAMM expression and alternative splicing. Alternatively, because even
wild-type ras is transforming when constitutively targeted to
the membrane,55 deregulated RHAMM may directly or indirectly alter ras localization to give a transformed phenotype.
The molecular characterization of RHAMM isoforms in MM represents a
primary step in defining the role RHAMM plays in mediating the
metastatic spread of malignant B cells to distant BM sites. In this
report, we have shown that overexpression of RHAMM and its splice
variants characterizes malignant B and plasma cells. Overexpression and
modulation of the balance between soluble, surface, and intracellular
RHAMM isoforms may control the regulation of key signaling molecules
and the behavioral characteristics of premalignant cells, leading to
constitutive stimulation and malignancy.
|
Top
Abstract
Introduction