|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 5 (March 1), 1999:
pp. 1724-1731
The Somatostatin Analog Octreotide Inhibits Growth of Interleukin-6
(IL-6)-Dependent and IL-6-Independent Human Multiple Myeloma Cell
Lines
By
Patrik Georgii-Hemming,
Thomas Strömberg,
Eva Tiensuu Janson,
Mats Stridsberg,
Helena Jernberg Wiklund, and
Kenneth Nilsson
From the Department of Genetics and Pathology and Department of
Medical Sciences, University Hospital, Uppsala, Sweden.
 |
ABSTRACT |
Somatostatin and its analogs can inhibit growth in several cell
types, in part by interfering with insulin-like growth factor-I (IGF-I)
signaling. Our previous studies point to the importance of paracrine
and autocrine IGF-I in the support of growth and survival of human
multiple myeloma (MM) cell lines. In this report, we have investigated
the potential role of a somatostatin analog, octreotide, in regulating
growth and/or survival in MM. The results show that all MM cell
lines express functional somatostatin receptors (sst). The MM cell
lines express the subtypes sst2, sst3, and predominantly sst5 as determined by reverse-transcriptase
polymerase chain reaction and fluorescence-activated cell sorter
analysis. Octreotide inhibited the growth of both the interleukin-6
(IL-6)-dependent and the IL-6-independent MM cell lines. The effect
is mainly cytostatic, resulting in 25% to 45% growth inhibition, and
in three of eight of the MM cell lines a weak induction of apoptosis
was recorded. Our results also show that octreotide may act as an
inducer of apoptosis in primary B-B4+ plasma cells
isolated from bone marrow of MM patients. In conclusion, the results
show a novel pathway for growth inhibition of MM cells: the activation
of somatostatin receptor signaling.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
HUMAN MULTIPLE MYELOMA (MM) is a clonal
expansion of malignant plasmablasts-plasma cells in the bone marrow.
The growth of MM cells is regulated by complex interactions between the
malignant cells and cells of the microenvironment, eg, osteoblasts and
stroma cells.1 Interleukin-6 (IL-6) is a major growth
factor both in vitro and in vivo, but several other cytokines have been
reported to stimulate the growth of MM cell lines and/or
freshly explanted MM cells.2 We and others have recently
shown that insulin-like growth factor-I (IGF-I) can promote growth
and/or survival of MM cell lines.3,4 We also showed
that IGF-I is produced by MM cell lines, and that an autocrine IGF-I
loop may participate in maintaining growth and survival in MM cell
lines.3
So far only a few factors have been shown to inhibit the growth of MM
cells. Interferon (IFN)- at low concentrations may act as a growth
factor for MM biopsy cells and MM cell lines,5,6 while
higher concentrations of IFN- inhibit the growth of MM cell lines
and biopsy cells.5,7,8 IFN- can inhibit the growth of
IL-6-dependent MM cell lines and was also reported to inhibit
IL-6-dependent proliferation of freshly explanted MM
cells.8,9 The growth-inhibitory effect of the IFNs seems
partly to be mediated by inhibition of paracrine and autocrine IL-6
signaling, eg, via a downregulation of IL-6
receptors.2,9,10
Analogous to the inhibitory effect of IFNs on IL-6 signaling,
somatostatin and its analogs can inhibit growth by interfering with
IGF-I signaling in normal and malignant cells.11
Downregulation of IGF-I,12 upregulation of the expression
of inhibitory IGF-I-binding proteins,13 and inhibition of
the mitogenic signaling via the IGF-I receptor
(IGF-IR)14,15 have been reported as plausible mechanisms
mediating the growth-inhibitory effect of the somatostatin analog octreotide.
Somatostatin acts as a neurotransmitter and a general inhibitor of
secretion, and can induce antiproliferative effects in, for example,
activated peripheral blood lymphocytes (PBL) and intestinal mucosa
lymphocytes.16 The growth-inhibitory effect has been
suggested to be subtype-specific, since cells with high-affinity receptors are more sensitive to somatostatin-induced growth
inhibition.16,17 The knowledge of somatostatin receptor
(sst) expression in lymphocytes is incomplete. In receptor-binding
assays, normal resting PBL express low-affinity sst, while activated
PBL, lymphoblastic leukemia cells, and Epstein-Barr virus
(EBV)-positive B cells usually express high-affinity
sst.17 The U-266 MM cell line has been shown to express
both low-and high-affinity sst.18 Five different sst subtypes have now been cloned,19-21 and a growth-inhibitory
signal has been shown to be mediated by sst1,
sst2, and sst5 through different
mechanisms.22,23 Furthermore, sst3 activation
may induce apoptosis.24 The function of sst4,
which has a low affinity for somatostatin compared with the other sst
subtypes, is essentially unknown. The knowledge of subtype expression
in hematopoietic cells is limited, but sst2,
sst3, and sst5 have been found in some B- and
T-cell lines.25
Based on our earlier results, showing IGF-I stimulation of growth
and/or survival of MM cell lines and the ability of octreotide to inhibit IGF-I signaling in several cell types, we examined the
expression of sst subtypes in MM cells and whether such receptors, when
expressed, may transmit growth-inhibitory signals following binding of
the somatostatin analog octreotide. The response of primary isolated
B-B4+ cells to octreotide was also examined. By
reverse-transcriptase polymerase chain reaction (RT-PCR) and flow
cytometry, all MM cell lines in the panel were found to express
sst2, sst3, and sst5 both at the
RNA level and on the cell surface. Octreotide inhibited the growth of
both IL-6-independent and IL-6-dependent cell lines and a weak
induction of apoptosis in three of eight MM cell lines was recorded.
Our results also indicate that octreotide may induce apoptosis in
freshly explanted MM cells.
| |
MATERIALS AND METHODS |
Cell lines.
A panel of eight human MM cell lines, previously examined for their
response to IGF-I and IL-6, was selected (Table
1). The panel included two cell lines
(U-266 and HL407) in which a progression from IL-6 dependence at early
passages (U-266-197026 and HL 407E27) to IL-6
independence has occurred during long-term in vitro culture
(U-266-198428 and H407L27). The
IL-6-independent cell lines (LP-1,29 EJM,30
Karpas 707,31 HL407L, and U-266-1984) are maintained in
RPMI 1640 (Flow, Irvine, UK) supplemented with 10% fetal bovine serum
(FBS; GIBCO, Grand Island, NY), glutamine, and antibiotics (penicillin
100 U/mL and streptomycin 50 µg/mL). The IL-6-dependent cell lines
(U-1958,32 HL407E, and U-266-1970) are grown on human
fibroblasts, AG 1523, purchased from the Human Mutant Genetic Cell
Repository (Camden, NJ) and maintained in the same medium as the
IL-6-independent cell lines. Medium is replenished twice a week.
Bone marrow samples from two MM patients were obtained at the time of
diagnosis and the mononuclear cells were isolated using Ficoll-Hypaque
(Pharmacia, Uppsala, Sweden) density centrifugation. The cells were
then incubated with the B-B4+ antibody (IQP, Groningen,
Holland) for 30 minutes, washed, and incubated with antimouse
IgG-covered magnetic beads (Dynal, Oslo, Norway). The B-B4+
cells were separated with a Dynal MPC and counted. The frequency of
B-B4+ cells with a plasma cell morphology exceeded 95% as
determined in May-Grünwald-Giemsa-stained cytospin preparations.
Receptor-binding studies.
The cells were incubated in acidic medium (RPMI 1640, pH 3) for 1 minute to remove bound ligand, washed, and then kept in binding buffer
(phosphate-buffered saline [PBS], 1% FBS, HEPES 10 mmol/L pH 7.2, aprotinin 2.8 µg/mL, phenylmethylsulfonyl fluoride [PMSF] 0.2 mmol/L). A 10,000 cpm quantity of 125I-somatostatin (2,000 Ci/mmol; Amersham, Essex, UK) was added to each well
containing 106 cells. Cold somatostatin
(10 5 mol/L; Sigma, Stockholm, Sweden) was added to
control wells to compete for binding. The cells were then incubated on
ice for 2 hours to reach equilibrium and washed three times followed by measurement of the bound radioactivity in a -counter (LKB Wallac, Pharmacia, Finland). Specific binding (cpm) refers to total binding minus binding in the presence of cold somatostatin.
PCR.
Exponentially growing cells from stock cultures were harvested, and RNA
was extracted using a modified version of the single-step method
established by Chomczynski and Sacchi.33 cDNA was
synthesized from 1 µg of RNA and primed with oligo-d(T) as described
elsewhere.34 For each PCR, we used 1/10 of a cDNA synthesis
reaction. Amplification was performed for 35 cycles. The annealing
temperature was 60°C for all reactions. The ubiquitously expressed
G3PDH gene was used as a control for the quality of the cDNA. Primers
were purchased from Scandinavian Gene Synthesis (Köping, Sweden).
The primer sequences used are as previously described35,36:
sst2 primers 5' TGGAAGCCACACATGGCTAT, 3'
CCATCCACAGTCATGACCAC; sst3 primers5' CATGGACATGCTTCATCCAT, 3' CATGACCAGGCGGCACATGA; sst5
primers5' CGTCTTCATCATCTACACGG, 3' GGCCAGGTTGACGATGTTGA.
Reactions were performed in PCR buffer (50 mmol/L KCl, 10 mmol/L
Tris-HCl, pH 9.0, and 0.1% Triton X-100), 1.5 mmol/L
MgCl2, 200 µmol/L of each dNTP, 1.0 U Taq polymerase, and
1 µmol/L of each primer. The reagents, except the primers, were
purchased from Promega (Madison, WI). Dimethyl sulfoxide (DMSO) (2%)
was added to the sst5 reactions. As negative controls,
tubes without RT were included in the cDNA synthesis reactions. No
genomic contamination was detected in the RNA preparations after PCR.
As a control for carry-over contamination, we also included tubes
without cDNA in the PCR. The specificity of the products was confirmed
by size and by cutting the products with restriction enzymes
(sst2, Bal I; sst3, Sac I; and
sst5, Hga I). The specificity of the products was
also confirmed by fluorescence-based dideoxy terminator cycle
sequencing using a Taq polymerase-based kit (Applied Biosystems, Foster
City, CA) and an automated DNA sequencer (Model 310; Applied
Biosystems). The products were run on a 2% agarose gel with a 100-bp
marker (Pharmacia) and stained with ethidium bromide (0.5 µg/mL). The expected sizes of the PCR products were 342, 361, and 222 nt for sst2, sst3, and sst5, respectively.
Development of rabbit antihuman sst antibodies.
Deduced from the amino acid sequences of human sst subtypes
sst2, sst3, and sst5,21
three polypeptides were synthesized by a solid-phase system using Fmoc
chemistry (Applied Biosystems Model 430A). The peptides were purified
by reverse-phase chromatography and analyzed by plasma desorption mass
spectrometry (PDMS; Bioion 20, Bioion Nordic AB, Uppsala, Sweden). The
sequences were selected to be specific for the different sst subtypes
and the homology was less than 48% to any other known protein sequence
in the data bank MPsrch Protein, version 1.5 (Shane S. Surrock & John
F. Collins 1993, Biocomputing Research Unit, University of Edinburgh,
UK), except for the respective sequences of sst from other species. The
sequences were amino acids 330 to 343 for sst2, amino acids 366 to 381 for sst3, and amino acids 327 to 341 for
sst5, all with additional tyrosine residues at the
N-terminals (Tyr0) and amidated C-terminals. Before immunization, the
peptides were coupled to a carrier protein. Peptide (2 mg) and 20 mg
bovine serum albumin were dissolved in a 50 mmol/L sodium phosphate
buffer at pH 7.4, containing 150 mmol/L NaCl. Coupling was then induced
by addition of 90 µL glutaraldehyde.37 The resulting
complexes were injected into white New Zealand rabbits, using the
intradermal injection technique, to produce polyclonal
antibodies.38
Flow cytometry.
Exponentially growing cells were pretreated with acidic medium as
described earlier and then kept in PBS with 1% FBS. The rabbit
antihuman sst antisera were diluted 1:6 and incubated with the cells
for 30 minutes on ice. Normal rabbit serum from the same rabbits was
used as a negative control. The cells were then washed three times and
incubated for 30 minutes on ice with fluorescein-conjugated swine
antirabbit antibodies (1:30) (Dako A/S, Glostrup, Denmark) and analyzed
in a flow cytometer (FACScan; Becton Dickinson, San José, CA). To
allow comparison between cell lines with different levels of
autofluorescence, the mean fluorescence (MFI) was expressed as relative
fluorescence, where the negative control was arbitrarily set to 1. The
results are presented as the MFI from three experiments ± SEM.
Growth and survival assays.
Exponentially growing cells were seeded at a concentration of 4 × 10 5 cells/mL in RPMI 1640 with 10% FBS, glutamine, and
antibiotics. IL-6 (50 U/mL; R&D Systems, Abington, UK) was added to
cultures of IL-6-dependent cells. Octreotide (Novartis Pharma AG,
Basel, Switzerland) was added at concentrations ranging from 0 to 1,000 nmol/L. In a few experiments, native somatostatin (Sigma) was used in
parallel at the same concentrations and was added every 12 hours.
Octreotide binds to sst2, sst3, and
sst5, while somatostatin binds to all sst
subtypes.22 The cells were then incubated at +37°C for 48 hours, harvested, and total and viable
cell numbers determined using a Bürker chamber and Trypan blue
exclusion. In some experiments, the apoptotic cells were analyzed using
annexin V/propidium iodide (PI) staining (R&D Systems) according to the
manufacturer's instructions. The number of apoptotic cells was
determined as the percentage of annexin V-positive, PI-negative cells.
The B-B4+ primary cells were seeded at 6 × 10 5 cells/mL in RPMI 1640, 10% FBS, glutamine, and
antibiotics. Octreotide (108 mol/L), IL-6 (100 U/mL), and IGF-I (107 mol/L, Pharmacia) were added
(see Fig 6). After 24 hours, the cells were counted using
Trypan blue exclusion. Apoptosis was identified by the morphologic
hallmarks, cell shrinkage, condensation of chromatin, and karyorrhexis
examined in May-Grünwald-Giemsa-stained cytospin preparations.
Cell cycle analysis.
We also performed PI staining of cell nuclei to analyze the cell cycle
distribution as described elsewhere.39 Briefly, cells were
incubated without or with 106 mol/L octreotide and
harvested at 8 and 20 hours. Nuclei were prepared by treating cells
with 0.03 mg/mL of trypsin (Sigma) for 10 minutes at room temperature
and RNase A (0.08 mg/mL; Sigma) for 10 minutes at room temperature. The
nuclei were stained with PI (0.2 mg/mL; Sigma) and analyzed with the
MacCycle program (Phoenix Flow Systems, Inc, San Diego,
CA) on a FACScan.
| |
RESULTS |
sst binding.
To investigate the expression of ssts on the panel of MM cell lines, we
performed receptor binding studies using 125I-somatostatin.
The MM cells were pretreated with acidic medium to remove bound ligand.
The cells were then incubated with 125I-somatostatin in the
absence or presence of a large excess of cold somatostatin
(105 mol/L). Specific binding, binding to sst, was
calculated as total binding minus binding in the presence of cold
somatostatin. All MM cell lines show specific binding of
125I-somatostatin, but at different levels (Fig
1). The LP-1 cell line displayed the lowest
level of 125I-somatostatin binding (100 ± 17 cpm),
while U-1958 cells bound almost six times as much
125I-somatostatin (585 ± 120).
View larger version (37K):
[in this window]
[in a new window]
| Fig 1.
sst binding. Cells were incubated for 2 hours on ice with
125I-somatostatin (2,000 Ci/mmol) in 24-well plates. A
total of 10,000 cpm was added to each well containing 106
cells. Cold somatostatin (105 mol/L) competed for
binding and specific binding was calculated as total binding minus
binding in the presence of cold somatostatin. Data are means ± SD from one representative experiment of three.
|
|
The level of binding correlated to the population doubling time of the
different cell lines (r2 = .89; Table 1 and Fig 1).
Thus, the LP-1 and HL407L cell lines, which had the lowest level of
binding, have population doubling times of 24 to 36 hours, while the
U-1958 and Karpas 707 cell lines with high
125I-somatostatin binding have a doubling time of 60 to 72 hours. The other cell lines (EJM, U-266-1984, HL407E, and U-266-1970) with an intermediate level of binding have population doubling times
ranging between 48 and 60 hours.
As a group, the IL-6-dependent cell lines displayed a higher level of
125I-somatostatin binding than the IL-6-independent cell
lines. This difference was also reflected in the clones of the U-266
and HL407 cell lines. During in vitro culture, the U-266 and HL407 cell lines have progressed from IL-6 dependence (U-266-1970 and HL407E) to
IL-6 independence (U-266-1984 and HL407L). Concomitant with this
progression the growth rate increased, and the tendency to undergo
spontaneous apoptosis decreased. As shown in Fig 1, the sst have been
downregulated during progression in these cell lines. U-266-1970 cells
bind three times as much 125I-somatostatin as U-266-1984
cells, while the HL407E cells bound twice as much as the cells of the HL407L.
sst subtype expression.
To investigate sst subtype expression on the different MM cell lines,
we isolated RNA from exponentially growing cells from each cell line,
synthesized cDNA, and performed PCR for sst2, sst3, and sst5. As shown in Fig
2, all cell lines expressed mRNA for all
three sst subtypes investigated. The PCR reached the plateau phase
before 35 cycles in some reactions; therefore, quantification of
different expression levels is not possible in this experimental set-up. The human sst genes, except sst2, lack introns and
contamination by genomic DNA would yield products of the same size.
Therefore, we included tubes without RT in the cDNA synthesis
reactions. Amplification of these templates were all negative (data not
shown). The specificity of the PCR products was confirmed by size and restriction fragment analysis using Bal I, Sac I, and
Hga I for sst2, sst3, and
sst5, respectively, and G3PDH was used as a control for the
quality of the cDNA. Furthermore, the specificity of the products was
also confirmed by sequencing as described in Materials and Methods
(data not shown).
View larger version (58K):
[in this window]
[in a new window]
| Fig 2.
Expression of sst2, sst3, and
sst5 mRNA. RNA was extracted and cDNA was synthesized as
described in Materials and Methods. Only RNA free of contaminating
genomic DNA was used for the PCR. A PCR with 35 cycles of amplification
was performed and the products were resolved on a 2% agarose gel and
stained with ethidium bromide. dH2O was used as a control
for carry-over contamination. The expected sizes of the fragments are:
sst2, 342 bp; sst3, 361 bp; sst5,
222 bp.
|
|
To study the expression of sst subtypes on the cell surface of the MM
cell lines, we performed flow cytometric analysis using rabbit
antiserum against human sst2, sst3, and
sst5. Normal rabbit serum (NRS) was used as a negative
control. As secondary antibody, we used fluorescein-conjugated swine
antirabbit antibodies. To enable us to compare fluorescence
intensities, the MFI of cells incubated with NRS and the secondary
antibody was arbitrarily set to 1. As shown in Fig
3, all MM cell lines expressed
sst2, sst3, and sst5. The pattern
was similar in the MM cell lines in that the MFI was lowest for
sst2 and highest for sst5. The exception was
cells of the LP-1 and HL407L cell lines, where no significant difference in the MFI of the sst subtypes could be shown.
View larger version (40K):
[in this window]
[in a new window]
| Fig 3.
FACScan analysis on the expression of sst2,
sst3, and sst5. Cells were incubated with
normal rabbit serum (ctr) or rabbit antihuman polyclonal antibodies.
After washing, cells were incubated with fluorescein-conjugated swine
antirabbit antibodies. Relative fluorescence is the MFI of the
different samples compared with the MFI of the negative control, which
was arbitrarily set to 1. Data are means ± SEM from three
experiments. ( ) sst2 , ( ) sst3, ()
sst5.
|
|
Effect of octreotide on growth of MM cells.
Exponentially growing cells from the MM cell lines were harvested,
washed twice, and then seeded at 4 × 10 5 cells/mL in
48-well plates. The cells were incubated in RPMI 1640 with 10% FBS,
glutamine, antibiotics, and different concentrations of octreotide (0 to 1,000 nmol/L). After 48 hours, the cells were harvested and total
and viable cells were counted using Trypan blue exclusion. To simplify
comparisons between the MM cell lines, which have a wide range of
population doubling times, the number of viable cells was plotted as
the percentage of exponentially growing control cells. As depicted in
Fig 4, cells from all MM cell lines were
growth-inhibited in a dose-dependent manner by octreotide. The growth
was inhibited by 25% to 45%. When octreotide was substituted by
somatostatin, the inhibitory effect on growth was essentially the same
(data not shown). No systematic difference between IL-6-independent
(Fig 4A) and IL-6-dependent cell lines (Fig 4B) could be recorded. The
strongest growth inhibition (40% to 45%) was seen in cells from the
LP-1 and HL407L cell lines. The weakest response (25%) was seen in
cells of the U-266 cell lines (U-266-1970 and U-266-1984). In a
majority of the cell lines, the growth inhibition was not accompanied
by a decrease in viability, the exception being the U-1958, HL407E, and
HL407L cell lines, where a minor decrease in the viability was recorded
(Table 2). Annexin V/PI staining of cells
from the U-1958, HL407E, and HL407L cell lines showed a small increase
in the number of apoptotic cells in cell cultures treated with
octreotide (Table 2).
View larger version (45K):
[in this window]
[in a new window]
| Fig 4.
Effect of octreotide on proliferation. Exponentially
growing cells from stock cultures were seeded at a concentration of 4 × 105 cells/mL and incubated for 48 hours with different
concentrations of octreotide. Cells were harvested and total and viable
cells were counted using Trypan blue exclusion to determine viability.
Experiments were set up in triplicates. One of at least three
experiments performed in triplicate is shown. Each point represents the
mean ± SEM. (A) IL-6-independent MM cell lines: ( ) LP-1, ( )
EJM, ( ) Karpas 707, ( ) HL407L, ( ) U-266-1984. (B)
IL-6-dependent cell lines: () U-1958, () HL407E, ()
U-266-1970.
|
|
To determine if the growth-inhibitory effect of octreotide was due to a
cell cycle block in MM cells, we performed PI staining of cell nuclei.
Cells of the LP-1 and HL407L cell lines were incubated without or with
octreotide (106 mol/L). Figure
5, depicting the cell cycle distribution of
the LP-1 cell line after treatment with octreotide, shows a small and
transient accumulation of cells in the G2/M phase of the cell cycle.
The accumulation of cells in G2/M was seen at 8 hours, but at 20 hours,
the effect was no longer detectable. In the HL407L cell line,
essentially the same effect of octreotide could be shown (data not
shown).
View larger version (28K):
[in this window]
[in a new window]
| Fig 5.
Cell cycle distribution of the LP-1 cell line treated
with octreotide. Exponentially growing cells were seeded at 4 × 105 cells/mL and incubated for 8 and 20 hours
without or with 106 mol/L octreotide. Cells were
harvested and cell nuclei were prepared, stained with PI, and DNA
content analyzed in a FACScan.
|
|
Primary B-B4+ plasma cells from two MM patients were
incubated with octreotide (108 mol/L) to determine
survival of these nondividing cells. As indicated in Fig
6, primary cells were incubated with
octreotide in the absence or presence of IL-6 (100 U/mL) or IGF-I
(107 mol/L) to investigate whether the effect of
octreotide could be inhibited by these factors. After 24 hours of
incubation, the cells were counted using Trypan blue exclusion to
determine viability. The dead cells displayed a typical apoptotic
morphology with condensed chromatin and karyorrhexis. The results show
that octreotide induces apoptosis in primary B-B4+ cells.
Furthermore, IGF-I, but not IL-6, could inhibit the effect of
octreotide (Fig 6).
View larger version (42K):
[in this window]
[in a new window]
| Fig 6.
Effect of octreotide on survival of primary isolated
B-B4+ plasma cells. Cells were seeded at 6 × 105 cells/mL, incubated for 24 hours, and counted.
Octreotide (108 mol/L), IL-6 (100 U/mL), and IGF-I
(107 mol/L) were added as indicated. () Patient
sample 1; ( ) patient sample 2.
|
|
| |
DISCUSSION |
Somatostatin and its analogs inhibit growth of several types of tumor
cells in vitro, eg, breast and prostate cancer cells.40,41 Several mechanisms have been suggested by which somatostatin and octreotide might inhibit the growth of tumor cells. One pathway is by
interfering with IGF-IR signaling.
We and others have previously reported that IGF-I is a growth
and/or survival factor for many MM cell lines.3,4
The fact that octreotide can interfere with IGF-I signaling prompted us to investigate the role of octreotide as a growth and survival regulator in MM cells.
We used a receptor-binding assay, PCR, and flow cytometry to
investigate the expression of sst in the MM cell lines. All cell lines
showed specific 125I-somatostatin binding, but a wide range
in the level of binding was found. The level of sst expression can be
influenced by several factors. Earlier studies on normal lymphocytes
have shown that when resting lymphocytes are activated a new set of
high-affinity sst are expressed.17 In lymph nodes, sst can
only be identified on germinal center lymphocytes, also linking sst
expression to activation/proliferation.42 The sst
expression on normal plasma cells has not been determined. Our results
show a correlation between sst expression and population doubling time
in the MM cell lines. Interestingly, during the in vitro progression,
the U-266 and HL407 cell lines have acquired a higher growth rate, they
are less prone to undergo apoptosis, and they have become independent
of IL-6.27,28 Our study shows that these cell lines have
also downregulated the expression of sst. It is possible that there is
a Darwinian selection for tumor cells with lower levels of sst
expression. Accordingly, in studies of pancreas cancer cells,
progression has been associated with loss of sst2. Transfection of such sst deficient cells with sst2 results
in lower growth rate and block of the capacity for colony formation in
soft agar.43
The reports of sst subtype mRNA expression in lymphocytes are limited.
However, Reubi et al reported variable expression of sst2
and sst3 in several lymphomas,44 while the
sst5 expression was not investigated. In some B- and T-cell
lines, Tsutsumi et al found expression of sst2 and in a few
cases a weak expression of sst3 and
sst5.25 In this study, we found expression of
sst2, sst3, and sst5 mRNA in all MM
cell lines. We also show cell-surface expression of sst2,
sst3, and sst5 in all MM cell lines.
sst5 was the predominant subtype, except on the LP-1 and
the HL407L cell lines, where the three subtypes were expressed at
similar levels. There are no previous reports of cell-surface
expression of sst subtypes on MM cells or other lymphocytes and the
relative importance of the different sst subtypes in transmitting the
growth-inhibitory signal of octreotide is unclear. In several studies,
antiproliferative effects of octreotide have been linked to expression
of sst2, but in some cases, antiproliferative effects have
also been reported to be mediated by sst5.22,45
Furthermore, a recent study reported that octreotide could induce
apoptosis in a p53-dependent manner by way of
sst3.46 Further studies are therefore needed
before any conclusions can be drawn from the different levels of
subtype expression on MM cells. However, we have preliminary data
showing that resting PBL have a very low expression of
sst2, sst3, and sst5 on the cell
surface compared with the MM cell lines, again linking sst expression
to activation/proliferation.
To elucidate the effect of octreotide on the growth of MM cell lines,
the cells were cultured with different concentrations of octreotide for
48 hours. The growth of all MM cell lines was inhibited by 25% to 45%
compared with the exponentially growing control cells. We also
investigated the effect of octreotide on the growth of an acute
lymphoblastic leukemia cell line (KM3), a Burkitt lymphoma cell line
(Mutu) and a lymphoblastoid cell line (I83.4). These cell lines were
not growth inhibited by octreotide (data not shown). Native
somatostatin had the same effect as octreotide, but had to be
replenished every 12 hours, probably due to a short half-life in the
cell cultures. The viability of the cells was not changed except in the
U-1958, HL407E, and HL407L cell lines, where viability decreased by 8%
to 15% in the octreotide-treated cells. Using annexin V/PI staining,
we found that this decrease in viability was associated with a small
increase in the number of annexin V-positive/PI-negative, apoptotic
cells. Taken together, octreotide mainly exerts a cytostatic effect on
the MM cells.
Cell cycle analysis showed a small and transient accumulation of cells
in the G2/M phase of the cell cycle. This is consistent with an earlier
study of the effect of octreotide on the cell cycle in a breast cancer
cell line (MCF-7), which also showed a small and transient accumulation
of cells in the G2/M phase of the cell cycle after octreotide
treatment.47 However, it is unlikely that the block in G2/M
can explain the growth-inhibitory effect of octreotide, but it is
conceivable that all phases of the cell cycle are prolonged in
octreotide-treated cells. Baserga et al recently showed that cells
lacking the IGF-IR have longer population doubling times, and that all
phases of the cell cycle are prolonged.48
As to the mechanism of octreotide-induced growth inhibition, previous
reports suggest downregulation of IGF-I expression, upregulation of
inhibitory IGF-I-binding protein expression, and inhibition of IGF-IR
signaling as candidate mechanisms. We are currently investigating the
possibility that one or several of these mechanisms are involved in the
growth-inhibitory effect of octreotide in MM.
Primary B-B4+ cells from patients with MM have a very low
or nonexistent proliferative activity in vitro, and during the course of a few days time they continuously die when kept in culture, as shown
by Gu et al49 and Georgii-Hemming et al
(unpublished data, December 1997). The possible biologic
effect of octreotide on MM cells can therefore not be recorded by a
proliferation-inhibition assay as for the MM cell lines. Interestingly,
the analysis of survival in cultures of freshly isolated MM cells
indicates that octreotide may act as an inducer of apoptosis in these
cells. IGF-I, but not IL-6, could inhibit the effect of octreotide.
However, considering the heterogeneity in MM, these data must be
interpreted cautiously. Another reason for caution is that only
selected cases of patient MM bone marrow with high numbers of
B-B4+ cells can be analyzed due to technical limitations of
the isolation protocol and the subsequent cell survival assay. For
these reasons, further studies will be required to allow any
conclusions to be drawn as to the relevance of these in vitro data for
the in vivo situation. The effect of IL-6 and IGF-I on
octreotide-induced growth inhibition was also studied in the U-266-1970
and Karpas 707 cell lines. As in the primary cells IGF-I, but not IL-6,
could inhibit octreotide-induced growth inhibition (data not shown).
In time-course experiments, we found that the inhibitory effect of
octreotide was maximal after 48 hours, while after 72 hours, the
difference between octreotide-treated cells and controls diminished (data not shown). The effect of octreotide could be prolonged by
replenishing octreotide every 24 hours, but eventually a decline in the
growth-inhibitory effect was seen. As reported by Hukovic et
al,50 this could be due to a densitization of sst. An
alternative explanation for a diminished effect over time is that an
octreotide-resistant subpopulation eventually takes over the cell cultures.
The potential therapeutic usefulness of octreotide will depend on
several factors, which must be subject to further studies. The
diminished effect in long-term cultures, which may reduce the clinical
relevance of our findings, must be understood and circumvented. The
effectiveness of combinations with other drugs will also have to be
addressed, since octreotide has been reported to amplify the effect of
drugs like doxorubicin.51 Furthermore, combination
treatment with octreotide and IFN- has been used in carcinoid tumors
with encouraging results and this combination might also be of
therapeutic interest for MM patients.52 Apart from the
mechanisms already mentioned, octreotide have indirect effects on tumor
growth by downregulation of IGF-I in the circulation and by inhibition
of angiogenesis.53,54 In conclusion, studies of the effect
of octreotide in vivo are clearly warranted.
In this work, we have pointed to a new way to inhibit growth of MM cell
lines; activation of sst. Future studies will focus on the effect of
octreotide in vivo and its potential therapeutic usefulness.
| |
FOOTNOTES |
Submitted May 4, 1998; accepted September 26, 1998.
Supported by grants from the Swedish Cancer Society.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Kenneth Nilsson, MD, PhD, Laboratory of
Tumor Biology, Department of Genetics and Pathology, University
Hospital, S-751 85 Uppsala, Sweden.
| |
REFERENCES |
1.
Hallek M, Bergsagel P, Anderson K:
Multiple myeloma: Increasing evidence for a multistep transformation process.
Blood
91:3, 1998[Free Full Text]
2.
Klein B:
Cytokine, cytokine receptors, transduction signals, and oncogenes in human multiple myeloma.
Semin Hematol
32:4, 1995[Medline]
[Order article via Infotrieve]
3.
Georgii-Hemming P, Jernberg Wiklund H, Ljungren Ö, Nilsson K:
Insulin-like growth factor I is a growth and survival factor in human multiple myeloma cell lines.
Blood
88:2250, 1996[Abstract/Free Full Text]
4.
Jelinek DF, Witzig TE, Arendt BK:
A role for insulin-like growth factor in the regulation of IL-6-responsive human myeloma cell line growth.
J Immunol
159:487, 1997[Abstract]
5.
Brenning G:
The in vitro effect of leucocyte alpha-interferon on human myeloma cells in a semisolid agar culture system.
Scand J Haematol
35:178, 1985[Medline]
[Order article via Infotrieve]
6.
Jourdan M, Zhang XG, Portier M, Boiron JM, Bataille R, Klein B:
IFN-alpha induces autocrine production of IL-6 in myeloma cell lines.
J Immunol
147:4402, 1991[Abstract]
7.
Brenning G, Jernberg H, Gidlund M, Sjoberg O, Nilsson K:
The effect of alpha and gamma-interferon on proliferation and production of IgE and beta 2-microglobulin in the human myeloma cell line U-266 and in an alpha-interferon resistant U-266 subline.
Scand J Haematol
37:280, 1986[Medline]
[Order article via Infotrieve]
8.
Jernberg Wiklund H, Pettersson M, Nilsson K:
Recombinant interferon-gamma inhibits the growth of IL-6-dependent human multiple myeloma cell lines in vitro.
Eur J Haematol
46:231, 1991[Medline]
[Order article via Infotrieve]
9.
Portier M, Zhang XG, Caron E, Lu ZY, Bataille R, Klein B:
Gamma-interferon in multiple myeloma: Inhibition of interleukin-6 (IL-6)-dependent myeloma cell growth and downregulation of IL-6-receptor expression in vitro.
Blood
81:3076, 1993[Abstract/Free Full Text]
10.
Schwabe M, Brini AT, Bosco MC, Rubboli F, Egawa M, Zhao J, Princler GL, Kung HF:
Disruption by interferon-alpha of an autocrine interleukin-6 growth loop in IL-6-dependent U266 myeloma cells by homologous and heterologous down-regulation of the IL-6 receptor alpha- and beta-chains.
J Clin Invest
94:2317, 1994
11.
Reubi JC, Laissue JA:
Multiple actions of somatostatin in neoplastic disease.
Trends Pharmacol Sci
16:110, 1995[Medline]
[Order article via Infotrieve]
12.
Yumi K, Fagin JA, Yamashita M, Fishbein MC, Shah PK, Kaul S, Niu W, Nilsson J, Cercek B:
Direct effects of somatostatin analog octreotide on insulin-like growth factor-I in the arterial wall.
Lab Invest
76:329, 1997[Medline]
[Order article via Infotrieve]
13.
Ren S-G, Ezzat S, Melmed S, Braunstein G:
Somatostatin analog induces insulin-like growth factor binding protein-1 (IGFBP-1) expression in human hepatoma cells.
Endocrinology
131:2479, 1992[Abstract/Free Full Text]
14.
Cattaneo MG, Amoroso D, Gussoni G, Sanguini AM, Vicentini LM:
A somatostatin analogue inhibits MAP kinase activation and cell proliferation in human neuroblastoma and in human small cell lung carcinoma cell lines.
FEBS Lett
397:164, 1996[Medline]
[Order article via Infotrieve]
15.
Grant M, Caballero S, Millard W:
Inhibition of IGF-I and b-FGF stimulated growth of human retinal endothelial cells by the somatostatin analogue, octreotide: A potential treatment for ocular neovascularization.
Regul Pept
48:267, 1993[Medline]
[Order article via Infotrieve]
16.
Fais S, Annibale B, Boirivant M, Santoro A, Pallone F, Delle Fave G:
Effects of somatostatin on human intestinal lamina propria lymphocytes. Modulation of lymphocyte activation.
J Neuroimmunol
31:211, 1991[Medline]
[Order article via Infotrieve]
17.
van Hagen PM, Krenning EP, Kwekkeboom DJ, Reubi JC, Anker Lugtenburg PJ, Lowenberg B, Lamberts SW:
Somatostatin and the immune and haematopoetic system; A review.
Eur J Clin Invest
24:91, 1994[Medline]
[Order article via Infotrieve]
18.
Sreedharan SP, Kodama KT, Peterson KE, Goetzl EJ:
Distinct subsets of somatostatin receptors on cultured human lymphocytes.
J Biol Chem
264:949, 1989[Abstract/Free Full Text]
19.
Yamada Y, Post S, Wang K, Tager H, Bell G, Seino S:
Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney.
Proc Natl Acad Sci USA
89:251, 1992[Abstract/Free Full Text]
20.
Yamada Y, Reisine T, Law S, Ihara Y, Kubota A, Kagimoto S, Seino M, Seino Y, Bell G, Seino S:
Somatostatin receptors, an expanding gene family: Cloning and functional characterization of human sstr3, a protein coupled to adenylyl cyclase.
Mol Endocrinol
6:2136, 1992[Abstract/Free Full Text]
21.
Yamada Y, Kagimoto S, Kubota A, Yasuda K, Masuda K, Someya Y, Ihara Y, Li Q, Imura H, Seino S:
Cloning, functional, expression and pharmacological characterization of a fourth (hSSTR4) and a fifth (hSSTR5) human somatostatin receptor subtype.
Biochem Biophys Res Commun
195:844, 1993[Medline]
[Order article via Infotrieve]
22.
Hofland LJ, Lamberts SW:
Somatostatin receptors and disease: Role of receptor subtypes.
Baillieres Clin Endocrinol Metab
10:163, 1996[Medline]
[Order article via Infotrieve]
23.
Buscail L, Estève J-P, Saint-Laurent N, Bertrand V, Reisine T, O'Carrol A-M, Bell G, Schally A, Vaysse N, Susini C:
Inhibition of cell proliferation by the somatostatin analogue RC-160 is mediated by somatostatin receptor subtypes SSTR2 and SSTR5 through different mechanisms.
Proc Natl Acad Sci USA
92:1580, 1995[Abstract/Free Full Text]
24.
Sharma K, Patel Y, Srikant C:
Subtype-selective induction of wildtype p53 and apoptosis, but not cell cycle arrest by human somatostatin receptor 3.
Mol Endocrinol
10:1688, 1996[Abstract/Free Full Text]
25.
Tsutsumi A, Takano H, Ichikawa K, Kobayashi S, Koike T:
Expression of somatostatin receptor subtype 2 mRNA in human lymphoid cells.
Cell Immunol
181:44, 1997[Medline]
[Order article via Infotrieve]
26.
Nilsson K, Bennich H, Johansson S, Pontén J:
Established immunoglobulin producing myeloma (IgE) and lymphoblastoid (IgG) cell line from an IgE myeloma patient.
Clin Exp Immunol
7:477, 1970[Medline]
[Order article via Infotrieve]
27.
Scibienski R, Paglieroni T, Caggiano V, Lemonello D, Gumerlock P, Mackenzie M:
Factors affecting the in vitro evolution of a myeloma cell line.
Leukemia
6:940, 1992[Medline]
[Order article via Infotrieve]
28.
Jernberg Wiklund H, Pettersson M, Carlsson M, Nilsson K:
Increase in interleukin-6 (IL-6) and IL-6 receptor expression in a human multiple myeloma cell line, U-266, during long-term in vitro culture and the development of a possible autocrine IL-6 loop.
Leukemia
6:310, 1992[Medline]
[Order article via Infotrieve]
29.
Pegoraro L, Malavasi F, Belloni G, Massaia M, Boccadoro M, Saglio G, Guerrasio A, Benetton G, Lombardi L, Coda R, Avanzi G:
The human myeloma cell line LP-1: A versatile model in which to study early plasma cell differentiation and c-myc activation.
Blood
73:1020, 1989[Abstract/Free Full Text]
30.
Hamilton M, Ball J, Bromidge E, Lowe J, Franklin I:
Characterization of a new IgGlambda myeloma plasma cell line (EJM): A further tool in the investigation of the biology of multiple myeloma.
Br J Haematol
75:378, 1990[Medline]
[Order article via Infotrieve]
31.
Karpas A, Fischer P, Swirsky D:
Human myeloma cell line carrying a Philadelphia chromosome.
Science
216:997, 1982[Abstract/Free Full Text]
32.
Jernberg H, Nilsson K, Zech L, Lutz D, Nowotny H, Scheirer W:
Establishment and phenotypic characterization of three new human myeloma cell lines (U-1957, U-1958, and U-1996).
Blood
69:1605, 1987[Abstract/Free Full Text]
33.
Chomczynski P, Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
34.
Kawasaki E:
Amplification of RNA. San Diego, CA, Academic, 1990.
35.
Evans A, Crook T, Laws S, Gough A, Royle G, Primrose J:
Analysis of somatostatin receptor subtype mRNA expression in human breast cancer.
Br J Cancer
75:798, 1997[Medline]
[Order article via Infotrieve]
36.
Ain K, Taylor K, Tofiq S, Venkataraman G:
Somatostatin receptor subtype expression in human thyroid and thyroid carcinoma cell lines.
J Clin Endocrinol Metab
82:1857, 1997[Abstract/Free Full Text]
37.
O'Shaughnessey D:
Radioimmunoassay of Gut Regulatory Peptides. London, UK, Saunders, 1982.
38.
Vaitukaitis J, Robbins J, Nieschlag E, Ross G:
A method for producing specific antisera with small doses of immunogen.
J Clin Endocrinol
33:988, 1971[Abstract/Free Full Text]
39.
Vindelov L, Christensen I, Nissen N:
A detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis.
Cytometry
3:323, 1983[Medline]
[Order article via Infotrieve]
40.
Schally A:
Oncological applications of somatostatin analogues.
Cancer Res
48:6977, 1988[Free Full Text]
41.
Lamberts S, Krenning E, Reubi J:
The role of somatostatin and its analogs in the diagnosis and treatment of tumors.
Endocr Rev
12:450, 1991[Abstract/Free Full Text]
42.
Reubi JC, Horisberger U, Waser B, Gebbers JO, Laissue J:
Preferential location of somatostatin receptors in germinal centers of human gut lymphoid tissue.
Gastroenterology
103:1207, 1992[Medline]
[Order article via Infotrieve]
43.
Delesque N, Buscail L, Estève J-P, Saint-Laurent N, Muller C, Weckbecker G, Bruns C, Vaysse N, Susini C:
sst2 somatostatin receptor expression reverses tumorigenicity of human pancreatic cancer cells.
Cancer Res
57:956, 1997[Abstract/Free Full Text]
44.
Reubi JC, Waser B, van Hagen M, Lamberts SW, Krenning EP, Gebbers JO, Laissue JA:
In vitro and in vivo detection of somatostatin receptors in human malignant lymphomas.
Int J Cancer
50:895, 1992[Medline]
[Order article via Infotrieve]
45.
Cordelier P, Esteve JP, Bousquet C, Delesque N, O'Carroll AM, Schally AV, Vaysse N, Susini C, Buscail L:
Characterization of the antiproliferative signal mediated by the somatostatin receptor subtype sst5.
Proc Natl Acad Sci USA
94:9343, 1997[Abstract/Free Full Text]
46.
Sharma K, Patel YC, Srikant CB:
Subtype-selective induction of wild-type p53 and apoptosis, but not cell cycle arrest, by human somatostatin receptor 3.
Mol Endocrinol
10:1688, 1996
47.
Pagliacci MC, Tognellini R, Grignani F, Nicoletti I:
Inhibition of human breast cancer cell (MCF-7) growth in vitro by the somatostatin analog SMS 201-995: Effects on cell cycle parameters and apoptotic cell death.
Endocrinology
129:2555, 1991[Abstract/Free Full Text]
48.
Sell C, Dumenil G, Deveaud C, Miura M, Coppola D, DeAngelis T, Rubin R, Efstratiadis A, Baserga R:
Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts.
Mol Cell Biol
14:3604, 1994[Abstract/Free Full Text]
49.
Gu Z-J, Costes V, Lu ZY, Zhang X-G, Pitard V, Moreau J-F, Bataille R, Wijdenes J, Rossi J-F, Klein B:
Interleukin-10 is a growth factor for human myeloma cells by induction of an oncostatin m autocrine loop.
Blood
88:3972, 1996[Abstract/Free Full Text]
50.
Hukovic N, Panetta R, Kumar U, Patel YC:
Agonist-dependent regulation of cloned human somatostatin receptor types 1-5 (hsstr1-5): Subtype selective internalization or upregulation.
Endocrinology
137:4046, 1996[Abstract]
51.
Weckbecker G, Raulf F, Tolcsvai L, Bruns C:
Potentiation of the anti-proliferative effects of anti-cancer drugs by octreotide in vitro and in vivo.
Digestion
57:22, 1996[Medline]
[Order article via Infotrieve]
52.
Janson E, Ahlström H, Andersson T, Öberg K:
Octreotide and interferon alfa: A new combination for the treatment of malignant carcinoid tumours.
Eur J Cancer
28A:1647, 1992
53.
Serri O, Brazeau P, Kachra Z, Posner B:
Octreotide inhibits insulin-like growth factor-I hepatic gene expression in the hypophysectomized rat: Evidence for a direct and indirect mechanism of action.
Endocrinology
130:1816, 1992[Abstract/Free Full Text]
54.
Woltering EA, Watson JC, Alperin Lea RC, Sharma C, Keenan E, Kurozawa D, Barrie R:
Somatostatin analogs: Angiogenesis inhibitors with novel mechanisms of action.
Invest New Drugs
15:77, 1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. Pal, M. Janz, D. L. Galson, M. Gries, S. Li, K. Johrens, I. Anagnostopoulos, B. Dorken, M. Y. Mapara, L. Borghesi, et al.
C/EBP{beta} regulates transcription factors critical for proliferation and survival of multiple myeloma cells
Blood,
October 29, 2009;
114(18):
3890 - 3898.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Q. Lacy, M. Alsina, R. Fonseca, M. L. Paccagnella, C. L. Melvin, D. Yin, A. Sharma, M. Enriquez Sarano, M. Pollak, S. Jagannath, et al.
Phase I, Pharmacokinetic and Pharmacodynamic Study of the Anti-Insulinlike Growth Factor Type 1 Receptor Monoclonal Antibody CP-751,871 in Patients With Multiple Myeloma
J. Clin. Oncol.,
July 1, 2008;
26(19):
3196 - 3203.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Moreaux, F. W. Cremer, T. Reme, M. Raab, K. Mahtouk, P. Kaukel, V. Pantesco, J. De Vos, E. Jourdan, A. Jauch, et al.
The level of TACI gene expression in myeloma cells is associated with a signature of microenvironment dependence versus a plasmablastic signature
Blood,
August 1, 2005;
106(3):
1021 - 1030.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Duet, P. Tran Ba Huy, M. Wassef, and F. Liote
Plasma Cell Problems: CASE 3. Plasmacytoma Mimicking a Paraganglioma of the Skull Base: Diagnostic Value of Somatostatin Receptor Scintigraphy
J. Clin. Oncol.,
May 1, 2005;
23(13):
3143 - 3145.
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction