|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 6 (March 15), 1999:
pp. 1809-1816
RAPID COMMUNICATION
Gab-Family Adapter Proteins Act Downstream of Cytokine and Growth
Factor Receptors and T- and B-Cell Antigen Receptors
By
Keigo Nishida,
Yuichi Yoshida,
Motoyuki Itoh,
Toshiyuki Fukada,
Takuya Ohtani,
Takahiro Shirogane,
Toru Atsumi,
Mariko Takahashi-Tezuka,
Katsuhiko Ishihara,
Masahiko Hibi, and
Toshio Hirano
From the Division of Molecular Oncology, Biomedical Research Center,
Osaka University Medical School, Osaka, Japan.
 |
ABSTRACT |
We previously found that the adapter protein Gab1 (110 kD) is
tyrosine-phosphorylated and forms a complex with SHP-2 and PI-3 kinase
upon stimulation through either the interleukin-3 receptor (IL-3R) or
gp130, the common receptor subunit of IL-6-family cytokines. In this
report, we identified another adapter molecule (100 kD) interacting
with SHP-2 and PI-3 kinase in response to various stimuli. The molecule
displays striking homology to Gab1 at the amino acid level; thus, we
named it Gab2. It contains a PH domain, proline-rich sequences, and
tyrosine residues that bind to SH2 domains when they are
phosphorylated. Gab1 is phosphorylated on tyrosine upon stimulation
through the thrombopoietin receptor (TPOR), stem cell factor receptor
(SCFR), and T-cell and B-cell antigen receptors (TCR and BCR,
respectively), in addition to IL-3R and gp130. Tyrosine phosphorylation
of Gab2 was induced by stimulation through gp130, IL-2R, IL-3R,
TPOR, SCFR, and TCR. Gab1 and Gab2 were shown to be substrates for
SHP-2 in vitro. Overexpression of Gab2 enhanced the gp130 or
Src-related kinases-mediated ERK2 activation as that of Gab1 did.
These data indicate that Gab-family molecules act as adapters for
transmitting various signals.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
Src HOMOLOGY 2-containing tyrosine
phosphatase 2 (SHP-2) is a tyrosine phosphatase bearing two SH2 domains
in the amino-terminal region.1-3 In comparison to SHP-1,
which is a negative regulator for signaling cytokine
receptors4-8 and the B-cell antigen receptor (BCR),9 SHP-2 is a positive regulator of signaling from
receptor tyrosine kinases and cytokine receptors.
SHP-2 is phosphorylated on tyrosine in response to growth factors and
cytokines such as platelet-derived growth factor
(PDGF),10,11 prolactin,12 interferon- /
(INF-/),13 granulocyte-macrophage colony-stimulating
factor (GM-CSF)14 and to stimulation through gp130,15 the common receptor subunit of inteleukin-6
(IL-6)-family cytokines.16 SHP-2 contains YXNX motifs,
which is the consensus sequence for Grb2 binding, in its
carboxy-terminal region.2,3 Upon stimulation, SHP-2
associates with Grb2, which forms a link to the Ras pathway through
Sos.10,11,15 These data suggest that SHP-2 may act as an
adapter molecule for activating Ras. In addition to the adapter
function of SHP-2, its catalytic activity is necessary for transmitting
signals to the ERK MAP kinases. Catalytically inactive mutants of SHP-2
inhibit the activation of ERK MAP kinases in response to
insulin,17 EGF,18 and FGF,19 providing evidence for the existence of substrates for SHP-2 and suggesting a role they might play in signal transduction. Candidates for SHP-2 substrates include several molecules reported to associate with SHP-2. These include the SIRP/SHPS family of transmembrane proteins,20,21 IRS1,17 IRS2,22
Gab1,23 and as yet unidentified 97- to 100-kD
molecules.24-28 Especially, 97- to 100-kD
tyrosine-phosphorylated proteins (pp97 and pp100) were shown to
associate with SHP-2 in response to IL-2,24
IL-3,25 macrophage colony-stimulating factor
(M-CSF),26 the stimulation of the T-cell receptor
(TCR),27 and transformation by
bcr-abl.28 pp97 and pp100 interact with the SH2
domains of the p85 PI-3 kinase and CrkL and the SH3 domain of
Grb2.24 These data suggested that pp97 and pp100 are
adapter molecules that contain various tyrosine motifs for binding to the SH2 domains and prolinerich sequences for binding to the SH3 domain, although their identities were not yet known. However, these
characteristic features of pp97 and pp100 quite resembled those of Gab1.
Gab1 was originally isolated as a binding protein for Grb2. Gab1 is
tyrosine-phosphorylated and interacts with SHP-2 and PI-3 kinase
in response to insulin, EGF,23 HGF,29
NGF,30 lysophosphatidic acid (LPA),31 IL-3, and
gp130 stimulation.32 It contains a PH domain,
tyrosine-based motifs, and proline-rich sequences including MBD (c-Met
binding domain). Furthermore, the Drosophila Gab1 homologue Daughter of
Sevenless (DOS) is a substrate for the Drosophila SHP-2 homologue
Corkscrew (CSW). DOS was shown to act downstream of the receptor
tyrosine kinase Sevenless and upstream of or in parallel to the Ras
pathway.33,34 Therefore, Gab1 or Gab1-related molecules are
good candidates for substrates or signal transducers for SHP-2.
We previously demonstrated that Gab1 acts downstream of gp130 in
transmitting signals to ERK MAP kinase.32 However, in
BAF-B03 cells, ERK2 was activated upon the stimulation of gp130 without the expression of Gab1. Instead, we observed a tyrosine-phosphorylated 100-kD molecule to associate with SHP-2 and PI-3 kinase upon
stimulation of gp13015 and the IL-3 receptor. In this
report, we identified pp100 as a member of the Gab1 family of
adapter molecules and named it Gab2. We show that both Gab1 and Gab2
act downstream of cytokine and growth factor receptors as well as the
antigen receptors on T and B cells.
| |
MATERIALS AND METHODS |
cDNA cloning and plasmid construction.
The amino-terminal fragment of human Gab2 cDNA was obtained by 5'
rapid amplification of 5'-cDNA ends (5'-RACE) from a cDNA library of the human myeloma cell line U266. The U266 cDNA library was
constructed by using a Marathon cDNA Amplification Kit (Clontech, La
Jolla, CA). The fragment was amplified by polymerase chain reaction (PCR) with the adapter primers and primers
CCGGCTGAGGAAACATTTCTCAGG and AGCCTGATTGAAGCCACAGATCTGGC. Their
design was based on the nucleotide sequence of KIAA0571 (accession no.
AB011143) according to the manufacturer's protocol. The PCR fragment
and KIAA0571 were ligated at the Pst I site and subcloned into
the expression vector pcDNA3 (Invitrogen, San Diego, CA).
The Flag-tagged expression vectors for Gab2 were constructed as
previously described32 and subcloned into pcDNA3. The
partial fragments of mouse Gab2 were obtained by screening a  ZipLox
BAF-B03 cDNA library with the KIAA0571 fragment (kindly provided by
Kazusa DNA Research Institute, Chiba, Japan) as a
hybridization probe. The BAF-B03 cDNA phage library was constructed
using the Superscript system for cDNA synthesis (GIBCO-BRL, Grand
Island, NY) from granulocyte colony-stimulating factor
(G-CSF)-stimulated BAF-B03 G133 transfectants.15 A cDNA
fragment containing the entire coding sequence of mouse Gab2 was
obtained by the ligation of a product of 5'RACE PCR that was
obtained using the adapter primers and primers
CTGTGCTCTCTTCAGCCTGATTGAAG and AGCCTGATTGAAGCCGCAGATCTGGC and a
fragment obtained by PCR using the primers CATGAATAAGTGGGTCCAGAGCATC
and GGTCAACAACTTTCAACACAAACACATTC. A BAF-B03 cDNA library was used as a
template in the RACE and PCR reactions. It was constructed from
G-CSF-stimulated BAF-B03 G133 transfectants. The cDNAs were sequenced
by an automated ALF sequencer (Amersham Pharmacia, Arlington Heights,
IL) and an ABI377 sequencer (ABI, Foster City,
CA). The bacterial expression vectors for GST-SHP-2 CAT
and GST-SHP-2 C/S CAT were constructed by inserting the catalytic
domain (amino acid 263-594) of SHP-2 and SHP-2 C/S into the Nco
I and BamHI sites of pGEX-KG. The bacterial expression vector
for GST-Gab2 was constructed by inserting the Bgl
II-Sca I fragment of human Gab2 cDNA (amino acids 380-563) into
the BamHI and Sma I sites of pGEX-KG. The expression
vector for Gab2 was constructed by inserting the
HindIII-Pvu II fragment of human Gab2 into pcDNA3. The
expression vectors for Flag-tagged ERK2, Gab1, JAK1, STAT3, and v-Src
were described previously.32 Expression vectors for v-Src,
Btk, and Tec were gifts from Drs M. Karin, S. Tsukada, and H. Mano and were described previously.35
Antibodies.
Anti-Gab2 antibody was raised by immunizing rabbits with GST-Gab2. For
immunization, female rabbits were first injected with 1.0 mg of
GST-Gab2 fusion protein in complete Freund's adjuvant and then boosted
every 2 weeks with 0.5 mg of the antigen in incomplete Freund's
adjuvant. Anti-Gab1 antibody was described previously.32 The anti-HA (12CA5) and anti-Flag (M2) antibodies were purchased from
Boehringer Manheim (Indianapolis, IN) and Eastman Kodak
(Rochester, NY), respectively. Anti-SHP-2 (sc280) and
anti-Grb2 (sc255) antibodies were purchased from Santa Cruz
Biotechnology Co (Santa Cruz, CA). Anti-p85 PI-3 kinase
(06-195) and antiphosphotyrosine (4G10) antibodies were purchased from
UBI Corp (Lake Placid, NY).
Cell lines and stimulation.
HepG2, 293T, 293T transfectants, BAF-B03, BAF-B03-G277, and BAF-B03-G68
cells were maintained as described previously.15,32 KT-3
cells were maintained in RPMI1640 supplemented with 10% fetal calf
serum (FCS), penicillin (100 U/mL), streptomycin (100 µg), and 5 ng/mL of recombinant human IL-6 (Ajinomoto, Tokyo,
Japan). NIH3T3 cells were maintained in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% FCS and
penicillin (100 U/mL). MO7E cells were maintained in RPMI1640, 10%
FCS, antibiotics, and 10 ng/mL of recombinant human IL-3. Jurkat and
Ramos cells were maintained in RPMI1640, 10% FCS, and antibiotics. For
the stimulation of cell lines, KT-3 cells were starved of IL-6 for 12 hours and stimulated with 20 ng/mL of human recombinant IL-2 for 10 minutes. HepG2 cells were starved of serum for 24 hours and stimulated
with 100 ng/mL of IL-6 for 10 minutes. NIH3T3 cells were starved of
serum for 24 hours and stimulated with 50 ng/mL of human recombinant PDGF for 10 minutes. MO7E cells were starved of IL-3 for 12 hours and
stimulated with 30 ng/mL of human recombinant SCF for 10 minutes. TF-1
cells were starved of IL-3 for 12 hours and stimulated with 30 ng/mL of
human recombinant thrombopoietin (TPO) for 10 minutes.36 Jurkat cells were incubated with RPMI1640 and 0.5% FCS for 4 hours and
stimulated with 10 µg/mL of anti-CD3 antibody (UCHT-1) for 10 minutes. Ramos cells were stimulated with 10 µg/mL of
F(ab')2 fragments of goat antihuman IgM for 5 minutes. TF-1 and MO7E cells were kindly provided by Drs Y. Kanakura
and I. Matsumura.
Immunoprecipitation and immunoblotting.
The methods of immunoprecipitation and immunoblotting were essentially
as described previously.32 After stimulation, cell lysates
were prepared in lysis buffer (20 mmol/L Tris HCl, pH 7.4, 150 mmol/L
NaCl, 1% NP40, 500 µmol/L sodium vanadate, 1 mmol/L dithiotheritol,
5 µg/mL aprotinin, 5 µg/mL leupeptin, 1 mmol/L phenylmethylsulfonyl
fluoride) and incubated with 1 µL of anti-Gab1, Gab2 serum, 4 µL of
anti-SHP-2, or 0.5 µL of anti-p85 antibodies and 10 µL of protein
A-sepharose for 12 hours at 4°C. Immunoprecipitates were washed
three times with 1 mL of lysis buffer without protease inhibitors.
Proteins were eluted with 20 µL of 3× Laemmli's sodium dodecyl
sulfate (SDS) loading buffer, separated on a 4% to 20% polyacrylamide gel (Dai-ichi Kagaku, Tokyo, Japan), and
electrotransferred to a polyvinyliden difluoride membrane (Immobilon-P;
Millipore, Bedford, MA). The membranes were blocked with
TBST (20 mmol/L Tris HCl, pH 7.4, 150 mmol/L NaCl, 0.1% Tween 20)
containing 1% gelatin and incubated with the primary antibodies (1 µg/mL of monoclonal antibodies, 5,000×-diluted anti-Gab1, Gab2,
and SHP-2 antibodies, 10,000×-diluted anti-p85 antibody) for 1 hour at room temperature. The membranes were washed with TBST for 10 minutes three times and incubated with horseradish peroxidase
(HRP)-conjugated goat antimouse (for monoclonal antibodies) diluted
1:5,000 or HRP-conjugated goat antirabbit (for polyclonal antibodies)
diluted 1:10,000 Ig antibodies (Zymed, South San Francisco,
CA). The membranes were washed with TBST three times. The
immune complexes were visualized using a chemiluminescence system
(Renaissance; Dupont NEN Products, Boston, MA).
Phosphatase assay.
Tyrosine-phosphorylated Gab1 and STAT3 were immunoprecipitated from 5 × 106 IL-6-stimulated HepG2 cells.
Tyrosine-phosphorylated Gab2 was immunoprecipitated from 5 × 106 IL-3-stimulated BAF-B03 cells. The precipitates were
washed three times with 1 mL of lysis buffer without sodium vanadate or
protease inhibitors and once with phosphatase buffer (100 mmol/L
MES, pH 6.8, 150 mmol/L NaCl, 5 mmol/L dithiothreitol
[DTT], and 2 mmol/L EDTA). The dephosphorylation
reaction was performed by incubating with 50 µL of phosphatase buffer
containing 3 µg of GST-SHP-2 CAT or GST-SHP-2 C/S CAT for 30 minutes
at 30°C. The immunoprecipitates were washed with 1 mL of lysis
buffer containing sodium vanadate. Proteins were eluted with SDS
loading buffer. Tyrosine phosphorylation of Gab1, Gab2, and STAT3 was
analyzed by immunoblotting with anti-phosphotyrosine antibody.
Other assays.
Northern blotting, transfection, and the MAP kinase assay were
performed as described previously.15,32 For probes of
Northern blotting, the BamHI-Xba I fragment (4.8 kbp)
of mouse Gab1, the Not I-Xba I fragment of mouse Gab2
(3.0 kbp), and the EcoRI-BamHI fragment (0.6 kbp) of
CHO-B were used.
| |
RESULTS |
Identification of Gab2 and its expression.
We previously observed that, when G-CSF15 or
IL-332 were used to stimulate BAF-B03 transfectants
expressing a chimeric receptor that contained the extracellular domains
of the G-CSF receptor and the transmembrane and cytoplasmic domains of
gp130, a tyrosine-phosphorylated 100-kD molecule (pp100) that was
associated with SHP-2 appeared (Fukada et al15 and see Fig
3B). SHP-2 and pp100 were also coimmunoprecipitated with anti-p85 PI-3
kinase antibody immunoprecipitates (see Fig 3B). pp100 bound
GST-Grb2 in vitro (see Fig 3D). These data indicate that the
biochemical characteristics of pp100 are similar to those of Gab1,
which was shown to interact with SHP-2, PI-3 kinase, and Grb2,
prompting us to search for homologues of Gab1.
We found that a human cDNA from an entire cDNA sequencing project
(KIAA0571 accession no. AB011143; Kazusa DNA Research Institute)
displayed strong homology to Gab1. Although Gab1 contains a PH domain,
the KIAA0571 clone lacked part of the PH domain in the amino-terminal
region. We isolated the PH domain by 5'RACE PCR from a cDNA
library made from the human myeloma cell line U266. The mouse cDNA was
also isolated using a combination of hybridization and PCR. The entire
coding region of the human and mouse clones exhibited 37% and 35%
identity to human Gab1 at the amino acid level
(Fig 1), indicating that these clones
encode a novel member of human and mouse Gab1-family adapter proteins. Given the similarities in sequence and function (described below), we
have named this molecule Gab2. In addition to the PH domain, Gab2 has
many functional domains that are well conserved between it and Gab1.
Like Gab1, Gab2 contains various tyrosine-based motifs for SH2-domain
binding. In particular, the binding motifs for Grb2, Crk, PI-3 kinase,
and SHP-2 are well conserved (Fig 1). Gab2 also has a region similar to
the c-Met binding domain (MBD) of Gab1 (37% and 36% identity in human
and mouse Gab2 versus that in human Gab1) and it possesses proline-rich
sequences (amino acids 351-358 in human Gab2) that are also conserved.
View larger version (86K):
[in this window]
[in a new window]
| Fig 1.
Comparison of the amino acid sequences of Gab1 and Gab2.
The sequences of human and mouse Gab2 cDNA were deposited in the DNA
Data Bank of Japan (DDBJ). Their accession numbers are AB018413 and
AB018414, respectively. The PH domain, MBD, and tyrosine-based motifs
for Grb2, Crk, p85 PI-3 kinase, and SHP-2 are underlined.
|
|
Both Gab1 and Gab2 were expressed ubiquitously, but they were most
highly expressed in the brain, kidney, lung, heart, testis, and ovary
(Fig 2).
View larger version (45K):
[in this window]
[in a new window]
| Fig 2.
Ubiquitous expression of Gab1 and Gab2. Total RNA was
isolated from mouse tissues. RNA (20 µg) was analyzed by Northern
blotting with mouse Gab1 (upper panel) and Gab2 cDNAs (lower panel) as
probes. Note that RNA for both Gab1 and Gab2 was detected in all of the
tissues after a long exposure. CHO-B cDNA was used as a loading
control.
|
|
Gab2 is pp100, which interacts with SHP-2, PI-3 kinase, and Grb2. The
Box1 and Box2 region of gp130 was sufficient for its tyrosine
phosphorylation.
To demonstrate that Gab2 is pp100, we raised the polyclonal antibody
against a carboxy-terminal region (amino acids 380-563) of Gab2 and
used it for immunoprecipitation and immunoblotting. BAF-B03 cells,
which did not express Gab1, were stimulated with IL-3, and
immunoprecipitated Gab2 was tyrosine-phosphorylated after 2 minutes of
stimulation (Fig 3A). Concomitantly,
tyrosine-phosphorylated SHP-2 was coimmunoprecipitated with Gab2. The
p85 PI-3 kinase was not tyrosine-phosphorylated (data not shown) but
was also coimmunoprecipitated with Gab2 (Fig 3A). Gab2 was the major
tyrosine-phosphorylated molecule interacting with SHP-2 and PI-3 kinase
in response to IL-3 stimulation in BAF-B03 cells (Fig 3B). Furthermore,
when we transfected 293T cells with an expression vector for
Flag-tagged Gab2, the Gab2 immunoprecipitated with anti-Flag antibodies
was 100 kD (Fig 3C). It comigrated on a SDS polyacrylamide gel with the
100-kD protein that was immunoprecipitated with either anti-SHP-2 or
anti-Gab2 antibodies from IL-3-stimulated BAF-B03 cells (Fig 3C). Gab2
was not detected in the anti-Grb2 immunoprecipitates from either
nonstimulated or stimulated cells (data not shown). However, Grb2 bound
both nonphosphorylated and tyrosine-phosphorylated Gab2 in vitro (Fig
3D). These data indicate that Gab2 is the pp100 interacting with
SHP-2 and PI-3 kinase. Gab2 may also interact with Grb2 in cells.
View larger version (41K):
[in this window]
[in a new window]
| Fig 3.
Gab2 associates with SHP-2 and PI-3 kinase. (A) BAF-B03
cells were stimulated with IL-3 for the indicated periods of time.
Proteins were immunoprecipitated with an anti-Gab2 antibody, separated
on an SDS-polyacrylamide gel, and subjected to immunoblotting with
anti-phosphotyrosine, anti-Gab2, anti-SHP-2, and anti-p85 PI-3 kinase
antibodies. The locations of Gab2, SHP-2, and p85 are indicated by
arrows. (B) BAF-B03 cells were stimulated with IL-3 (+) or left
unstimulated ( ). Cell lysates were immunoprecipitated with
anti-SHP-2 or anti-p85 PI-3 kinase antibodies and subjected to
immunoblotting with anti-phosphotyrosine (upper panel) and anti-Gab2
(lower panel) antibodies. (C) 293T cells were transfected with an
expression vector for Flag-tagged Gab2 (lane 1) or a control vector
(lane 2), and cell lysates were immunoprecipitated with anti-Flag
antibodies. Cell lysates from IL-3-stimulated BAF-B03 cells were
immunoprecipitated with anti-SHP-2 (lane 3) or anti-Gab2 (lane 4)
antibodies. The immunoprecipitates were separated on the same
SDS-polyacrylamide gel. The anti-Flag, anti-SHP-2, and anti-Gab2
immunoprecipitates were analyzed by immunoblotting with anti-Flag and
anti-phosphotyrosine antibodies, respectively. (D) Cell lysates from
BAF-B03 cells that were stimulated or unstimulated with IL-3 were mixed
with GST fusion proteins containing the entire coding fragment (Full)
or the SH2 domain of Grb2. GST fusion protein-bound fractions were
isolated by glutathione sepharose and subjected to immunoblotting with
anti-phosphotyrosine (upper panel) and anti-Gab2 (lower panel)
antibodies. Anti-SHP-2 immunoprecipitates were also analyzed in the
same membrane. Note that the slower migrating form of Gab2 is the
tyrosine-phosphorylated form. (E) BAF-B03 cells expressing the chimeric
receptor G277 (containing the entire cytoplasmic domain) or G68
(containing 68 amino acids from the membrane region) were stimulated
with G-CSF (+) or left unstimulated (), and immunoprecipitated
Gab2 proteins were subjected to immunoblotting with
anti-phosphotyrosine (upper panel) and anti-Gab2 (lower panel)
antibodies.
|
|
We previously showed that neither tyrosine residues nor the
carboxy-terminal region (amino acid 710) of gp130 was necessary for the
tyrosine-phosphorylation of Gab1. We also determined which part of
gp130 is responsible for the tyrosine-phosphorylation of Gab2 (Fig 3E).
When BAF-B03 cells expressing the G68 chimeric receptors (containing
only the box1 and box2 region of gp130) were stimulated with G-CSF,
Gab2 was tyrosine-phosphorylated, as observed in G-CSF-stimulated
BAF-B03 cells expressing the G277 chimeric receptor (containing the
entire cytoplasmic domain of gp130; Fig 3E) or IL-3-stimulated BAF-B03
cells (data not shown). These data indicate that, as for Gab1, the box1
and box2 region of gp130 was sufficient and that the tyrosine residues
of gp130 were not necessary for the tyrosine phosphorylation of Gab2.
Gab1 and Gab2 act as adapter proteins for various signaling pathways.
We next examined the roles of Gab1 and Gab2 in various signal
transduction pathways (Fig 4A through C).
When HepG2 cells, which express both Gab1 and Gab2, were stimulated
with IL-6, Gab1 was phosphorylated on tyrosine but Gab2 was not
strongly phosphorylated. When KT-3 cells, which express Gab2 but not
Gab1, were stimulated with IL-2, Gab2 was phosphorylated on tyrosine.
In TF-1 cells, both Gab1 and Gab2 were phosphorylated on tyrosine in
response to both thrompoietin and IL-3. In MO7E cells, both Gab1 and
Gab2 were phosphorylated on tyrosine in response to SCF. In NIH3T3 cells, which express Gab1 but not Gab2, Gab1 was phosphorylated on
tyrosine in response to PDGF. These data indicate that both Gab1 and
Gab2 act downstream of cytokine receptors and receptor tyrosine kinases
(SCF and PDGF).
View larger version (50K):
[in this window]
[in a new window]
| Fig 4.
Gab1 and Gab2 are phosphorylated on tyrosine in response
to various stimuli. (A) Cytokines and growth factor stimuli. Various
cell lines were stimulated by the indicated cytokines or growth
factors. Anti-Gab1 and anti-Gab2 immunoprecipitates were analyzed by
immunoblotting with anti-phosphotyrosine, anti-Gab1, and anti-Gab2
antibodies. Note that Gab2 was tyrosine-phosphorylated in unstimulated
MO7E cells, but the band of Gab2 was shifted upon SCF stimulation,
indicating that Gab2 was hyper-phosphorylated in the stimulated cells.
HepG2, KT-3, TF-1, NIH3T3, and MO7E were human hepatoblastoma, human
(Lennert's) T lymphoma, human erythroleukemia, mouse fibroblast, and
human megakaryocytic leukemia cell lines, respectively. HepG2, TF-1,
and MO7E cells express both Gab1 and Gab2. But KT-3 and NIH3T3 cells do
not express Gab1 or Gab2, respectively (confirmed by RT-PCR, data not
shown). Proteins of 115 to 120 kD detected in the Gab2
immunoprecipitates from HepG2, NIH3T3, and MO7E cells are likely Gab1
proteins cross-reacted with anti-Gab2 antibodies. (B) TCR and (C) BCR
stimuli. Jurkat cells were stimulated with anti-CD3 antibody or left
unstimulated. Ramos cells were stimulated with anti-IgM antibody or
left unstimulated. Cell lysates were immunoprecipitated with anti-Gab1
or anti-Gab2 antibodies and subjected to immunoblotting with
anti-phosphotyrosine, anti-Gab1, anti-Gab2, anti-SHP2, and anti-p85
antibodies. Expression of Gab2 in Ramos cells was not detected by
immunoblotting and RT-PCR (data not shown).
|
|
It was previously reported that SHP-2 interacts with 97- and 120-kD
molecules upon stimulation of TCR27 and BCR37
in lymphocytes. We determined whether Gab1 and Gab2 act downstream of
antigen receptors. When TCR were stimulated with an anti-CD3 antibody on human Jurkat T cells, Gab2 was strongly tyrosine-phosphorylated, but
the phosphorylation of Gab1 was relatively low (Fig 4B). Furthermore, SHP-2 and the p85 PI-3 kinase were detected in the Gab2
immunoprecipitates (Fig 4B), confirming that Gab2 is the previously
reported pp97. In the human B-cell line Ramos, which expresses Gab1 but
not Gab2, Gab1 was tyrosine phosphorylated when the cells were
stimulated with anti-IgM antibodies (Fig 4C). These data showed that
Gab family adapter molecules act downstream of not only cytokine
receptors and receptor tyrosine kinases, but also of antigen receptors
in lymphocytes.
Gab1 and Gab2 are substrates for SHP-2.
We next examined whether Gab1 and Gab2 are substrates for SHP-2.
Tyrosine-phosphorylated Gab1, Gab2, and STAT3 were isolated from
IL-6-stimulated HepG2 and IL-3-stimulated BAF-B03 cells by immunoprecipitation and subjected to an in vitro phosphatase assay using GST fusion proteins containing the catalytic domain of SHP-2 or
its inactive mutant (C/S). Gab1 and Gab2 but not STAT3 were dephosphorylated by the catalytic domain of SHP-2. The
dephosphorylation did not occur in the presence of the inactive
catalytic domain (Fig 5). These data
indicate that Gab1 and Gab2 could be substrates for SHP-2 in
vivo.
View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
Gab1 and Gab2 are substrates for SHP-2 in vitro.
Tyrosine-phosphorylated Gab1 and STAT3 were isolated by
immunoprecipitation from IL-6-stimulated HepG2 cells.
Tyrosine-phosphorylated Gab2 was isolated from IL-3-stimulated BAF-B03
cells. These proteins were incubated with a GST fusion protein
containing the catalytic domain of SHP-2 (GST-SHP-2 WT) or the
catalytic inactive mutant (GST-SHP-2 C/S). Dephosphorylation of these
proteins was determined by immunoblotting with anti-phosphotyrosine
antibody (upper panel). The amounts of these proteins were analyzed by
immunoblotting with anti-Gab1, anti-Gab2, and anti-STAT3 antibodies
(lower panel), respectively.
|
|
Gab2 acts upstream of ERK MAP kinases.
It was reported that the overexpression of Gab1 enhanced the c-Met- or
gp130-mediated ERK MAP kinase activation.29,32 We analyzed
the role of Gab2 in MAP kinase activation. When an expression vector
for Flag-tagged ERK2 was transfected with and without vectors for Gab2
into 293T cells expressing the G-CSF-R/gp130 chimeric receptor, the
gp130-mediated ERK2 activities were enhanced by the expression of Gab2
(Fig 6A), suggesting that Gab2 acts
upstream of ERK MAP kinases, as Gab1 does. The ERK activation by v-Src, Tec, and Btk was also enhanced by the overexpression of both Gab1 and
Gab2 (Fig 6B and data not shown). Moreover, Gab1 and Gab2 were
phosphorylated on tyrosine in cells expressing v-Src, Tec, and Btk (Fig
6C). These data suggest that Gab1 and Gab2 are substrates for these
tyrosine kinases and that, after phosphorylation, they serve as adapter
molecules for transmitting signals to ERK MAP kinases.
View larger version (51K):
[in this window]
[in a new window]
| Fig 6.
Gab2 is involved in the activation of ERK MAP kinase. (A)
293T cells expressing the chimeric receptor G277 were transfected with
expression vectors for Flag-tagged ERK2, together with either Gab1,
Gab2, or a control vector. Cells were stimulated with G-CSF for 30 minutes (+) or left stimulated () and the ERK2 activities were
determined by an immunoprecipitation kinase assay using myelin basic
protein (MBP) as a substrate. The amount of MBP-incorporated
32P was quantified by an image analyzer and indicated as
the ratios against that from control unstimulated cells. (B) 293T cells
were transfected with vectors for Flag-tagged ERK2, together with
either Gab1, Gab2, or a control vector. They were also transfected with
the expression vectors for v-Src (+) or a control vector (), as
indicated. The ERK2 activities were determined as described above. (C)
293T cells were transfected with vectors for Flag-tagged-Gab1 or Gab2,
together with either JAK1, v-Src, Btk, Tec, or a control vector. Gab1
and Gab2 were immunoprecipitated with anti-Flag antibodies and analyzed
using anti-phosphotyrosine (upper panel) and anti-Flag antibodies
(lower panel).
|
|
| |
DISCUSSION |
Although SHP-2 has been implicated in cytokine and growth factor
receptor signaling, the molecular mechanism(s) by which SHP-2 controls
downstream signaling has been largely unknown. Drosophila genetics
showed that CSW and its substrate DOS are required for Sev-dependent
eye development.33,34 In addition to the CSW-DOS pathway,
Sos and an adapter molecule Drk (Drosphila homologue of Grb2) are also
required for Sev signaling.38 This situation is very
similar to that for cytokine receptors and receptor tyrosine kinases in
mammals. Many of those receptors recruit Grb2 either directly or
indirectly through Shc or SHP-2. In addition, the catalytic activity of
SHP-2 was shown to be required for signaling to ERK MAP kinases.
Therefore, it is quite important to find substrates for SHP-2. It was
reported that 97-to 100-kD molecules are tyrosine-phosphorylated and
associated with SHP-2 and PI-3 kinase in hematopoietic cells upon
IL-2,24 IL-3,25 and TCR27
stimulation and upon transformation by bcr-abl.28
Gab2, identified here, is the pp97 and pp100 previously reported: it
was phosphorylated on tyrosine in response to IL-2, IL-3, and TCR and
in response to other cytokines (Fig 4A and B). Upon stimulation, Gab2
associated with SHP-2 and PI-3 kinase (Fig 3A and B). Grb2 interacted
with Gab2 in vitro (Fig 3D). Tyrosine-phosphorylated Gab2 was
dephosphorylated by the catalytic subunit of SHP-2 (Fig 5). These data
indicate that Gab2 is an adapter molecule for transmitting signals from
cytokines, growth factors, and antigen receptors in lymphocytes.
Although both Gab1 and Gab2 are phosphorylated on tyrosine in response
to a wide variety of stimuli, there seems to be certain specificity. In
HepG2 cells, stimulation of gp130 resulted in the tyrosine
phosphorylation of, mainly, Gab1. In BAF-B03 cells, which express only
Gab2, gp130-stimulation resulted in the tyrosine phosphorylation of
Gab2 (Fig 3E), suggesting that Gab2 can replace the function of Gab1.
Quantitative analyses will be required to show if the preferential use
of Gab1 and Gab2 through various signaling pathways reflects any
functional specificity. In this regard, targeted disruption of these
genes will show the roles of Gab1 and Gab2 in these signal-transduction pathways.
Overexpression of Gab1 and Gab2 enhanced gp130-mediated ERK MAP kinase
activation. It also enhanced the ERK activation induced by the
expression of Src and its related tyrosine kinases (Fig 6A and B).
These data suggest that both Gab1 and Gab2 are substrates for various
tyrosine kinases and act as signal transducers for them. In T or B
cells, various Src family kinases, such as Lck, Fyn, and Lyn, and
Src-related kinases Tec and Btk, were shown to be involved in antigen
receptor signaling.39-41 Furthermore, in TCR signaling, the
phosphatase activity of SHP-2 was shown to be required for ERK
activation.42 Therefore, Gab1 and Gab2 are good candidates
for signal transducers for ERK activation in TCR and BCR signaling.
It is not yet clear how Gab1 and Gab2 are regulated by SHP-2 or how
they transmit signals downstream. Our previous data on Gab132 and other reports on pp97 and pp100 show that SHP-2
and PI-3 kinase simultaneously interact with Gab1 or Gab2 upon
stimulation.24,25 We also found that, in cells expressing a
gp130 mutant that lacks the SHP-2 binding motif, SHP-2 was neither
phosphorylated on tyrosine nor associated with Gab1; coincidentally,
the interaction of PI-3 kinase with Gab1 was attenuated, although Gab1
was phosphorylated on tyrosine.32 These data suggest that
the interaction of PI-3 kinase with the Gab proteins somehow depends on
the interaction between SHP-2 and the Gab proteins. The involvement of
the PI-3 kinase was also supported by the observation that a
dominant-negative p85 PI-3 kinase or treatment with wortmanin, a PI-3
kinase inhibitor, blocked the Gab1-enhanced ERK
activation.32 Thus, Gab family proteins may link SHP-2 to
PI-3 kinase for transmitting signals. In support of this hypothesis,
Gab1, Gab2, and the distantly related IRS1 and IRS2 all contain two
SHP-2 binding motifs in their carboxy-terminal region. A cluster of
PI-3 kinase-binding motifs (>3) are located 30 to 181 amino acids
distant from the cluster of SHP-2 binding motifs in all these proteins.
Either dephosphorylation of these adapter molecules by SHP-2 or the
binding to them of SHP-2 may facilitate conformational changes that
render them able to recruit or activate PI-3 kinase. Mutational
analyses of Gab1, Gab2, and SHP-2 will be required to clarify these
points. In any case, Gab1 and Gab2 play important roles in the signal
transduction of cytokines, growth factors, antigen receptors, and
possibly others.
| |
NOTE ADDED IN PROOF |
After acceptance of this manuscript, Gu et al (Mol Cell 2:729,
1998) reported the molecular cloning of p97/Gab2.
| |
ACKNOWLEDGMENT |
The authors thank R. Masuda and T. Kimura for their excellent
secretarial assistance. We thank Drs I. Matsumura, Y. Kanakura, S. Tsukada, H. Mano, M. Kasuga, T. Matozaki, and K. Matsuoka
for various reagents. We thank Kazusa DNA Research Institute for
providing us the KIAA0571 cDNA. We also thank Dr T. Kurosaki for his
suggestion on the analysis of B-cell antigen receptor signaling.
| |
FOOTNOTES |
Submitted October 22, 1998; accepted December 11, 1998.
Supported by grants and a Grant-Aid for COE Research from the Ministry
of Education, Science, Sports, and Culture in Japan, the Searle
Scientific Research Fellowship, and the Osaka Foundation for Promotion
of Clinical Immunology.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Toshio Hirano, MD, PhD,
Division of Molecular Oncology (C-7), Osaka University Medical School,
2-2 Yamada-oka, Suita, Osaka 565-0871, Japan; e-mail:
hirano{at}molonc.med.osaka-u.ac.jp;
http://www.med.osaka-u.ac.jp/pub/molonc/www/index.html.
| |
REFERENCES |
1.
Adachi M, Fischer EH, Ihle J, Imai K, Jirik F, Neel B, Pawson T, Shen S, Thomas M, Ullrich A, Zhao Z:
Mammalian SH2-containing protein tyrosine phosphatases.
Cell
85:15, 1996[Medline]
[Order article via Infotrieve]
2.
Feng GS, Hui CC, Pawson T:
SH2-containing phosphotyrosine phosphatase as a target of protein-tyrosine kinases.
Science
259:1607, 1993[Abstract/Free Full Text]
3.
Vogel W, Lammers R, Huang J, Ullrich A:
Activation of a phosphotyrosine phosphatase by tyrosine phosphorylation.
Science
259:1611, 1993[Abstract/Free Full Text]
4.
Yi T, Mui AL, Krystal G, Ihle JN:
Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor beta chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis.
Mol Cell Biol
13:7577, 1993[Abstract/Free Full Text]
5.
Klingmuller U, Lorenz U, Cantley LC, Neel BG, Lodish HF:
Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals.
Cell
80:729, 1995[Medline]
[Order article via Infotrieve]
6.
Paulson RF, Vesely S, Siminovitch KA, Bernstein A:
Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1.
Nat Genet
13:309, 1996[Medline]
[Order article via Infotrieve]
7.
Lorenz U, Bergemann AD, Steinberg HN, Flanagan JG, Li X, Galli SJ, Neel BG:
Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1.
J Exp Med
184:1111, 1996[Abstract/Free Full Text]
8.
Chen HE, Chang S, Trub T, Neel BG:
Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1.
Mol Cell Biol
16:3685, 1996[Abstract]
9.
D'Ambrosio D, Hippen KL, Minskoff SA, Mellman I, Pani G, Siminovitch KA, Cambier JC:
Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by Fc gamma RIIB1.
Science
268:293, 1995[Abstract/Free Full Text]
10.
Bennett AM, Tang TL, Sugimoto S, Walsh CT, Neel BG:
Protein-tyrosine-phosphatase SHPTP2 couples platelet-derived growth factor receptor beta to Ras.
Proc Natl Acad Sci USA
91:7335, 1994[Abstract/Free Full Text]
11.
Li W, Nishimura R, Kashishian A, Batzer AG, Kim WJ, Cooper JA, Schlessinger J:
A new function for a phosphotyrosine phosphatase: Linking GRB2-Sos to a receptor tyrosine kinase.
Mol Cell Biol
14:509, 1994[Abstract/Free Full Text]
12.
Ali S, Chen Z, Lebrun JJ, Vogel W, Kharitonenkov A, Kelly PA, Ullrich A:
PTP1D is a positive regulator of the prolactin signal leading to beta-casein promoter activation.
EMBO J
15:135, 1996[Medline]
[Order article via Infotrieve]
13.
David M, Zhou G, Pine R, Dixon JE, Larner AC:
The SH2 domain-containing tyrosine phosphatase PTP1D is required for interferon alpha/beta-induced gene expression.
J Biol Chem
271:15862, 1996[Abstract/Free Full Text]
14.
Itoh T, Muto A, Watanabe S, Miyajima A, Yokota T, Arai K:
Granulocyte-macrophage colony-stimulating factor provokes RAS activation and transcription of c-fos through different modes of signaling.
J Biol Chem
271:7587, 1996[Abstract/Free Full Text]
15.
Fukada T, Hibi M, Yamanaka Y, Takahashi Tezuka M, Fujitani Y, Yamaguchi T, Nakajima K, Hirano T:
Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: Involvement of STAT3 in anti-apoptosis.
Immunity
5:449, 1996[Medline]
[Order article via Infotrieve]
16.
Hirano T, Nakajima K, Hibi M:
Signaling mechanisms through gp130: A model of the cytokine system.
Cytokine Growth Factor Rev
8:241, 1997[Medline]
[Order article via Infotrieve]
17.
Noguchi T, Matozaki T, Horita K, Fujioka Y, Kasuga M:
Role of SH-PTP2, a protein-tyrosine phosphatase with Src homology 2 domains, in insulin-stimulated Ras activation.
Mol Cell Biol
14:6674, 1994[Abstract/Free Full Text]
18.
Bennett AM, Hausdorff SF, O'Reilly AM, Freeman RM, Neel BG:
Multiple requirements for SHPTP2 in epidermal growth factor-mediated cell cycle progression.
Mol Cell Biol
16:1189, 1996[Abstract]
19.
Tang TL, Freeman RM Jr, O'Reilly AM, Neel BG, Sokol SY:
The SH2-containing protein-tyrosine phosphatase SH-PTP2 is required upstream of MAP kinase for early Xenopus development.
Cell
80:473, 1995[Medline]
[Order article via Infotrieve]
20.
Kharitonenkov A, Chen Z, Sures I, Wang H, Schilling J, Ullrich A:
A family of proteins that inhibit signalling through tyrosine kinase receptors.
Nature
386:181, 1997[Medline]
[Order article via Infotrieve]
21.
Fujioka Y, Matozaki T, Noguchi T, Iwamatsu A, Yamao T, Takahashi N, Tsuda M, Takada T, Kasuga M:
A novel membrane glycoprotein, SHPS-1, that binds the SH2-domain-containing protein tyrosine phosphatase SHP-2 in response to mitogens and cell adhesion.
Mol Cell Biol
16:6887, 1996[Abstract]
22.
Welham MJ, Bone H, Levings M, Learmonth L, Wang LM, Leslie KB, Pierce JH, Schrader JW:
Insulin receptor substrate-2 is the major 170-kDa protein phosphorylated on tyrosine in response to cytokines in murine lymphohemopoietic cells.
J Biol Chem
272:1377, 1997[Abstract/Free Full Text]
23.
Holgado Madruga M, Emlet DR, Moscatello DK, Godwin AK, Wong AJ:
A Grb2-associated docking protein in EGF- and insulin-receptor signalling.
Nature
379:560, 1996[Medline]
[Order article via Infotrieve]
24.
Gesbert F, Guenzi C, Bertoglio J:
A new tyrosine-phosphorylated 97-kDa adaptor protein mediates interleukin-2-induced association of SHP-2 with p85-phosphatidylinositol 3-kinase in human T lymphocytes.
J Biol Chem
273:18273, 1998[Abstract/Free Full Text]
25.
Craddock BL, Welham MJ:
Interleukin-3 induces association of the protein-tyrosine phosphatase SHP2 and phosphatidylinositol 3-kinase with a 100-kDa tyrosine-phosphorylated protein in hemopoietic cells.
J Biol Chem
272:29281, 1997[Abstract/Free Full Text]
26.
Carlberg K, Rohrschneider LR:
Characterization of a novel tyrosine phosphorylated 100-kDa protein that binds to SHP-2 and phosphatidylinositol 3'-kinase in myeloid cells.
J Biol Chem
272:15943, 1997[Abstract/Free Full Text]
27.
Yamauchi K, Pessin JE:
Epidermal growth factor-induced association of the SHPTP2 protein tyrosine phosphatase with a 115-kDa phosphotyrosine protein.
J Biol Chem
270:14871, 1995[Abstract/Free Full Text]
28.
Gu H, Griffin JD, Neel BG:
Characterization of two SHP-2-associated binding proteins and potential substrates in hematopoietic cells.
J Biol Chem
272:16421, 1997[Abstract/Free Full Text]
29.
Weidner KM, Di Cesare S, Sachs M, Brinkmann V, Behrens J, Birchmeier W:
Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis.
Nature
384:173, 1996[Medline]
[Order article via Infotrieve]
30.
Holgado Madruga M, Moscatello DK, Emlet DR, Dieterich R, Wong AJ:
Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and the promotion of cell survival by nerve growth factor.
Proc Natl Acad Sci USA
94:12419, 1997[Abstract/Free Full Text]
31.
Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A:
Signal characteristics of G protein-transactivated EGF receptor.
EMBO J
16:7032, 1997[Medline]
[Order article via Infotrieve]
32.
Takahashi Tezuka M, Yoshida Y, Fukada T, Ohtani T, Yamanaka Y, Nishida K, Nakajima K, Hibi M, Hirano T:
Gab1 acts as an adapter molecule linking the cytokine receptor gp130 to ERK mitogen-activated protein kinase.
Mol Cell Biol
18:4109, 1998[Abstract/Free Full Text]
33.
Herbst R, Carroll PM, Allard JD, Schilling J, Raabe T, Simon MA:
Daughter of sevenless is a substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling.
Cell
85:899, 1996[Medline]
[Order article via Infotrieve]
34.
Raabe T, Riesgo Escovar J, Liu X, Bausenwein BS, Deak P, Maroy P, Hafen E:
DOS, a novel pleckstrin homology domain-containing protein required for signal transduction between sevenless and Ras1 in Drosophila.
Cell
85:911, 1996[Medline]
[Order article via Infotrieve]
35.
Takahashi Tezuka M, Hibi M, Fujitani Y, Fukada T, Yamaguchi T, Hirano T:
Tec tyrosine kinase links the cytokine receptors to PI-3 kinase probably through JAK.
Oncogene
14:2273, 1997[Medline]
[Order article via Infotrieve]
36.
Matsumura I, Kanakura Y, Kato T, Ikeda H, Ishikawa J, Horikawa Y, Hashimoto K, Moriyama Y, Tsujimura T, Nishiura T, Miyazaki H, Matsuzawa Y:
Growth response of acute myeloblastic leukemia cells to recombinant human thrombopoietin.
Blood
86:703, 1995[Abstract/Free Full Text]
37.
Nakamura K, Cambier JC:
B cell antigen receptor (BCR)-mediated formation of a SHP-2-pp120 complex and its inhibition by Fc gamma RIIB1-BCR coligation.
J Immunol
161:684, 1998[Abstract/Free Full Text]
38.
Olivier JP, Raabe T, Henkemeyer M, Dickson B, Mbamalu G, Margolis B, Schlessinger J, Hafen E, Pawson T:
A Drosophila SH2-SH3 adaptor protein implicated in coupling the sevenless tyrosine kinase to an activator of Ras guanine nucleotide exchange, Sos.
Cell
73:179, 1993[Medline]
[Order article via Infotrieve]
39.
Weiss A, Littman DR:
Signal transduction by lymphocyte antigen receptors.
Cell
76:263, 1994[Medline]
[Order article via Infotrieve]
40.
DeFranco AL:
Transmembrane signaling by antigen receptors of B and T lymphocytes.
Curr Opin Cell Biol
7:163, 1995[Medline]
[Order article via Infotrieve]
41.
Chan AC, Shaw AS:
Regulation of antigen receptor signal transduction by protein tyrosine kinases.
Curr Opin Immunol
8:394, 1996[Medline]
[Order article via Infotrieve]
42.
Frearson JA, Alexander DR:
The phosphotyrosine phosphatase SHP-2 participates in a multimeric signaling complex and regulates T cell receptor (TCR) coupling to the Ras/mitogen-activated protein kinase (MAPK) pathway in Jurkat T cells.
J Exp Med
187:1417, 1998[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Andratsch, N. Mair, C. E. Constantin, N. Scherbakov, C. Benetti, S. Quarta, C. Vogl, C. A. Sailer, N. Uceyler, J. Brockhaus, et al.
A Key Role for gp130 Expressed on Peripheral Sensory Nerves in Pathological Pain
J. Neurosci.,
October 28, 2009;
29(43):
13473 - 13483.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Terness, T. Oelert, S. Ehser, J. J. Chuang, I. Lahdou, C. Kleist, F. Velten, G. J. Hammerling, B. Arnold, and G. Opelz
Mitomycin C-treated dendritic cells inactivate autoreactive T cells: Toward the development of a tolerogenic vaccine in autoimmune diseases
PNAS,
November 25, 2008;
105(47):
18442 - 18447.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Sun, M. Pedersen, and L. Ronnstrand
Gab2 Is Involved in Differential Phosphoinositide 3-Kinase Signaling by Two Splice Forms of c-Kit
J. Biol. Chem.,
October 10, 2008;
283(41):
27444 - 27451.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Koyama, Y. Nakaoka, Y. Fujio, H. Hirota, K. Nishida, S. Sugiyama, K. Okamoto, K. Yamauchi-Takihara, M. Yoshimura, S. Mochizuki, et al.
Interaction of Scaffolding Adaptor Protein Gab1 with Tyrosine Phosphatase SHP2 Negatively Regulates IGF-I-dependent Myogenic Differentiation via the ERK1/2 Signaling Pathway
J. Biol. Chem.,
August 29, 2008;
283(35):
24234 - 24244.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Draberova, G. M. Shaik, P. Volna, P. Heneberg, M. Tumova, P. Lebduska, J. Korb, and P. Draber
Regulation of Ca2+ Signaling in Mast Cells by Tyrosine-Phosphorylated and Unphosphorylated Non-T Cell Activation Linker
J. Immunol.,
October 15, 2007;
179(8):
5169 - 5180.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. M. Lockyer, E. Tran, and B. H. Nelson
STAT5 Is Essential for Akt/p70S6 Kinase Activity during IL-2-Induced Lymphocyte Proliferation
J. Immunol.,
October 15, 2007;
179(8):
5301 - 5308.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Zhang, E. Diaz-Flores, G. Li, Z. Wang, Z. Kang, E. Haviernikova, S. Rowe, C.-K. Qu, W. Tse, K. M. Shannon, et al.
Abnormal hematopoiesis in Gab2 mutant mice
Blood,
July 1, 2007;
110(1):
116 - 124.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Orian-Rousseau, H. Morrison, A. Matzke, T. Kastilan, G. Pace, P. Herrlich, and H. Ponta
Hepatocyte Growth Factor-induced Ras Activation Requires ERM Proteins Linked to Both CD44v6 and F-Actin
Mol. Biol. Cell,
January 1, 2007;
18(1):
76 - 83.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Bard-Chapeau, J. Yuan, N. Droin, S. Long, E. E. Zhang, T. V. Nguyen, and G.-S. Feng
Concerted Functions of Gab1 and Shp2 in Liver Regeneration and Hepatoprotection
Mol. Cell. Biol.,
June 15, 2006;
26(12):
4664 - 4674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Chemnitz, A. R. Lanfranco, I. Braunstein, and J. L. Riley
B and T Lymphocyte Attenuator-Mediated Signal Transduction Provides a Potent Inhibitory Signal to Primary Human CD4 T Cells That Can Be Initiated by Multiple Phosphotyrosine Motifs.
J. Immunol.,
June 1, 2006;
176(11):
6603 - 6614.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. V. Parry, G. C. Whittaker, M. Sims, C. E. Edmead, M. J. Welham, and S. G. Ward
Ligation of CD28 Stimulates the Formation of a Multimeric Signaling Complex Involving Grb-2-Associated Binder 2 (Gab2), Src Homology Phosphatase-2, and Phosphatidylinositol 3-Kinase: Evidence That Negative Regulation of CD28 Signaling Requires the Gab2 Pleckstrin Homology Domain
J. Immunol.,
January 1, 2006;
176(1):
594 - 602.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nishida, S. Yamasaki, Y. Ito, K. Kabu, K. Hattori, T. Tezuka, H. Nishizumi, D. Kitamura, R. Goitsuka, R. S. Geha, et al.
Fc{varepsilon}RI-mediated mast cell degranulation requires calcium-independent microtubule-dependent translocation of granules to the plasma membrane
J. Cell Biol.,
July 4, 2005;
170(1):
115 - 126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kohno, S. Yamasaki, V. L. J. Tybulewicz, and T. Saito
Rapid and large amount of autocrine IL-3 production is responsible for mast cell survival by IgE in the absence of antigen
Blood,
March 1, 2005;
105(5):
2059 - 2065.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Zompi, H. Gu, and F. Colucci
The absence of Grb2-associated binder 2 (Gab2) does not disrupt NK cell development and functions
J. Leukoc. Biol.,
October 1, 2004;
76(4):
896 - 903.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Fernandez-Madrid, N. Tang, H. Alansari, J. L. Granda, L. Tait, K. C. Amirikia, M. Moroianu, X. Wang, and R. L. Karvonen
Autoantibodies to Annexin XI-A and Other Autoantigens in the Diagnosis of Breast Cancer
Cancer Res.,
August 1, 2004;
64(15):
5089 - 5096.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Lamothe, M. Yamada, U. Schaeper, W. Birchmeier, I. Lax, and J. Schlessinger
The Docking Protein Gab1 Is an Essential Component of an Indirect Mechanism for Fibroblast Growth Factor Stimulation of the Phosphatidylinositol 3-Kinase/Akt Antiapoptotic Pathway
Mol. Cell. Biol.,
July 1, 2004;
24(13):
5657 - 5666.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. van den Akker, T. van Dijk, M. Parren-van Amelsvoort, K. S. Grossmann, U. Schaeper, K. Toney-Earley, S. E. Waltz, B. Lowenberg, and M. von Lindern
Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors
Blood,
June 15, 2004;
103(12):
4457 - 4465.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Podar, G. Mostoslavsky, M. Sattler, Y.-T. Tai, T. Hayashi, L. P. Catley, T. Hideshima, R. C. Mulligan, D. Chauhan, and K. C. Anderson
Critical Role for Hematopoietic Cell Kinase (Hck)-mediated Phosphorylation of Gab1 and Gab2 Docking Proteins in Interleukin 6-induced Proliferation and Survival of Multiple Myeloma Cells
J. Biol. Chem.,
May 14, 2004;
279(20):
21658 - 21665.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q.-S. Zhu, L. J. Robinson, V. Roginskaya, and S. J. Corey
G-CSF-induced tyrosine phosphorylation of Gab2 is Lyn kinase dependent and associated with enhanced Akt and differentiative, not proliferative, responses
Blood,
May 1, 2004;
103(9):
3305 - 3312.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Holgado-Madruga and A. J. Wong
Role of the Grb2-Associated Binder 1/SHP-2 Interaction in Cell Growth and Transformation
Cancer Res.,
March 15, 2004;
64(6):
2007 - 2015.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Sun, J. Yuan, H. Liu, Z. Shi, K. Baker, K. Vuori, J. Wu, and G.-S. Feng
Role of Gab1 in UV-Induced c-Jun NH2-Terminal Kinase Activation and Cell Apoptosis
Mol. Cell. Biol.,
February 15, 2004;
24(4):
1531 - 1539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. S. Kapoor, Y. Zhan, G. R. Johnson, and D. M. O'Rourke
Distinct Domains in the SHP-2 Phosphatase Differentially Regulate Epidermal Growth Factor Receptor/NF-{kappa}B Activation through Gab1 in Glioblastoma Cells
Mol. Cell. Biol.,
January 15, 2004;
24(2):
823 - 836.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Brocke-Heidrich, A. K. Kretzschmar, G. Pfeifer, C. Henze, D. Loffler, D. Koczan, H.-J. Thiesen, R. Burger, M. Gramatzki, and F. Horn
Interleukin-6-dependent gene expression profiles in multiple myeloma INA-6 cells reveal a Bcl-2 family-independent survival pathway closely associated with Stat3 activation
Blood,
January 1, 2004;
103(1):
242 - 251.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P.-C. Chan, Y.-L. Chen, C.-H. Cheng, K.-C. Yu, L. A. Cary, K.-H. Shu, W. L. Ho, and H.-C. Chen
Src Phosphorylates Grb2-associated Binder 1 upon Hepatocyte Growth Factor Stimulation
J. Biol. Chem.,
November 7, 2003;
278(45):
44075 - 44082.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Momose, H. Kurosu, N. Tsujimoto, K. Kontani, K. Tsujita, H. Nishina, and T. Katada
Dual Phosphorylation of Phosphoinositide 3-Kinase Adaptor Grb2-Associated Binder 2 Is Responsible for Superoxide Formation Synergistically Stimulated by Fc{gamma} and Formyl-Methionyl-Leucyl-Phenylalanine Receptors in Differentiated THP-1 Cells
J. Immunol.,
October 15, 2003;
171(8):
4227 - 4234.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Zhao, H. Ma, E. Bossy-Wetzel, S. A. Lipton, Z. Zhang, and G.-S. Feng
GC-GAP, a Rho Family GTPase-activating Protein That Interacts with Signaling Adapters Gab1 and Gab2
J. Biol. Chem.,
September 5, 2003;
278(36):
34641 - 34653.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Wang
Fill a Gab(1) in Cardiac Hypertrophy Signaling: Search a Missing Link Between gp130 and ERK5 in Hypertrophic Remodeling in Heart
Circ. Res.,
August 8, 2003;
93(3):
186 - 188.
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Nakaoka, K. Nishida, Y. Fujio, M. Izumi, K. Terai, Y. Oshima, S. Sugiyama, S. Matsuda, S. Koyasu, K. Yamauchi-Takihara, et al.
Activation of gp130 Transduces Hypertrophic Signal Through Interaction of Scaffolding/Docking Protein Gab1 With Tyrosine Phosphatase SHP2 in Cardiomyocytes
Circ. Res.,
August 8, 2003;
93(3):
221 - 229.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Holgado-Madruga and A. J. Wong
Gab1 Is an Integrator of Cell Death versus Cell Survival Signals in Oxidative Stress
Mol. Cell. Biol.,
July 1, 2003;
23(13):
4471 - 4484.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kong, C. Mounier, A. Balbis, G. Baquiran, and B. I. Posner
Gab2 Tyrosine Phosphorylation by a Pleckstrin Homology Domain-Independent Mechanism: Role in Epidermal Growth Factor-Induced Mitogenesis
Mol. Endocrinol.,
May 1, 2003;
17(5):
935 - 944.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Bouscary, F. Pene, Y.-E. Claessens, O. Muller, S. Chretien, M. Fontenay-Roupie, S. Gisselbrecht, P. Mayeux, and C. Lacombe
Critical role for PI 3-kinase in the control of erythropoietin-induced erythroid progenitor proliferation
Blood,
May 1, 2003;
101(9):
3436 - 3443.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. M. Agazie and M. J. Hayman
Development of an Efficient "Substrate-trapping" Mutant of Src Homology Phosphotyrosine Phosphatase 2 and Identification of the Epidermal Growth Factor Receptor, Gab1, and Three Other Proteins as Target Substrates
J. Biol. Chem.,
April 11, 2003;
278(16):
13952 - 13958.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Seiffert, J. M. Custodio, I. Wolf, M. Harkey, Y. Liu, J. N. Blattman, P. D. Greenberg, and L. R. Rohrschneider
Gab3-Deficient Mice Exhibit Normal Development and Hematopoiesis and Are Immunocompetent
Mol. Cell. Biol.,
April 1, 2003;
23(7):
2415 - 2424.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Yamasaki, K. Nishida, M. Sakuma, D. Berry, C. J. McGlade, T. Hirano, and T. Saito
Gads/Grb2-Mediated Association with LAT Is Critical for the Inhibitory Function of Gab2 in T Cells
Mol. Cell. Biol.,
April 1, 2003;
23(7):
2515 - 2529.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. R. Maroun, M. A. Naujokas, and M. Park
Membrane Targeting of Grb2-associated Binder-1 (Gab1) Scaffolding Protein through Src Myristoylation Sequence Substitutes for Gab1 Pleckstrin Homology Domain and Switches an Epidermal Growth Factor Response to an Invasive Morphogenic Program
Mol. Biol. Cell,
April 1, 2003;
14(4):
1691 - 1708.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kong, C. Mounier, V. Dumas, and B. I. Posner
Epidermal Growth Factor-induced DNA Synthesis. KEY ROLE FOR Src PHOSPHORYLATION OF THE DOCKING PROTEIN Gab2
J. Biol. Chem.,
February 14, 2003;
278(8):
5837 - 5844.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-O. Kim, K. Loesch, X. Wang, J. Jiang, L. Mei, J. M. Cunnick, J. Wu, and S. J. Frank
A Role for Grb2-Associated Binder-1 in Growth Hormone Signaling
Endocrinology,
December 1, 2002;
143(12):
4856 - 4867.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Lamorte, S. Rodrigues, M. Naujokas, and M. Park
Crk Synergizes with Epidermal Growth Factor for Epithelial Invasion and Morphogenesis and Is Required for the Met Morphogenic Program
J. Biol. Chem.,
September 27, 2002;
277(40):
37904 - 37911.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Gogg and U. Smith
Epidermal Growth Factor and Transforming Growth Factor alpha Mimic the Effects of Insulin in Human Fat Cells and Augment Downstream Signaling in Insulin Resistance
J. Biol. Chem.,
September 20, 2002;
277(39):
36045 - 36051.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Q. Zhang, W. G. Tsiaras, T. Araki, G. Wen, L. Minichiello, R. Klein, and B. G. Neel
Receptor-Specific Regulation of Phosphatidylinositol 3'-Kinase Activation by the Protein Tyrosine Phosphatase Shp2
Mol. Cell. Biol.,
June 15, 2002;
22(12):
4062 - 4072.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. S. Lock, C. R. Maroun, M. A. Naujokas, and M. Park
Distinct Recruitment and Function of Gab1 and Gab2 in Met Receptor-mediated Epithelial Morphogenesis
Mol. Biol. Cell,
June 1, 2002;
13(6):
2132 - 2146.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. F. Yu, Z.-X. Liu, and L. G. Cantley
ERK Negatively Regulates the Epidermal Growth Factor-mediated Interaction of Gab1 and the Phosphatidylinositol 3-Kinase
J. Biol. Chem.,
May 24, 2002;
277(22):
19382 - 19388.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Itoh, M. Itoh, K. Nishida, S. Yamasaki, Y. Yoshida, M. Narimatsu, S. J. Park, M. Hibi, K. Ishihara, and T. Hirano
Adapter Molecule Grb2-Associated Binder 1 Is Specifically Expressed in Marginal Zone B Cells and Negatively Regulates Thymus-Independent Antigen-2 Responses
J. Immunol.,
May 15, 2002;
168(10):
5110 - 5116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z.-H. Xie, I. Ambudkar, and R. P. Siraganian
The Adapter Molecule Gab2 Regulates Fc{epsilon}RI-Mediated Signal Transduction in Mast Cells
J. Immunol.,
May 1, 2002;
168(9):
4682 - 4691.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W.-M. Yu, T. S. Hawley, R. G. Hawley, and C.-K. Qu
Role of the docking protein Gab2 in beta 1-integrin signaling pathway-mediated hematopoietic cell adhesion and migration
Blood,
April 1, 2002;
99(7):
2351 - 2359.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nishida, L. Wang, E. Morii, S. J. Park, M. Narimatsu, S. Itoh, S. Yamasaki, M. Fujishima, K. Ishihara, M. Hibi, et al.
Requirement of Gab2 for mast cell development and KitL/c-Kit signaling
Blood,
March 1, 2002;
99(5):
1866 - 1869.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. F. Dorsey, J. M. Cunnick, S. M. Mane, and J. Wu
Regulation of the Erk2-Elk1 signaling pathway and megakaryocytic differentiation of Bcr-Abl+ K562 leukemic cells by Gab2
Blood,
February 15, 2002;
99(4):
1388 - 1397.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Takaki, H. Morita, Y. Tezuka, and K. Takatsu
Enhanced Hematopoiesis by Hematopoietic Progenitor Cells Lacking Intracellular Adaptor Protein, Lnk
J. Exp. Med.,
January 14, 2002;
195(2):
151 - 160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Wolf, B. J. Jenkins, Y. Liu, M. Seiffert, J. M. Custodio, P. Young, and L. R. Rohrschneider
Gab3, a New DOS/Gab Family Member, Facilitates Macrophage Differentiation
Mol. Cell. Biol.,
January 1, 2002;
22(1):
231 - 244.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Gary-Gouy, J. Harriague, A. Dalloul, E. Donnadieu, and G. Bismuth
CD5-Negative Regulation of B Cell Receptor Signaling Pathways Originates from Tyrosine Residue Y429 Outside an Immunoreceptor Tyrosine-Based Inhibitory Motif
J. Immunol.,
January 1, 2002;
168(1):
232 - 239.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kameda, J. I. Risinger, B.-B. Han, S. J. Baek, J. C. Barrett, T. Abe, T. Takeuchi, W. C. Glasgow, and T. E. Eling
Expression of Gab1 Lacking the Pleckstrin Homology Domain Is Associated with Neoplastic Progression
Mol. Cell. Biol.,
October 15, 2001;
21(20):
6895 - 6905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Barnache, P. Mayeux, B. Payrastre, and F. Moreau-Gachelin
Alterations of the phosphoinositide 3-kinase and mitogen-activated protein kinase signaling pathways in the erythropoietin-independent Spi-1/PU.1 transgenic proerythroblasts
Blood,
October 15, 2001;
98(8):
2372 - 2381.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. S. Wilson, J. R. Pfeiffer, Z. Surviladze, E. A. Gaudet, and J. M. Oliver
High resolution mapping of mast cell membranes reveals primary and secondary domains of Fc{epsilon}RI and LAT
J. Cell Biol.,
August 6, 2001;
154(3):
645 - 658.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Wu, C.-F. Lai, and W. C. Mobley
Nerve Growth Factor Activates Persistent Rap1 Signaling in Endosomes
J. Neurosci.,
August 1, 2001;
21(15):
5406 - 5416.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kameda, J. I. Risinger, B.-B. Han, S. J. Baek, J. C. Barrett, W. C. Glasgow, and T. E. Eling
Identification of Epidermal Growth Factor Receptor- Grb2-associated Binder-1-SHP-2 Complex Formation and Its Functional Loss during Neoplastic Cell Progression
Cell Growth Differ.,
June 1, 2001;
12(6):
307 - 318.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Liu, B. Jenkins, J. L. Shin, and L. R. Rohrschneider
Scaffolding Protein Gab2 Mediates Differentiation Signaling Downstream of Fms Receptor Tyrosine Kinase
Mol. Cell. Biol.,
May 1, 2001;
21(9):
3047 - 3056.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. I. Kontaridis, X. Liu, L. Zhang, and A. M. Bennett
SHP-2 complex formation with the SHP-2 substrate-1 during C2C12 myogenesis
J. Cell Sci.,
January 6, 2001;
114(11):
2187 - 2198.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. R. Maroun, M. A. Naujokas, M. Holgado-Madruga, A. J. Wong, and M. Park
The Tyrosine Phosphatase SHP-2 Is Required for Sustained Activation of Extracellular Signal-Regulated Kinase and Epithelial Morphogenesis Downstream from the Met Receptor Tyrosine Kinase
Mol. Cell. Biol.,
November 15, 2000;
20(22):
8513 - 8525.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. C. Pratt, V. E. Igras, H. Maeda, S. Baksh, E. W. Gelfand, S. J. Burakoff, B. G. Neel, and H. Gu
Cutting Edge: Gab2 Mediates an Inhibitory Phosphatidylinositol 3'-Kinase Pathway in T Cell Antigen Receptor Signaling
J. Immunol.,
October 15, 2000;
165(8):
4158 - 4163.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Gu, H. Maeda, J. J. Moon, J. D. Lord, M. Yoakim, B. H. Nelson, and B. G. Neel
New Role for Shc in Activation of the Phosphatidylinositol 3-Kinase/Akt Pathway
Mol. Cell. Biol.,
October 1, 2000;
20(19):
7109 - 7120.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. W.-M. Lee and D. J. States
Both Src-Dependent and -Independent Mechanisms Mediate Phosphatidylinositol 3-Kinase Regulation of Colony-Stimulating Factor 1-Activated Mitogen-Activated Protein Kinases in Myeloid Progenitors
Mol. Cell. Biol.,
September 15, 2000;
20(18):
6779 - 6798.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
U. Schaeper, N. H. Gehring, K. P. Fuchs, M. Sachs, B. Kempkes, and W. Birchmeier
Coupling of Gab1 to C-Met, Grb2, and Shp2 Mediates Biological Responses
J. Cell Biol.,
June 26, 2000;
149(7):
1419 - 1432.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Itoh, Y. Yoshida, K. Nishida, M. Narimatsu, M. Hibi, and T. Hirano
Role of Gab1 in Heart, Placenta, and Skin Development and Growth Factor- and Cytokine-Induced Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase Activation
Mol. Cell. Biol.,
May 15, 2000;
20(10):
3695 - 3704.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. M. Cunnick, J. F. Dorsey, T. Munoz-Antonia, L. Mei, and J. Wu
Requirement of SHP2 Binding to Grb2-associated Binder-1 for Mitogen-activated Protein Kinase Activation in Response to Lysophosphatidic Acid and Epidermal Growth Factor
J. Biol. Chem.,
April 28, 2000;
275(18):
13842 - 13848.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nishigaki, C. Hanson, T. Ohashi, D. Thompson, K. Muszynski, and S. Ruscetti
Erythroid Cells Rendered Erythropoietin Independent by Infection with Friend Spleen Focus-Forming Virus Show Constitutive Activation of Phosphatidylinositol 3-Kinase and Akt Kinase: Involvement of Insulin Receptor Substrate-Related Adapter Proteins
J. Virol.,
April 1, 2000;
74(7):
3037 - 3045.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
Z.-Q. Shi, D.-H. Yu, M. Park, M. Marshall, and G.-S. Feng
Molecular Mechanism for the Shp-2 Tyrosine Phosphatase Function in Promoting Growth Factor Stimulation of Erk Activity
Mol. Cell. Biol.,
March 1, 2000;
20(5):
1526 - 1536.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. R. Rohrschneider, J. F. Fuller, I. Wolf, Y. Liu, and D. M. Lucas
Structure, function, and biology of SHIP proteins
Genes & Dev.,
March 1, 2000;
14(5):
505 - 520.
[Full Text]
|
|
|
|
|
|
|
J. M. Korhonen, F. A. Said, A. J. Wong, and D. R. Kaplan
Gab1 Mediates Neurite Outgrowth, DNA Synthesis, and Survival in PC12 Cells
J. Biol. Chem.,
December 24, 1999;
274(52):
37307 - 37314.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Wickrema, S. Uddin, A. Sharma, F. Chen, Y. Alsayed, S. Ahmad, S. T. Sawyer, G. Krystal, T. Yi, K. Nishada, et al.
Engagement of Gab1 and Gab2 in Erythropoietin Signaling
J. Biol. Chem.,
August 27, 1999;
274(35):
24469 - 24474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Miyakawa, P. Rojnuckarin, T. Habib, and K. Kaushansky
Thrombopoietin Induces Phosphoinositol 3-Kinase Activation through SHP2, Gab, and Insulin Receptor Substrate Proteins in BAF3 Cells and Primary Murine Megakaryocytes
J. Biol. Chem.,
January 19, 2001;
276(4):
2494 - 2502.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. S. Lock, I. Royal, M. A. Naujokas, and M. Park
Identification of an Atypical Grb2 Carboxyl-terminal SH3 Domain Binding Site in Gab Docking Proteins Reveals Grb2-dependent and -independent Recruitment of Gab1 to Receptor Tyrosine Kinases
J. Biol. Chem.,
September 29, 2000;
275(40):
31536 - 31545.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Gadina, C. Sudarshan, R. Visconti, Y.-J. Zhou, H. Gu, B. G. Neel, and J. J. O'Shea
The Docking Molecule Gab2 Is Induced by Lymphocyte Activation and Is Involved in Signaling by Interleukin-2 and Interleukin-15 but Not Other Common gamma Chain-using Cytokines
J. Biol. Chem.,
August 25, 2000;
275(35):
26959 - 26966.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kong, C. Mounier, J. Wu, and B. I. Posner
Epidermal Growth Factor-induced Phosphatidylinositol 3-Kinase Activation and DNA Synthesis. IDENTIFICATION OF Grb2-ASSOCIATED BINDER 2 AS THE MAJOR MEDIATOR IN RAT HEPATOCYTES
J. Biol. Chem.,
November 10, 2000;
275(46):
36035 - 36042.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Besset, R. P. Scott, and C. F. Ibanez
Signaling Complexes and Protein-Protein Interactions Involved in the Activation of the Ras and Phosphatidylinositol 3-Kinase Pathways by the c-Ret Receptor Tyrosine Kinase
J. Biol. Chem.,
December 8, 2000;
275(50):
39159 - 39166.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ali and S. Ali
Recruitment of the Protein-tyrosine Phosphatase SHP-2 to the C-terminal Tyrosine of the Prolactin Receptor and to the Adaptor Protein Gab2
J. Biol. Chem.,
December 8, 2000;
275(50):
39073 - 39080.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. L. Craddock, J. Hobbs, C. E. Edmead, and M. J. Welham
Phosphoinositide 3-Kinase-dependent Regulation of Interleukin-3-induced Proliferation. INVOLVEMENT OF MITOGEN-ACTIVATED PROTEIN KINASES, SHP2 AND Gab2
J. Biol. Chem.,
June 22, 2001;
276(26):
24274 - 24283.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. J. Ingham, L. Santos, M. Dang-Lawson, M. Holgado-Madruga, P. Dudek, C. R. Maroun, A. J. Wong, L. Matsuuchi, and M. R. Gold
The Gab1 Docking Protein Links the B Cell Antigen Receptor to the Phosphatidylinositol 3-Kinase/Akt Signaling Pathway and to the SHP2 Tyrosine Phosphatase
J. Biol. Chem.,
April 6, 2001;
276(15):
12257 - 12265.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Yamasaki, K. Nishida, M. Hibi, M. Sakuma, R. Shiina, A. Takeuchi, H. Ohnishi, T. Hirano, and T. Saito
Docking Protein Gab2 Is Phosphorylated by ZAP-70 and Negatively Regulates T Cell Receptor Signaling by Recruitment of Inhibitory Molecules
J. Biol. Chem.,
November 21, 2001;
276(48):
45175 - 45183.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Mazerolles, C. Barbat, M. Trucy, W. Kolanus, and A. Fischer
Molecular Events Associated with CD4-mediated Down-regulation of LFA-1-dependent Adhesion
J. Biol. Chem.,
January 4, 2002;
277(2):
1276 - 1283.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION