|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 6 (March 15), 1999:
pp. 1843-1850
RAPID COMMUNICATION
Human Immunodeficiency Virus-1-Infected Macrophages Induce
Inducible Nitric Oxide Synthase and Nitric Oxide (NO)
Production in Astrocytes: Astrocytic NO as a Possible Mediator of
Neural Damage in Acquired Immunodeficiency Syndrome
By
Kotaro Hori,
Parris R. Burd,
Keizo Furuke,
Joseph Kutza,
Karis A. Weih, and
Kathleen A. Clouse
From the Division of Cytokine Biology and the Division of Cellular
and Gene Therapies, Center for Biologics Evaluation and Research, Food
and Drug Administration, Rockville, MD.
 |
ABSTRACT |
Nitric oxide (NO) plays an important role in normal neural cell
function. Dysregulated or overexpression of NO contributes to
neurologic damage associated with various pathologies, including human
immunodeficiency virus (HIV)-associated neurological disease. Previous
studies suggest that HIV-infected monocyte-derived macrophages (MDM)
produce low levels of NO in vitro and that inducible nitric oxide
synthase (iNOS) is expressed in the brain of patients with neurologic
disease. However, the levels of NO could not account for the degree of
neural toxicity observed. In this study, we found that induction of
iNOS with concomitant production of NO occurred in primary human
astrocytes, but not in MDM, when astrocytes were cocultured with
HIV-1-infected MDM. This coincided with decreased HIV replication in
infected MDM. Supernatants from cocultures of infected MDM and
astrocytes also stimulated iNOS/NO expression in astrocytes, but
cytokines known to induce iNOS expression (interferon- , interleukin-1 , and tumor necrosis factor- ) were not detected. In
addition, the recombinant HIV-1 envelope protein gp41, but not rgp120,
induced iNOS in cocultures of uninfected MDM and astrocytes. This
suggests that astrocytes may be an important source of NO production
due to dysregulated iNOS expression and may constitute one arm of the
host response resulting in suppression of HIV-1 replication in the
brain. It also leads us to speculate that neurologic damage observed in
HIV disease may ensue from prolonged, high level production of NO.
This is a US government work. There are no restrictions on its use.
| |
INTRODUCTION |
HUMAN IMMUNODEFICIENCY virus-1 (HIV-1)
infection of the brain can cause neurologic deficits in the absence of
opportunistic infections or associated malignancies. HIV-1-associated
cognitive/motor complex is a severe form of these neurologic
impairments, which is observed in 20% to 30% of patients with
acquired immunodeficiency syndrome (AIDS).1-3 The
characteristic neuropathology of HIV-1-associated cognitive/motor
complex consists of infiltrating macrophages, multinucleated giant
cells, astrogliosis, myelin pallor, and neuronal loss.4
Productive HIV-1 infection in the brain occurs predominantly in
macrophages, microglia, and multinucleated giant cells.5,6 More recent observations using highly sensitive methods suggest that
infection of astrocytes may also occur with restricted virus replication, affirming that the effects of HIV on astrocytes may be
indirect.7-11
The pathogenesis of HIV-1-associated cognitive/motor complex is not
well understood. In the majority of patients with HIV disease, virus
enters the brain early in the course of systemic infection, but not all
patients develop neurologic disease.12,13 The correlation
between the disease severity and viral load is unconvincing,3,14-17 and the neurotoxicity of the virus
itself is controversial.18,19 In AIDS-related vacuolar
myelopathy and sensory neuropathy, little or no virus is
found.20,21 These findings suggest that indirect mechanisms
are most likely responsible for the development of HIV-related neuronal disease.
One means by which indirect effects may be exerted upon neural cells is
via nitric oxide (NO) production. NO is a highly reactive gaseous
molecule produced during the conversion of L-arginine to L-citrulline,
catalyzed by a family of NO synthases (NOS),22 which exerts
diverse effects.23 It is known that small amounts of NO
produced by neuronal NO synthase (nNOS) act as a neurotransmitter, and
excess NO is directly or indirectly neurotoxic via stimulation of
N-methyl-D-aspartate (NMDA) receptors, leading to necrosis and
apoptosis.24-28 Inducible NOS (iNOS) is an attractive
candidate for mediating NO-associated neurotoxicities, because it
functions independently of signals that modulate other forms of the
enzymes (eNOS and nNOS). After induction of iNOS protein, NO production continues until cellular processes remove the protein or the enzymatic substrates are depleted. Thus, a large amount of NO may be produced by
iNOS, as is observed when rodent macrophages are stimulated during
inflammatory and immune responses. Furthermore, NO has been shown to
exhibit antiviral activity against a wide range of viruses in rodents
(eg, herpes simplex, vaccinia, ectromelia, vesicular stomatitis, Friend
leukemia, Coxsackie, Japanese encephalitis viruses, and
Coronavirus).29-36 The existence of NO-mediated antiviral activity against HIV-1 could account for the observed low levels of
virus detectable in vivo in the presence of significant neurologic damage.
When modeling possible mechanisms of HIV pathogenesis, it is apparent
that activation of the iNOS pathway in humans differs from that in
rodents. In fact, the effect of NO in the human host defense has been
difficult to study because much lower levels of NO are present in human
macrophages than in rodents.37,38 However, antiviral
activity of NO against Epstein-Barr and hepatitis C viruses in the
human system has recently been reported.39,40 It has also
been shown that HIV-1 infection41 and HIV envelope proteins
induce iNOS expression42-45 and that NO is involved in IgE-induced HIV-1 expression in chronically infected monocytic cells,46 but data show that human macrophages may not be a
potent source of iNOS/NO. Studies have demonstrated in vivo iNOS
expression in the brains of patients with HIV-1-associated
cognitive/motor complex,41,45,47 although it is unclear
which cell types are responsible for iNOS/NO production. Human
astrocytes, as well as human macrophages, are documented to produce
iNOS under certain conditions.48-52 Thus, it is conceivable
that either cell type could indirectly contribute to the pathogenesis
of HIV-1-associated cognitive/motor complex via induction of iNOS and
subsequent production of NO in response to the virus. This prompted us
to examine which cells produce iNOS during HIV-1 infection and to
determine whether NO has anti-HIV-1 activity.
In this study, we show that HIV-1-infected monocyte-derived
macrophages (MDM) induce iNOS production in primary human astrocytes and that astrocyte-derived NO inhibits HIV-1 replication in MDM. These
results suggest that astrocyte-derived NO may contribute to HIV-1
replication as well as brain cell injury in AIDS patients and may
provide new insight into the pathogenesis of HIV-1-associated cognitive/motor complex.
| |
MATERIALS AND METHODS |
Reagents.
Recombinant HIV-1IIIB gp41 (amino acids 1 through 241;
rgp41) was purchased from Intracel Corp (Cambridge, MA). Recombinant full-length HIV-1IIIB gp120 (rgp120) was purchased from
Celltech, Inc (Slough, Berks, UK) and was provided to us by the
Developmental Therapeutics Branch, Division of AIDS, NIAID, NIH
(Bethesda, MD). HIV-1ADA and neutralizing anti-gp41
antibody (Ab) were supplied by the NIH AIDS Research and Reference
Reagent Program (Rockville, MD). Virus stock was expanded in human
macrophages; culture supernatants were then harvested, virus was
pelleted by ultracentrifugation, and the virions were resuspended in
fresh medium at a 1,000× concentration (Advanced Biotechnologies,
Columbia, MD). NG-monomethylL-arginine (L-NMMA) and
S-nitroso-N-acethylpenicillamine (SNAP) were purchased from
Calbiochem-Novabiochem Co (La Jolla, CA) and Sigma Chemical Co (St
Louis, MO), respectively.
Preparation and HIV-1 infection of primary cells.
Human fetal astrocytes were kindly provided by Drs Eugene Major and
Katherine Conant (NINDS, NIH) and grown in minimal essential medium
(MEM; Life Technologies, Inc, Gaithersburg, MD)
supplemented with 10% fetal calf serum (FCS), 2 mmol/L L-glutamine,
and gentamicin (5 µg/mL). Human adult astrocytes were kindly provided
by Dr Kathryn Carbone and Steven Rubin (CBER, FDA) and maintained in
Dulbecco's modified Eagle's medium (DMEM; Life
Technologies) supplemented with 10% FCS, 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and 50 U/mL penicillin/streptomycin. The purity
of the astrocyte cultures was greater than 95% by immunohistochemical
staining for glial fibrillary acidic protein (GFAP).
Monocytes were isolated and infected with HIV-1ADA as
described previously.53 Briefly, monocytes were isolated
from peripheral blood mononuclear cells (PBMC) of HIV-seronegative
donors by countercurrent centrifugal elutriation using a Beckman system
(Beckman Instruments, Fullerton, CA). These cells were greater than
99% viable and greater than 95% pure as determined by Giemsa stain of
representative cytocentrifuge preparations. To generate MDM, elutriated
monocytes were incubated in DMEM supplemented with 2 mmol/L
L-glutamine, 1 mmol/L sodium pyruvate, 50 U/mL penicillin/streptomycin,
and 10% pooled human serum (DMEM medium) for 5 to 8 days before infection.
MDM were then exposed to HIV-1ADA (1 × 106 cpm RT activity/1 × 106 MDM) for 4 hours, washed, and then cultured in fresh DMEM medium. In coculture
experiments, infected MDM were harvested by cell scraping at day 1 postinfection and then replated on astrocytes. At 3-day intervals, 80%
of the total volume of medium was replaced. Aliquots of harvested
culture supernatant were stored at  70°C until use.
Reverse transcriptase (RT) assay.
The RT assay was performed as described previously.54
Briefly, harvested culture supernatants were diluted with an equal volume of Tris buffer (pH 7.8)/0.05% Triton X-100, and then duplicate diluted samples were incubated with a solution containing poly (rA)
(Pharmacia LKB, Piscataway, NJ), oligo (dT) (Pharmacia LKB), MgCl2, and 3H-labeled dTTP (NEN, Boston, MA)
for 2 hours at 37°C. Finally, 10% trichloracetic acid (TCA) was
added to each sample, and samples were transferred to glass-fiber
filters (Wallac, Turku, Finland) and counted on a beta scintillation
counter (Pharmacia LKB).
RNA isolation and RT-polymerase chain reaction (PCR).
Total cellular RNA was isolated with Ultraspec RNA (Biotecx, Houston,
TX) according to the manufacturer's instructions. Levels of iNOS mRNA
were determined using a semiquantitative RT-PCR, as described
previously.55 After reverse transcription of 4 µg of each
RNA sample using random primers, each sample was subjected to PCR using
primers for -actin mRNA. On the basis of the amount of -actin PCR
product, aliquots of reverse transcriptase product representing
equivalent amounts of -actin cDNA were amplified using primers for
iNOS and again for -actin. PCR was performed in a reaction mixture
(50 µL) containing cDNA, 200 mmol/L each dNTP, 1 µCi
 -[32P]dCTP (3,000 Ci/mmol; NEN), 1 µmol/L each
primer, 5% dimethyl sulfoxide (DMSO; Sigma Chemical Co), and 2.5 U
AmpliTaq DNA polymerase (Perkin Elmer Cetus, Norwalk, CT) in reaction
buffer supplied by the manufacturer. Primers were designed to amplify a
459-bp product of human iNOS and a 577-bp product of human -actin.
The sense strand primer for iNOS was TGTGCCACCTCCAGTCCAGTGACA and the
antisense strand primer was GCTCATCTCCCGTCAGTTGGTAGG; the -actin
sense strand primer was ATCTGGCACCACACCTTCTACA and
GTTTCGTGGATGCCACAGGACT was the antisense strand primer. Amplifications
were performed in a thermocycler (GeneAmp PCR System 9600; Perkin Elmer
Cetus). After an initial denaturation step at 94°C for 3 minutes,
PCR proceeded with 25 or 35 amplification cycles (94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 45 seconds),
followed by an extension step at 72°C for 5 minutes. Aliquots of
each amplification were analyzed by electrophoresis on 7% acrylamide
(Long Ranger; AT Biochem, Malvern, PA) Tris-borate EDTA gels, followed
by autoradiography and quantitation by Phosphorimager (Molecular
Dynamics, Sunnyvale, CA). DNA sizes were determined using mobility
standards derived by T4 DNA polymerase end-labeling of Gel Marker DNA
(Research Genetics, Huntsville, AL). The cytokine-stimulated A172 cell
line (American Type Culture Collection, Rockville, MD) was used as a
positive control (PC) for human iNOS.50
Analysis of NO production.
NO production was assessed via measurement of nitrite in culture
supernatants by the Griess reaction.56 Fifty microliters of
culture supernatant was mixed with 100 µL of Griess reagent (Sigma
Chemical Co) containing 1% sulfanilamide and 0.1%
D-naphthylethylenediamine dihydrochloride in 2.5% phosphoric acid.
After 10 minutes, samples were read at 570 nm on an enzyme-linked
immunosorbent assay (ELISA) reader (ICN Biomedicals Inc, Costa Mesa,
CA). The sample concentration was determined by comparison against a
standard curve using sodium nitrite (Sigma Chemical Co).
Flow cytometric analysis.
For two-color staining of cell surface antigen and intracellular
antigen, a suspension of 1 × 106 cells was incubated
for 30 minutes at 4°C with a 1:5 dilution of phycoerythrin
(PE)-labeled anti-CD14 Ab (Becton Dickinson, San Jose, CA)
or PE-labeled mouse IgG and then washed two times with
phosphate-buffered saline (PBS). After fixation and permeabilization of
cells using Cytofix/Cytoperm (Pharmingen, San Diego, CA) for 20 minutes
at 4°C, cells were blocked with Perm/Wash solution (Pharmingen)
containing normal mouse serum, normal rabbit serum, and AlbuMax I (Life
Technologies, Inc) and then incubated with a 1:1,000 dilution of
anti-iNOS Ab (Calbiochem-Novabiochem Co) or normal rabbit serum in
Perm/Wash solution containing AlbuMax I for 60 minutes at room
temperature. After washing with Perm/Wash solution, anti-iNOS Ab was
detected with a goat F(ab') antirabbit IgG conjugated to
fluorescein isothiocyanate (FITC; Boehringer Mannheim Co,
Indianapolis, IN) at a 1:50 dilution. For two-color staining of
intracellular antigens, cells were fixed and permealized by
Cytofix/Cytoperm, blocked, and then incubated with a 1:20 dilution of
anti-GFAP Ab (Boehringer Mannheim Co) or normal mouse IgG in Perm/Wash
solution containing AlbuMax I for 60 minutes at room temperature.
Anti-GFAP Ab was followed by detection with a goat F(ab')
antimouse IgG conjugated to PE (Immunotech International, Westbrook,
ME). After washing three times with Perm/Wash solution, cells were
incubated with anti-iNOS Ab or normal rabbit serum for 60 minutes at
room temperature, followed by detection with a goat F(ab')
antirabbit IgG conjugated to FITC. Finally, stained cells were
resuspended in PBS and analyzed in a flow cytometer (Becton Dickinson).
Cytokine assays.
All cytokines were quantitated using ELISA kits purchased from
Immunotech International. Sensitivities of the kits are 0.08 IU/mL for
interferon- (IFN-), 5 pg/mL for interleukin-1 (IL-1), and 5 pg/mL for tumor necrosis factor- (TNF-).
| |
RESULTS |
Production of NO and expression of iNOS occurs in cocultures of
HIV-1-infected MDM and human astrocytes.
It has previously been reported that HIV-1 infection induces iNOS
expression with subsequent low level NO production by human macrophages.41 However, we did not detect NO in
HIV-1-infected macrophages at levels greater than those present in
uninfected control MDM when MDM were infected with HIV-1 and monitored
in culture for 30 days (Fig 1A). Because NO
production is reported to be enhanced when infected macrophages are
cocultured with astrocytes,41 we also examined levels of NO
production in cocultures of HIV-1 infected MDM and primary human fetal
(HFA) or adult (HAA) astrocytes. As shown in Fig 1A, production of NO
in cocultures, measured as the concentration of nitrite in culture
supernatants, occurred at levels approximately 10-fold in excess of
control levels. RT-PCR analysis showed that iNOS is expressed in
cocultures between days 15 and 21 postinfection (Fig 1B). However,
expression was not observed in either MDM or astrocytes cultured alone
or in cocultures of uninfected MDM and astrocytes (Fig 1C), suggesting
that the presence of both infected MDM and astrocytes is required for
induction of iNOS.
View larger version (28K):
[in this window]
[in a new window]
| Fig 1.
NO is produced and iNOS is expressed in cocultures of
HIV-1-infected MDM and human astrocytes. (A) MDM precultured for 7 days in DMEM medium were infected with HIV-1ADA. At day 1 postinfection, infected MDM were cocultured with HFA and HAA at a 2:3
ratio and were fed with fresh DMEM medium every 3 days. Nitrite was
measured in culture supernatants by the Griess reaction. Each bar
represents the mean ± SD in triplicate samples of supernatants. (B)
Levels of iNOS mRNA in cocultures with infected MDM and astrocytes were
analyzed by RT-PCR. Amplification cycles used were 35 cycles for iNOS
and 25 cycles for -actin. The cytokine-stimulated A172 cell line was
used as a positive control. Days after infection are shown above the
lanes. (C) Results of the RT-PCR analysis of different cultures at day
18 postinfection are presented. Lane 1, positive control (PC); lane 2, uninfected MDM; lane 3, infected MDM; lane 4, HFA; lane 5, HAA; lane 6, HFA cocultured with uninfected MDM; lane 7, HAA cocultured with
uninfected MDM; lane 8, HFA cocultured with infected MDM; lane 9, HAA
cocultured with infected MDM.
|
|
Induction of iNOS occurs in astrocytes, but not in MDM.
The expression of iNOS has been previously demonstrated in both human
macrophages and astrocytes.41,44,48-52 Therefore, we wanted
to clarify whether infected MDM, astrocytes, or both cells produce iNOS
in our coculture system. Cocultured cells were harvested at day 18 postinfection and then stained with antibodies for CD14, GFAP, and iNOS
using an intracellular antigen detection method. We found that 85% to
95% of MDM stained positive for CD14 and 70% to 80% of primary
astrocytes were GFAP positive by flow cytometric analysis, whereas more
than 95% of the astrocytes were positive for GFAP by
immunohistochemistry. As shown in Fig 2,
iNOS was detected in cells that were CD14 and
GFAP+, suggesting that astrocytes, but not MDM, expressed
iNOS.
View larger version (39K):
[in this window]
[in a new window]
| Fig 2.
Cells producing iNOS in cocultures are astrocytes but not
MDM. MDM precultured for 7 days in DMEM medium were infected with
HIV-1ADA. At day 1 postinfection, infected MDM were
cocultured with HFA and were fed with fresh DMEM medium every 3 days.
At day 21 postinfection, cells were stained with antibodies for CD14,
GFAP, and iNOS using an intracellular antigen detection method and
analyzed using a flow cytometer.
|
|
Coculture supernatants induce iNOS in astrocytes.
Because coculture of HIV-infected MDM with human astrocytes induced
iNOS expression in astrocytes, we next determined whether culture
supernatants could mediate this effect. Human fetal astrocytes were
incubated with or without various culture supernatants for 7 days, and
iNOS expression was determined by RT-PCR. As shown in
Fig 3, only supernatants obtained from
cocultures of infected MDM and astrocytes harvested 18 to 21 days
postinfection induced iNOS expression in astrocytes; iNOS expression
was not observed in astrocytes incubated with coculture supernatants
harvested 3 to 6 days postinfection, when little RT activity could be
detected. Furthermore, elevations of RT activity or iNOS expression
could not be detected when astrocytes were directly exposed to
HIV-1ADA in the same manner as MDM. Thus, HIV-1 does not
directly induce iNOS expression in primary astrocytes. These data
therefore suggest that HIV-infected MDM, and not HIV alone, are
responsible for induction of iNOS in astrocytes; that soluble cell- or
virus-derived factors are capable of mediating this effect; and that
threshold levels of these factors are required for iNOS induction.
View larger version (36K):
[in this window]
[in a new window]
| Fig 3.
Coculture supernatant induces iNOS in astrocytes. Total
RNA was extracted from MDM/HFA cocultures at day 18 postinfection and
from HFA cultures incubated for 7 days with different supernatants.
Levels of iNOS mRNA in HFA were analyzed by RT-PCR. The
cytokine-stimulated A172 cell line was used as a positive control. Lane
1, positive control; lane 2, HFA; lane 3, HFA cocultured with
uninfected MDM; lane 4, HFA cocultured with infected MDM; lane 5, HFA
incubated with HIV-1; lane 6, HFA incubated with day 18 to 21 supernatant of uninfected MDM culture; lane 7, HFA incubated with day
18 to 21 supernatant of infected MDM culture; lane 8, HFA incubated
with day 18 to 21 supernatant of coculture with uninfected MDM and HFA;
lane 9, HFA incubated with day 3 to 6 supernatant of coculture with
infected MDM and HFA; lane 10, HFA incubated with day 18 to 21 supernatant of coculture with infected MDM and HFA.
|
|
HIV gp41 induces iNOS in astrocytes when MDM are present.
Because the HIV-1 envelope proteins gp120 and gp41 have been reported
to induce NO production in macrophage and mixed glial cell
cultures,43-45 we tested the ability of rgp120 and rgp41 to induce iNOS expression in human astrocytes. The recombinant protein preparations used had previously been shown to have biological activity
in similar in vitro cell culture systems.45,57 As shown in
Fig 4A, neither rgp120 nor rgp41 induced
iNOS in cultures of astrocytes or MDM alone (lanes 3, 7, and 15).
However, when uninfected MDM were present in culture with astrocytes,
rgp41 induced iNOS expression, whereas rgp120 did not (Fig 4A, lanes 11 and 12). NO was also detected when rgp41 was added to cocultures of
uninfected MDM and astrocytes (Fig 4B). When tested using a Limulus Amebocyte Lysate assay, endotoxin was not detected in the rgp41 preparation. Furthermore, anti-gp41 antibody or a competitive inhibitor of NOS, L-NMMA, reversed NO production mediated by rgp41. Taken together, these data suggest that gp41 is required, but not
sufficient, for induction of iNOS in astrocytes (Fig 4B).
View larger version (35K):
[in this window]
[in a new window]
| Fig 4.
iNOS is induced by gp41 in cocultures of uninfected MDM
and astrocytes. (A) Levels of iNOS mRNA were analyzed by RT-PCR. Total
RNA was extracted from MDM, HFA, and HAA cultures or cocultures
incubated for 7 days with rgp41 (10 ng/mL) and rgp120 (10 ng/mL). Total
RNA from cells stimulated by cytokine mixture containing IFN (10 ng/mL), IL-1 (100 ng/mL), and TNF- (100 ng/mL) was extracted
after 8 hours of treatment. The cytokine-stimulated A172 cell line was
used as a positive control. Cells are shown above the lanes. Lane 1, positive control; lanes 2, 6, 10, 14, and 18, no treatment; lanes 3, 7, 11, 15, and 19, treatment with rgp41; lanes 4, 8, 12, 16, and 20, treatment with rgp120; lanes 5, 9, 13, 17, and 21, treatment with
cytokine mixture. (B) HFA were cocultured with uninfected MDM in the
presence and absence of rgp41 (10 ng/mL), anti-gp41 Ab (1 mg/mL), and
L-NMMA (500 µmol/L) for 9 days. At 3-day intervals, cultures were fed
with fresh DMEM medium, and rgp41, L-NMMA and anti-gp41 Ab were
replenished. Nitrite in culture supernatants at day 9 was measured by
the Griess reaction. Each bar represents the mean ± SD in triplicate
samples of supernatants.
|
|
Stimulation of astrocytes with IFN, IL-1, and TNF- can also
induce iNOS expression (Fig 4 and previous
studies48-52). Therefore, we tested
supernatants from cocultures of HIV-1-infected MDM and astrocytes for
the presence of these cytokines by ELISA. As shown in
Table 1, IFN, IL-1, and TNF- were
not detected, suggesting that these cytokines are not involved in the
induction of iNOS in our coculture system.
NO inhibits HIV-1 replication in MDM. Our data thus far demonstrated
that HIV-1 induces iNOS expression and NO production in human
astrocytes through a mechanism that involves the gp41 envelope protein
and requires the presence of MDM. Because NO exhibits antiviral
activity in rodent and other human systems,29-36,39,40 we
studied the anti-HIV-1 activity of NO using the NO-donor compound, SNAP. HIV-1ADA was incubated with or without SNAP for 3 hours and then MDM were infected with non-SNAP-treated and
SNAP-treated viruses. MDM infected with nontreated virus were cultured
in the presence and absence of SNAP. As shown in
Fig 5, SNAP inhibited virus replication in
MDM in a dose-dependent manner when added after adsorption. In
addition, the pretreatment of virus with 1 mmol/L SNAP had no effect on
the ability of virus to infect MDM (Fig 5), and this reagent had no
effect on RT activity at any dose when purified virus was incubated
directly with SNAP for 3 days (data not shown). MDM viabilities were
greater than 98% after 4 weeks of culture in the presence and absence
of SNAP as determined by the MTT
(3-[4,5-dimethylthiozol-2-yl]-2,5-diphenyltetrazolium bromide) cell
viability assay. These findings suggest that NO generated by SNAP is
neither virucidal nor cytotoxic for MDM.
View larger version (27K):
[in this window]
[in a new window]
| Fig 5.
NO inhibits HIV-1 replication in MDM.
HIV-1ADA was incubated with or without SNAP for 3 hours and
then MDM was precultured for 7 days in DMEM medium were infected with
non-SNAP-treated and SNAP-treated viruses. MDM infected with
nontreated virus were maintained in the presence and absence of SNAP.
Cultures were fed with fresh DMEM medium and SNAP was replenished every
3 days. Data are representative of three experiments and reflect the
average levels of RT activity present in duplicate samples of
supernatants, which differed by not more than 15%.
|
|
Our recent studies show that human astrocytes can also suppress HIV-1
replication in MDM via production of a soluble factor(s) (Hori et al,
manuscript submitted). Therefore, we examined the effect
of the NO inhibitor, L-NMMA, on cocultures of infected MDM and
astrocytes to confirm that NO plays a role in astrocyte-mediated inhibition of HIV replication. As shown in
Fig 6, virus replication, as measured by RT
activity, was substantially decreased when infected MDM were cocultured
with astrocytes. Inclusion of L-NMMA in the cocultures partially
reversed the suppressive effect of astrocytes, suggesting that NO is,
at least in part, responsible for the suppressive effect of astrocytes
on HIV-1 replication in MDM.
View larger version (19K):
[in this window]
[in a new window]
| Fig 6.
A NOS inhibitor partially reverses the HIV-1 suppressive
effect of astrocytes. MDM precultured for 7 days in DMEM medium were
infected with HIV-1ADA. At day 1 postinfection, infected
MDM were cocultured with HAA at a 2:3 ratio. Cocultures were fed with
fresh DMEM medium with or without L-NMMA (500 µmol/L) every 3 days.
Data are representative of two experiments and reflect the average
levels of RT activity present in duplicate samples of supernatants,
which differed by not more than 15%.
|
|
| |
DISCUSSION |
In this study, we have shown that HIV-1 induces iNOS/NO expression in
human astrocytes when cocultured with MDM by a mechanism involving gp41
and perhaps other soluble factors. We also showed that
astrocyte-derived NO exerts antiviral activity through inhibition of
virus replication in infected MDM. Thus, human astrocytes can regulate
HIV-1 replication through the effects of NO in vitro and
astrocyte-derived NO may influence the viral burden in the brain in
vivo. Our study also suggests that the astrocyte may be an important,
potent source of high level, unregulated NO production during HIV
infection in the brain, which, in turn, raises the possibility that
astrocyte-derived NO may mediate neural toxicity during HIV infection.
It was previously reported that HIV-1 infection induced low-level iNOS
expression and NO production in human macrophages from 4 of 6 donors
tested.41 We detected neither iNOS expression nor NO
production after HIV-1 infection of MDM obtained from 7 normal donors.
However, we found induction of iNOS in human fetal and adult
astrocytes, but not macrophages, upon coculture of these primary
astrocytes with HIV-1-infected human MDM. The issue regarding iNOS
expression in human macrophages has been controversial for many years.
Although we do not deny the ability of human macrophages to produce
iNOS, its induction in human MDM appears to be highly restricted and
further studies are necessary to determine the optimal conditions
required for induction. The fact that RNA encoding iNOS could be
detected in brain tissues from AIDS patients with severe neurological
disease41,45 indicates that NO may be involved in
neurologic AIDS and stresses the importance of identifying cells
expressing iNOS in vivo.
Consistent with a previous report that gp41 induces iNOS in primary
cultures of mixed rat neuronal and glial cells,45 we found
that rgp41 also induces iNOS expression in cocultures of human MDM and
astrocytes. However, rgp41 could not directly stimulate astrocytes to
produce iNOS in the absence of uninfected MDM, but could when
supplemented with the MDM. NO, as measured by nitrite production, was
detected 6 days after rgp41 stimulation, which indicates that some
intermediate event is required. Although IFN, IL-1, and TNF-
are known to induce iNOS, production of these cytokines could not be
detected in coculture supernatants and could therefore not account for
iNOS induction. This suggests that an additional unidentified factor(s)
may be involved in the induction of iNOS in astrocytes and that
macrophages may regulate their expression after interaction with the
HIV-1 gp41 envelope protein. Efforts are underway to identify the
factor(s) resulting from the interaction between MDM and astrocytes and
to clarify the molecular mechanisms by which gp41 induces iNOS in astrocytes.
Our studies thus far have demonstrated that NO inhibits HIV-1
replication in MDM without directly killing the virus. The diverse biological effects of NO are known to result from its interactions with
target proteins that contain metals or thiols strategically located at
either allosteric or active sites.23 These target proteins
include ion channels, transporters, enzymes, G proteins, and
transcription factors. Among them, NF- B is the one most frequently associated with HIV-1 replication.58 NO can directly
inhibit DNA binding to NF-B by S-nitrosylation of the cysteine-62
residue of the p50 subunit.59 However, the effect of NO on
NF-B activation differs with the system under investigation. Lander
et al60,61 found that NO-donor compounds induce NF-B
translocation via G protein activation in PBMC. In contrast, others
found that NO-donor compounds inhibit cytokine-induced NF-B
activation through stabilization and increased expression of
IkB.62,63 Recently, Togashi et al64 have
shown that NF-B activation is inhibited in Jurkat cells by
pyrrolidine dithiocarbamate, an inhibitor of NF-B and a scavenger of
NO, but is induced in astrocytes that have higher levels of
constitutive NOS and p50. Intriguingly, Ouaaz et al46 have
reported that CD23/Fc RII-mediated NO production induces HIV-1
expression in U1 cells with low-level constitutive production of p24,
whereas virus replication is decreased in another variant of U1 with
high constitutive production of p24 levels. Thus, the paradoxical
actions of NO are likely to be dependent on a given biological model.
The pathogenesis of HIV-1-associated cognitive/motor complex is
complicated and not well understood. In this study, we have shown that
HIV-1-infected MDM stimulate human astrocytes to express iNOS in vitro
via a mechanism involving gp41 and another as yet unidentified
factor(s). Because gp41, unlike gp120, is a membrane-anchored protein,
it is conceivable that free virions with exposed gp41 could stimulate
astrocytes in vivo. In addition, our observation that NO inhibits HIV-1
replication in MDM, coupled with the fact that neurons and
oligodendrocytes are generally more susceptible to the effects of NO
than astrocytes and microglia,65,66 may explain the
discrepancy between disease severity and viral burden in the brain.
Furthermore, it is possible that the manifestations of neurologic
HIV-disease attributable to NO are actually a side effect of the host
attempt to inhibit virus replication.
| |
ACKNOWLEDGMENT |
The authors thank Drs Eugene Major and Katherine Conant for providing
human fetal astrocytes and Dr Kathryn Carbone and Steven Rubin for
providing human adult astrocytes. We also thank Dr Finbarr Murphy for
endotoxin testing of rgp41 and Drs Kathryn Carbone and Eda Bloom for
critical reading of this manuscript.
| |
FOOTNOTES |
Submitted August 31, 1998; accepted December 28, 1998.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
This is a US government work. There are no restrictions on its use.
Address reprint requests to Kathleen A. Clouse, PhD, FDA/CBER/Division
of Cytokine Biology (HFM-508), 1401 Rockville Pike, Rockville, MD
20852; e-mail: clouse{at}cber.fda.gov.
| |
REFERENCES |
1.
Atwood WJ, Berger J, Kaderman R, Tornatore CS, Major EO:
Human immunodeficiency virus type 1 infection of the brain.
Clin Micobiol Rev
6:339, 1993[Abstract/Free Full Text]
2.
Gendelman HE, Lipton SA, Tardieu M, Bukrinsky MI, Nottet HSLM:
The neuropathogenesis of HIV-1 infection.
J Leukoc Biol
56:389, 1994[Abstract]
3.
Glass JD, Johnson RT:
Human immunodeficiency virus and the brain.
Annu Rev Neurosci
19:1, 1996[Medline]
[Order article via Infotrieve]
4.
Sotrel A, Multani P:
Pathology of the nervous system in HIV-infected patients, in
Wormser GP
(ed):
AIDS and Other Manifestations of HIV Infection. New York, NY, Raven, 1992, p 543.
5.
Koenig S, Gendelman HE, Orenstein JM:
Detection of AIDS virus in macrophages in brain tissue from AIDS patients with encephalopathy.
Science
233:1089, 1986[Abstract/Free Full Text]
6.
Wiley CA, Schrier RD, Nelson JA, Lampert PW, Oldstone MB:
Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients.
Proc Natl Acad Sci USA
83:7089, 1986[Abstract/Free Full Text]
7.
Brack-Werner R, Kleinschmidt A, Ludbigsen A:
Infection of human brain cells by HIV-1: Restricted virus production in chronically infected glial cell lines.
AIDS
6:273, 1992[Medline]
[Order article via Infotrieve]
8.
Saito Y, Sharer L, Epstein L, Michaels J, Mintz M, Lowder M, Golding K, Cvetkovich T, Blumberg B:
Overexpression of nef as a marker for restricted HIV-1 infection of astrocytes in postmortem pediatric central nervous tissues.
Neurology
44:474, 1994[Abstract/Free Full Text]
9.
Tornatore C, Chandra R, Berger JR, Major EO:
HIV-1 infection of subcortical astrocytes in the pediatric central nervous system.
Neurology
44:481, 1994[Abstract/Free Full Text]
10.
Ranki A, Nyberg M, Ovod V, Haltia M, Elovaara I, Raininko R, Haapasalo H, Krohn K:
Abundant expression of HIV Nef and Rev proteins in brain astrocytes in vivo is associated with dementia.
AIDS
9:1001, 1995[Medline]
[Order article via Infotrieve]
11.
Takahashi K, Wesselingh SL, Griffin DE, McArthur JC, Johnson RT, Glass JD:
Localization of HIV-1 in human brain using polymerase chain reaction/in situ hybridization and immunocytochemistry.
Ann Neurol
39:705, 1996[Medline]
[Order article via Infotrieve]
12.
Resnick L, Berger JR, Shapshak P, Tourtellotte WW:
Early penetration of the blood-brain barrier by HIV.
Neurology
38:9, 1988[Abstract/Free Full Text]
13.
Davis LE, Hjelle BL, Miller VE, Palmer DL, Llewelly AL, Merlin TL, Young SA, Mills RG, Wachsman W, Wiley CA:
Early viral brain invasion in iatrogenic human immunodeficiency virus infection.
Neurology
42:1736, 1992[Abstract/Free Full Text]
14.
Portegies P, Epstein LG, Hung STA, de Grans J, Goudsmit J:
Human immunodeficiency virus type 1 antigen in cerebrospinal fluid.
Arch Neurol
46:261, 1989[Abstract/Free Full Text]
15.
Pang S, Koyanagi Y, Miles S, Wiley C, Vinters HV, Chen IS:
High levels of unintegrated HIV-1 DNA in brain tissue of AIDS dementia patients.
Nature
343:85, 1990[Medline]
[Order article via Infotrieve]
16.
Wiley CA, Achim C:
Human immunodeficiency virus encephalitis is the pathological correlate of dementia in acquired immunodeficiency syndrome.
Ann Neurol
36:673, 1994[Medline]
[Order article via Infotrieve]
17.
Johnson RT, Glass JD, McArthur JC, Chesebro BW:
Quantitation of human immunodeficiency virus in brains of demented and nondemented patients with acquired immunodeficiency syndrome.
Ann Neurol
39:392, 1994
18.
Bernton EW, Bryant HU, Decoster MA, Orenstein JM, Ribas JL, Meltzer MS, Gendelman HE:
No direct neuronotoxicity by HIV-1 virions or culture fluids from HIV-1-infected T cells or monocytes.
AIDS Res Hum Retroviruses
8:495, 1992[Medline]
[Order article via Infotrieve]
19.
Tardieu M, Hery C, Peudenier S, Boespflug O, Montagnier L:
Human immunodeficiency virus type 1-infected monocytic cells can destroy human neuronal cells after cell-to-cell adhesion.
Ann Neurol
32:11, 1992[Medline]
[Order article via Infotrieve]
20.
Petito CK, Vecchio D, Chen Y-T:
HIV antigen and DNA in AIDS spinal cords correlate with macrophage infiltration but not with vacuolar myelopathy.
J Neuropathol Exp Neurol
53:86, 1994[Medline]
[Order article via Infotrieve]
21.
Yoshioka M, Shapshak P, Srivastava AK, Stewart RV, Nelson SJ, Bradley WG, Berger JR, Rhodes RH, Sun NC, Nakamura S:
Expression of HIV-1 and interleukin-6 in lumbosacral dorsal root ganglia of patients with AIDS.
Neurology
44:1120, 1994[Abstract/Free Full Text]
22.
Nathan C:
Nitric oxide as a secretory product of mammalian cells.
FASEB J
6:3051, 1992[Abstract]
23.
Stamler JS:
Redox signaling: Nitrosylation and related target interactions of nitric oxide.
Cell
78:931, 1994[Medline]
[Order article via Infotrieve]
24.
Synder SH:
Nitric oxide: First in a new class of neurotransmitters?
Science
257:494, 1992[Free Full Text]
25.
Lipton SA, Choi Y-B, Pan Z-H, Lei SZ, Chen H-SV, Sucher NJ, Loscalzo J, Singel DJ, Stamler JS:
A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds.
Nature
364:626, 1993[Medline]
[Order article via Infotrieve]
26.
Dawson VL, Dawson TM, Bartley DA, Uhl GR, Snyder SH:
Mechanisms of nitric oxide-mediated neurotoxicity in primary brain cultures.
J Neurosci
13:2651, 1993[Abstract]
27.
Hewett SJ, Csernansky CA, Choi DW:
Selective potentiation of NMDA-induced neuronal injury following induction of astrocytic iNOS.
Neuron
13:487, 1994[Medline]
[Order article via Infotrieve]
28.
Bonfoco E, Krainc D, Ankarcrona M, Nicotera P, Lipton SA:
Apoptosis and necrosis: Two distinct events induced, respectively, by mild and intense insults with N-methyl-D-aspartate or nitric oxide/superoxide in cortical cell culture.
Proc Natl Acad Sci USA
92:7162, 1995[Abstract/Free Full Text]
29.
Croen KD:
Evidence for an antiviral effect of nitric oxide. Inhibition of herpes simplex virus type 1 replication.
J Clin Invest
91:2446, 1993
30.
Karupiah G, Xie Q-w, Buller RML, Nathan C, Duarte C, MacMicking JD:
Inhibition of virus replication by interferon-induced nitric oxide synthase.
Science
261:1445, 1993[Abstract/Free Full Text]
31.
Mêlková Z, Esteban M:
Inhibition of vaccinia virus DNA replication by inducible expression of nitric oxide synthase.
J Immunol
155:5711, 1995[Abstract]
32.
Bi Z, Reiss CS:
Inhibition of vesicular stomatitis virus infection by nitric oxide.
J Virol
69:2208, 1995[Abstract]
33.
Akarid K, Sinet M, Desforges B, Gougerot-Pocidalo MA:
Inhibitory effect of nitric oxide on the replication of a murine retrovirus in vitro and in vivo.
J Virol
69:7001, 1995[Abstract]
34.
Lowenstein CJ, Hill SL, Lafond-Walker A, Wu J, Allen G, Landavere M, Rose NR, Herskowitz A:
Nitric oxide inhibits viral replication in murine myocarditis.
J Clin Invest
97:1837, 1996[Medline]
[Order article via Infotrieve]
35.
Lin Y-L, Huang Y-L, Ma S-H, Yeh C-T, Chiou S-Y, Chen L-K, Liao C-L:
Inhibition of Japanese encephalitis virus infection by nitric oxide: Antiviral effect of nitric oxide on RNA virus replication.
J Virol
71:5227, 1997[Abstract]
36.
Lane TE, Paoletti AD, Buchmeier MJ:
Disassociation between in vitro and in vivo effects of nitric oxide on a neurotropic murine coronavirus.
J Virol
71:2202, 1997[Abstract]
37.
Denis M:
Human monocytes/macrophages: NO or no NO?
J Leukoc Biol
55:682, 1994[Abstract]
38. Dugas B, Mossalayi MD, Damais C, Kolb J-P: Nitric oxide
production by human monocytes: Evidence for a role of CD23. 16:574,
1995
39.
Mannick JB, Asano K, Izumi K, Kieff E, Stamler JS:
Nitric oxide produced by human B lymphocytes inhibits apoptosis and Epstein-Barr virus reactivation.
Cell
79:1137, 1994[Medline]
[Order article via Infotrieve]
40.
Sharara AI, Perkins DJ, Misukonis MA, Chan SU, Dominitz JA, Weinberg JB:
Interferon (IFN) activation of human blood mononuclear cells in vitro and in vivo for nitric oxide synthase (NOS) type 2 mRNA and protein expression: Possible relationship of induced NOS2 to the anti-hepatitis C effects of IFN in vivo.
J Exp Med
186:1495, 1997[Abstract/Free Full Text]
41.
Bukrinsky MI, Nottet HSLM, Schmidtmayerova H, Dubrovsky L, Flanagan CR, Mullins ME, Lipton SA, Gendelman HE:
Regulation of nitric oxide synthase activity in human immunodeficiency virus type 1 (HIV-1)-infected monocytes: Implications for HIV-associated neurological disease.
J Exp Med
181:735, 1995[Abstract/Free Full Text]
42.
Mollace V, Colasanti M, Persichini T, Bagetta G, Lauro GM, Nistico G:
HIV gp120 glycoprotein stimulates the inducible isoform of NO synthase in human cultured astrocytoma cells.
Biochem Biophys Res Commun
194:439, 1993[Medline]
[Order article via Infotrieve]
43.
Pietraforte D, Tritarelli E, Testa U, Minetti M:
gp120 HIV envelope glycoprotein increases the production of nitric oxide in human monocyte-derived macrophages.
J Leukoc Biol
55:175, 1994[Abstract]
44.
Koka P, He K, Zack JA, Kitchen S, Peacock W, Fried I, Tran T, Yashar SS, Merrill JE:
Human immunodeficiency virus 1 envelope proteins induce interleukin 1, tumor necrosis factor , and nitric oxide in glial cultures derived from fetal, neonatal, and adult human brain.
J Exp Med
182:941, 1995[Abstract/Free Full Text]
45.
Adamson DC, Wildemann B, Sasaki M, Glass JD, McArthur JC, Christov VI, Dawson TM, Dawson VL:
Immunologic NO synthase: Elevation in severe AIDS dementia and induction by HIV-1 gp41.
Science
274:1917, 1996[Abstract/Free Full Text]
46.
Ouaaz F, Ruscetti FW, Digas B, Mikovits J, Agut H, Debré P, Mossalayi MJ:
Role of IgE immune complexes in the regulation of HIV-1 replication and increased cell death of infected U1 monocytes: Involvement of CD23/FceRII-mediated nitric oxide and cyclic AMP pathways.
Mol Med
2:38, 1996[Medline]
[Order article via Infotrieve]
47.
Nuovo GJ, Alfieri ML:
AIDS dementia is associated with massive, activated HIV-1 infection and concomitant expression of several cytokines.
Mol Med
2:358, 1996[Medline]
[Order article via Infotrieve]
48.
Lee SC, Dickson DW, Liu W, Brosnan CF:
Induction of nitric oxide synthase activity in human astrocytes by interleukin-1 and interferon.
J Neuroimmunol
46:19, 1993[Medline]
[Order article via Infotrieve]
49.
Brosnan CF, Battistini L, Raine CS, Dickson DW, Casadevall A, Lee SC:
Reactive nitrogen intermediates in human neuropathology: An overview.
Dev Neurosci
16:152, 1994[Medline]
[Order article via Infotrieve]
50.
Fujisawa H, Ogura T, Hokari A, Weisz A, Yamashita J, Esumi H:
Inducible nitric oxide synthase in a human glioblastoma cell line.
J Neurochem
64:85, 1995[Medline]
[Order article via Infotrieve]
51.
Janabi N, Chabrier S, Tardieu M:
Endogenous nitric oxide activates prostaglandin F2a production in human microglial cells but not in astrocytes. A study of interactions between eicosanoids, nitric oxide, and superoxide anion (O2) regulatory pathways.
J Immunol
157:2129, 1996[Abstract]
52.
Ding M, St Pierre BA, Parkinson JF, Medberry P, Wong JL, Rogers NE, Ignarro LJ, Merrill JE:
Inducible nitric-oxide synthase and nitric oxide production in human fetal astrocytes and microglia.
J Biol Chem
272:11327, 1997[Abstract/Free Full Text]
53.
Gruber MF, Weih KA, Boone EJ, Smith PD, Clouse KA:
Endogenous macrophage CSF production is associated with viral replication in HIV-1-infected human monocyte-derived macrophages.
J Immunol
154:5528, 1995[Abstract]
54.
Hori K, Hatfield D, Maldarelli F, Lee BJ, Clouse KA:
Selenium supplementation suppresses tumor necrosis factor -induced human immunodeficiency virus type 1 replication in vitro.
AIDS Res Hum Retroviruses
13:1325, 1997[Medline]
[Order article via Infotrieve]
55.
Burd PR, Thompson WC, Max EE, Mills FC:
Activated mast cells produce interleukin 13.
J Exp Med
181:1373, 1995[Abstract/Free Full Text]
56.
Green SJ, Nacy CA:
Antimicrobial and immunopathologic effects of cytokine-induced nitric oxide synthase.
Curr Opin Infect Dis
6:384, 1993
57.
Clouse KA, Cosentino LM, Weih KA, Pyle SW, Robbins PB, Hochstein HD, Natarajan V, Farrar WL:
The HIV-1 gp120 envelope protein has the intrinsic capacity to stimulate monokine secretion.
J Immunol
147:2892, 1991[Abstract]
58.
Griffin GE, Leung K, Folks TM, Kunkel S, Nabel GJ:
Activation of HIV gene expression during monocyte differentiation by induction of NF-kB.
Nature
339:70, 1989[Medline]
[Order article via Infotrieve]
59.
Matthews JR, Botting CH, Panico M, Morris HR, Hay RT:
Inhibition of NF-kB DNA binding by nitric oxide.
Nucleic Acids Res
24:2236, 1996[Abstract/Free Full Text]
60.
Lander HM, Sehajpal P, Levine DM, Novogrodsky A:
Activation of human peripheral blood mononuclear cells by nitric oxide-generating compounds.
J Immunol
150:1509, 1993[Abstract]
61.
Lander HM, Sehajpal PK, Novogrodsky A:
Nitric oxide signaling: A possible role for G proteins.
J Immunol
151:7182, 1993[Abstract]
62.
Peng H-B, Libby P, Liao JK:
Induction and stabilization of IkBa by nitric oxide mediates inhibition of NF-kB.
J Biol Chem
270:14214, 1995[Abstract/Free Full Text]
63.
Colasanti M, Persichini T, Menegazzi M, Mariotto S, Giordano E, Caldarera CM, Sogos V, Lauro GM, Suzuki H:
Induction of nitric oxide synthase mRNA expression.
J Biol Chem
270:26731, 1995[Abstract/Free Full Text]
64.
Togashi H, Sasaki M, Frohman E, Taira E, Ratan R, Dawson TM, Dawson VL:
Neuronal (type I) nitric oxide synthase regulates nuclear factor kB activity and immunologic (type II) nitric oxide synthase expression.
Proc Natl Acad Sci USA
94:2676, 1997[Abstract/Free Full Text]
65.
Merrill JE, Ignarro LJ, Sherman MP, Melinek J, Lane TE:
Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide.
J Immunol
151:2132, 1993[Abstract]
66.
Mitrovic B, Ignarro LJ, Montestruque S, Smoll A, Merrill JE:
Nitric oxide as a potential pathological mechanism in demyelination: Its differential effects on primary glial cells in vitro.
Neuroscience
61:575, 1994[Medline]
[Order article via Infotrieve]
This is a US government work. There are no restrictions on its use.
0006-4971/99/9306-0035$0.00/0
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
H. Dou, K. Birusingh, J. Faraci, S. Gorantla, L. Y. Poluektova, S. B. Maggirwar, S. Dewhurst, H. A. Gelbard, and H. E. Gendelman
Neuroprotective Activities of Sodium Valproate in a Murine Model of Human Immunodeficiency Virus-1 Encephalitis
J. Neurosci.,
October 8, 2003;
23(27):
9162 - 9170.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Liu, M. Jana, S. Dasgupta, S. Koka, J. He, C. Wood, and K. Pahan
Human Immunodeficiency Virus Type 1 (HIV-1) Tat Induces Nitric-oxide Synthase in Human Astroglia
J. Biol. Chem.,
October 11, 2002;
277(42):
39312 - 39319.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Speth, T. Schabetsberger, I. Mohsenipour, G. Stockl, R. Wurzner, H. Stoiber, C. Lass-Florl, and M. P. Dierich
Mechanism of Human Immunodeficiency Virus-Induced Complement Expression in Astrocytes and Neurons
J. Virol.,
March 7, 2002;
76(7):
3179 - 3188.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Mollace, D. Salvemini, D. P. Riley, C. Muscoli, M. Iannone, T. Granato, L. Masuelli, A. Modesti, D. Rotiroti, R. Nistico, et al.
The contribution of oxidative stress in apoptosis of human-cultured astroglial cells induced by supernatants of HIV-1-infected macrophages
J. Leukoc. Biol.,
January 1, 2002;
71(1):
65 - 72.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Dickie, A. Roberts, and R. Lee
A defect in HIV-1 transgenic murine macrophages results in deficient nitric oxide production
J. Leukoc. Biol.,
October 1, 2001;
70(4):
592 - 600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. HOWIE, R. RAMAGE, and T. HEWSON
Innate Immune System Damage in Human Immunodeficiency Virus Type 1 Infection . Implications for Acquired Immunity and Vaccine Design
Am. J. Respir. Crit. Care Med.,
October 1, 2000;
162(4):
S141 - 145.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Furuke, P. R. Burd, J. A. Horvath-Arcidiacono, K. Hori, H. Mostowski, and E. T. Bloom
Human NK Cells Express Endothelial Nitric Oxide Synthase, and Nitric Oxide Protects Them from Activation-Induced Cell Death by Regulating Expression of TNF-{alpha}
J. Immunol.,
August 1, 1999;
163(3):
1473 - 1480.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Stasiolek, V. Gavrilyuk, A. Sharp, P. Horvath, K. Selmaj, and D. L. Feinstein
Inhibitory and Stimulatory Effects of Lactacystin on Expression of Nitric Oxide Synthase Type 2 in Brain Glial Cells. THE ROLE OF Ikappa B-beta
J. Biol. Chem.,
August 4, 2000;
275(32):
24847 - 24856.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION