|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 6 (March 15), 1999:
pp. 2043-2056
Mutant N-ras Induces Myeloproliferative Disorders and Apoptosis
in Bone Marrow Repopulated Mice
By
K.L. MacKenzie,
A. Dolnikov,
M. Millington,
Y. Shounan, and
G. Symonds
From the Department of Clinical Pharmacology and Toxicology and the
Department of Haematology, St Vincent's Hospital, Darlinghurst, New
South Wales, Australia; and the School of Physiology and Pharmacology,
University of New South Wales, Kensington, New South Wales, Australia.
 |
ABSTRACT |
Mutations that activate the N-ras oncogene are among the
most frequently detected genetic alterations in human acute myeloid leukemias (AMLs), Philadelphia chromosome-negative myeloproliferative disorders (MPDs), and myelodysplastic syndromes (MDSs). However, because N-ras has not been shown to induce these disorders in an in vivo model, the role of N-ras in the evolution of myeloid leukemia is unclear. To investigate the potential of N-ras to induce myeloid leukemia, lethally irradiated mice were reconstituted with bone marrow (BM) cells infected with a retroviral vector carrying
activated N-ras. Approximately 60% of these mice developed hematopoietic disorders, including severe MPDs resembling human chronic
myelogenous leukemia (CML) or AML with differentiation (French-American-British [FAB] classification M2). Other
reconstituted mice succumbed to hematopoietic defects that were
pathologically similar to human MDSs. The latter disorders appeared to
be due to a myeloid impairment that was demonstrated by enumeration of day-12 colony-forming units-spleen (CFU-S) and by in vitro
colony assays. A high level of apoptosis associated with thymic atrophy and peripheral blood (PB) lymphopenia was also evident in N-ras reconstituted mice. Our results are consistent with a model in which
antiproliferative effects are a primary consequence of N-ras mutations and secondary transforming events are necessary for the
development of myeloid leukemia. This is the first report of an in vivo
model for N-ras induced MPD and leukemia.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
THE N-ras ONCOGENE is one member
of the ras super gene family that also includes the closely
related oncogenes c-Ki-ras and c-Ha-ras.1
These oncogenes all encode 21-kD guanine nucleotide binding proteins
that operate as molecular switches to regulate the transduction of
physiological signals from the cell membrane to the
nucleus.2 Receptors for a number of cytokines, including platelet-derived growth factor (PDGF), epidermal growth factor, macrophage colony-stimulating factor (M-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 (IL-2),
and IL-3 transmit mitogenic signals via ras. ras is
also an effector molecule for a number of oncoproteins, including
src, fes, neu, and the bcr-abl fusion
protein.3 Activation of ras can stimulate a number
of divergent downstream pathways via various (putative) target
molecules such as raf,4 phosphotidylinositol-3-OH
kinase,5 RalGDS,6 and Jun N-terminal
kinase.7 The phenotypic consequences of ras
activation are varied and appear to be cell-type specific and dependent
on the initiating signal. Downstream divergence probably accounts for
the potential of ras signal transduction pathways to elicit
multiple cellular outcomes.
ras signal transduction pathways become constitutively
activated when a cell acquires a specific point mutation in one of the
ras genes.8 Mutations that activate the
N-ras oncogene are among the most frequently detected genetic
alterations in human myeloid disorders. N-ras mutations have
been detected in acute myeloid leukemia (AML), Philadelphia
chromosome-negative myeloproliferative disorders (MPDs), and
myelodysplastic syndromes (MDSs) at frequencies that vary from
approximately 25% to 40%.9-11 ras signal
transduction pathways are also activated in some myeloid leukemias that
retain wild-type ras alleles. For example, the bcr-abl
fusion protein expressed in Philadelphia chromosome-positive MPDs
activates a ras signal transduction pathway that appears necessary for transformation.12,13 ras is also
activated in juvenile chronic myelogenous leukemia (JCML) as a
consequence of loss of the neurofibromatosis (NF1) gene that
normally functions to negatively regulate ras.14,15
In chronic myelomonocytic leukemia (CMML), ras may be activated
by the t(5,12) translocation that fuses PDGF receptor and
tel.16
Although recent investigations have provided much insight into the
molecular mechanisms involved in ras signal transduction, the
role of N-ras in the development of myeloid leukemia remains unclear. The high incidence of N-ras mutations in preleukemic conditions such as MDSs and MPDs suggests that activation of
N-ras may play an initiating or predisposing role in
hematopoietic neoplasia. In contrast, N-ras mutations in AML
samples are sometimes only detected in a subset of the leukemic
population,17 suggesting that N-ras mutations may
be involved in the progression rather than initiation of leukemia. To
date, most of the studies that have sought to define the role of
ras disregulation in hematopoietic neoplasia have used models
in which the Ha-ras oncogene is constitutively activated.18-22 However, the significance of these studies
is unclear, because Ha-ras does not appear to be involved in
human myeloid disorders,8 and it was recently shown that
Ha-ras and N-ras have different transformation
capabilities in hematopoietic cells.23 This may explain the
induction of lymphoid, rather than myeloid disorders in mice that were
repopulated with bone marrow (BM) cells expressing activated
Ha-ras.20,22 Transgenic mice carrying activated
N-ras developed mammary tumors, reticulum cell sarcomas, and
lymphomas after a long latency.24,25 However, in humans, these tumor types rarely harbor N-ras mutations. The incidence of N-ras mutations in lymphomas is apparently significantly
lower than the frequency of ras mutations in myeloid
disorders.26 The malignancies that developed in these
transgenic animals are more likely to reflect the tissue specificity of
the promoters used to drive the transgenes rather than the
transformation specificity of mutant N-ras.
To investigate the role of N-ras mutations in myeloid leukemia,
we have reconstituted mice with BM progenitor cells that express mutationally activated N-ras. Myeloid disorders resembling
human pathologies associated with N-ras mutations, including
MDS, chronic myelogenous leukemia (CML), and AML, arose in the
reconstituted mice. These investigations demonstrate that mutational
activation of N-ras may be a predisposing event, and they
provide the first report of a relevant in vivo model for studying the
evolution of human myeloid leukemia.
 |
MATERIALS AND METHODS |
Retroviral vectors and packaging cell lines.
The retroviral vector termed LK (shown in
Fig 1) was constructed by
replacing neo within the retroviral vector pLNL627
with a polylinker. The polylinker contains recognition sites for
EcoRI, Bgl II, Sac I, Sma I,
BamHI, Xba I, and HindIII. To construct LN-ras2, a 650-bp HindIII/BamHI fragment of human
N-ras cDNA containing an activating mutation at codon 12 was
excised from pZipN-ras (Der and Tainsky, unpublished
data) and subcloned by blunt-end ligation into the
BamHI site of pLK. The integrity and orientation of the
resultant pLN-ras2 plasmid was checked by polymerase chain reaction
(PCR) analysis and restriction enzyme digestion. The codon 12 mutation
within the N-ras cDNA was confirmed by sequence analysis. The
LN-ras2 vector is shown in Fig 1B.



View larger version (143K):
[in this window]
[in a new window]
| Fig 1.
Retroviral vectors and packaging cell lines.
(A) LK; (B) LN-ras2. LTR, M-MLV long terminal repeat; , packaging
region; thick vertical line, viral splice donor site; parallel vertical
lines, polylinker; arrows, primers used for PCR. (C and D)
Immunohistochemical staining for human N-ras protein. (C)
LN-ras215 cells show cytoplasmic staining of N-ras protein.
(D) LN-ras2 nonproducers (LN-ras2 transfectant that did not make
detectable virus). Mophology of (E), LN-ras215 producers; (F)
LK09 producers (original magnification ×250).
|
|
To establish producer cell lines, the plasmids pLK and pLN-ras2 were
each cotransfected, along with pMolneo,28 into
-cre packaging cells.29 Cotransfections were performed
using 10 µg of retroviral vector plasmid and 1 µg of
pMolneo in a standard calcium phosphate precipitation
procedure.30 The pMolneo vector does not include
any packaging sequence or any sequence encoding retroviral proteins
that would potentiate the generation of replication competent
retroviruses (RCRs). Transfectants were selected in 1 mg/mL G418,
cloned using cloning cylinders, and assayed for viral titer by viral
RNA dot blot analysis. For isolation of viral RNA, viral particles were
precipitated from 900 µL of clarified viral supernatant by the
addition of 225 µL of 40% polyethylene glycol and 128 µL NaCl,
followed by incubation on ice for 1 hour. After centrifugation at
13,000g for 10 minutes, the pelleted viral particles were
resuspended in 250 µL RNase-free TE and extracted with
phenol/chloroform/IAA (24:24:1). Generally, viral RNA samples were
extracted in triplicates. Viral RNA samples were applied to Zeta probe
nylon membranes (Bio-Rad, Hercules, CA) using a dot blot
apparatus (Bio-Rad) according to the manufacturer's instructions. Membranes were hybridized to an -32P-dCTP-labeled
packaging region ( ) probe using standard procedures. The probe
is a 505-bp PCR product (primers 3 and 4, Fig 1) that extends from the
viral splice donor site of pLK into gag. After hybridization
and autoradiography, viral dot blots were quantitated by densitometry
and standardized against dilutions of RNA prepared from the supernatant
of the 2AV viral producer cell line.31 Using this
method, the titers of the producer clones used in this study, LK09
and LN-ras215, were determined to be of the order 105
colony-forming units (CFU)/mL and 106 CFU/mL,
respectively. Southern and Northern blot analysis using both the probe and an N-ras cDNA confirmed that both of these clones
harbored full-length proviruses and expressed transcripts of the
expected size. The N-ras probe hybridized to the same
LN-ras215 transcripts and provirus as the probe. The
LN-ras215 and LK09 cell lines were assayed for RCR using the
marker rescue assay. The titer of virus in the supernatant from a
positive control (NIH3T3 cells infected with replication competent
Moloney murine leukemia virus [M-MLV]) was determined to
be approximately 105 CFU/mL, and no RCR was detected in
undiluted supernatant from either of the viral producer clones.
BM infections and reconstitution of irradiated mice.
BM was flushed from the femurs of 8- to 10-week-old female Balb/c mice
that were injected intraperitoneally 4 days before with 5-flurouracil
(5-FU; 150 mg/kg body weight). For retroviral infection, BM cells were
resuspended in supernatant collected from retroviral producers and
supplemented with 10% fetal bovine serum (FBS), 8 µg/mL polybrene,
30 µg/mL transferrin, 1 mg/mL bovine serum albumin (BSA), and 20%
WEHI conditioned media (WCM; a source of IL-3), 1 ng/mL
IL-6, and, in the second series, 20 ng/mL kit ligand (KL). Two rounds
of infection were performed over a 40-hour period.
Recipient mice (11- to 14-week-old female Balb/c) were irradiated with
8.5 Gy from a linear accelerator. Retrovirally infected BM cells
suspended in serum-free Iscove's modified Dulbecco's medium (IMDM)
were injected into irradiated mice by intravenous injection within 5 hours of irradiation. BM from one donor mouse was used per irradiated
recipient mouse.
Colony assays.
BM obtained from mice pretreated with 5-FU was infected with either
LN-ras2 or LK as described above. The infected cells were maintained in
IMDM supplemented with IL-3 and 10% FBS for 48 hours before seeding
105 cells/mL in 0.8% methylcellulose with 25% horse
serum, 20% WCM, 100 ng/mL IL-6, 2 U/mL erythropoietin (Epo), 1 mg/mL
BSA, and 10 4 mol/L -mercaptoethanol. Resulting
colonies were scored on day 10 to 14 after benzidine staining for
visualization of erythroid colonies.
Colony-forming units-spleen (CFU-S) assay.
BM progenitor cells (2 × 105) infected with either
LN-ras2 or LK virus as described above were transplanted into lethally
irradiated recipient mice. The recipient mice were killed 12 days after
transplantation and CFU-S were microscopically determined and enumerated.
Cytospun cell preparations, blood smears, and histology.
Cytospun cell preparations and blood smears were stained with 0.25%
May-Grunwald stain and counterstained with 10% Giemsa stain. Tissue
samples for histology were preserved in cold 4% formaldehyde in
phosphate-buffered saline (PBS). Embedding, sectioning, and staining
with hematoxylin and eosin was performed by the Veterinary Histopathology Department, University of Sydney (Sydney, Australia).
Fluorescence-activated cell sorting (FACS) analysis.
Approximately 105 spleen, BM, or thymus cells were washed
once in PBS plus 2% FBS and then resuspended in 50 µL of diluted conjugated antibody (Becton Dickinson, Mountain View, CA)
and incubated on ice for 30 minutes. The cells were then washed
twice in PBS plus 2% FBS, resuspended in 1 mL PBS, and analyzed on a Becton Dickinson FACSort. Gates were set to exclude mature erythrocytes and dead cells from the analysis.
TUNEL analysis.
Paraffin-embedded sections mounted on polylysine slides (prepared by
the Veterinary Histopathology Department, University of Sydney) were
analyzed using the TUNEL reaction essentially as
described.32 Briefly, after deparaffinization and
rehydration, the sections were incubated in 20 µg/mL proteinase K for
15 minutes at room temperature, washed in dH2O, incubated
in 2% H2O2 for 5 minutes at room temperature,
and rinsed again in dH2O. The terminal deoxynucleotydyl
transferase (TdT) reaction was performed using a terminal transferase
kit and biotinylated dUTP (Sigma, St Louis, MO). The reaction was
terminated by rinsing the sections in 2× SSC for 15 minutes, then
rinsing in dH2O, and finally washing in PBS for 5 minutes.
The color reaction and counterstaining were performed using a universal
antimouse staining kit (Sigma) according to the manufacturer's instructions.
Immunohistochemistry.
Paraffin-embedded sections mounted on polylysine slides were
deparaffinized and rehydrated for staining with a human
N-ras-specific antibody, F155 (Santa Cruz, Santa Cruz,
CA). Exogenous peroxidase activity was quenched in a
5-minute incubation with 2% H2O2, followed by
blocking with 2% BSA. The primary antibody was incubated overnight at
4°C and visualized using the Univeral Antimouse Staining Kit (Sigma). Counterstaining was performed with hematoxylin. Producer cells
were stained for N-ras protein on a cytocentrifuge preparation after fixation with methanol:acetone (1:1) at 20°C for 5 minutes.
PCR analysis.
Genomic DNA was isolated by phenol/chloroform extraction as described
previously.30 Cell lysates were prepared by resuspending 105 to 106 cells in 500 µL H2O,
boiling for 10 minutes, and collecting the supernatant after
centrifugation at 13,000g for 5 minutes. PCR amplification was
performed using 1 U Taq polymerase (Cetus Perkin Elmer, Norwalk,
CT) with primers at a concentration of 200 nmol/L and 150 to 250 ng of genomic DNA or 10 µL of cell lysate in the manufacturer
supplied buffer. The thermal cycling program used was: 3 minutes at
95°C for 1 cycle; then 30 cycles of 94°C for 30 seconds,
60°C for 30 seconds, and 72°C for 2 minutes; and a final
elongation step of 72°C for 10 minutes.
Primers used for PCR (shown in Fig 1) were as follows: (1) 5'
CGAAGGCTTCCTCTGTGTAT 3' (human N-ras); (2) 5'
GGCTTCAGCTGGTGATATTG 3' (MLV env); (3) 5'
TGGCCAGCAACTTATCTGTGT 3' ( region M-MLV/MSV); and (4) 5'
TCTTGACATCTACCGACTGG 3' (M-MLV gag).
Northern analysis.
RNA extraction and Northern analysis was performed as previously
described.30 Nylon membranes (Hybond N; Amersham, Arlington Heights, IL) were hybridized to an
-32P[dCTP]-labeled probe (described above).
 |
RESULTS |
Retroviral vectors and packaging cell lines.
The retroviral vectors and packaging cell lines used in these studies
are shown in Fig 1 and are further described in Materials and Methods.
The N-ras cDNA within LN-ras2 has a single activating point
mutation at codon 12 that replaces the wild-type glycine residue with
aspartate. This mutation is one of the most common mutations detected
in human myeloid leukemias.8 Because internal promoters and
selectable markers were previously associated with vector
rearrangements and appeared to suppress retroviral expression in
vivo,33-35 no additional sequence was included in these
constructs. The titers of the retroviral producer clones, LN-ras215
and LK09, used in these studies were determined to be of the order
of 106 and 105 CFU/mL, respectively.
Immunohistochemistry using a human N-ras-specific antibody
showed high levels of human N-ras protein in the LN-ras215 producer clone (Fig 1C and D). Because of expression of mutant N-ras, LN-ras215 cells are morphologically transformed. As
shown in Fig 1, LN-ras215 cells are rounded and highly refractile
and grow loosely attached to the culture flask without cell-cell
contact inhibition. LN-ras215 cells can be grown to very high
density, enabling collection of highly concentrated virus. Indeed, the titer of some LN-ras215 viral supernatants was estimated to be around 1 × 107 CFU/mL. In contrast to LN-ras215,
LK09 cells (as well as -cre parental cells and N-ras2
nonproducers) are flat, spindle-shaped, achorage-dependent, and
contact-inhibited. Despite the difference in growth kinetics and viral
titer, the transduction efficiency of LN-ras215 and LK09 as
assayed on 5-FU-treated BM was comparable. PCR analysis of individual
colonies plucked from methylcellulose cultures indicated that up to
80% of colony-forming units-cells (CFU-C) could be
transduced with either LN-ras215 or LK09 (data not shown).
Similar BM transduction efficiencies were also determined for
additional retroviruses generated in our laboratory. The viral titer of
the latter vectors were also variable, within the range of
105 to 107.36,37
Proliferative disorders and impaired reconstitution in LN-ras2 mice.
To investigate the consequences of N-ras activation in an in
vivo model, lethally irradiated mice were transplanted with
retrovirally transduced BM progenitor cells. For the first
reconstitution series, retroviral transduction was performed in the
presence of IL-3 and IL-6. In this experiment, mice that received
LN-ras2-infected BM were termed Nr1 to Nr15 and mice that received
LK-infected marrow were termed LK1 to LK7. BM for infection with either
LNras2 or LK was harvested from one donor mouse per recipient such that mice receiving LN-ras2 or LK-infected marrow would receive the same
number of stem cells. Ten of the 15 Nr mice became moribund and were
killed or had died by week 14. In contrast, mice that were infused with
LK-infected BM remained healthy throughout the course of the
experiment. The mice termed Nr11 to Nr15 were healthy when killed at
the end of the experiment (31 weeks after transplantation). The disease
latencies and a description of pathologies of the Nr mice are listed in
Table 1.
The LN-ras2-reconstituted mice that became moribund within the first 4 weeks (Nr2-6) succumbed to hematopoietic deficiencies characterized by
hypoplastic BM, reduced splenic hematopoiesis, small thymuses, and
anemia. The Nr mice that were killed at or near day 12 had fewer
macroscopic spleen colonies than a time-matched LK control mouse. The
spleens of Nr mice that became moribund between days 37 and 50 were
enlarged and had macroscopic nodal outgrowths. The histology and a
cytocentrifuged preparation of spleen cells from one of the latter mice
is shown in
Fig
2B and F, respectively. The normal follicular architecture of the
spleen from this mouse was disrupted by an expansion of erythroid
progenitor cells. Aberrant erythrocytes were evident within the
peripheral blood (PB) of these mice (Fig 2J), indicating that erythroid
maturation was defective. Blast cells were also present in the PB of
these mice. Cytocentrifuged preparations also showed an increase in mast cells and a depletion of mature granulocytes and lymphocytes within their spleens. FACS analysis of spleen cell preparations confirmed these observations (data not shown). We conclude that these
mice developed erythroid hyperplasia associated with a hematopoietic impairment.


View larger version (232K):
[in this window]
[in a new window]
| Fig 2.
Proliferative disorders in LN-ras2
reconstituted mice. (A) LK8 spleen section. Normal splenic
architecture, follicular organization of the lymphoid cells, marginal
zones, and red pulp composed of erythroid cells are shown. (B) Nr9
spleen section. The splenic architecture is disrupted by darkly stained
hematopoietic cells (arrow). (C) Nr18 spleen section. Large foci of
myelomonocytic cells that obliterate the normal splenic architecture
(light staining) are shown. (D) Nr17 spleen section. Sheets of abnormal
mast cells (light staining) that have disrupted the normal splenic
architecture are shown. (E) LK8 spleen cells. Normal splenocytes, large
and small lymphocytes, myeloid cells, and erythroid progenitor cells
are shown. (F) Nr9 spleen cells. Abundant erythroid progenitors
(arrows) are shown. (G) Nr16 spleen cells. Increased numbers of large
monocytes (X) and myeloid cells (arrow) are shown. (H) Nr17 spleen
cells. Darkly granulated mast cells (X) and increased numbers of
erythroid progenitors (arrows) are shown. (I) LK8 blood. Normal
erythrocytes and a neutrophilic granulocyte are shown. (J) Nr9 blood.
Polychromatic and spiculated erythrocytes are demonstrated. (K) Nr18
blood. Two abnormal myelomonocytic cells are shown. (L) Blood from
Nr17. Aberrant erythrocytes are shown. Histologic sections (A through
D) were stained with hematoxylin and eosin (original magnification
×50). Cytospun preparations (E through H) and blood smears (I through
L) were stained with May-Grunwald and Giemsa (original magnification
×500).
|
|
Further reconstitution experiments were performed using KL in addition
to IL-3 and IL-6 in the viral infection medium. When added to BM
cultures in combination with IL-3 and IL-6, KL increases CFU-S numbers
and the long-term repopulating ability of BM cells.38 Apart
from the addition of KL, all other constituents in the infection culture, the period of infection, and the ratio of donor mice to
recipients remained the same in the second reconstitution series as in
the first. The second set of reconstituted mice are referred to as Nr16
to Nr 27 and LK8 to LK13 (Table 1). In contrast to the mice in the
first series, all Nr mice in the second series survived the initial (4 weeks) reconstitution period and 58% (7/12) of the Nr mice later
succumbed to severe proliferative disorders. None of the LK control
mice developed hematopoietic disorders.
The hematopoietic disorders that were characterized in Nr mice in this
reconstitution series were more severe, in terms of cell expansion and
invasiveness, than the disorders in the first reconstitution series.
The spleens of moribund Nr mice were enlarged up to fourfold, mottled
pink, and, in some cases (eg, Nr20), had large white nodules.
Additional macroscopic abnormalities included a lung tumor in Nr18 and
white nodal growths along the intestine of Nr16. Examination of
histologic sections showed large foci of abnormal hematopoietic cells
throughout the spleen, liver, lung, kidney, thymus, and BM of these Nr
mice. The intestinal nodes in the Nr16 mouse and the lung tumor in Nr18
were confirmed as hematopoietic outgrowths. Representative histology
and cytospun preparations of spleen cells from these mice are shown in
Fig 2C, D, G, and H. Abundant, abnormally large myelomonocytic cells that were at various stages of differentiation were evident in cytospun
preparations of spleen and BM cells from several of these mice (Fig
2G). The ratio of myelocytes versus monocytic cells within the spleen
and BM varied among these mice. Severe erythroid and mast cell
disorders also afflicted Nr mice in this experiment (Fig 2H). Mast cell
disorders were confirmed by staining tissue sections with toluidine
blue (data not shown).
Differential counts of PB leukocytes for representative mice are shown
in Table 2. These data show a relative
elevation of myeloid cells, particularly granulocytes, at the expense
of lymphoid cells in the Nr mice that succumbed to hematopoietic
disorders. Generally, the granulocytes in these mice were
morphologically mature, although some abnormal myeloblasts were
identified in the blood of Nr16, Nr17, and Nr18 (Fig 2K). As in the
first reconstitution series, PB erythrocytes in Nr mice with erythroid
hyperplasias were abnormal, exhibiting polychromasia and irregular
shapes (Fig 2L). Abundant blast cells and increased numbers of
monocytes were evident in the PB of Nr20. The disorders in Nr16, Nr18,
and Nr21 are referred to as MPDs because the abnormal myelomonocytic
cells appeared to be differentiating, whereas the large numbers of
blast cells in Nr20 were indicative of overt leukemia. The variable pathologies and long latencies required for the development of MPDs and
leukemia in Nr mice suggests that a secondary molecular event was
necessary for malignant evolution. It is unlikely that mutagenesis due
to retroviral insertion accounts for the second oncogenic hit, because
(1) vector stocks were free of RCR and (2) thymomas, which are
typically induced by replication competent Moloney murine leukemia
virus, were not evident in Nr mice.
FACS analysis of spleen and BM cells confirmed the phenotype of
neoplastic cells in mice with hematopoietic disorders. Representative results from these investigations are summarized in
Table 3. Erythroid hyperplasia (eg, Nr17)
was characterized by an increase in the proportion of nucleated
erythroid cells (TER119 reactive) that was offset by a decrease in
T-lymphoid and B-lymphoid cells (Thy1.2+ and
B220+, respectively) as well as a decrease in monocytic
cells (Mac-1+). FACS analysis of cell suspensions from mice
with MPDs (eg, Nr16 and Nr18) did not show drastic changes, although in
the Nr18 mouse, increases in the percentage of monocytic and
granulocytic ( -Gr+) cells were detected in spleen and a
modest elevation of monocytes was detected in BM.
Apoptosis in LN-ras2 mice.
The thymuses of Nr mice were small in comparison to the thymuses of LK
animals. Examination of cytocentrifuged preparations showed many
thymocytes with apoptotic features such as condensed and fragmented
nuclei (Fig 3A and B). TUNEL
analysis32 confirmed that there was massive apoptotic cell
death within the thymic cortex of some Nr mice (Fig 3C and D). There
was also a higher incidence of apoptotic cells in the spleens of Nr
mice in the first reconstitution series (Fig 3E through G). Apoptotic
cells were predominantly confined to the lymphoid follicles in Nr9 and were scattered throughout the spleen of Nr8. Macrophages that have
engulfed cell debris that may stain with the TUNEL reaction are
sometimes found within germinal centers of animals harboring certain
malignancies. However, high-power magnification of the spleen of Nr7
shows no phagocytic macrophages (Fig 3G). The localization of apoptotic
bodies within the thymic cortex and lymphoid follicle of Nr mice
strongly suggests that the cells undergoing programmed cell death were
lymphoid; however, we cannot rule out the possibility that some other
cell types were TUNEL-positive. Apoptosis of lymphocytes in Nr mice
could account for the reduced numbers of lymphoid cells seen in the PB
(Table 2) and the absence of lymphoid malignancies in Nr mice.
Extensive apoptosis was also evident among transformed foci of
myelomonocytic cells (Fig 3H). However, because we speculate that
additional oncogenes were activated in these cells, we do not
necessarily assume that apoptosis of transformed cells was a direct
consequence of the LN-ras2 vector.

View larger version (105K):
[in this window]
[in a new window]
| Fig 3.
Apoptosis in LN-ras2 reconstituted mice. (A) LK3
thymocytes demonstrate normal morphology. (B) Nr9 thymocytes have
condensed and fragmented nuclei (arrows). (C) LK2 TUNEL-stained thymus
section. Small numbers of apoptotic cells (stained red) dispersed
throughout the cortex are shown. (D) Nr9 TUNEL-stained thymus section.
An elevation of apoptotic cells is shown. (E) LK3 TUNEL-stained spleen
section. Small numbers of apoptotic cells are dispersed throughout the
spleen. (F) Nr9 TUNEL-stained spleen section. Apoptotic cells clustered
within lymphoid follicles are shown. (G) Spleen section from Nr9
showing morphology of apoptotic cells. (H) Nr16 TUNEL-stained section
of intestinal node. Cytospun preparations (A and B) were stained with
May-Grunwald and Giemsa (original magnification ×1,250). Tissue
section (G) was stained with hematoxylin and eosin (original
magnification ×1,250). TUNEL-stained tissue sections (C through F and
H) apoptotic cells are stained red (original magnification ×125).
|
|
Impaired myelopoiesis and altered differentiation of
LN-ras2-transduced BM progenitor cells.
To further investigate the apparent defect in myelopoiesis caused by
expression of mutant N-ras, day-12 CFU-S generated from retrovirally transduced BM cells were evaluated. Mice transplanted with
LN-ras2-transduced cells developed significantly fewer day-12 CFU-S
(P = .001, n = 4, Student's t-test) than mice
transplanted with LK-infected cells. The average number of CFU-S in
LN-ras2 and LK mice was 5 ± 0.8 and 10 ± 1.4, respectively.
Thus, it appears that LN-ras2 impairs the multipotent myeloid
progenitor cells that give rise to day-12 CFU-S. Because day-12 CFU-S
confer short-term (6 weeks) radioprotection on irradiated
hosts,39 it is likely that LN-ras2-mediated inhibition of
myeloid progenitor cells acted to impair repopulation of Nr mice in the
first reconstitution. Colony assays were also performed to assess the
effects of mutant N-ras expression on myelopoiesis. The results
in Table 4 demonstrate that BM cells
infected with LN-ras2 generated fewer colonies than LK-infected BM
(P = .01, Student's t-test). The reduction in colony formation was highly significant for colony-forming unit granulocyte, erythroid, monocyte, megakaryocyte (CFU-GEMM) and colony-forming unit
granulocyte, monocyte, megakaryocyte (CFU-GMM; P < .005). Colony-forming unit-granulocyte-macrophage
(CFU-GM) generated by LN-ras2-infected BM was also
significantly reduced (P = .05). No erythroid colonies were
detected in LN-ras2 cultures. This may be due to defects in erythroid
differentiation that were evident in vivo (Fig 2J and L). A similar
observation was made by Darley et al,40 who also
demonstrated that human erythroid progenitor cells transduced by a
retroviral vector carrying activated N-ras have a drastically
reduced ability to form colonies and fail to differentiate in vitro.
The results from clonogenic assasy shown in Table 4 are consistent with
our results from CFU-S and the first series of repopulation studies and
further demonstrate that transduction by LN-ras2 inhibits proliferation
of hematopoietic progenitor cells.
Retrovirally transduced BM cells were also cultured in liquid media
supplemented with WCM (as a source of IL-3). FACS analysis of
nonadherent cells at day 27 showed reduced expression of mature myeloid
markers on nonadherent LN-ras2 cells compared with LK cells
(Fig 4A through D). Altered maturation of
LN-ras2 cells was also evident by morphologic examination of colonies
plucked from methlycellulose cultures (Fig 4E and F). After 4 weeks in liquid culture, mature macrophages predominated in colonies derived from LK cultures. In contrast, LN-ras2 colonies contained abundant immature monocytic cells. Thus, it appears that transduction with LN-ras2 impairs both differentiation and proliferation.


View larger version (133K):
[in this window]
[in a new window]
| Fig 4.
Altered differentiation of LN-ras2-transduced BM cells.
(A through D) FACS analysis of transduced BM cells after 27 days in
liquid culture. (A) LK cells stained with Mac-1 antibody (macrophage
specific). (B) LK cells stained with Gr-1 (granulocyte specific).
Underlayed (open curves represent isotype controls). (C) LN-ras2 cells
stained with Mac-1. (D) LN-ras2 cells stained with Gr-1. (E and F)
Cytocentrifuge preparations stained with May-Grunwald and Giemsa
showing morphologic appearance of methylcellulose colonies after 7 days
in liquid culture. View shows representative cells from pooled colonies
from LK (E) and LN-ras2 (F) cultures (original magnification ×500).
|
|
Molecular analysis of hematopoietic cells from reconstituted mice.
PCR analysis was performed to detect LN-ras2 and LK proviral integrants
in retrovirally infected BM and reconstituted mice. Figure 5A shows PCR analysis performed
using primers 1 and 2 (Fig 1A) to detect LN-ras2. LNras2 PCR products
of the predicted size (470 bp) were amplified from LN-ras215
DNA (lane 1) and from hematopoietic cells of all Nr mice that succumbed
to hematopoietic disorders (examples shown in lanes 2 through 9).
LN-ras2 sequence was also detected in BM cells that were used for in
vitro experiments (lane 10). An LK fragment of the expected size was
amplified from LK09 DNA from cells from the LK reconstituted mice
(data not shown).


View larger version (136K):
[in this window]
[in a new window]
| Fig 5.
Molecular analysis of reconstituted mice. (A) Proviral
integrants. Ethidium bromide-stained agarose gel showing PCR products
amplified from lysates of cells from reconstituted mice or BM cultures.
Primers 1 and 2 (Fig 1) were used for amplification of LN-ras2
sequence. Lane 1, LN-ras215 (positive control); lane 2, Nr1 spleen;
lane 3, Nr4 thymus; lane 4, Nr5 spleen; lane 5, Nr7 spleen; lane 6, Nr7
lung; lane 7, Nr8 lung; lane 8, Nr8 spleen; lane 9, Nr9 lung; lane 10, LN-ras2-infected BM (in vitro analysis); lane 11, negative control
DNA; lane 12, no sample. (B) Proviral expression. Autoradiograph of a
Northern blot hybridized to a region probe (described in Materials
and Methods). RNA samples are indicated above each well. Transcript
sizes are indicated to the right. The RNA samples on ethidium
bromide-stained agarose gels are shown below the autoradiograph. Lane
numbers above the gel correspond to the autoradiograph.
|
|
Northern analysis and reverse transcriptase-PCR (RT-PCR)
were performed to investigate proviral expression within the
reconstituted animals. Representative results from Northern analyses
are shown in Fig 5B. A 2.3-kb transcript was detected in samples from
the Nr reconstituted mice (lanes 4 through 8 and 10), indicating
expression of full-length LN-ras2 in hematopoietic organs of these
mice. In the analysis shown in Fig 5B, no LK-derived transcript was detected in the spleen or BM of the LK8 mouse (lanes 2 and 3). This may
be a consequence of the lower titer of LK compared with LN-ras2. The
lower titer of LK decreases the ability of this virus to transduce
long-term repopulating cells. However, LK-derived transcripts were
detected by RT-PCR in spleen and thymus of the majority of the LK mice
that were tested. Also, LK-derived PCR products were detected in some
LK mice 385 days after transplantation (data not shown).
Expression of N-ras protein in Nr mice was confirmed by
immunohistochemical staining of tissue sections with an
N-ras-specific antibody. Figure 6
shows N-ras protein expression within mononuclear cells in the
PB and lung of mice with myeloproliferative disorders. Expression of
human N-ras protein was also detected in LN-ras2-infected BM
cells used for in vitro analyses (data not shown).

View larger version (158K):
[in this window]
[in a new window]
| Fig 6.
N-ras protein expression in reconstituted mice.
Immunohistochemical staining with human N-ras antibody. (A) LK8
lung. (B) Nr16 lung. Stained hematopoietic cells are shown. (C) LK 8 blood vessel in liver. (D) Nr18 blood vessel in liver. Stained
mononuclear cells within a blood vessel are shown.
|
|
 |
DISCUSSION |
In this report, expression of mutant N-ras was shown to impair
myelopoiesis as well as promote leukemogenesis and induce apoptosis. Maturation of LN-ras2-transduced myeloid cells was shown to be perturbed in in vitro assays and aberrant erythroid differentiation was
evident from blood smears of transplanted mice. LN-ras2-transduced BM
cells also exhibited an impaired ability to reconstitute lethally irradiated mice. This defect was only partially overcome by the inclusion of KL in addition to IL-6 and IL-3 in the retroviral infection cocktail. Cells transduced with LN-ras2 in the presence of KL
rescued mice from irradiation but generated fewer day-12 CFU-S in vivo
and fewer myeloid and erythroid colonies in vitro than BM transduced by
the control vector. The inclusion of KL in the infection media may have
influenced pathologic outcome by either promoting survival of
transduced cells or by altering the transduction efficiency
and/or target cell populations of LN-ras2. Further
investigations could explore these possibilities.
The myelopoietic defect associated with LNras2 transduction is contrary
to previous demonstrations of ras-induced growth enhancement of
hematopoietic cell lines.19,21,41 This apparent discrepancy may reflect differental effects of ras expression in primary
and immortalized cells. It was previously shown that, although
ras transforms rodent fibroblast cell lines, coexpression of an
additional oncogene is necessary for ras-induced transformation
of primary rat fibroblasts.42,43 Indeed, in the absence of
a cooperating oncogene, ras induces cell cycle arrest of
primary fibroblasts.44 Similarly, N-ras expression
in primary human erythroblasts appears to slow cell cycling and thereby
inhibit proliferation and alter differentiation.40 A recent
report also indicates that ras signal transduction pathways can induce
G1 cell cycle arrest by upregulating p21cip/waf1.45 Our results are consistent with
these studies and suggest that N-ras expression may have
impaired myelopoiesis by altering cell cycle regulation. Additional
genetic alterations, such as those that confer an immortal phenotype,
appear necessary for ras-mediated transformation of
hematopoietic cells.
Several Nr mice developed hematopoietic disorders that resembled human
MPD, such as those seen in CML, which are characterized by excessive
proliferation of myeloid cells that continue to
differentiate.46 However, in comparison to the MPD seen in
human CML, the pathology of the Nr mice was more aggressive;
nonhematopoietic organs were infiltrated and extramedullary tumors
composed of myelomonocytic cells arose. Hence, with regard to
aggressiveness, the myeloid disorders in Nr mice were also similar to
AML with differentiation (French-American-British [FAB] classified
M2).47 It is significant that N-ras codon 12 mutations are detected at a relatively high frequency in both human
AMLs9,17 and in bcr-abl-negative
CML.11 N-ras mutations are also frequent in human
MDS and correlate with a high risk of leukemic
transformation.48,49 MDSs are preleukemic conditions that
arise as a consequence of BM dysfunction and are characterized by
anemia, erythroid hyperplasia, and, in some cases, BM hypoplasia and
apoptosis.50,51 Because similar disorders were
characterized in Nr7, Nr8, and Nr9, the myeloid impairment induced by
expression of mutant N-ras in these mice may describe an
underlying defect in human MDS.
The neoplastic disorders characterized in the Nr mice are
phenotypically similar to MPDs that developed in both
bcr-abl-reconstituted mice52-54 and mice that were
transplanted with hematopoietic cells from NF1-null
mice.55 bcr-abl-reconstituted mice also succumbed to erythroid disorders that were sometimes coincident with mast cell
accumulations and granulocytosis,56 an apparently similar disorder to the pathology of Nr17 in this study. Because
ras-dependent pathways are necessary for
bcr-abl-induced oncogenesis12,13 and are also
activated in JCML as a consequence of loss of the NF1
gene,14,15 these studies suggest that N-ras
activation, bcr-abl translocation, and NF1 loss have
some redundant functions in myeloid cell transformation. The absence of
ras mutations in myeloid leukemic cells with either the
bcr-abl translocation11 or NF1 gene
loss57 is consistent with this hypothesis.
This is the first report of a relevant in vivo model for
N-ras-induced MPD or myelomonocytic leukemia. The long
latencies indicate a predisposing, yet nonetheless causal, role for
N-ras in these pathologies. Previously, in two independent
investigations, BM repopulated mice that carried mutationally activated
Ha-ras developed thymic lymphomas20,22 and B-cell
leukemias.22 The development of lymphoid rather than
myeloid disorders in the Ha-ras mice may be due to the
different transformation abilities of Ha-ras versus
N-ras in hematopoietic cells23 or a consequence of
inefficient expression of the Ha-ras within the myeloid
compartment. Although the retroviral vector used in the investigation
of Dunbar et al20 was expressed within the thymus, no
vector expression was detected in the spleen or BM of the reconstituted
mice. Regardless of the reason for the lymphoid phenotype, the
significance of these Ha-ras investigations is unclear, because
Ha-ras mutations are not detected in human hematopoietic
disorders.8 The development of lymphomas in transgenic mice
expressing activated N-ras24,25 is probably a
reflection of the specificity of the different transgene promoters rather than an indication of the transformation specificity of N-ras. In the study by Harris et al,24 transgenic
expression was directed by an Ig heavy chain (Eµ) enhancer that
operates most efficiently in lymphoid cells rather than in myeloid
cells.58 The mouse mammary tumor virus (MMTV)
promoter used by Mangues et al25 is primarily
expressed in epithelial cells and is not as efficient in hematopoietic
cells.59
Apoptosis of lymphocytes may also account for the absence of lymphoid
leukemias in LN-ras2-reconstituted mice. A high level of apoptosis was
observed within the thymus and spleen of mice that succumbed to
hematopoietic deficiencies. PB lymphocytes were scarce in these
animals. Because LN-ras2 vector sequences were detected in both thymus
and spleen of Nr mice and elevated apoptosis was not seen in any of the
control mice, apoptotic cell death within these organs appears to be a
consequence of N-ras expression. Other investigators have
provided evidence of ras-induced apoptosis of embryonic
fibroblasts60 and neuronal cells61 in vitro. Neuronal apoptosis was also demonstrated in mice with a null mutation in the gene encoding p120-rasGAP, a negative regulator of
ras signal transduction pathways.62 Recently,
erythroblasts expressing mutant N-ras were also shown to
be susceptible to apoptosis.40 The present investigation
extends these findings by providing in vivo evidence for N-ras
induced apoptosis of hematopoietic cells.
In summary, these studies demonstrate that mutant N-ras
expression impairs myelopoiesis and erythopoiesis and confers
susceptibility to hematopoietic disorders that resemble human MDS, MPD,
and AML. A long latency was required for the development of invasive
MPD and overt leukemia, suggesting that activation of additional
oncogenes was necessary for the evolution of these disorders. The
N-ras-associated myeloid impairment may represent a
preleukemic phenotype such as MDS. Extensive apoptosis was also
observed in mice reconstituted with BM cells expressing mutant
N-ras. Our results suggest that the primary consequences of
N-ras mutations are antiproliferative and that secondary
transforming events are necessay for the development of myeloid
leukemia. These studies are consistent with the multistep hypothesis
for the development of leukemia and provide the first relevant in
vivo model of N-ras-induced myeloid disorders.
 |
ACKNOWLEDGMENT |
The authors thank C. Der for the pZip-N-ras plasmid, W. Gerlach
(Johnson and Johnson Research Laboratories) for access to facilities,
and A. Todd (Johnson and Johnson Research Laboratories) and P.B. Rowe
(Children's Medical Research Institute) for helpful discussion. We
also thank Terry Rothwell (Sydney University) for expert advice on
histopathology and Julie Ferguson (Garvan Institute) for animal husbandry.
 |
FOOTNOTES |
Submitted September 22, 1997; accepted August 17, 1998.
Supported by a project grant from the National Health and Medical
Research Council of Australia. G.S. is an NHMRC Senior Research Fellow.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to G. Symonds, PhD, Johnson and Johnson
Research Laboratories, GPO BOX 3331, Sydney, NSW 2001, Australia.
 |
REFERENCES |
1.
Shimizu K, Goldfarb M, Suard Y, Perucho M, Li Y, Kamata T, Feramisco J, Stavnezer E, Fogh J, Wigler MH:
Three human transforming genes are related to the viral ras oncogenes.
Proc Natl Acad Sci USA
80:2112, 1983[Abstract/Free Full Text]
2.
Lowry DR, Willumsen BM:
Function and regulation of ras.
Annu Rev Biochem
62:851, 1993[Medline]
[Order article via Infotrieve]
3.
Mandanas RA, Leibowitz DS, Gharenhbaghi K, Tauchi T, Burgess GS, Miyazawa K, Jayaram HN, Boswell HS:
Role of p21 RAS in p210 bcr-abl transformation of murine myeloid cells.
Blood
82:1838, 1992[Abstract/Free Full Text]
4.
Moodie SA, Willumsen BM, Weber MJ, Wolfman A:
Complexes of Ras.GTP with Raf-1 and mitogen-activated protein kinase kinase.
Science
260:1658, 1993[Abstract/Free Full Text]
5.
Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ, Waterfield MD, Downward J:
Phosphatidylinositol-3-OH kinase as a direct target of Ras.
Nature
370:527, 1994[Medline]
[Order article via Infotrieve]
6.
Spaargaren M, Bischoff JR:
Identification of the guanine nucleotide dissociation stimulator for Raf as putative effector molecule of R-ras, H-ras, K-ras, and RAP.
Proc Natl Acad Sci USA
91:12609, 1994[Abstract/Free Full Text]
7.
Adler V, Pincus MR, Brandt-Rauf PW, Ronai Z:
Complexes of p21Ras with Jun N-terminal kinase and Jun proteins.
Proc Natl Acad Sci USA
92:10585, 1995[Abstract/Free Full Text]
8.
Bos JL:
ras Oncogenes in human cancer: A review.
Cancer Res
49:4682, 1989[Abstract/Free Full Text]
9.
Bos JL, Toksoz D, Marshall CJ, Verlaan-de Vries M, Veeneman GH, van der Eb AJ, van Boom JH, Janssen JWG, Steenvoorden ACM:
Amino-acid substitutions at codon 13 of the N-ras oncogene in human acute myeloid leukaemia.
Nature
315:726, 1985[Medline]
[Order article via Infotrieve]
10.
Hirai H, Kobayashi Y, Mano H, Hagiwara K, Maru Y, Omine M, Mizoguchi H, Nishida J, Takaku F:
A point mutation at codon 13 of the N-ras oncogene in myelodysplastic syndrome.
Nature
327:430, 1987[Medline]
[Order article via Infotrieve]
11.
Hirsch-Ginsberg C, LeMaistre AC, Kantarjian H, Talpaz M, Cork A, Freireich EJ, Trujillo JM, Lee MS, Stass SA:
RAS mutations are rare events in Philadelphia chromosome-negative/bcr gene rearrangement-negative chronic myelogenous leukemia, but are prevalent in chronic myelomonocytic leukemia.
Blood
76:1214, 1990[Abstract/Free Full Text]
12.
Gishizky ML, Cortez D, Pendergast AM:
Mutant forms of growth factor-binding protein-2 reverse BCR-ABL-induced transformation.
Proc Natl Acad Sci USA
92:10889, 1995[Abstract/Free Full Text]
13.
Raitano AB, Halpern JR, Hambuch TM, Sawyers CL:
The BCR-ABL leukemia oncogene activates Jun kinase and requires Jun for transformation.
Proc Natl Acad Sci USA
92:11746, 1995[Abstract/Free Full Text]
14.
Basu TN, Gutman DH, Fletcher JA, Glover TW, Collins FS, Downward J:
Aberrant regulation of ras proteins in malign |