|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 6 (March 15), 1999:
pp. 2067-2074
Cyclin A1 Expression in Leukemia and Normal Hematopoietic Cells
By
Rong Yang,
Tsuyoshi Nakamaki,
Michael Lübbert,
Jonathan Said,
Akiko Sakashita,
Bettina S. Freyaldenhoven,
Susan Spira,
Vong Huynh,
Carsten Müller, and
H. Phillip Koeffler
From the Division of Hematology/Oncology, Cedars-Sinai Research
Institute, UCLA School of Medicine, Los Angeles, CA; the Department of
Hematology, Showa University School of Medicine, Tokyo, Japan; the
Department of Hematology/Oncology, University of Freiburg Medical
Center, Freiburg, Germany; the Department of Pathology and Laboratory
Medicine, University of California, Los Angeles, Los Angeles, CA; the
Saitama Cancer Center, Saitama, Japan; and the Department of Pathology
and Laboratory Medicine, Cedars-Sinai Medical Center, Los Angeles, CA.
 |
ABSTRACT |
Human cyclin A1 is a newly cloned, tissue-specific cyclin that is
prominently expressed in normal testis. In this study, we showed that
cyclin A1 was highly expressed in a subset of leukemia samples from
patients. The highest frequency of cyclin A1 overexpression was
observed in acute myelocytic leukemias, especially those that were at
the promyelocyte (M3) and myeloblast (M2) stages of development. Cyclin
A1 expression was also detected in normal CD34+
progenitor cells. The expression of cyclin A1 increased when these
cells were stimulated to undergo myeloid differentiation in vitro.
Taken together, our observations suggest that cyclin A1 may have a role
in hematopoiesis. High levels of cyclin A1 expression are especially
associated with certain leukemias blocked at the myeloblast and
promyelocyte stages of differentiation.
© 1999 by The American Society of Hematology.
 |
INTRODUCTION |
ABNORMAL CELL CYCLE regulation can lead
to uncontrolled cell growth and cancer. Cyclins are positive regulators
of the cell cycle and their overexpression is associated with
uncontrolled cell growth and cancer. For example, cyclin D1
overexpression is linked to several cancers (eg, breast, esophageal,
and lung cancers as well as lymphomas).1-5 The
CDK4/6-cyclin D-Rb (retinoblastoma susceptibility gene product) pathway
that controls the G1/S phase transition is altered in many
cancers.6,7 Ectopic expression of cyclin A leads to
adhesion-independent cell proliferation,8,9 and the cyclin
A gene locus is integrated by the Hepatitis B virus in a hepatocellular
carcinoma.10 Also, some tumor viruses express viral cyclin
proteins that contribute to the cellular transformation mediated by
these viruses.11,12
We recently cloned a human cyclin A-like gene (cyclin
A1).13 The human cyclin A1 and the newly cloned murine
cyclin A1 are highly tissue specific with prominent expression only in
testis among normal tissues; and they are thought to function in
meiosis during spermatogenesis.14 We also observed high
expression of human cyclin A1 in several human leukemia cell
lines,13 but whether it functions in promoting the cell
cycle is still unknown. In this study, we report that cyclin A1
expression is especially prominent in promyelocytic and myeloblastic leukemias.
 |
MATERIALS AND METHODS |
Antibody production and affinity purification.
A 16 amino acid-peptide unique to the carboxy terminus of cyclin A1
(residue 421-437) was synthesized and coupled to the carrier protein
keyhole limpet hemacyanin (KLH). The conjugate was used to immunize two
rabbits using a standard protocol. The antibodies against the peptide
were affinity-purified from the rabbit serum using an affinity column
with peptide-coupled sepharose beads as described.15 This
antibody, which we named antiA1C16, specifically recognized the
recombinant cyclin A1 expressed in sf9 insect cells and the GST-cyclin
A1 fusion protein expressed in Escherichia coli in our
immunoblot and immunoprecipitation (IP) experiments (data not shown).
Northern blot and immunoblot analyses.
A collection of 28 leukemia samples from the University of Freiburg
Medical Center (Freiburg, Germany) was studied for cyclin A1 expression
by Northern blot and immunoblot. Total RNA was extracted from leukemia
samples and Northern blot was performed using standard protocols.16 The full-length cDNA of cyclin A1 was used as
a probe. Immunoblots were performed as described16 using
antiA1C16. Leukemia cells were lysed in sodium dodecyl sulfate
(SDS) sample buffer and the protein concentration was
determined by protein assay (Bio-Rad protein assay kit; Bio-Rad,
Hercules, CA). Thirty micrograms of total protein was
loaded per lane for each sample and 10% gels were used for protein separation.
Reverse transcriptase-polymerase chain reaction
(RT-PCR).
Eighty leukemia and preleukemia samples from a collection at Showa
University School of Medicine (Tokyo, Japan) were analyzed for cyclin
A1 and cyclin A expression by semiquantitative RT-PCR. RNA samples were
prepared and RT-PCR was performed as previously described.17 The PCR was performed using the following
primers and conditions: for cyclin A1, GCCTGGCAAACTATACTGTG (5'),
CTCCATGAGGGACACACACA (3'); 94°C for 40 seconds, 60°C for
30 seconds, and 72°C for 40 seconds for 19 cycles. Twenty-five
cycles were used for detection of cyclin A1 in normal myeloid cells.
Two large introns are present between this pair of primers so that any
contaminating genomic DNAs would not be amplified. The primers and
conditions for cyclin A are as follows: TCCATGTCAGTGCTGAGAGGC
(5'), GAAGGTCCATGAGACAAGGC (3'); 94°C for 1 minute,
60°C for 30 seconds, and 72°C for 45 seconds for 19 cycles. A
set of primers for -actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also used in each reaction as positive controls; and RTs without the addition of reverse transcriptase were
used as negative controls. The primer pairs for actin and GAPDH were as
follows: TACATGGCTGGGGTGTTGAA/AAGAGAGGCATCCTCACCCT and
CCATGGAGAAGGCTGGGG/CAAAGTTGTCATGGATGACC, respectively. For GAPDH, 13 cycles of PCR were performed. The RT-PCR products were transferred onto
a nylon membrane (Amersham, Arlington Heights, IL) after
agarose gel electrophoresis and a standard Southern blot analysis was
performed using appropriate cDNAs as probes. The band intensities on
Southern blots were analyzed by a densitometer and the ratios of cyclin
A1 (or cyclin A) versus GAPDH were obtained for quantitative analyses.
Immunohistochemistry.
Immunohistochemistry studies were performed on formalin or B5 fixed
sections of tissues and bone marrow biopsies obtained from the files of
UCLA Center for the Health Sciences and Cedars-Sinai Medical Center.
Sections were pretreated with trypsin 10 mg/50 mL in Tris buffer, pH
8.1, for 10 minutes at 37°C, followed by cyclin A1 antibody diluted
1:1,000 in phosphate-buffered saline (PBS) for 30 minutes. Slides were
washed in PBS and incubated sequentially for 15 minutes with
peroxidase-conjugated swine antirabbit Igs and rabbit antiswine Igs
both diluted 1:50 (DAKO Corp, Carpinteria, CA). Staining was
performed with the DAKO autostainer. Localization of reaction product
was performed with the diaminobenzidene reaction as previously
described.18 Intensity of staining was rated 1+ (weak) to
3+ (strong).
Isolation and induction of differentiation of hematopoietic stem
cells.
Human CD34+CD38 and
CD34+CD33+ cells were isolated by magnetic cell
sorting followed by fluorescence-activated cell sorting (FACS) as
described.17 These cells were cultured in RPMI medium
containing stem cell factor (50 ng/mL), interleukin-3 (20 ng/mL),
granulocyte-macrophage colony-stimulating factor (20 ng/mL), and 30%
fetal calf serum (FCS). Cells were harvested on days 0, 2, 4, 6, and 8 for total RNA extraction. Cytospins were prepared concurrently, and
cells at different stages of differentiation were analyzed as
described.17 Because of the limited number of
CD34+ cells that we could isolate, RT-PCR, as described
above, was used to investigate if cyclin A1 was expressed in
CD34+ cells.
Immunofluorescent staining and FACS analysis of cyclin A1 expression
in CD34+ cells.
CD34-enriched cells (using the magnetic cell sorting kit; Miltenyi
Biotec Inc, Bergisch Gladbach, Germany) were washed twice with PBS and stained with either monoclonal anti-CD34-fluorescein isothiocyanate (FITC) or monoclonal anti-CD4-FITC as a
control in PBS containing 3% bovine serum albumin (BSA) for 30 minutes at room temperature. After washing, the cells were fixed in 3% paraformaldehyde, 2% sucrose, 1× PBS for 10 minutes at room
temperature followed by permeabilization in 0.5% TX-100, 50 mmol/L
NaCl, 3 mmol/L MgCl2, 200 mmol/L sucrose, 10 mmol/L HEPES,
pH 7.4, for 10 minutes at room temperature. After washing, the cells
were split into two halfs; one half was stained with a control rabbit antibody and the other half was stained with rabbit anti-cyclin A1 antibody. Both halves were then stained with a secondary goat antirabbit Ig-R-phycoerythrin (RPE). The cells were analyzed by FACS analysis for either CD34 or CD4 (green, FITC) and cyclin A1 (red,
RPE). Unstained cells and cells stained by FITC-labeled antibody
alone or RPE-labeled antibody alone were used to calibrate the FACS machine. For each sample, 20,000 cells were analyzed.
 |
RESULTS |
Localization of cyclin A1 in bone marrow and tissue sections.
A variety of tissues were sampled for expression of cyclin A1 using
immunohistochemistry on formalin- and B5-fixed paraffin-embedded sections. One case of acute promyelocytic leukemia showed strong 3+
nuclear staining in almost all leukemic cells
(Fig 1A). In contrast, normal
marrows had few positive cells with weak nuclear staining (Fig 1B).
Cyclin A1 was also localized in a few solid tumors
(Table 1). One case of adenocarcinoma of
the colon showed speckled nuclear staining (Fig 1C). In contrast, the
normal colonic mucosa showed only rare positive cells in the epithelium
at the base of the crypts (data not shown). We were particularly
impressed by strong expression in the promyelocytic leukemia shown in
Fig 1A, which prompted us to investigate further the expression of cyclin A1 in leukemia samples.


View larger version (249K):
[in this window]
[in a new window]
| Fig 1.
Immunohistochemistry showing cyclin A1 expression in
tissue sections. (A) Bone marrow biopsy from a case of acute
promyelocytic leukemia (AML M3). Promyelocytes show strong nuclear
staining for cyclin A1. (B) Normal bone marrow biopsy with negative or
focal weak staining of myeloid precursors. (C) Adenocarcinoma of the
colon with malignant cells showing nuclear staining for cyclin A1
(arrowheads). Hematoxylin counterstain original magnification × 400.
|
|
Cyclin A1 is highly expressed in certain leukemias from patients.
We analyzed a collection of 23 acute myelogenous leukemias (AML), 1 acute lymphocytic leukemia (ALL), and 1 B-chronic lymphocytic leukemia
(B-CLL) for cyclin A1 expression by Northern blot analysis. The
French-American-British (FAB) classification of AML is as follows: M1,
undifferentiated; M2, myeloblastic; M3, promyelocytic; M4,
myelomonocytic; and M5, monoblastic. Figure
2A and Table 2 show that cyclin A1 mRNA was
detected by Northern blot in several leukemia samples. Positive samples
include one of 2 samples of M1, 7 of 13 M2, 1 of 2 M3, 1 of 5 M4, 1 of
1 M5, and 1 of 1 ALL L2. The ALL L2 sample that expressed cyclin A1
also coexpressed the myeloid markers CD13 and CD65 (data not shown).
Some of the M2, M3, and the ALL L2 samples (lanes 1, 3, 15, 18, and 20 in Fig 2A) had higher levels of cyclin A1 mRNA than did the control U937 cells (lane 27 in Fig 2A). Normal peripheral blood leukocytes did
not have detectable levels of cyclin A1 by Northern blot, as previously
shown.13


View larger version (59K):
[in this window]
[in a new window]
| Fig 2.
Northern blot and immunoblot showing cyclin A1 expression
in leukemia samples. (A) Northern blot showing the expression of cyclin
A1 in leukemia samples. Lanes 26 and 27 are NB4 and U937 cell lines,
respectively. (B) Immunoblot show cyclin A1 protein level in leukemia
samples. The diagnostic information for each lane of the Northern blot
and immunoblot is summarized in Table 2.
|
|
To determine whether the RNA levels correlated with the protein levels
of cyclin A1 in the leukemia cells, we analyzed eight samples for which
frozen cells were available by immunoblot using the antiA1C16 antibody.
Cyclin A1 protein was present at higher levels in the samples that
tested positive in Northern blot analyses (lanes 2, 3, 5, and 6 in Fig
2B and Table 2) as contrasted with the samples that had undetectable
levels of cyclin A1 on Northern blot (lanes 1, 4, 7, and 8 in Fig 2B
and Table 2). We also analyzed two bone marrow samples from patients in
remission, and these samples showed barely detectable cyclin A1 on
immunoblots (data not shown).
Another collection of 80 leukemia and preleukemia samples from patients
was analyzed for cyclin A1 expression by semiquantitative RT-PCR. This
collection included 7 M1, 9 M2, 6 M3, 12 M4, 4 M5a, 9 M5b, 1 M6, 8 ALL,
5 chronic myelocytic leukemia (CML), 5 refractory anemia with excess
blasts (RAEB), 5 RAEB in transition (RAEB-t), and 9 acute myeloid
leukemias that were preceded by myelodysplasia (AML/MDS). The level of
expression of cyclin A1 mRNA was quantitated as the ratio of band
intensity of cyclin A1 versus GAPDH on autoradiograms. In
Fig 3A, the level of cyclin
A1 in each sample was shown as a percentage of that expressed in the
ML-1 myeloblast cell line. ML-1 cells were previously shown to express
particularly high levels of cyclin A1.13 We arbitrarily
placed the samples with more than 50% of expression of ML-1 in the
category of high expressors of cyclin A1.



View larger version (62K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR study of the expression of cyclin A1 in
leukemia and preleukemia samples. (A) Dot plot show the level of
expression of cyclin A1 in leukemia samples as a percentage of the
level detected in the ML-1 myeloblast cell line. (B) Cyclin A1 mean
levels of each group are shown. The statistical analysis of differences
among the groups is discussed in the Results. (C) Ratio of cyclin
A1/cyclin A is shown on a dot plot. Each dot represents one sample.
|
|
Many of the AML and a few other types of leukemia expressed high levels
of cyclin A1. The M3 type (acute promyelocytic leukemia) consistently
showed high levels of expression of cyclin A1. All 5 of the M3 samples
expressed levels that were more than 50% of ML-1 and 3 of 5 expressed
more than ML-1. RAEB was at the other end of the spectrum; 3 of the 5 samples had negligible levels of cyclin A1 (dots are on the horizontal
axis in Fig 3A) and none of the rest expressed more than 20% of that
expressed by ML-1. As shown in Fig 3B, the M3 samples had the highest
and RAEB had the lowest mean level of cyclin A1 expression. Student's
t-tests indicated that the level of cyclin A1 expression in M3
was significantly higher than that of all the other groups (P < .05). The level of expression in M2 was significantly higher than
that of M4, ALL, and RAEB (P < .05). No statistically
significant differences were found among other groups. One sample of
normal peripheral blood mononuclear (PBM) cells was also analyzed by
RT-PCR, and it showed a negligible level of cyclin A1 at 19 cycles of
PCR (Fig 3B). However, cyclin A1 could be detected from these cells when 35 PCR cycles were used (data not shown).
The expression of cyclin A was also determined in this same collection
of leukemias and the level of expression of cyclin A1 was compared with
that of cyclin A (Fig 3C). About 25% of the AML samples (2/7 M1, 1/8
M2, 5/6 M3, 2/12 M4, 2/11 M5, and 1/9 AML/MDS) had higher levels of
cyclin A1 compared with cyclin A. The pattern of cyclin A1/cyclin A
ratios closely resembled the absolute level of cyclin A1 (compare Fig
3C and A). All the samples that expressed more cyclin A1 than cyclin A
were AML, whereas all of the RAEB, RAEB-t, CML, and ALL cases showed
higher levels of cyclin A than cyclin A1. Similar to the absolute
levels of cyclin A1 shown in Fig 3A and B, the M3 subtype had the most
samples (5/6) expressing more cyclin A1 than cyclin A and had the
highest average of cyclin A1/cyclin A ratio, whereas the RAEB samples had the lowest average (data not shown).
Cyclin A1 is expressed in normal myeloid cells.
RT-PCR was used to investigate if cyclin A1 was expressed in
CD34+ cells. As shown in Fig 4,
both CD34+CD38 and
CD34+CD33+ cells expressed cyclin A1 at a level
that was detectable at 25 cycles of PCR. In other nonhematopoietic
tissues that we tested, cyclin A1 mRNA either required 35 PCR cycles
for detection or was undetectable (data not shown). The expression
level in CD34+CD33+ cells was higher than that
in early hematopoietic stem cells (CD34+CD38 ). The level in this cohort of
cells increased over time and peaked at day 6 of in vitro culture. At
day 6, the cell culture mainly contained myelocytes (39%),
promyelocytes (28%), granulocytes (20%), and blast/myeloblast
(10%).17 The CD34+CD33+ cell
population at day 0 mainly contained myeloblasts. Therefore, the more
mature myeloid cell populations expressed more cyclin A1 than the less
mature cells. The level of cyclin A1 expressed in these normal cells
was lower than the amount of cyclin A1 that was expressed in the
myeloblastic leukemia samples.

View larger version (39K):
[in this window]
[in a new window]
| Fig 4.
Expression of cyclin A1 in normal human myeloid cells
detected by RT-PCR. Lanes 1 through 5, CD34+CD33+ cells at days 0, 2, 4, 6, and 8 of in vitro culture. Lane 6, CD34+CD38
cells.
|
|
To confirm further that cyclin A1 was expressed in CD34+
cells, we performed immunofluorescent staining and FACS analysis using CD34+ enriched peripheral blood white cells. A monoclonal
anti-CD34-FITC was used to stain CD34 and a rabbit anti-cyclin A1
followed by a secondary antirabbit-RPE was used to stain cyclin A1. A
monoclonal anti-CD4-FITC and an irrelevant rabbit antibody were used as
controls. As shown in Fig 5A, most of the
cells that stained positive for CD34 (right of the vertical line) also
stained positive for cyclin A1 (upper right square), although many
cyclin A1 positive cells were CD34 (upper left
square), whereas in the control experiment, the anti-CD4-stained population of T lymphocytes stained mostly negative for cyclin A1 (Fig
5C, lower right square) under the same experimental conditions. When
anti-cyclin A1 staining was compared with staining by the control
rabbit antibody in the CD34+ cell populations, the
anti-cyclin A1 gave a significantly higher positivity than the control
antibody (Fig 5B), but no difference was observed between the
anti-cyclin A1 and control antibody in the CD4+ cell
populations (Fig 5D). These results indicated that most of the
CD34+ cells also expressed cyclin A1.




View larger version (86K):
[in this window]
[in a new window]
| Fig 5.
FACS analysis showing the costaining of CD34 and cyclin
A1 in myeloid progenitors. (A) Dot plot shows that CD34 and cyclin A1
are costained in the population of the upper right square. Lower left
square: cyclin A1 /CD34 ; lower right
square: cyclin A1 / CD34+; upper left
square: cyclin A1+/ CD34 . (B and D)
Histograms show the specificity of cyclin A1 staining. The staining for
cyclin A1 (shaded curve) is significantly stronger than the staining
for the control rabbit antibody (solid curve) in the
CD34+ cell population (shown in [B]), but no difference
was observed between the cyclin A1 (shaded) and control (solid)
staining in the CD4+ T-lymphocyte population (D). (C) Dot
plot shows that the control CD4-stained cells are negatively stained
for cyclin A1 (lower right square). CD34+, peripheral
blood progenitor cells were partially purified for use in these
experiments, as described in the Materials and Methods.
|
|
 |
DISCUSSION |
Cyclin A1 is a newly discovered cyclin that shows highly specific
expression in testis.13,14 The murine cyclin A1 is
expressed at high levels in germ cells undergoing meiosis in
testis14 and is thought to function in meiosis. Preliminary
studies by us detected cyclin A1 in several human leukemia cell
lines.13 This prompted us to investigate whether cyclin A1
was expressed in leukemia samples from patients. Using several
different techniques, high levels of cyclin A1 expression were
frequently found in AML, especially the M3 subtype. Although we also
found cyclin A1 expression in normal hematopoietic cells, the leukemia
samples that express high levels of cyclin A1 appear to express higher
levels than do the normal cells. Our immunohistochemistry studies
showed that almost all cells in 1 sample of the M3 subtype expressed
much higher levels of cyclin A1 than the few cyclin A1-expressing cells in the normal bone marrow (Fig 1A and B). Our immunoblots also detected
much less cyclin A1 in normal remission bone marrow cells than in
several leukemia samples from the same individuals. Finally, the
detection of cyclin A1 in normal hematopoietic cells by RT-PCR required
more PCR cycles as compared with some of the leukemia cells with high
cyclin A1 expression. These results suggest that cyclin A1 is
overexpressed in certain leukemias such as the M3 subtype. Cyclin A1
expression was also detected in a few solid cancers by
immunohistochemistry. However, because only a limited number of samples
were examined, the significance of this observation needs to be further studied.
Cyclin A1 transcripts were present in normal myeloid
CD34+/CD33+ and
CD34+/CD38 cells and higher levels were
observed in cell populations containing predominantly promyelocytes and
myelocytes than in populations containing mainly early hematopoietic
stem cells (CD34+/CD38 ) or myeloblasts
(CD34+/CD33+). Our immunofluorescent study also
showed that CD34+ cells are stained positive for cyclin A1.
These results suggest that cyclin A1 may have a role in the
proliferation and differentiation of myeloid cells. The functions of
cyclin A1 in cell cycle regulation is still not known. However, we have
some evidence that cyclin A1 is regulated in the mitotic cell cycle and
that it interacts with the cell cycle regulators E2F-1 and
Rb.18a We also observed that B- and C-Myb partially
contribute to the transcriptional activation of cyclin A1 (Müller
et al, unpublished data). B- and C-Myb are known to be
expressed in testis and hematopoietic cells,
respectively,19,20 which could explain the expression of
cyclin A1 in hematopoietic cells. The clarification of the exact
function of cyclin A1 in hematopoiesis will await the study of cyclin
A1 deletional murine models.
One potential explanation for cyclin A1 overexpression in AML leukemias
could be that the leukemia cells that express high levels of cyclin A1
may be arrested at the stage of differentiation when cyclin A1 is
normally expressed. That is to say, the AML cells mirror the level of
expression of cyclin A1 of their normal counterpart at the same stage
of hematopoietic development. However, this hypothesis cannot explain
why only a fraction of leukemia samples in the same lineage, and
presumably at similar stages of differentiation, expressed cyclin A1 at
high levels (Table 2).
Our results suggested that the M3-type leukemia samples that we
examined by RT-PCR showed high expression levels of cyclin A1. We are
currently further investigating the expression of cyclin A1 in M3
leukemia and are studying the potential molecular mechanism for this
prominent expression. No obvious genetic alterations have been found at
the cyclin A1 locus in the highly expressing leukemia samples. Several
of the leukemia cell lines (ML-1, U937, and NB4) with prominent
expression of cyclin A1 were examined for cyclin A1 gene amplifications
by Southern blot, but none was found.13 Possibly, cyclin A1
overexpression is indirectly caused by another genetic alteration in
leukemia. Whether cyclin A1 in some way contributes to the development
of certain leukemias or simply is associated with these leukemias is
still under study.
During the review of this manuscript, another study of cyclin A1
expression in leukemia was published.21 In that report, RT-PCR was used to examine the expression of cyclin A1 in various leukemia samples. Although it was not a quantitative study, their results also showed that cyclin A1 was detected in the majority of
myeloid and undifferentiated hematological malignancies that is in
agreement with our results.
 |
ACKNOWLEDGMENT |
The authors thank Dr Michael Lill and Malka Frantzen for providing the
normal human CD34-enriched cells.
 |
FOOTNOTES |
Submitted June 22, 1998; accepted November 13, 1998.
Supported by National Institutes of Health grants, the Parker Hughes
Trust, and C. and H. Koeffler Fund. H.P.K. is a member of the Jonsson
Cancer Center and holds the Mark Goodson Chair in Oncology Research.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Rong Yang, PhD, Division of
Hematology/Oncology, Davis Research Building, RM 5066, Cedars-Sinai
Research Institute, UCLA School of Medicine, 8700 Beverly Blvd, Los
Angeles, CA 90048; e-mail: yangr{at}CSMC.edu.
 |
REFERENCES |
1.
Motokura T, Bloom T, Kim HG, Juppner H, Ruderman JV, Kronenberg HM, Arnold A:
A novel cyclin encoded by a bcl1-linked candidate oncogene.
Nature
350:512, 1991[Medline]
[Order article via Infotrieve]
2.
Rosenberg CL, Wong E, Petty EM, Bale AE, Tsujimoto Y, Harris NL, Arnold A:
PRAD1, a candidate BCL1 oncogene: Mapping and expression in centrocytic lymphoma.
Proc Natl Acad Sci USA
88:9638, 1991[Abstract/Free Full Text]
3.
Withers DA, Harvey RC, Faust JB, Melnyk O, Carey K, Meeker TC:
Characterization of a candidate bcl-1 gene.
Mol Cell Biol
11:4846, 1991[Abstract/Free Full Text]
4.
Jiang W, Kahn SM, Tomita N, Zhang Y-J, Lu S-H, Weinstein IB:
Amplification and expression of the human cyclin D gene in esophageal cancer.
Cancer Res
52:2980, 1992[Abstract/Free Full Text]
5.
Schauer IE, Siriwardana S, Langan TA, Sclafani RA:
Cyclin D1 overexpression vs. retinoblastoma inactivation: implications for growth control evasion in non-small cell and small cell lung cancer.
Proc Natl Acad Sci USA
91:7827, 1994[Abstract/Free Full Text]
6.
Sherr CJ, Roberts JM:
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev
9:1149, 1995[Free Full Text]
7.
Hirama T, Koeffler HP:
Role of the cyclin-dependent kinase inhibitors in the development of cancer.
Blood
86:841, 1995[Free Full Text]
8.
Barrett JF, Lewis BC, Hoang AT, Alvarez RJ Jr, Dang CV:
Cyclin A links c-Myc to adhesion-independent cell proliferation.
J Biol Chem
270:15923, 1995[Abstract/Free Full Text]
9.
Guadagno TM, Ohtsubo M, Roberts JM, Assoian RK:
A link between cyclin A expression and adhesion-dependent cell cycle progression.
Science
262:1572, 1994
10.
Wang J, Chenivesse X, Henglein B, Brechot C:
Hepatitis B virus integration in a cyclin A gene in a hepatocellular carcinoma.
Nature
343:555, 1990[Medline]
[Order article via Infotrieve]
11.
Jung JU, Stager M, Desrosiers RC:
Virus-encoded cyclin.
Mol Cell Biol
14:7235, 1994[Abstract/Free Full Text]
12.
Li M, Lee H, Yoon D, Albrecht J, Fleckenstein B, Neipel F, Jung JU:
Kaposi's sarcoma-associated herpesvirus encodes a functional cyclin.
J Virol
71:1984, 1997[Abstract]
13.
Yang R, Morosetti R, Koeffler HP:
Characterization of a second human cyclin A that is highly expressed in testis and in several leukemic cell lines.
Cancer Res
57:913, 1997[Abstract/Free Full Text]
14.
Sweeney C, Murphy M, Kubelka M, Ravnik SE, Hawkins CF, Wolgemuth DJ, Carrington M:
A distinct cyclin A is expressed in germ cells in the mouse.
Development
122:53, 1996[Abstract]
15.
Harlow E, Lane D:
Antibodies: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989.
16.
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K:
Current Protocols in Molecular Biology. New York, NY, Wiley, 1994.
17.
Morosetti R, Park D, Chumakov AM, Grillier I, Shiohara M, Gombart AF, Nakamura T, Weinberg K, Koeffler HP:
A novel, myeloid transcription factor, C/EBP , is upregulated during granulocytic, but not monocytic differentiation.
Blood
90:2591, 1997[Abstract/Free Full Text]
18.
Said JW, Pinkus JL, Shintaku IP, deVos S, Matsumura F, Yamashiro S, Pinkus GS:
Alterations in fascin expressing germinal center dendritic cells in neoplastic follicles of B-cell lymphomas.
Modern Pathol
11:1, 1998[Medline]
[Order article via Infotrieve]
18a. Yang R, Müller C, Huynh V, Fung YK, Yee AS, Koeffler HP:
Functions of cyclin A1 in the cell cycle and its interactions with the
transcription factor E2F-1 and the Rb family of proteins. Mol Cell Biol
(in press)
19.
Latham KE, Litvin J, Orth JM, Patel B, Mettus R, Reddy EP:
Temporal patterns of A-myb and B-myb gene expression during testis development.
Oncogene
13:1161, 1996[Medline]
[Order article via Infotrieve]
20.
Introna M, Luchetti M, Castellano M, Arsura M, Golay J:
The myb oncogene family of transcription factors: Potent regulators of hematopoietic cell proliferation and differentiation.
Semin Cancer Biol
5:113, 1994[Medline]
[Order article via Infotrieve]
21.
Kramer A, Hochhaus A, Saussele S, Reichert A, Willer A, Hehlmann R:
Cyclin A1 is predominantly expressed in hematological malignancies with myeloid differentiation.
Leukemia
12:893, 1998[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. G. Renner, C. Dos Santos, C. Recher, C. Bailly, L. Creancier, A. Kruczynski, B. Payrastre, and S. Manenti
Polo-like kinase 1 is overexpressed in acute myeloid leukemia and its inhibition preferentially targets the proliferation of leukemic cells
Blood,
July 16, 2009;
114(3):
659 - 662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Restle, M. Farber, C. Baumann, M. Bohringer, K. H. Scheidtmann, C. Muller-Tidow, and L. Wiesmuller
Dissecting the role of p53 phosphorylation in homologous recombination provides new clues for gain-of-function mutants
Nucleic Acids Res.,
September 1, 2008;
36(16):
5362 - 5375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Jang, S.-j. Yang, A. Ehlen, S. Dong, H. Khoury, J. Chen, J. L. Persson, and K. Ye
Serine/Arginine Protein-Specific Kinase 2 Promotes Leukemia Cell Proliferation by Phosphorylating Acinus and Regulating Cyclin A1
Cancer Res.,
June 15, 2008;
68(12):
4559 - 4570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. F. Peterson, M. Yan, and D.-E. Zhang
The p21Waf1 pathway is involved in blocking leukemogenesis by the t(8;21) fusion protein AML1-ETO
Blood,
May 15, 2007;
109(10):
4392 - 4398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Katabami, H. Donninger, F. Hommura, V. D. Leaner, I. Kinoshita, J. F. B. Chick, and M. J. Birrer
Cyclin A Is a c-Jun Target Gene and Is Necessary for c-Jun-induced Anchorage-independent Growth in RAT1a Cells
J. Biol. Chem.,
April 29, 2005;
280(17):
16728 - 16738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller-Tidow, P. Ji, S. Diederichs, J. Potratz, N. Baumer, G. Kohler, T. Cauvet, C. Choudary, T. van der Meer, W.-Y. I. Chan, et al.
The Cyclin A1-CDK2 Complex Regulates DNA Double-Strand Break Repair
Mol. Cell. Biol.,
October 15, 2004;
24(20):
8917 - 8928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Lele and D. J. Wolgemuth
Distinct Regions of the Mouse Cyclin A1 Gene, Ccna1, Confer Male Germ-Cell Specific Expression and Enhancer Function
Biol Reprod,
October 1, 2004;
71(4):
1340 - 1347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Diederichs, N. Baumer, P. Ji, S. K. Metzelder, G. E. Idos, T. Cauvet, W. Wang, M. Moller, S. Pierschalski, J. Gromoll, et al.
Identification of Interaction Partners and Substrates of the Cyclin A1-CDK2 Complex
J. Biol. Chem.,
August 6, 2004;
279(32):
33727 - 33741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Coletta, K. Christensen, K. J. Reichenberger, J. Lamb, D. Micomonaco, L. Huang, D. M. Wolf, C. Muller-Tidow, T. R. Golub, K. Kawakami, et al.
The Six1 homeoprotein stimulates tumorigenesis by reactivation of cyclin A1
PNAS,
April 27, 2004;
101(17):
6478 - 6483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cammenga, J. C. Mulloy, F. J. Berguido, D. MacGrogan, A. Viale, and S. D. Nimer
Induction of C/EBPalpha activity alters gene expression and differentiation of human CD34+ cells
Blood,
March 15, 2003;
101(6):
2206 - 2214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Wolgemuth, E. Laurion, and K. M. Lele
Regulation of the Mitotic and Meiotic Cell Cycles in the Male Germ Line
Recent Prog. Horm. Res.,
January 1, 2002;
57(1):
75 - 101.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawabata, T. Nakamaki, P. Ikonomi, R. D. Smith, R. S. Germain, and H. P. Koeffler
Expression of transferrin receptor 2 in normal and neoplastic hematopoietic cells
Blood,
November 1, 2001;
98(9):
2714 - 2719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liao, X. Y. Wang, H. Q. Wei, S. Q. Li, T. Merghoub, P. P. Pandolfi, and D. J. Wolgemuth
Altered myelopoiesis and the development of acute myeloid leukemia in transgenic mice overexpressing cyclin A1
PNAS,
May 24, 2001;
(2001)
121540098.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller-Tidow, W. Wang, G. E. Idos, S. Diederichs, R. Yang, C. Readhead, W. E. Berdel, H. Serve, M. Saville, R. Watson, et al.
Cyclin A1 directly interacts with B-myb and cyclin A1/cdk2 phosphorylate B-myb at functionally important serine and threonine residues: tissue-specific regulation of B-myb function
Blood,
April 1, 2001;
97(7):
2091 - 2097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Müller-Tidow, R. Metzger, K. Kügler, S. Diederichs, G. Idos, M. Thomas, B. Dockhorn-Dworniczak, P. M. Schneider, H. P. Koeffler, W. E. Berdel, et al.
Cyclin E is the Only Cyclin-dependent Kinase 2-associated Cyclin that Predicts Metastasis and Survival in Early Stage Non-Small Cell Lung Cancer
Cancer Res.,
January 1, 2001;
61(2):
647 - 653.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Muller, R. Yang, D. J. Park, H. Serve, W. E. Berdel, and H. P. Koeffler
The aberrant fusion proteins PML-RARalpha and PLZF-RARalpha contribute to the overexpression of cyclin A1 in acute promyelocytic leukemia
Blood,
December 1, 2000;
96(12):
3894 - 3899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Müller, C. Readhead, S. Diederichs, G. Idos, R. Yang, N. Tidow, H. Serve, W. E. Berdel, and H. P. Koeffler
Methylation of the Cyclin A1 Promoter Correlates with Gene Silencing in Somatic Cell Lines, while Tissue-Specific Expression of Cyclin A1 Is Methylation Independent
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3316 - 3329.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Muller, R. Yang, G. Idos, N. Tidow, S. Diederichs, O. M. Koch, W. Verbeek, T. P. Bender, and H. P. Koeffler
c-myb Transactivates the Human Cyclin A1 Promoter and Induces Cyclin A1 Gene Expression
Blood,
December 15, 1999;
94(12):
4255 - 4262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Muller, R. Yang, L. Beck-von-Peccoz, G. Idos, W. Verbeek, and H. P. Koeffler
Cloning of the cyclin A1 Genomic Structure and Characterization of the Promoter Region. GC BOXES ARE ESSENTIAL FOR CELL CYCLE-REGULATED TRANSCRIPTION OF THE cyclin A1 GENE
J. Biol. Chem.,
April 16, 1999;
274(16):
11220 - 11228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liao, X. Y. Wang, H. Q. Wei, S. Q. Li, T. Merghoub, P. P. Pandolfi, and D. J. Wolgemuth
Altered myelopoiesis and the development of acute myeloid leukemia in transgenic mice overexpressing cyclin A1
PNAS,
June 5, 2001;
98(12):
6853 - 6858.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|