|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 93 No. 6 (March 15), 1999:
pp. 2075-2080
Methylation of the ABL1 Promoter in Chronic Myelogenous
Leukemia: Lack of Prognostic Significance
By
Jean-Pierre J. Issa,
Hagop Kantarjian,
Avinash Mohan,
Susan O'Brien,
Jorge Cortes,
Sherry Pierce, and
Moshe Talpaz
From The Johns Hopkins Oncology Center, Baltimore, MD; and The MD
Anderson Cancer Center, Houston, TX.
 |
ABSTRACT |
The BCR-ABL chromosomal translocation is a central event in
the pathogenesis of chronic myelogenous leukemia (CML). One of the
ABL1 promoters (Pa) and the coding region of the gene are usually translocated intact to the BCR locus, but the
translocated promoter appears to be silent in most cases. Recently,
hypermethylation of Pa was demonstrated in CML and was proposed to mark
advanced stages of the disease. To study this issue, we measured Pa
methylation in CML using Southern blot analysis. Of 110 evaluable
samples, 23 (21%) had no methylation, 17 (15%) had minimal (<15%)
methylation, 12 (11%) had moderate methylation (15% to 25%), and 58 (53%) had high levels of methylation (>25%) at the ABL1
locus. High methylation was more frequent in advanced cases of CML.
Among the 76 evaluable patients in early chronic phase (ECP), a major
cytogenetic response with interferon-based therapy was observed in 14 of 34 patients with high methylation compared with 19 of 42 among the
others (41% v 45%; P value not significant). At a
median follow-up of 7 years, there was no significant difference in
survival by ABL1 methylation category. Among patients who
achieved a major cytogenetic response, low levels of methylation were
associated with a trend towards improved survival, but this trend did
not reach statistical significance. Thus, Pa methylation in CML is
associated with disease progression but does not appear to predict for
survival or response to interferon-based therapy.
© 1999 by The American Society of Hematology.
| |
INTRODUCTION |
THE PHILADELPHIA chromosome (Ph)
translocation involving the ABL1 gene on chromosome 9 and the
BCR gene on chromosome 22 is nearly always present in chronic
myelogenous leukemia (CML) and is thought to be a central pathogenic
event in this disease.1-3 ABL1 has two alternate
exon 1 sequences, transcribed from two distinct promoters: Pa and Pb,
which is 150 to 200 kb upstream of Pa.4 In most cases of
CML, the translocation breakpoint occurs in the intron that separates
the two alternate first exons.4 Thus, the Philadelphia
chromosome contains the entire coding sequence of ABL1, along
with an intact Pa and exon 1a sequences. Despite having an apparently
normal sequence, Pa is not transcribed from the Philadelphia chromosome
in some CML cell lines.5 This lack of transcriptional
activation is not due to an absence of transcription factors, because
most CML cells transcribe the remaining intact ABL1 at normal
levels.6,7 Recently, hypermethylation of the translocated
Pa promoter has been described in some cases of CML,5 and,
similar to other genes hypermethylated in cancer,8-10 it was proposed that this methylation results in transcriptional silencing
through acquisition of a closed chromatin configuration. Furthermore,
this methylation has been proposed to potentially serve as a disease
marker and as a prognostic factor in CML.5,11 We now report
that, in a study of 109 patients with CML, ABL1 methylation is
associated with late stages of the disease, but does not correlate with
response to therapy or outcome in early chronic phase (ECP) CML.
| |
MATERIALS AND METHODS |
Patients.
One hundred eighteen cases of CML seen and followed-up at the MD
Anderson Cancer Center (MDACC; Houston, TX) between 1988 and 1993 were
selected for this study based on the availability of stored leukemic
cells. The characteristics of the 109 cases included in the final
analysis are detailed in Table 1. Risk group was assigned according to the overall prognostic
model.1 Leukemia samples were obtained from the bone marrow
of patients at the time of diagnosis or referral to MDACC. Patients
were treated at MDACC on a variety of chemotherapy protocols that were
approved by the Investigational Review Board of the MDACC in accordance with the policies of the Department of Health and Human Services. All
patients gave informed consent for the use of their tissue samples.
Therapy varied according to the treatment period. Patients in ECP CML
(diagnosis to study entry <12 months) were offered interferon-
(IFN-)-based regimens. Therapy in late chronic phase, accelerated
phase, and blast crisis depended on the time of referral. The different
first-time treatments offered to patients are detailed in
Table 2.
Measurement of ABL1 methylation.
DNA was extracted from frozen mononuclear cell fractions using standard
methods. Southern blot analysis was used to determine the methylation
state of the ABL1 CpG island. This island contains a cluster of
methylation-sensitive restriction enzymes. We used one of these
enzymes, Not I, to study the methylation state of the island.
Not I will digest DNA to completion if the two CG sites in its
recognition sequence are unmethylated, but will not cut DNA if either
of the two CG sites are methylated. Briefly, 5 µg of genomic DNA was
digested with 50 U of EcoRI and 100 U of Not I for 16 hours as specified by the manufacturer (New England Biolabs, Boston,
MA). The DNA was then precipitated, electrophoresed on a
1% agarose gel, transferred to a nylon membrane, and hybridized with a
32P-labeled probe specific to the 5' end of the
ABL1 gene (Fig 1). This probe was
generated by PCR amplification from normal genomic DNA using primers
(U) CAAACTTCCCTGATGGTGCCCTCTTG (L) TGACGTGTATTGTGCTCTTCCTATGT. The
blots were washed using standard solutions and exposed to a phosphor
screen for 2 to 4 days before imaging in a phosphorimager (Molecular
Dynamics, Sunnyvale, CA). In this analysis, normal (unmethylated) ABL1 alleles are represented by a band at 5.4 kb, whereas methylated alleles, which fail to cut down with Not
I, are represented by a band at 6.2 kb, which corresponds to the size
of the EcoRI flank (Fig 1). For quantification of ABL1
methylation, the relative density of the 5.4 kb was measured using the
ImageQuant software (Molecular Dynamics) and expressed as a percentage
of the density of all bands in each lane. All methylation studies were
performed without prior knowledge of the patient's characteristics, stage, or outcome.
View larger version (8K):
[in this window]
[in a new window]
| Fig 1.
Map of the 5' region of the ABL1 gene. The
two alternate first exons of the gene are depicted by a solid box
labeled Pa (for exon 1a, transcribed from promoter a) and Pb (for exon
1b, transcribed from promoter b). Arrows indicate the transcription
start sites for these two exons. The location of most of the
translocation breakpoints in CML is shown on top. For methylation
analysis, DNA is restricted with EcoRI (E) and Not I
(N) and hybridized using the indicated DNA probe. In this analysis,
normal (unmethylated) alleles yield a 5.4-kb fragment, whereas
methylated alleles result in a 6.2-kb fragment.
|
|
Measurement of BCR rearrangement.
DNA was restricted with EcoRI, Bgl II, or BamHI
and run on Southern blots as described above. The blots were then
probed with a BCR cDNA probe (a kind gift from Dr C. Griffith,
Johns Hopkins University, Baltimore, MD). The proportion of the
rearranged band (an indirect measure of the purity of the samples and
the contamination with nonneoplastic cells) was determined by
densitometry, as described above.
Statistical analysis.
Demographic, clinical, and outcome data for all patients were collected
and evaluated according to standard procedures at the MDACC. Patient
and disease characteristics were entered into the CML data base upon
referral and updated periodically for treatment effects, including
response both hematologically and cytogenetically and survival.
Response to therapy is as previously detailed.1 Briefly, a
complete hematologic response (CHR) referred to complete normalization
of peripheral counts and differential and disappearance of signs and
symptoms of disease including palpable splenomegaly. A CHR was further
categorized by the degree of Ph suppression: complete cytogenetic
response, Ph+ cells 0%; partial cytogenetic response,
Ph+ cells 1% to 34%; minor cytogenetic response,
Ph+ cells 35% to 90%; and no cytogenetic response,
Ph+ cells greater than 90%. A major cytogenetic response
included both complete and partial response (Ph+ <35%).
Differences among characteristics of different subsets were evaluated
by the  2 or Wilcox tests. Survival was plotted by the
Kaplan-Meier method,12 and differences among curves were
analyzed using the log-rank test.
| |
RESULTS |
The ABL1 Pa promoter is embedded in a typical CpG island that
is usually translocated intact to chromosome 22.4 We used quantitative Southern blot analysis of DNA restricted with
methylation-sensitive restriction enzymes (as outlined in Fig 1) to
measure ABL1 Pa methylation in various samples. No ABL1
methylation was observed in any control blood (N = 10) or bone marrow
(N = 3; data not shown) or multiple cases of acute myelogenous leukemia
(AML; Fig 2). For this study,
118 samples from patients with CML seen and treated at MDACC were
selected based on the availability of frozen leukemic cells. DNA was
extracted from the leukemic blasts, and ABL1 methylation was
quantitated by Southern blot analysis followed by densitometry of the
phosphorimager scans. The DNA from 5 samples was degraded and
unsuitable for this study, leaving 113 samples for analysis. Two
samples were from the same patient (1 from Acc phase and 1 from Blast
crisis). In 2 cases, the translocation breakpoint was within the
EcoRI flank, and methylation of the translocated allele could
not be ascertained. However, in both cases, the nontranslocated allele
was completely unmethylated (Fig 3). In the
remaining 111 samples, ABL1 methylation ranged from 0% to
62%, with a median of 27% (examples in Fig 2). One patient had
Ph CML and had no evidence of ABL1
methylation. This case was excluded from further analyses. To study
interactions between ABL1 methylation and clinical variables,
we analyzed the data both by treating ABL1 methylation as a
continuous variable and by classifying patients into four categories
based on ABL1 methylation: (1) negative (<3%, N = 23), (2)
low (3% to <15%, N = 17), (3) moderate (15% to <25%, N = 12),
and (4) high (>25%, N = 58).
View larger version (49K):
[in this window]
[in a new window]
| Fig 2.
Examples of ABL1 methylation. The top panel is a
representative composite Southern blot of 17 cases of CML restricted
either with EcoRI alone (E) or EcoRI and Not I
(EN). The band at 6.2 kb (arrow) in the EN lanes represents alleles
methylated at the ABL1 Pa promoter. This methylation was
quantitated by densitometric analysis of the 6.2-kb band relative to
the density of all the bands in each lane. The relative methylation is
indicated below each lane and ranges from 0% to 62% in these samples.
The bottom panel shows examples of ABL1 methylation analysis of
8 cases of AML. None of these (and other) cases have the 6.2-kb band
indicative of methylation of this CpG island.
|
|
View larger version (76K):
[in this window]
[in a new window]
| Fig 3.
Methylation analysis of 2 cases of CML in which the
translocation breakpoint is within the EcoRI flank. In both
cases (CML-A and -B), EcoRI restriction alone (lanes labeled E)
results in two distinct bands: a normal band at 6.2 kb and a rearranged
band of higher molecular weight (indicated by a star). In both cases,
after digestion with Not I (EN lanes), the unrearranged allele
is completely digested to a 5.4-kb band, indicating complete lack of
methylation. The rearranged allele does not change in size after
Not I digestion, which could be due either to complete
methylation or to a breakpoint upstream of the Not I site. For
comparison purposes, normal DNA digested with EcoRI alone is
shown in lane 1.
|
|
There was no correlation between ABL1 methylation and age or
gender. ABL1 methylation increased with advancing stages of CML (Table 3 and
Fig 4): ABL1 methylation
averaged 23% (N = 82) in ECP, 32% (N = 11) in late chronic
phase (LCP), 35% (N = 12) in accelerated phase (Acc), and 42% (N = 5)
in blast crisis (BC). Similarly, when treated as a categorical
variable, high methylation was more frequent in advanced cases of CML:
37 of 82 (45%) in ECP, 8 of 11 (73%) in LCP, 9 of 12 (75%) in Acc,
and 4 of 5 (80%) in BC (P < .01 for ECP v other). In
ECP, ABL1 methylation was higher in the group with a white
blood cell count (WBC)  50 × 109/L (31/55 [56%]
compared with 6/27 [27%], P < .01). However, there was no
correlation between ABL1 methylation and other significant patient or disease characteristics, including risk group
(Table 4). Among the 72 patients in ECP
evaluable for risk classification, high methylation levels were found
in 13 of 38 with good-risk, 14 of 24 with intermediate-risk, and 5 of
10 with poor-risk disease (34% v 58% v 50%,
P = .16). There was no correlation between ABL1 methylation and the percentage of Ph+ cells at diagnosis
(99.2%, 96.7%, 100%, and 99.9% in the negative, low, moderate, and
high categories, respectively).
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Scatter plot analysis of ABL1 methylation in
various stages of CML. Each dot represents a single case of CML
analyzed as described in Fig 2.
|
|
View this table:
[in this window]
[in a new window]
|
Table 4.
Correlation of Patient and Disease Characteristics in
Early Chronic Phase With Methylation Profile (N = 82)
|
|
Variable levels of ABL1 methylation in CML, especially in ECP,
could potentially be due to variable contamination with nonneoplastic cells in the samples or could be related to the maturation state of the
cells studied (with undifferentiated cells having higher levels of
methylation). To address the first issue, we determined the relative
contamination of the samples with nonneoplastic cells using Southern
blots probed with a BCR probe. In this analysis, the relative
proportion of the rearranged band (which reflects the purity of the
samples) can be estimated by densitometry. We performed this analysis
on 16 randomly selected ECP cases, 8 with negative ABL1
methylation and 8 with high levels of methylation. To maximize the
detection of rearranged alleles, each sample was digested with three
different restriction enzymes, BamHI, EcoRI, and
Bgl II. All 16 cases had detectable rearranged bands using one
or more of the three enzymes (13 with BamHI, 11 with
Bgl II, and 10 with EcoRI). The proportion of
rearranged alleles was similar in the ABL1 methylation-negative
versus methylation-high groups regardless of the
restriction enzyme used: 34% versus 38% using EcoRI
(P = .56), 55% versus 47% using Bgl II (P = .48), and 51% versus 47% (P = .72) using EcoRI
(examples in Fig 5). The variations in
proportion of rearranged alleles using different enzymes are due to the
fact that the nonrearranged alleles are of different sizes and
transfer/hybridize more or less efficiently in the Southern blot
analysis. In particular, with BamHI, the nonrearranged allele is usually smaller in size than the rearranged allele and hybridizes better to the probe. The reverse is true with Bgl II. By
averaging the values of all three enzymes, the rearranged alleles
represent 47% of the ABL1-negative methylation cases and 44%
of the ABL1 high methylation cases. Thus, contamination with
nonneoplastic tissues (which appears to be very minimal in these
samples) cannot explain the observed differences in methylation status.
View larger version (55K):
[in this window]
[in a new window]
| Fig 5.
Detection of BCR rearrangement in negative and
high ABL1 methylation groups. Shown are representative
(composite) Southern blots of DNA restricted with EcoRI and
probed with a BCR cDNA probe. The N lane contains DNA from
normal colon, whereas lanes 1 through 10 contain DNA from cases of
CML-ECP with either negative or high levels of ABL1 methylation
(as indicated on the top of each group). The arrow points to the normal
(nonrearranged band). All CML cases except those in lanes 4 and 8 contain additional bands, reflecting the presence of a BCR
rearrangement. Quantitation of the rearranged band relative to the
normal band showed no differences between the high versus negative
methylation groups. Slight variations in the apparent size of the
normal band are due to the fact that it runs at greater than 20 kb, an
area that is difficult to resolve by Southern analysis.
|
|
To determine whether differences in ABL1 methylation in ECP
could be attributed to the maturation state of the cells studied, we
compared the bone marrow differential counts in the four methylation categories. The number of blasts was identical in all four categories (1%). Similarly, the number of promyelocytes, myelocytes,
metamyelocytes, and polymorphonuclear cells (PMNs) did not
vary according to ABL1 methylation. For example, PMNs
represented 28%, 28%, 29%, and 26% of the bone marrow cells in the
methylation groups negative, low, moderate, and high, respectively.
These data also suggest that the high levels of ABL1
methylation in advanced stages of CML are not due simply to an
expansion of the blast component, because many ECP cases had levels of
methylation comparable to accelerated or blast crisis phases of the disease.
We next analyzed the potential impact of ABL1 methylation on
outcome measures in patients with ECP CML. Of the 76 evaluable patients
in this category, 33 (43%) achieved a major cytogenetic response, 30 (38%) had a minor cytogenetic response or CHR with no cytogenetic
improvement, and 13 (17%) did not respond to initial therapy. There
was no correlation between ABL1 methylation (analyzed as a
categorical variable) and response (Table
5): a major response with IFN-based therapy was observed in 14 of 34 patients with high methylation compared with 19 of 42 among the others
(41% v 45%; P value not significant). When analyzed
as a continuous variable, ABL1 methylation averaged 23% in the
group that had a major response, 22% in the group with a minor
response, and 27% in the nonresponders (P value not
significant).
At a median follow-up of 7 years, the median survival of the 82 patients in ECP was 63 months, and 56% have died. Using ABL1 methylation as a continuous variable, there was no correlation with
survival. When using ABL1 as a categorical variable, there appeared to be a trend towards improved survival after 5 years among
patients in the two low methylation categories when compared with
patients in the high methylation categories
(Fig 6), but this difference did not reach
statistical significance. In the subgroup of 19 patients who achieved a
complete response to initial therapy, there also appeared to be a trend
towards improved survival among patients in the two low methylation
categories when compared with patients in the high methylation
categories (1/9 [11%] relapses v 5/10 [50%] relapses),
but this difference did not reach statistical significance at the
current median follow-up.
View larger version (17K):
[in this window]
[in a new window]
| Fig 6.
Kaplan-Meier survival curves for patients in ECP by
ABL1 methylation category: negative-low methylation (N = 33)
or positive-high methylation (N = 49; P = .3).
|
|
| |
DISCUSSION |
Methylation of the ABL1 promoter Pa appears to be an early
event in CML. In this study, we found such methylation in more than
half of patients in ECP, and more frequent methylation was observed in
advanced stages of CML. These results confirm earlier reports of
ABL1 methylation in CML, although we find significantly higher
rates in ECP than previously reported.5,11 This could be
related to differences in patient characteristics or to the technique
used to measure ABL1 methylation. The fact that ABL1 methylation was present in a significant number of patients early in
the course of CML raised the issue of whether it can be useful as a
prognostic marker in this disease or whether it could be modulated
favorably by therapeutic interventions (eg, IFN- or decitabine13).
In our study, no correlation was found between ABL1 methylation
and most disease characteristics, risk group, or response to IFN-
therapy. This suggests that ABL1 methylation in ECP does not
define a unique subgroup of patients and may simply be a stochastic event that follows the 9:22 translocation. ABL1 methylation was also not a major prognostic factor for survival in ECP CML, within the
limitations of the number of patients studied. Among patients who
achieved a complete response after initial therapy, there was a trend
towards improved outcome with low levels of methylation. A possible
explanation for this is that ABL1 methylation is simply a
molecular clock reflecting the time since formation of the Philadelphia chromosome. Thus, patients in clinical ECP with high levels of ABL1 methylation may have had undetected subclinical disease
for several years, which then results in a higher chance of disease progression and a lower overall survival. Alternatively, it is possible
that ABL1 methylation itself results in a more aggressive disease, as discussed below. Nevertheless, it is clear that factors other than ABL1 methylation determine the likelihood of
response to initial therapy in ECP CML, which explains the lack of
impact of this molecular marker on overall survival in this disease. Whether ABL1 methylation could be useful in predicting relapse among those patients who achieve a complete remission to IFN- therapy deserves further investigation.
The mechanism and biological significance of ABL1 methylation
in CML remain to be defined. As previously indicated by studies in cell
lines,5 methylation appears to be limited to the rearranged ABL1 allele because (1) in 2 cases in which the chromosome 9 breakpoint was within our flanking cut, the normal (unrearranged)
ABL1 allele was unmethylated; and (2) there was little evidence
of methylation that significantly exceeds 50% and never any complete
methylation at this locus, even in blast crisis CML. Thus, unlike other
hypermethylation events in cancer, ABL1 methylation appears to
be triggered exclusively by the 9:22 translocation. Further supportive
evidence is that ABL1 methylation is not observed in
malignancies that lack the 9:22 translocation, such as AML or solid
tumors. One possible explanation for ABL1 methylation in CML
then, is that it is a passive event that follows chromatin
restructuring induced by the chromosomal translocation14
and that it does not provide CML cells with a particular growth
advantage. Studies of viral integration sites have suggested that
methylation after chromatin restructuring may be a progressive event
that evolves with time.15 By analogy, ABL1
methylation may then merely be a molecular clock timing the occurrence
of the 9:22 translocation, with more cells and alleles involved the
longer the disease is active. However, it is also possible that
ABL1 methylation is contributing to the pathogenesis of CML,
perhaps by affecting the expression of the BCR/ABL transcript.
Thus, it is conceivable that the translocated ABL1 promoter
competes with the native BCR promoter for transcription factors
and/or enhancers, as has been described at other
loci.16,17 If this is the case, then hypermethylation and
silencing of the translocated ABL1 promoter may be required for
efficient expression of the BCR/ABL transcript and may then be selected
for during CML progression.
In summary, our study confirms that ABL1 methylation is a
frequent and early event in CML, but we found no prognostic impact for
this molecular marker within the limitations of our studies. ABL1 methylation could still serve as a useful marker of
disease in CML and, in patients who have unmethylated cells at
diagnosis, ABL1 methylation may be used to monitor for disease
progression. Because ECP-CML can be a slowly evolving disease, further
studies should also address the long-term (>7 years) impact of
ABL1 methylation on survival in this group of patients.
| |
ACKNOWLEDGMENT |
The authors thank Dr Lynne Rosenblum-Voss and Dr Constance Griffith for
the BCR cDNA probe and Mutsumi Ohe-Toyota for excellent technical assistance.
| |
FOOTNOTES |
Submitted June 17, 1998; accepted November 17, 1998.
Supported in part by a Translational Research Grant from the Leukemia
Society of America. J.-P.J.I. is a Kimmel Foundation Scholar.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Jean-Pierre J. Issa, MD, The Johns Hopkins
Oncology Center, 424 N Bond St, Baltimore, MD 21231; e-mail:
jpissa{at}welchlink.welch.jhu.edu.
| |
REFERENCES |
1.
Cortes JE, Talpaz M, Kantarjian H:
Chronic myelogenous leukemia: A review.
Am J Med
100:555, 1996[Medline]
[Order article via Infotrieve]
2.
Jones RJ:
Biology and treatment of chronic myeloid leukemia.
Curr Opin Oncol
9:3, 1997[Medline]
[Order article via Infotrieve]
3.
Rowley JD:
The Philadelphia chromosome translocation. A paradigm for understanding leukemia.
Cancer
65:2178, 1990[Medline]
[Order article via Infotrieve]
4.
Chissoe SL, Bodenteich A, Wang YF, Wang YP, Burian D, Clifton SW, Crabtree J, Freeman A, Iyer K, Jian L, Ma Y, McLaury H-J, Pan H-Q, Sarhan OH, Toth S, Wang Z, Zhang G, Heisterkamp N, Groeffen J, Roe B:
Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation.
Genomics
27:67, 1995[Medline]
[Order article via Infotrieve]
5.
Zion M, Ben-Yehuda D, Avraham A, Cohen O, Wetzler M, Melloul D, Ben-Neriah Y:
Progressive de novo DNA methylation at the bcr-abl locus in the course of chronic myelogenous leukemia.
Proc Natl Acad Sci USA
91:10722, 1994[Abstract/Free Full Text]
6.
Guo JQ, Lian J, Glassman A, Talpaz M, Kantarjian H, Deisseroth AB, Arlinghaus RB:
Comparison of bcr-abl protein expression and Philadelphia chromosome analyses in chronic myelogenous leukemia patients.
Am J Clin Pathol
106:442, 1996[Medline]
[Order article via Infotrieve]
7.
Diamond J, Goldman JM, Melo JV:
BCR-ABL, ABL-BCR, BCR, and ABL genes are all expressed in individual granulocyte-macrophage colony-forming unit colonies derived from blood of patients with chronic myeloid leukemia.
Blood
85:2171, 1995[Abstract/Free Full Text]
8.
Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JPJ:
Alterations in DNA methylation A fundamental aspect of neoplasia.
Adv Cancer Res
72:141, 1997
9.
Issa JPJ, Baylin SB, Herman JG:
DNA Methylation changes in hematologic malignancies: Biologic and clinical implications.
Leukemia
11:S7, 1997
10.
Jones PA:
DNA methylation errors and cancer.
Cancer Res
56:2463, 1996[Free Full Text]
11.
Ben-Yehuda D, Krichevsky S, Rachmilewitz EA, Avraham A, Palumbo GA, Frassoni F, Sahar D, Rosenbaum H, Paltiel O, Zion M, Ben-Neriah Y:
Molecular follow-up of disease progression and interferon therapy in chronic myelocytic leukemia.
Blood
90:4918, 1997[Abstract/Free Full Text]
12.
Kaplan EL, Meier P:
Nonparametric estimation from incomplete observations.
J Am Stat Assoc
53:457, 1958
13.
Kantarjian HM, O'Brien S, Anderlini P, Talpaz M:
Treatment of myelogenous leukemia: Current status and investigational options.
Blood
87:3069, 1996[Free Full Text]
14.
Schaefer-Rego KE, Leibowitz D, Mears JG:
Chromatin alterations surrounding the BCR/ABL fusion gene in K562 cells.
Oncogene
5:1669, 1990[Medline]
[Order article via Infotrieve]
15.
Doerfler W:
The insertion of foreign DNA into mammalian genomes and its consequences: A concept in oncogenesis.
Adv Cancer Res
66:313, 1995[Medline]
[Order article via Infotrieve]
16.
Kim CG, Epner EM, Forrester WC, Groudine M:
Inactivation of the human beta-globin gene by targeted insertion into the beta-globin locus control region.
Genes Dev
6:928, 1992[Abstract/Free Full Text]
17.
Foley KP, Engel JD:
Individual stage selector element mutations lead to reciprocal changes in beta- vs. epsilon-globin gene transcription: Genetic confirmation of promoter competition during globin gene switching.
Genes Dev
6:730, 1992[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. Quintas-Cardama and J. E. Cortes
Chronic Myeloid Leukemia: Diagnosis and Treatment
Mayo Clin. Proc.,
July 1, 2006;
81(7):
973 - 988.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Ortmann, A. Burchert, K. Holzle, A. Nitsche, B. Wittig, A. Neubauer, and M. Schmidt
Down-regulation of interferon regulatory factor 4 gene expression in leukemic cells due to hypermethylation of CpG motifs in the promoter region
Nucleic Acids Res.,
December 7, 2005;
33(21):
6895 - 6905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Cortes and H. Kantarjian
New Targeted Approaches in Chronic Myeloid Leukemia
J. Clin. Oncol.,
September 10, 2005;
23(26):
6316 - 6324.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Zeng, Y. Hu, and B. Li
Identification of TopBP1 as a c-Abl-interacting Protein and a Repressor for c-Abl Expression
J. Biol. Chem.,
August 12, 2005;
280(32):
29374 - 29380.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U. Lehmann, I. Berg-Ribbe, L. U. Wingen, K. Brakensiek, T. Becker, J. Klempnauer, B. Schlegelberger, H. Kreipe, and P. Flemming
Distinct Methylation Patterns of Benign and Malignant Liver Tumors Revealed by Quantitative Methylation Profiling
Clin. Cancer Res.,
May 15, 2005;
11(10):
3654 - 3660.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Zheng, X. Ma, L. Zhang, L. Gunn, M. T. Smith, J. L. Wiemels, K. Leung, P. A. Buffler, and J. K. Wiencke
Hypermethylation of the 5' CpG Island of the FHIT Gene Is Associated with Hyperdiploid and Translocation-Negative Subtypes of Pediatric Leukemia
Cancer Res.,
March 15, 2004;
64(6):
2000 - 2006.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-P. J. Issa
Methylation and Prognosis: Of Molecular Clocks and Hypermethylator Phenotypes
Clin. Cancer Res.,
August 1, 2003;
9(8):
2879 - 2881.
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Garcia-Manero, J. Daniel, T. L. Smith, S. M. Kornblau, M.-S. Lee, H. M. Kantarjian, and J.-P. J. Issa
DNA Methylation of Multiple Promoter-associated CpG Islands in Adult Acute Lymphocytic Leukemia
Clin. Cancer Res.,
July 1, 2002;
8(7):
2217 - 2224.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. J. Druker, S. G. O'Brien, J. Cortes, and J. Radich
Chronic Myelogenous Leukemia
Hematology,
January 1, 2002;
2002(1):
111 - 135.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. Sun, G. Jiang, M.-A. A. Zaydan, V. F. La Russa, H. Safah, and M. Ehrlich
ABL1 Promoter Methylation Can Exist Independently of BCR-ABL Transcription in Chronic Myeloid Leukemia Hematopoietic Progenitors
Cancer Res.,
September 1, 2001;
61(18):
6931 - 6937.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Deutsch, A. Dugray, B. AbdulKarim, E. Marangoni, L. Maggiorella, S. Vaganay, R. M'Kacher, S. D. Rasy, F. Eschwege, W. Vainchenker, et al.
BCR-ABL down-regulates the DNA repair protein DNA-PKcs
Blood,
April 1, 2001;
97(7):
2084 - 2090.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. T. Nguyen, A. F. Mohrbacher, Y. C. Tsai, J. Groffen, N. Heisterkamp, P. W. Nichols, M. C. Yu, M. Lubbert, and P. A. Jones
Quantitative measure of c-abl and p15 methylation in chronic myelogenous leukemia: biological implications
Blood,
May 1, 2000;
95(9):
2990 - 2992.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kantarjian, J. V. Melo, S. Tura, S. Giralt, and M. Talpaz
Chronic Myelogenous Leukemia: Disease Biology and Current and Future Therapeutic Strategies
Hematology,
January 1, 2000;
2000(1):
90 - 109.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. A. Asimakopoulos, P. J. Shteper, S. Krichevsky, E. Fibach, A. Polliack, E. Rachmilewitz, Y. Ben-Neriah, and D. Ben-Yehuda
ABL1 Methylation Is a Distinct Molecular Event Associated With Clonal Evolution of Chronic Myeloid Leukemia
Blood,
October 1, 1999;
94(7):
2452 - 2460.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. A. Asimakopoulos, P. J. Shteper, E. Fibach, E. Rachmilewitz, Y. Ben-Neriah, and D. Ben-Yehuda
Prognostic Significance of c-ABL Methylation in Chronic Myelogenous Leukemia: Still an Open Question
Blood,
August 1, 1999;
94(3):
1141 - 1142.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
